use a simple formula: WHO.WHAT = VALUE

where,

WHO is the element in the storyboard you want to make changes to for eg. label

WHAT is the property of that element you wish to change for eg. text

VALUE is the change that you wish to be displayed

for eg. if I want to change the text from story text to You see a fork in the road in the label as shown in screenshot 1

In this case, our WHO is the label (element in the storyboard), WHAT is the text (property of element) and VALUE will be You see a fork in the road

so our final code will be as follows: Final code

screenshot 1 changes to screenshot 2 once the above code is executed.

I hope this solution helps you solve your issue. Thank you!

The short answer is yes, as long as it is a public IP address.

Issuance of certificates to reserved IP addresses is not allowed, and all certificates previously issued to reserved IP addresses were revoked as of 1 October 2016.

According to the CA Browser forum, there may be compatibility issues with certificates for IP addresses unless the IP address is in both the commonName and subjectAltName fields. This is due to legacy SSL implementations which are not aligned with RFC 5280, notably, Windows OS prior to Windows 10.

Sources:

1. Guidance on IP Addresses In Certificates CA Browser Forum
2. Baseline Requirements 1.4.1 CA Browser Forum
3. The (soon to be) not-so Common Name unmitigatedrisk.com
4. RFC 5280 IETF

_{Note: an earlier version of this answer stated that all IP address certificates would be revoked on 1 October 2016. Thanks to Navin for pointing out the error.}

in Kotlin You can use,

webView.isScrollbarFadingEnabled = true
webView.setInitialScale(100)

See man git-add:

   -f, --force
       Allow adding otherwise ignored files.

So run this

git add --force my/ignore/file.foo

the following bitwise operators: &, |, ^, and ~ return values (based on their input) in the same way logic gates affect signals. You could use them to emulate circuits.

Generally you compile most .c files in the following way:

gcc foo.c -o foo. It might vary depending on what #includes you used or if you have any external .h files. Generally, when you have a C file, it looks somewhat like the following:

#include <stdio.h>
    /* any other includes, prototypes, struct delcarations... */
    int main(){
    */ code */
}

When I get an 'undefined reference to main', it usually means that I have a .c file that does not have int main() in the file. If you first learned java, this is an understandable manner of confusion since in Java, your code usually looks like the following:

//any import statements you have
public class Foo{
    int main(){}
 }

I would advise looking to see if you have int main() at the top.

Try this: sed -i '/^[ \t]*$/d' file-name

It will delete all blank lines having any no. of white spaces (spaces or tabs) i.e. (0 or more) in the file.

Note: there is a 'space' followed by '\t' inside the square bracket.

The modifier -i will force to write the updated contents back in the file. Without this flag you can see the empty lines got deleted on the screen but the actual file will not be affected.

This should solve your problem:

select replace(to_char(a, '90D90'),'.00','')
from
(
select 50 a from dual
union
select 50.57 from dual
union
select 5.57 from dual
union
select 0.35 from dual
union
select 0.4 from dual
);

Give a look also as this SQL Fiddle for test.

We have had clients insist on option B (database storage) a few times on a few different backends, and we always ended up going back to option A (filesystem storage) eventually.

Large BLOBs like that just have not been handled well enough even by SQL Server 2005, which is the latest one we tried it on.

Specifically, we saw serious bloat and I think maybe locking problems.

One other note: if you are using NTFS based storage (windows server, etc) you might consider finding a way around putting thousands and thousands of files in one directory. I am not sure why, but sometimes the file system does not cope well with that situation. If anyone knows more about this I would love to hear it.

But I always try to use subdirectories to break things up a bit. Creation date often works well for this:

Images/2008/12/17/.jpg

...This provides a decent level of separation, and also helps a bit during debugging. Explorer and FTP clients alike can choke a bit when there are truly huge directories.

EDIT: Just a quick note for 2017, in more recent versions of SQL Server, there are new options for handling lots of BLOBs that are supposed to avoid the drawbacks I discussed.

EDIT: Quick note for 2020, Blob Storage in AWS/Azure/etc has also been an option for years now. This is a great fit for many web-based projects since it's cheap and it can often simplify certain issues around deployment, scaling to multiple servers, debugging other environments when necessary, etc.

You can open a command prompt and do a

route print

and see your current routing table.

You can modify it by

route add    d.d.d.d mask m.m.m.m g.g.g.g 
route delete d.d.d.d mask m.m.m.m g.g.g.g 
route change d.d.d.d mask m.m.m.m g.g.g.g

these seem to work

I run a ping d.d.d.d -t change the route and it changes. (my test involved routing to a dead route and the ping stopped)

This works for me:

import SwiftyJSON

extension JSON {
    
    mutating func appendIfKeyValuePair(key: String, value: Any){
        if var dict = self.dictionaryObject {
            dict[key] = value
            self = JSON(dict)
        }
    }
}

Usage:

var data: JSON = []

data.appendIfKeyValuePair(key: "myKey", value: "myValue")

If you use AIX try this This will attach a text file and include a HTML body If this does not work catch the output in the /var/spool/mqueue

#!/usr/bin/kWh
if (( $# < 1 ))
 then
  echo "\n\tSyntax: $(basename) MAILTO SUBJECT BODY.html ATTACH.txt "
  echo "\tmailzatt"
  exit
fi
export MAILTO=${[email protected]}
MAILFROM=$(whoami)
SUBJECT=${2-"mailzatt"}
export BODY=${3-/apps/bin/attch.txt}
export ATTACH=${4-/apps/bin/attch.txt}
export HST=$(hostname)
#export BODY="/wrk/stocksum/report.html"
#export ATTACH="/wrk/stocksum/Report.txt"
#export MAILPART=`uuidgen` ## Generates Unique ID
#export MAILPART_BODY=`uuidgen` ## Generates Unique ID
export MAILPART="==".$(date +%d%S)."===" ## Generates Unique ID
export MAILPART_BODY="==".$(date +%d%Sbody)."===" ## Generates Unique ID
(
echo "To: $MAILTO"
 echo "From: mailmate@$HST "
 echo "Subject: $SUBJECT"
 echo "MIME-Version: 1.0"
 echo "Content-Type: multipart/mixed; boundary=\"$MAILPART\""
 echo ""
 echo "--$MAILPART"
 echo "Content-Type: multipart/alternative; boundary=\"$MAILPART_BODY\""
 echo ""
 echo ""
 echo "--$MAILPART_BODY"
 echo "Content-Type: text/html"
 echo "Content-Disposition: inline"
 cat $BODY
 echo ""
 echo "--$MAILPART_BODY--"
 echo ""
 echo "--$MAILPART"
 echo "Content-Type: text/plain"
 echo "Content-Disposition: attachment; filename=\"$(basename $ATTACH)\""
 echo ""
 cat $ATTACH
 echo ""
 echo "--${MAILPART}--"
  ) | /usr/sbin/sendmail -t

POCOs(Plain old CLR objects) are simply entities of your Domain. Normally when we use entity framework the entities are generated automatically for you. This is great but unfortunately these entities are interspersed with database access functionality which is clearly against the SOC (Separation of concern). POCOs are simple entities without any data access functionality but still gives the capabilities all EntityObject functionalities like

• Lazy loading
• Change tracking

Here is a good start for this

POCO Entity framework

You can also generate POCOs so easily from your existing Entity framework project using Code generators.

EF 5.X DbContext code generator

To take a quick look, you can percent-en/decode using this online tool.

Check the Java API for List.
The get(int index) method is declared to throw only the IndexOutOfBoundException which extends RuntimeException.
You are trying to tell Mockito to throw an exception SomeException() that is not valid to be thrown by that particular method call.

To clarify further.
The List interface does not provide for a checked Exception to be thrown from the get(int index) method and that is why Mockito is failing.
When you create the mocked List, Mockito will use the definition of List.class to creates its mock.

The behavior you are specifying with the when(list.get(0)).thenThrow(new SomeException()) doesn't match the method signature in List API, because get(int index) method does not throw SomeException() so Mockito fails.

If you really want to do this, then have Mockito throw a new RuntimeException() or even better throw a new ArrayIndexOutOfBoundsException() since the API specifies that that is the only valid Exception to be thrown.

This error can be due to many many things.

The key here seems the hint about error reading. I see you are working on a flash drive or something similar? Try to run the install on a local folder owned by your current user.

You could also try with sudo, that might solve a permission problem if that's the case.

Another reason why it cannot read could be because it has not downloaded correctly, or saved correctly. A little problem in your network could have caused that, and the cache clean would remove the files and force a refetch but that does not solve your problem. That means it would be more on the save part, maybe it didn't save because of permissions, maybe it didn't not save correctly because it was lacking disk space...

A thread is something like some branch. Multi-branched means when there are at least two branches. If the branches are reduced, then the minimum remains one. This one is although like the branches removed, but in general we do not consider it branch.

Similarly when there are at least two threads we call it multi-threaded program. If the threads are reduced, the minimum remains one. Hello program is a single threaded program, but no one needs to know multi-threading to write or run it.

In simple words when a program is not said to be having threads, it means that the program is not a multi-threaded program, more over in true sense it is a single threaded program, in which YOU CAN put your code as if it is multi-threaded.

Below a useless code is given, but it will suffice to do away with your some confusions about Runnable. It will print "Hello World".

class NamedRunnable implements Runnable {

    public void run() { // The run method prints a message to standard output.
        System.out.println("Hello World");
    }

    public static void main(String[]arg){ 
        NamedRunnable namedRunnable = new NamedRunnable( );
        namedRunnable.run();
    } 
}

You're confusing PATH and PYTHONPATH. You need to do this:

export PATH=$PATH:/home/randy/lib/python 

PYTHONPATH is used by the python interpreter to determine which modules to load.

PATH is used by the shell to determine which executables to run.

Add agian your deleted drawable image .jpg/png etc formate. and Then run your project to fine working on android studio 3.6.1

I ran into this issue and it turned out the problem was that the jenkins service wasn't being run as the jenkins user. So running the commands as the jenkins user worked just fine.

A variation using just standard color code:

android:textColor="#ff0000"

See C# specification. There are three types of division operators

• Integer division
• Floating-point division
• Decimal division

In your case we have Integer division, with following rules applied:

The division rounds the result towards zero, and the absolute value of the result is the largest possible integer that is less than the absolute value of the quotient of the two operands. The result is zero or positive when the two operands have the same sign and zero or negative when the two operands have opposite signs.

I think the reason why C# use this type of division for integers (some languages return floating result) is hardware - integers division is faster and simpler.

Since 2011, if you can change function1, do so, like this:

#include <functional>
#include <cstdio>

using namespace std;

class aClass
{
public:
    void aTest(int a, int b)
    {
        printf("%d + %d = %d", a, b, a + b);
    }
};

template <typename Callable>
void function1(Callable f)
{
    f(1, 1);
}

void test(int a,int b)
{
    printf("%d - %d = %d", a , b , a - b);
}

int main()
{
    aClass obj;

    // Free function
    function1(&test);

    // Bound member function
    using namespace std::placeholders;
    function1(std::bind(&aClass::aTest, obj, _1, _2));

    // Lambda
    function1([&](int a, int b) {
        obj.aTest(a, b);
    });
}

(live demo)

Notice also that I fixed your broken object definition (aClass a(); declares a function).

Instance variable on a class:

class Parent
  @things = []
  def self.things
    @things
  end
  def things
    self.class.things
  end
end

class Child < Parent
  @things = []
end

Parent.things << :car
Child.things  << :doll
mom = Parent.new
dad = Parent.new

p Parent.things #=> [:car]
p Child.things  #=> [:doll]
p mom.things    #=> [:car]
p dad.things    #=> [:car]

Class variable:

class Parent
  @@things = []
  def self.things
    @@things
  end
  def things
    @@things
  end
end

class Child < Parent
end

Parent.things << :car
Child.things  << :doll

p Parent.things #=> [:car,:doll]
p Child.things  #=> [:car,:doll]

mom = Parent.new
dad = Parent.new
son1 = Child.new
son2 = Child.new
daughter = Child.new

[ mom, dad, son1, son2, daughter ].each{ |person| p person.things }
#=> [:car, :doll]
#=> [:car, :doll]
#=> [:car, :doll]
#=> [:car, :doll]
#=> [:car, :doll]

With an instance variable on a class (not on an instance of that class) you can store something common to that class without having sub-classes automatically also get them (and vice-versa). With class variables, you have the convenience of not having to write self.class from an instance object, and (when desirable) you also get automatic sharing throughout the class hierarchy.

Merging these together into a single example that also covers instance variables on instances:

class Parent
  @@family_things = []    # Shared between class and subclasses
  @shared_things  = []    # Specific to this class

  def self.family_things
    @@family_things
  end
  def self.shared_things
    @shared_things
  end

  attr_accessor :my_things
  def initialize
    @my_things = []       # Just for me
  end
  def family_things
    self.class.family_things
  end
  def shared_things
    self.class.shared_things
  end
end

class Child < Parent
  @shared_things = []
end

And then in action:

mama = Parent.new
papa = Parent.new
joey = Child.new
suzy = Child.new

Parent.family_things << :house
papa.family_things   << :vacuum
mama.shared_things   << :car
papa.shared_things   << :blender
papa.my_things       << :quadcopter
joey.my_things       << :bike
suzy.my_things       << :doll
joey.shared_things   << :puzzle
suzy.shared_things   << :blocks

p Parent.family_things #=> [:house, :vacuum]
p Child.family_things  #=> [:house, :vacuum]
p papa.family_things   #=> [:house, :vacuum]
p mama.family_things   #=> [:house, :vacuum]
p joey.family_things   #=> [:house, :vacuum]
p suzy.family_things   #=> [:house, :vacuum]

p Parent.shared_things #=> [:car, :blender]
p papa.shared_things   #=> [:car, :blender]
p mama.shared_things   #=> [:car, :blender]
p Child.shared_things  #=> [:puzzle, :blocks]  
p joey.shared_things   #=> [:puzzle, :blocks]
p suzy.shared_things   #=> [:puzzle, :blocks]

p papa.my_things       #=> [:quadcopter]
p mama.my_things       #=> []
p joey.my_things       #=> [:bike]
p suzy.my_things       #=> [:doll] 

Here you go:

$.inArray('specialword', arr)

This function returns a positive integer (the array index of the given value), or -1 if the given value was not found in the array.

Live demo: http://jsfiddle.net/simevidas/5Gdfc/

You probably want to use this like so:

if ( $.inArray('specialword', arr) > -1 ) {
    // the value is in the array
}

If you just need this functionality and want to use it in more than one controller, this is a simple service to track route history:

  (function () {
  'use strict';

  angular
    .module('core')
    .factory('RouterTracker', RouterTracker);

  function RouterTracker($rootScope) {

    var routeHistory = [];
    var service = {
      getRouteHistory: getRouteHistory
    };

    $rootScope.$on('$stateChangeSuccess', function (ev, to, toParams, from, fromParams) {
      routeHistory.push({route: from, routeParams: fromParams});
    });

    function getRouteHistory() {
      return routeHistory;
    }

    return service;
  }
})();

where the 'core' in .module('core') would be the name of your app/module. Require the service as a dependency to your controller, then in your controller you can do: $scope.routeHistory = RouterTracker.getRouteHistory()

Using balexandre's info:

SELECT usesysid, usename FROM pg_stat_activity;

Unlike innerText, though, innerHTML lets you work with HTML rich text and doesn't automatically encode and decode text. In other words, innerText retrieves and sets the content of the tag as plain text, whereas innerHTML retrieves and sets the content in HTML format.

I'm using version 4.0.3 of MAMP along with phpmyadmin. The top of /Applications/MAMP/bin/phpMyAdmin/libraries/config.default.php reads:

DO NOT EDIT THIS FILE, EDIT config.inc.php INSTEAD !!!

Changing the following line in /Applications/MAMP/bin/phpMyAdmin/config.inc.php and restarting MAMP worked for me.

$cfg['ExecTimeLimit'] = 0;

If you're testing for all zeros to avoid a warning on another numpy function then wrapping the line in a try, except block will save having to do the test for zeros before the operation you're interested in i.e.

try: # removes output noise for empty slice 
    mean = np.mean(array)
except:
    mean = 0

The best way to understand is to simply think from top to bottom ( Large Desktops to Mobile Phones)

Firstly, as B3 is mobile first so if you use xs then the columns will be same from Large desktops to xs ( i recommend using xs or sm as this will keep everything the way you want on every screen size )

Secondly if you want to give different width to columns on different devices or resolutions, than you can add multiple classes e.g

the above will change the width according to the screen resolutions, REMEMBER i am keeping the total columns in each class = 12

I hope my answer would help!

After some searching, the most reasonable answer is the following:

MVC is already implemented in Android as:

1. View = layout, resources and built-in classes like Button derived from android.view.View.
2. Controller = Activity
3. Model = the classes that implement the application logic

(This by the way implies no application domain logic in the activity.)

The most reasonable thing for a small developer is to follow this pattern and not to try to do what Google decided not to do.

PS Note that Activity is sometimes restarted, so it's no place for model data (the easiest way to cause a restart is to omit android:configChanges="keyboardHidden|orientation" from the XML and turn your device).

EDIT

We may be talking about MVC, but it will be so to say FMVC, Framework--Model--View--Controller. The Framework (the Android OS) imposes its idea of component life cycle and related events, and in practice the Controller (Activity/Service/BroadcastReceiver) is first of all responsible for coping with these Framework-imposed events (such as onCreate()). Should user input be processed separately? Even if it should, you cannot separate it, user input events also come from Android.

Anyway, the less code that is not Android-specific you put into your Activity/Service/BroadcastReceiver, the better.

There's a better way of storing JSON in the HTML:

HTML

<script id="some-data" type="application/json">{"param_1": "Value 1", "param_2": "Value 2"}</script>

JavaScript

JSON.parse(document.getElementById('some-data').textContent);

a:link{
  text-decoration: none!important;
}

=> Working with me :) , good luck

To get rid of error:

Type '"text"' is not assignable to type '"json"'.

Use

responseType: 'text' as 'json'

import { HttpClient, HttpHeaders } from '@angular/common/http';
.....
 return this.http
        .post<string>(
            this.baseUrl + '/Tickets/getTicket',
            JSON.stringify(value),
        { headers, responseType: 'text' as 'json' }
        )
        .map(res => {
            return res;
        })
        .catch(this.handleError);

One liner to find a list of datetimes, incremented by month, between two dates.

import datetime
from dateutil.rrule import rrule, MONTHLY

strt_dt = datetime.date(2001,1,1)
end_dt = datetime.date(2005,6,1)

dates = [dt for dt in rrule(MONTHLY, dtstart=strt_dt, until=end_dt)]

if you're already logged in as root just

mysql -u root

prompting the password will otherwise return as error

I confess to not having read the whole thread. However when I faced a similar issue I found that checking carefully the case of the file name and correcting that in the HTML reference fixed a similar issue. So local preview on Windows worked but when I published to my server (hosted Linux) I had to make sure "mugshot.jpg" was changed to "mugshot.JPG". Part of the problem is the defaults in Windows hiding full file names behind file type indications.

I got this off of here:

In my case the mapping class was not public. In other words, instead of:

public class UserMap : ClassMap<user>  // note the public!

I just had:

class UserMap : ClassMap<user>

The sort method and sorted function allow you to provide a custom function to extract the key used for comparison:

>>> ls = ['Q1.3', 'Q6.1', 'Q1.2']
>>> sorted(ls, key=lambda x: float(x[1:]))
['Q1.2', 'Q1.3', 'Q6.1']

As an alternative to @Mark Byers' approach, you can use while True:

guess = 50     # this should be outside the loop, I think
while True:    # infinite loop
    n = raw_input("\n\nTrue, False or Correct?: ")
    if n == "Correct":
        break  # stops the loop
    elif n == "True":
        # etc.

using kotlin-extension makes it better

fun Int.toPx(context: Context): Int = (this * context.resources.displayMetrics.density).toInt()

fun Int.toDp(context: Context): Int = (this / context.resources.displayMetrics.density).toInt()

UPDATE:

Because of displayMetrics is part of global shared Resources, we can use Resources.getSystem()

fun Int.toPx(): Int = (this * Resources.getSystem().displayMetrics.density).toInt()

fun Int.toDp(): Int = (this / Resources.getSystem().displayMetrics.density).toInt()

Here is a complete example. Right click on the solution to manage nuget packages and get Newtonsoft and RestSharp:

using Newtonsoft.Json.Linq;
using RestSharp;
using System;


namespace TestAPI
{
    class Program
    {
        static void Main(string[] args)
        {
            String id = "xxx";
            String secret = "xxx";

            var client = new RestClient("https://xxx.xxx.com/services/api/oauth2/token");
            var request = new RestRequest(Method.POST);
            request.AddHeader("cache-control", "no-cache");
            request.AddHeader("content-type", "application/x-www-form-urlencoded");
            request.AddParameter("application/x-www-form-urlencoded", "grant_type=client_credentials&scope=all&client_id=" + id + "&client_secret=" + secret, ParameterType.RequestBody);
            IRestResponse response = client.Execute(request);

            dynamic resp = JObject.Parse(response.Content);
            String token = resp.access_token;            

            client = new RestClient("https://xxx.xxx.com/services/api/x/users/v1/employees");
            request = new RestRequest(Method.GET);
            request.AddHeader("authorization", "Bearer " + token);
            request.AddHeader("cache-control", "no-cache");
            response = client.Execute(request);
        }        
    }
}

The image should be embedded in the message as an attachment like this:

--boundary
Content-Type: image/png; name="sig.png"
Content-Disposition: inline; filename="sig.png"
Content-Transfer-Encoding: base64
Content-ID: <0123456789>
Content-Location: sig.png

base64 data

--boundary

And, the HTML part would reference the image like this:

<img src="cid:0123456789">

In some clients, src="sig.png" will work too.

You'd basically have a multipart/mixed, multipart/alternative, multipart/related message where the image attachment is in the related part.

Clients shouldn't block this image either as it isn't remote.

Or, here's a multipart/alternative, multipart/related example as an mbox file (save as windows newline format and put a blank line at the end. And, use no extension or the .mbs extension):

From 
From: [email protected]
To: [email protected]
Subject: HTML Messages with Embedded Pic in Signature
MIME-Version: 1.0
Content-Type: multipart/alternative; boundary="alternative_boundary"

This is a message with multiple parts in MIME format.

--alternative_boundary
Content-Type: text/plain; charset="utf-8"
Content-Transfer-Encoding: 8bit

test

-- 
[Picture of a Christmas Tree]

--alternative_boundary
Content-Type: multipart/related; boundary="related_boundary"

--related_boundary
Content-Type: text/html; charset="utf-8"
Content-Transfer-Encoding: 8bit

<!DOCTYPE html>
<html>
    <head>
        <meta charset="utf-8">
        <title></title>
    </head>
    <body>
        <p>test</p>
        <p class="sig">-- <br><img src="cid:0123456789"></p>
    </body>
</html>

--related_boundary
Content-Type: image/png; name="sig.png"
Content-Disposition: inline; filename="sig.png"
Content-Location: sig.png
Content-ID: <0123456789>
Content-Transfer-Encoding: base64

R0lGODlhKAA8AIMLAAD//wAhAABKAABrAACUAAC1AADeAAD/AGsAAP8zM///AP//
///M//////+ZAMwAACH/C05FVFNDQVBFMi4wAwGgDwAh+QQJFAALACwAAAAAKAA8
AAME+3DJSWt1Nuu9Mf+g5IzK6IXopaxn6orlKy/jMc6vQRy4GySABK+HAiaIoQdg
uUSCBAKAYTBwbgyGA2AgsGqo0wMh7K0YEuj0sUxRoAfqB1vycBN21Ki8vOofBndR
c1AKgH8ETE1lBgo7O2JaU2UFAgRoDGoAXV4PD2qYagl7Vp0JDKenfwado0QCAQOQ
DIcDBgIFVgYBAlOxswR5r1VIUbCHwH8HlQWFRLYABVOWamACCkiJAAehaX0rPZ1B
oQSg3Z04AuFqB2IMd+atLwUBtpAHqKdUtbwGM1BTOgA5YhBr374ZAxhAqRVLzA53
OwTEAjhDIZYs09aBASYq+94HfAq3cRt57sWDct2EvEsTpBMVF6sYeEpDQIFDdo62
BHwZApjEhjW94RyQTWK/FPx+Ahpg09GdOzoJ/ESx0JaOQ42e2tsiEYpCEFwAGi04
8g6gSgNOovD0gBeVjCPR2BIAkgOrmSNxPo3rbhgHZiMFPnLkBg2BAuQ2XdmlwK1Z
ooZu1sRz6xWlxd4U9GIHwOmdzFgCFKCERYNoeo2BZsPp0KY+A/OAfZDYWKJZLZBo
1mQXdlojvxNYiXrD8I+2uEvTdFJQksID0XjXiUwjJm6CzBVeBQgwBop1ZPpC8RKt
YN5RCpS6XiyMht093o8KcFFf/vKE0dCmaLeWYhQMwbeQaHLRfNk9o5Q13lQGklFQ
aMLFRLcwcN5qSWmGxS2jKQQFL9nEAgxsDEiwlAHaPPJWIfroo6FVEun0VkL4UABA
CAjUiIAFM2YQogzcoLCjC3HNsYB1aSBB5JFrZBABACH5BAkUAAsALAAAAAAoADwA
AwT7cMlJa3U2670x/6DkjKQXnleJrqnJruMxvq8xHDQbJEyC5yheAnh6MI5HYkgg
YNgGSo7BcGAMBNHNYGA7ELpZiyFBLg/DFvLArEBPHoAEgXDYChQP90IAoNYJCoGB
aACFhX8HBwoGegYAdHReijZoBXxmPWRYYQ8PZmSZZHmcnqBITp2jSgIBN5BVBFwC
BVkGAQJPiVV2rFCrCq1/sXUHAgQFAL45BncFNgSfW8wASoKBB59lhoVAnQqfDNCf
AJ05At5msHPiCeSqLwUBzF6nVnXSuIwvTDYGsXPhiMmSRUOWAC436HmZU+yGDQYF
81FhV+aevzUM3oHoZBD7W7Zs9VaUIhOn4pwE38p0srLCQCqSciBFUuBFGgEryj7E
Ojhg2yOG1hQMIMCEy4p8PB8llKmAIReiW040keUvmUygiexcwbWJwxUrzBDW+Thn
qLEB5UDUe0LxYwJmAhKk+pAqVLZE69qWGZpTQwG7ZISuw7uwzDFAXTXYYoJraKym
Q/HSASDpiiUFljbYitfYRtCF635yMRBUn4UA8aYclCw0shefW7gUgPxBKGPHA5pK
MpwsKy5AcmNZSIVHjdjI2eLwVZlK44IHQT8lkq7XTDznrAIEWMTErZwbsT/hQj1L
noXLV6YwS5eIJqIDf4tyLZB5Av1ZNrLzQSplrXVkOgxItBU1E+DCwC2xFZUME5dZ
c5AB9aw2jXkSQLhFIrj4xAx9szGWzwABdkGATwuAeEokW4wY24oK8MMViAjxxcc8
E0CUAYETIKAjAifgWGMI2ehBgVtCeleGEkYmeUYGEQAAIfkECRQACwAsAAAAACgA
PAADBPtwyUlrdTbrvTH/oOSMpBeeV4muqcmu4zG+r6EcNBskSoLnJ4VQCAw9ErzE
oxgSCBSGwYDJMRgOhIGAupFGsVEG12JAmpHicaU3QDPe6fHjoSAQDlIBY6leDIUD
dnp9C04DdXh3eAaEUTeKdwJRagUCBGdnW3JHmJh8XHNmWAeLDwCfRQIBA6MMiQMG
AgBcBgGSUgeuWQMAvb1MAgWruXAMrJYAUkU2wVGXDGZeAIxMCgVfaJhOVkB/PWeX
nXM5AnScSKR2dmZzqCwFUAKjo1l4XpLULNuwWXYHAHgWCYD15AXBgV+wEACg7sDA
A45oaLFy5ZKvXvYMEPCGYvvOwQOYAHRCQufFuU7/wp2Zo2AKCgPtwN3xR8/LLpcg
kg1khaVlQyw8GRAwlC8nvp2HeM5UR8CYxp05L8ay8YcplmLGtmniwCtKLFhJR9oR
amnAuBAiH9wK9G1kAgaxBCg5u6HdSUzp1LlNCqJAgZGBaC41Q6DAUAUfajm5ZUdK
v7z08ATjmKGWAltecaVTqE5oFisB/EIpSiH06IcKpQTa3JSVagPCWm7wZsgOwJkg
3xaTrJFkFgvtFHDywmt1J2iB2pC0C9x0yItnsLx1K8xdoQDYCcQ9I5KwaynaalUS
RnpBpYH4YiXoTipgIlIFtLSUFKwSBb/NtGCnb2Zl51fHo8hnhRZbSfCEKkgZkkcw
TgBgyVdxeQNRMNNMoMBOpBxFUSx+ObgYPgS1BBRss/jxxzwAqsbLRfwh1VJyF5WI
2AkIAIAAAiiUKMGMICDRXQIn6IiCW4Qs4NYZTByppBkbRAAAIf4ZQm95J3MgSGFw
cHkgSG9saWRheXMgUGFnZQA7

--related_boundary--

--alternative_boundary--

You can import that into Sylpheed or Thunderbird (with the Import/Export tools extension) or Opera's built-in mail client. Then, in Opera for example, you can toggle "prefer plain text" to see the difference between the HTML and text version. Anyway, you'll see the HTML version makes use of the embedded pic in the sig.

fopen vs open in C

1) fopen is a library function while open is a system call.

2) fopen provides buffered IO which is faster compare to open which is non buffered.

3) fopen is portable while open not portable (open is environment specific).

4) fopen returns a pointer to a FILE structure(FILE *); open returns an integer that identifies the file.

5) A FILE * gives you the ability to use fscanf and other stdio functions.

Basically, you're trying to use int as if it was an Object, which it isn't (well...it's complicated)

id.equals(list[pos].getItemNumber())

Should be...

id == list[pos].getItemNumber()

You can combine both in the same date function call

date("d-m-Y H:i:s");  

I'd just like to add some comments from my personal experience (using both sagas and thunk):

Sagas are great to test:

• You don't need to mock functions wrapped with effects
• Therefore tests are clean, readable and easy to write
• When using sagas, action creators mostly return plain object literals. It is also easier to test and assert unlike thunk's promises.

Sagas are more powerful. All what you can do in one thunk's action creator you can also do in one saga, but not vice versa (or at least not easily). For example:

• wait for an action/actions to be dispatched (take)
• cancel existing routine (cancel, takeLatest, race)
• multiple routines can listen to the same action (take, takeEvery, ...)

Sagas also offers other useful functionality, which generalize some common application patterns:

• channels to listen on external event sources (e.g. websockets)
• fork model (fork, spawn)
• throttle
• ...

Sagas are great and powerful tool. However with the power comes responsibility. When your application grows you can get easily lost by figuring out who is waiting for the action to be dispatched, or what everything happens when some action is being dispatched. On the other hand thunk is simpler and easier to reason about. Choosing one or another depends on many aspects like type and size of the project, what types of side effect your project must handle or dev team preference. In any case just keep your application simple and predictable.

Go to

Project properties >> Run >> VM options

and put this address:

-Djava.library.path="C:\opencv\build\java\x64"

The best way I have found is to use the initComplete method as it fires after the data has been retrieved and renders the table. NOTE this only fires once though.

$("#tableOfData").DataTable({
        "pageLength": 50,
        "ajax":{
            url: someurl,
            dataType : "json",
            type: "post",
            "data": {data to be sent}
        },
        "initComplete":function( settings, json){
            console.log(json);
            // call your function here
        }
    });

It depends on whether the setting you have chosen is at "User" scope or "Application" scope.

User scope

User scope settings are stored in

C:\Documents and Settings\ username \Local Settings\Application Data\ ApplicationName

You can read/write them at runtime.

For Vista and Windows 7, folder is

C:\Users\ username \AppData\Local\ ApplicationName

or

C:\Users\ username \AppData\Roaming\ ApplicationName

Application scope

Application scope settings are saved in AppName.exe.config and they are readonly at runtime.

You can also declare class variables as None which will prevent propagation. This is useful when you need a well defined class and want to prevent AttributeErrors. For example:

>>> class TestClass(object):
...     t = None
... 
>>> test = TestClass()
>>> test.t
>>> test2 = TestClass()
>>> test.t = 'test'
>>> test.t
'test'
>>> test2.t
>>>

Also if you need defaults:

>>> class TestClassDefaults(object):
...    t = None
...    def __init__(self, t=None):
...       self.t = t
... 
>>> test = TestClassDefaults()
>>> test.t
>>> test2 = TestClassDefaults([])
>>> test2.t
[]
>>> test.t
>>>

Of course still follow the info in the other answers about using mutable vs immutable types as the default in __init__.

Major difference:

Calling print will immediately make your program write out text for you to see. Use print when you want to show a value to a human.

return is a keyword. When a return statement is reached, Python will stop the execution of the current function, sending a value out to where the function was called. Use return when you want to send a value from one point in your code to another.

Using return changes the flow of the program. Using print does not.

You can use the call command...

Type: call /?

Usage: call [drive:][path]filename [batch-parameters]

For example call "Example File/Input File/My Program.bat" [This is also capable with calling files that have a .exe, .cmd, .txt, etc.

NOTE: THIS COMMAND DOES NOT ALWAYS WORK!!!

Not all computers are capable to run this command, but if it does work than it is very useful, and you won't have to open a brand new window...

java.util.Date.from(localDate.atStartOfDay().atZone(ZoneId.systemDefault()).toInstant());

Answer given by kennyut/Kistian works very well but to get exact RDD like output when RDD consist of list of attributes e.g. [1,2,3,4] we can use flatmap command as below,

rdd = df.rdd.flatMap(list)
or 
rdd = df.rdd.flatmap(lambda x: list(x))

A bit late, but using the extend() function lets you call "hasClass()" on any element, e.g.:
var hasClass = $('#divId').hasClass('someClass');

(function($) {
$.extend({
    hasClass: new function(className) {
        var classAttr = $J(this).attr('class');
        if (classAttr != null && classAttr != undefined) {
            var classList = classAttr.split(/\s+/);
            for(var ix = 0, len = classList.length;ix < len;ix++) {
                if (className === classList[ix]) {
                    return true;
                }
            }
        }
        return false;
    }
}); })(jQuery);

Sounds like you executed another statement in the same connection before traversing the result set from the first statement. If you're nesting the processing of two result sets from the same database, you're doing something wrong. The combination of those sets should be done on the database side.

I personally use prepared statements.

Why is it important?

Well it's important because of security. It's very easy to do an SQL injection on someone who use variables in the query.

Instead of using this code:

$query = "SELECT username,userid FROM user WHERE username = 'admin' ";
$result=$conn->query($query);

You should use this

$stmt = $this->db->query("SELECT * FROM users WHERE username = ? AND password = ?");
$stmt->bind_param("ss", $username, $password); //You need the variables to do something as well.
$stmt->execute();

Learn more about prepared statements on:

http://php.net/manual/en/mysqli.quickstart.prepared-statements.php MySQLI

http://php.net/manual/en/pdo.prepared-statements.php PDO

You are looking for a web crawler. You can use JSoup to do this, here is basic example

There is no way to create a file without opening it There is os.mknod("newfile.txt") (but it requires root privileges on OSX). The system call to create a file is actually open() with the O_CREAT flag. So no matter how, you'll always open the file.

So the easiest way to simply create a file without truncating it in case it exists is this:

open(x, 'a').close()

Actually you could omit the .close() since the refcounting GC of CPython will close it immediately after the open() statement finished - but it's cleaner to do it explicitely and relying on CPython-specific behaviour is not good either.

In case you want touch's behaviour (i.e. update the mtime in case the file exists):

import os
def touch(path):
    with open(path, 'a'):
        os.utime(path, None)

You could extend this to also create any directories in the path that do not exist:

basedir = os.path.dirname(path)
if not os.path.exists(basedir):
    os.makedirs(basedir)

Add a CommandName attribute, and optionally a CommandArgument attribute, to your LinkButton control. Then set the OnCommand attribute to the name of your Command event handler.

<asp:LinkButton ID="ENameLinkBtn" runat="server" CommandName="MyValueGoesHere" CommandArgument="OtherValueHere" 
          style="font-weight: 700; font-size: 8pt;" OnCommand="ENameLinkBtn_Command" ><%# Eval("EName") %></asp:LinkButton>

<asp:Label id="Label1" runat="server"/>

Then it will be available when in your handler:

protected void ENameLinkBtn_Command (object sender, CommandEventArgs e)
{
   Label1.Text = "You chose: " + e.CommandName + " Item " + e.CommandArgument;
}

More info on MSDN

Native browser smooth scrolling in JavaScript is like this:

// scroll to specific values,
// same as window.scroll() method.
// for scrolling a particular distance, use window.scrollBy().
window.scroll({
  top: 2500, 
  left: 0, 
  behavior: 'smooth' 
});

// scroll certain amounts from current position 
window.scrollBy({ 
  top: 100, // negative value acceptable
  left: 0, 
  behavior: 'smooth' 
});

// scroll to a certain element
document.querySelector('.hello').scrollIntoView({ 
  behavior: 'smooth' 
});

What you are looking for is called covariant type parameters. This means that if one type of object can be substituted for another in a method (for instance, Animal can be replaced with Dog), the same applies to expressions using those objects (so List<Animal> could be replaced with List<Dog>). The problem is that covariance is not safe for mutable lists in general. Suppose you have a List<Dog>, and it is being used as a List<Animal>. What happens when you try to add a Cat to this List<Animal> which is really a List<Dog>? Automatically allowing type parameters to be covariant breaks the type system.

It would be useful to add syntax to allow type parameters to be specified as covariant, which avoids the ? extends Foo in method declarations, but that does add additional complexity.

You should be able to adjust the width using the .modal-dialog class selector (in conjunction with media queries or whatever strategy you're using for responsive design):

.modal-dialog {
    width: 400px;
}

When in a window, go to GO ---> ENTER LOCATION... And then copy paste this: /opt/lampp/htdocs

Now you are at the htdocs folder. Then you can add your files there, or in a new folder inside this one (for example "myproyects" folder and inside it your files... and then from a navigator you access it by writting: localhost/myproyects/nameofthefile.php

What I did to find it easily everytime, was right click on "myproyects" folder and "Make link..."... then I moved this link I created to the Desktop and then I didn't have to go anymore to the htdocs, but just enter the folder I created in my Desktop.

Hope it helps!!

tr '\n' ' ' 

is the command.

Simple and easy to use.

You could use

https://github.com/slightfoot/flutter_after_layout

which executes a function only one time after the layout is completed. Or just look at its implementation and add it to your code :-)

Which is basically

  void initState() {
    super.initState();
    WidgetsBinding.instance
        .addPostFrameCallback((_) => yourFunction(context));
  }

The way I have sorted HTML tables in the browser uses plain, unadorned Javascript.

The basic process is:

1. add a click handler to each table header
2. the click handler notes the index of the column to be sorted
3. the table is converted to an array of arrays (rows and cells)
4. that array is sorted using javascript sort function
5. the data from the sorted array is inserted back into the HTML table

The table should, of course, be nice HTML. Something like this...

<table>
 <thead>
  <tr><th>Name</th><th>Age</th></tr>
 </thead>
 <tbody>
  <tr><td>Sioned</td><td>62</td></tr>
  <tr><td>Dylan</td><td>37</td></tr>
  ...etc...
 </tbody>
</table>

So, first adding the click handlers...

const table = document.querySelector('table'); //get the table to be sorted

table.querySelectorAll('th') // get all the table header elements
  .forEach((element, columnNo)=>{ // add a click handler for each 
    element.addEventListener('click', event => {
        sortTable(table, columnNo); //call a function which sorts the table by a given column number
    })
  })

This won't work right now because the sortTable function which is called in the event handler doesn't exist.

Lets write it...

function sortTable(table, sortColumn){
  // get the data from the table cells
  const tableBody = table.querySelector('tbody')
  const tableData = table2data(tableBody);
  // sort the extracted data
  tableData.sort((a, b)=>{
    if(a[sortColumn] > b[sortColumn]){
      return 1;
    }
    return -1;
  })
  // put the sorted data back into the table
  data2table(tableBody, tableData);
}

So now we get to the meat of the problem, we need to make the functions table2data to get data out of the table, and data2table to put it back in once sorted.

Here they are ...

// this function gets data from the rows and cells 
// within an html tbody element
function table2data(tableBody){
  const tableData = []; // create the array that'll hold the data rows
  tableBody.querySelectorAll('tr')
    .forEach(row=>{  // for each table row...
      const rowData = [];  // make an array for that row
      row.querySelectorAll('td')  // for each cell in that row
        .forEach(cell=>{
          rowData.push(cell.innerText);  // add it to the row data
        })
      tableData.push(rowData);  // add the full row to the table data 
    });
  return tableData;
}

// this function puts data into an html tbody element
function data2table(tableBody, tableData){
  tableBody.querySelectorAll('tr') // for each table row...
    .forEach((row, i)=>{  
      const rowData = tableData[i]; // get the array for the row data
      row.querySelectorAll('td')  // for each table cell ...
        .forEach((cell, j)=>{
          cell.innerText = rowData[j]; // put the appropriate array element into the cell
        })
      tableData.push(rowData);
    });
}

And that should do it.

A couple of things that you may wish to add (or reasons why you may wish to use an off the shelf solution): An option to change the direction and type of sort i.e. you may wish to sort some columns numerically ("10" > "2" is false because they're strings, probably not what you want). The ability to mark a column as sorted. Some kind of data validation.

For vector graphics, ImageMagick has both a render resolution and an output size that are independent of each other.

Try something like

convert -density 300 image.eps -resize 1024x1024 image.jpg

Which will render your eps at 300dpi. If 300 * width > 1024, then it will be sharp. If you render it too high though, you waste a lot of memory drawing a really high-res graphic only to down sample it again. I don't currently know of a good way to render it at the "right" resolution in one IM command.

The order of the arguments matters! The -density X argument needs to go before image.eps because you want to affect the resolution that the input file is rendered at.

This is not super obvious in the manpage for convert, but is hinted at:

SYNOPSIS

convert [input-option] input-file [output-option] output-file

I had this error when trying to use the dreadful Business Objects 4 for .Net SDK.

They ship five BusinessObjects*.dll files, but all of them are 64-bit.

To get my webpage to load, I needed to click on Tools\Options, then change this setting in VS2013:

The best way to accomplish that is to use POST which is a method of Hypertext Transfer Protocol https://developer.mozilla.org/en-US/docs/Web/HTTP/Methods

index.php

<html>
<body>

<form action="site2.php" method="post">
Name: <input type="text" name="name">
Email: <input type="text" name="email">
<input type="submit">
</form>

</body>
</html> 

site2.php

 <html>
 <body>

 Hello <?php echo $_POST["name"]; ?>!<br>
 Your mail is <?php echo $_POST["mail"]; ?>.

 </body>
 </html> 

output

Hello "name" !

Your email is "[email protected]" .

Assuming that this is .d, you can write

$(this).closest('.a');

The closest method returns the innermost parent of your element that matches the selector.

Here's a way to do it without regular expressions or explicit loops, although it's stretching the definition of a one liner a bit:

const input = 'abcdefghijlkm';

// Change `3` to the desired split length.
const output = input.split('').reduce((s, c) => {let l = s.length-1; (s[l] && s[l].length < 3) ? s[l] += c : s.push(c); return s;}, []);

console.log(output);  // output: [ 'abc', 'def', 'ghi', 'jlk', 'm' ]

It works by splitting the string into an array of individual characters, then using Array.reduce to iterate over each character. Normally reduce would return a single value, but in this case the single value happens to be an array, and as we pass over each character we append it to the last item in that array. Once the last item in the array reaches the target length, we append a new array item.

If you want to know the location of you NPM packages, you should:

which npm // locate a program file in the user's path SEE man which
// OUTPUT SAMPLE
/usr/local/bin/npm
la /usr/local/bin/npm // la: aliased to ls -lAh SEE which la THEN man ls
lrwxr-xr-x  1 t04435  admin    46B 18 Sep 10:37 /usr/local/bin/npm -> /usr/local/lib/node_modules/npm/bin/npm-cli.js

So given that npm is a NODE package itself, it is installed in the same location as other packages(EUREKA). So to confirm you should cd into node_modules and list the directory.

cd /usr/local/lib/node_modules/
ls
#SAMPLE OUTPUT
@angular npm .... all global npm packages installed

OR

npm root -g

As per @anthonygore 's comment

You can use lists comprehensions:

strip_list = [item.strip() for item in lines]

Or the map function:

# with a lambda
strip_list = map(lambda it: it.strip(), lines)

# without a lambda
strip_list = map(str.strip, lines)

You could also to check this page: Unicode Regular Expressions, as it contains some useful Unicode characters classes, like:

\p{Control}: an ASCII 0x00..0x1F or Latin-1 0x80..0x9F control character.

Enabling "Ensure right margin is not exceeded" doesn't work for me in Intellij IDEA 2018.2. I have found the workaround, we need to change every elements below from "Do not wrap" to "Wrap if long".

After that, we can preview what kind of wrap type will be changed by looking into right panel. If we are satisfied, Click "OK" or "Apply" to apply the changes. Finally we need a mannual format by using CTRL+ ALT+ L in Windows and Command+ Shift+ L in MacOS.

If you have to use an image as the transparent background, you might be able to work around it using a pseudo element:

html

<div class="wrap"> 
   <p>I have 100% opacity</p>  
</div>

css

.wrap, .wrap > * {
  position: relative;
}
.wrap:before {
  content: " ";
  opacity: 0.2;
  background: url("http://placehold.it/100x100/FF0000") repeat;     
  position: absolute;
  width: 100%;
  height: 100%;
}

I had this problem when I wanted to make a vnc connection via a tunnel. But the vncserver was not running. I solved it by opening the channel on the remote machine with vncserver :3.

Problem is that you seed the random generator again. Every time you seed it the initial state of the random number generator gets reset and the first random number you generate will be the first random number after the initial state

//this is only good in .NET 4
//read your file:
List<string> ReadFile = File.ReadAllLines(@"C:\TEMP\FILE.TXT").ToList();

//manipulate data here
foreach(string line in ReadFile)
{
    //do something here
}

//write back to your file:
File.WriteAllLines(@"C:\TEMP\FILE2.TXT", ReadFile);

you should add this line above your page

<meta http-equiv="Content-Type" content="text/html; charset=UTF-8" />

HTML

<select class='form-control'>
    <option *ngFor="let option of options"
    [selected]="option === nrSelect"
    [value]="option">
        {{ option }}
    </option>
</select>

Typescript

nrSelect = 47;
options = [41, 42, 47, 48];

The easiest way to open an admin Powershell window in Windows 10 (and Windows 8) is to add a "Windows Powershell (Admin)" option to the "Power User Menu". Once this is done, you can open an admin powershell window via Win+X,A or by right-clicking on the start button and selecting "Windows Powershell (Admin)":

[

Here's where you replace the "Command Prompt" option with a "Windows Powershell" option:

[

Late answer, but this might help someone. I got the same error, tried out all the previously mentioned suggestions, banged my head against the wall, but nothing worked.

On careful observation, I noticed the following in app.module.ts:

imports: [
  BrowserModule,
  BrowserAnimationsModule,
  FormsModule,
  HttpClientModule,, // Redundant comma 
  CoreModule
];

So I banged my head some more. The extra comma, very innocently higlighted, by WebStorm, as a mild warning, wreaked havoc by inserting an empty slot in the Array. Watchout fot the elision trap ;)

here's a regex one for ya.

update table
set col1=null
where col1 not like '%[a-z,0-9]%'

essentially finds any columns that dont have letters or numbers in them and sets it to null. might have to update if you have columns with just special characters.

it will have some effect on an object.... query for the result of the effect. If it has no visible effect its not worth unit testing!

To remove spaces... please use LTRIM/RTRIM

 LTRIM(String)
 RTRIM(String)

The String parameter that is passed to the functions can be a column name, a variable, a literal string or the output of a user defined function or scalar query.

SELECT LTRIM(' spaces at start')
SELECT RTRIM(FirstName) FROM Customers

Read more: http://rockingshani.blogspot.com/p/sq.html#ixzz33SrLQ4Wi

Use your WorkSheet.Columns.NumberFormat, and set it to string "@", here is the sample:

Excel._Worksheet workSheet = (Excel._Worksheet)_Excel.Worksheets.Add();
//set columns format to text format
workSheet.Columns.NumberFormat = "@";

Note: this text format will apply for your hole excel sheet!

If you want a particular column to apply the text format, for example, the first column, you can do this:

workSheet.Columns[0].NumberFormat = "@";

or this will apply the specified range of woorkSheet to text format:

workSheet.get_Range("A1", "D1").NumberFormat = "@";

Obviously, Class.isAssignableFrom() tells you whether an individual class implements the given interface. So then the problem is getting the list of classes to test.

As far as I'm aware, there's no direct way from Java to ask the class loader for "the list of classes that you could potentially load". So you'll have to do this yourself by iterating through the visible jars, calling Class.forName() to load the class, then testing it.

However, it's a little easier if you just want to know classes implementing the given interface from those that have actually been loaded:

• via the Java Instrumentation framework, you can call Instrumentation.getAllLoadedClasses()
• via reflection, you can query the ClassLoader.classes field of a given ClassLoader.

If you use the instrumentation technique, then (as explained in the link) what happens is that your "agent" class is called essentially when the JVM starts up, and passed an Instrumentation object. At that point, you probably want to "save it for later" in a static field, and then have your main application code call it later on to get the list of loaded classes.

very simple

var states = [,];
states[0,0] = tName; 
states[0,1] = '1';
states[1,0] = tName; 
states[2,1] = '1';

. . .

states[n,0] = tName; 
states[n,1] = '1';

This is my recipe

Note: This isn't exactly what OP is asking. These instructions will help you change the colors of items (comments, keywords, etc) that are defined syntax matching rules. For example, use these instructions to change so that all code comments are colored blue instead of green.

I believe the OP is asking how to define this as an item to be colored when found in a JavaScript source file.

1. Install Package: PackageResourceViewer

2. Ctrl+Shift+P > [PackageResourceViewer: Open Resource] > [Color Scheme - Default] > [Marina.sublime-color-scheme] (or whichever color scheme you use)

3. The above command will open a new tab to the file "Marina.sublime-color-scheme".

   • For me, this file was located in my roaming profile %appdata% (C:\Users\walter\AppData\Roaming\Sublime Text 3\Packages\Color Scheme - Default\) .
   • However, if I browse to that path in Windows Explorer, [Color Scheme - Default] is not of a child-dir of [Packages] dir. I suspect that PackageResourceViewer is doing some virtualization.

optional step: On the new color-scheme tab: Ctrl+Shift+P > [Set Syntax: JSON]

4. Search for the rule you want to change. I wanted to make comments be move visible, so I searched for "Comment"

   • I found it in the "rules" section

 "rules":
    [
        {
            "name": "Comment",
            "scope": "comment, punctuation.definition.comment",
            "foreground": "var(blue6)"
        },

5. Search for the string "blue6": to find the color variable definitions section. I found it in the "variables" section.

6. Pick a new color using a tool like http://hslpicker.com/ .

7. Either define a new color variable, or overwrite the color setting for blue6.

   • Warning: overwriting blue6 will affect all other text-elements in that color scheme which also use blue6 ("Punctuation" "Accessor").

8. Save your file, the changes will be applied instantly to any open files/tabs.

NOTES

Sublime will handle any of these color styles. Possibly more.

hsla = hue, saturation, lightness, alpha rgba = red, green, blue, alpha

hsla(151, 100%, 41%, 1) - last param is the alpha level (transparency) 1 = opaque, 0.5 = half-transparent, 0 = full-transparent

hsl(151, 100%, 41%) - no alpha channel

rgba(0, 209, 108, 1) - rgb with an alpha channel

rgb(0, 209, 108) - no alpha channel

You are running your HTML from a different host than the host you are requesting. Because of this, you are getting blocked by the same origin policy.

One way around this is to use JSONP. This allows cross-site requests.

In JSON, you are returned:

{a: 5, b: 6}

In JSONP, the JSON is wrapped in a function call, so it becomes a script, and not an object.

callback({a: 5, b: 6})

You need to edit your REST service to accept a parameter called callback, and then to use the value of that parameter as the function name. You should also change the content-type to application/javascript.

For example: http://localhost:8080/restws/json/product/get?callback=process should output:

process({a: 5, b: 6})

In your JavaScript, you will need to tell jQuery to use JSONP. To do this, you need to append ?callback=? to the URL.

$.getJSON("http://localhost:8080/restws/json/product/get?callback=?",
   function(data) {
     alert(data);         
   });

If you use $.ajax, it will auto append the ?callback=? if you tell it to use jsonp.

$.ajax({ 
   type: "GET",
   dataType: "jsonp",
   url: "http://localhost:8080/restws/json/product/get",
   success: function(data){        
     alert(data);
   }
});

Under the circumstances, you're almost certainly better off skipping the check for self-assignment -- when you're only assigning one member that seems to be a simple type (probably a double), it's generally faster to do that assignment than avoid it, so you'd end up with:

SimpleCircle & SimpleCircle::operator=(const SimpleCircle & rhs)
{
    itsRadius = rhs.getRadius(); // or just `itsRadius = rhs.itsRadius;`
    return *this;
}

I realize that many older and/or lower quality books advise checking for self assignment. At least in my experience, however, it's sufficiently rare that you're better off without it (and if the operator depends on it for correctness, it's almost certainly not exception safe).

As an aside, I'd note that to define a circle, you generally need a center and a radius, and when you copy or assign, you want to copy/assign both.

As of Swift 4:

    button.setTitle("Click", for: .normal)

You can reference Microsoft.VisualBasic.dll.

Then using the code below.

Microsoft.VisualBasic.Interaction.InputBox("Question?","Title","Default Text");

Alternatively, by adding a using directive allowing for a shorter syntax in your code (which I'd personally prefer).

using Microsoft.VisualBasic;
...
Interaction.InputBox("Question?","Title","Default Text");

Or you can do what Pranay Rana suggests, that's what I would've done too...

Dispatcher Controller are displayed in the figure all the incoming request is in intercepted by the dispatcher servlet that works as front controller. The dispatcher servlet gets an entry to handler mapping from the XML file and forwords the request to the Controller.

This website is pretty good but not specific to Java: http://bigocheatsheet.com/

If you installed the SquashFS image you can run the script firstboot. That will return OpenWrt to the defaults of when you flashed the router.

With your serial access just run firstboot and then power cycle the device.

It's not fancy I known but you could use a callback class, create a hostbuilder and set the configuration to a static property.

For asp core 2.2:

using Microsoft.AspNetCore;
using Microsoft.AspNetCore.Builder;
using Microsoft.AspNetCore.Hosting;
using Microsoft.Extensions.Configuration;
using System;

namespace Project
{
    sealed class Program
    {
        #region Variables
        /// <summary>
        /// Last loaded configuration
        /// </summary>
        private static IConfiguration _Configuration;
        #endregion

        #region Properties
        /// <summary>
        /// Default application configuration
        /// </summary>
        internal static IConfiguration Configuration
        {
            get
            {
                // None configuration yet?
                if (Program._Configuration == null)
                {
                    // Create the builder using a callback class
                    IWebHostBuilder builder = WebHost.CreateDefaultBuilder().UseStartup<CallBackConfiguration>();

                    // Build everything but do not initialize it
                    builder.Build();
                }

                // Current configuration
                return Program._Configuration;
            }

            // Update configuration
            set => Program._Configuration = value;
        }
        #endregion

        #region Public
        /// <summary>
        /// Start the webapp
        /// </summary>
        public static void Main(string[] args)
        {
            // Create the builder using the default Startup class
            IWebHostBuilder builder = WebHost.CreateDefaultBuilder(args).UseStartup<Startup>();

            // Build everything and run it
            using (IWebHost host = builder.Build())
                host.Run();
        }
        #endregion


        #region CallBackConfiguration
        /// <summary>
        /// Aux class to callback configuration
        /// </summary>
        private class CallBackConfiguration
        {
            /// <summary>
            /// Callback with configuration
            /// </summary>
            public CallBackConfiguration(IConfiguration configuration)
            {
                // Update the last configuration
                Program.Configuration = configuration;
            }

            /// <summary>
            /// Do nothing, just for compatibility
            /// </summary>
            public void Configure(IApplicationBuilder app, IHostingEnvironment env)
            {
                //
            }
        }
        #endregion
    }
}

So now on you just use the static Program.Configuration at any other class you need it.

First of all you need to set the responseType to arraybuffer. This is required if you want to create a blob of your data. See Sending_and_Receiving_Binary_Data. So your code will look like this:

$http.post('/postUrlHere',{myParams}, {responseType:'arraybuffer'})
  .success(function (response) {
       var file = new Blob([response], {type: 'application/pdf'});
       var fileURL = URL.createObjectURL(file);
});

The next part is, you need to use the $sce service to make angular trust your url. This can be done in this way:

$scope.content = $sce.trustAsResourceUrl(fileURL);

Do not forget to inject the $sce service.

If this is all done you can now embed your pdf:

<embed ng-src="{{content}}" style="width:200px;height:200px;"></embed>

You should be able to do something like this in your respond_to block:

respond_to do |format|
    format.json 
    render :partial => "users/show.json"
end

which will render the template in app/views/users/_show.json.erb.

For grayscale as a percent in Firefox, use saturate filter instead: (search for 'saturate')

filter: url("data:image/svg+xml;utf8,<svg xmlns='http://www.w3.org/2000/svg'><filter id='saturate'><feColorMatrix in='SourceGraphic' type='saturate' values='0.2' /></filter></svg>#saturate"

Token based authentication is stateless, server need not store user information in the session. This gives ability to scale application without worrying where the user has logged in. There is web Server Framework affinity for cookie based while that is not an issue with token based. So the same token can be used for fetching a secure resource from a domain other than the one we are logged in which avoids another uid/pwd authentication.

Very good article here:

http://www.toptal.com/web/cookie-free-authentication-with-json-web-tokens-an-example-in-laravel-and-angularjs

Note that as others have pointed out mysql_real_escape_string() will solve the problem (as will addslashes), however you should always use mysql_real_escape_string() for security reasons - consider:

SELECT * FROM valid_users WHERE username='$user' AND password='$password'

What if the browser sends

user="admin' OR (user=''"
password="') AND ''='"

The query becomes:

SELECT * FROM valid_users 
WHERE username='admin' OR (user='' AND password='') AND ''=''

i.e. the security checks are completely bypassed.

C.

You can use select2 . it is the best js for this job.
https://select2.org/dropdown

$(document).ready(function () {_x000D_
//change selectboxes to selectize mode to be searchable_x000D_
   $("select").select2();_x000D_
});

<html>_x000D_
<head>_x000D_
<script src="https://cdnjs.cloudflare.com/ajax/libs/jquery/3.2.1/jquery.min.js"></script>_x000D_
<link href="https://cdn.jsdelivr.net/npm/[email protected]/dist/css/select2.min.css" rel="stylesheet" />_x000D_
<script src="https://cdn.jsdelivr.net/npm/[email protected]/dist/js/select2.min.js"></script>_x000D_
_x000D_
</head>_x000D_
<body>_x000D_
  <select id="select_page" style="width:200px;" class="operator"> _x000D_
         <option value="">Select a Page...</option>_x000D_
         <option value="alpha">alpha</option> _x000D_
         <option value="beta">beta</option>_x000D_
         <option value="theta">theta</option>_x000D_
         <option value="omega">omega</option>_x000D_
  </select>_x000D_
</body>_x000D_
</html>

The Color structure is immutable (as all structures should really be), meaning that the values of its properties cannot be changed once that particular instance has been created.

Instead, you need to create a new instance of the structure with the property values that you want. Since you want to create a color using its component RGB values, you need to use the FromArgb method:

Color myColor = Color.FromArgb(100, 150, 75);

Get all distinct id, name and address columns and count the resulting rows.

SELECT COUNT(*) FROM mytable GROUP BY id, name, address

How about:

df <- data.frame(matrix(ncol = 3, nrow = 0))
x <- c("name", "age", "gender")
colnames(df) <- x

To do all these operations in one-liner:

setNames(data.frame(matrix(ncol = 3, nrow = 0)), c("name", "age", "gender"))

#[1] name   age    gender
#<0 rows> (or 0-length row.names)

Or

data.frame(matrix(ncol=3,nrow=0, dimnames=list(NULL, c("name", "age", "gender"))))

With some help from another person, we figured out it was an issue of ordering the source files within the HTML file. I learned that browsers accept the first usable format, and their seems to be an issue with the .m4v file, so I started with the .mp4, then .webm. Here's the order that works in Safari (even on my iPhone 5), Firefox, and Chrome:

<video width="100%" height="400" poster="assets/img/myVideo.jpg" controls="controls" preload="none">
      <!-- MP4 for Safari, IE9, iPhone, iPad, Android, and Windows Phone 7 -->
      <source type="video/mp4" src="assets/vid/PhysicsEtoys.mp4" />
      <!-- WebM/VP8 for Firefox4, Opera, and Chrome -->
      <source type="video/webm" src="assets/vid/PhysicsEtoys.webm" />
       <!-- M4V for Apple -->
      <source type="video/mp4" src="assets/vid/PhysicsEtoys.m4v" />
      <!-- Ogg/Vorbis for older Firefox and Opera versions -->
      <source type="video/ogg" src="assets/vid/PhysicsEtoys.ogv" />
      <!-- Subtitles -->
      <track kind="subtitles" src="assets/vid/subtitles.srt" srclang="en" />
      <track kind="subtitles" src="assets/vid/subtitles.vtt" srclang="en" />
      <!-- Flash fallback for non-HTML5 browsers without JavaScript -->
      <object width="100%" height="400" type="application/x-shockwave-flash" data="flashmediaelement.swf">
          <param name="movie" value="flashmediaelement.swf" />
          <param name="flashvars" value="controls=true&file=assets/vid/PhysicsEtoys.mp4" />
          <!-- Image as a last resort -->
          <img src="assets/img/myVideo.jpg" width="320" height="240" title="No video playback capabilities" />
      </object>
  </video>

Now, I'll have to re-check the encoding on the m4v file (perhaps an issue of Baseline vs Main, High, etc.).

for block elements:

<textarea style="width:100px; word-wrap:break-word;">_x000D_
  ACTGATCGAGCTGAAGCGCAGTGCGATGCTTCGATGATGCTGACGATGCTACGATGCGAGCATCTACGATCAGTC_x000D_
</textarea>

for inline elements:

<span style="width:100px; word-wrap:break-word; display:inline-block;"> _x000D_
   ACTGATCGAGCTGAAGCGCAGTGCGATGCTTCGATGATGCTGACGATGCTACGATGCGAGCATCTACGATCAGTC_x000D_
</span>

There's no way of getting around issue #2. That's just the way the C compiler (and hence the Objective-C compiler) work. If you use the XCode editor, the function popup should make it easy to navigate the @interface and @implementation blocks in the file.

Or if you need to set the value of found:

found = Value1.StartsWith("abc")

Edit: Given your edit, I would do something like:

found = Value1.Substring(0, 5).Contains("abc")

I had the same issue. In my case it was caused by having to names for the same remote. It created the standard 'origin', but I've been using 'github' as my remote for a long time, so that was there too. As soon as I removed the 'origin' remote, the error went away.

use content in iframe with JS:

document.getElementById('id_iframe').contentWindow.document.write('content');

If you have a named container then it can be started by running

docker container start container_name

where container_name is name of the container that must be given at the time of creating container. You can replace container_name with the container id in case the container is not named. The container ID can be found by running:

docker ps -a

mysql_update is what you need.

I don't know why anyone would follow the more complex ways of correcting this issue, when MySql graciously built a tool that already does this...

What you show looks like a mesh warp. That would be straightforward using OpenGL, but "straightforward OpenGL" is like straightforward rocket science.

I wrote an iOS app for my company called Face Dancerthat's able to do 60 fps mesh warp animations of video from the built-in camera using OpenGL, but it was a lot of work. (It does funhouse mirror type changes to faces - think "fat booth" live, plus lots of other effects.)

$output = preg_replace('/\s+/', ' ',$input);

\s is shorthand for [ \t\n\r]. Multiple spaces will be replaced with single space.

Use css:

<style>
input[name=btnsubmit]:active {
color: green;
}
</style>

You should use textView.setGravity(Gravity.CENTER_HORIZONTAL);.

Remember that using

LinearLayout.LayoutParams layoutParams =new LinearLayout.LayoutParams(LayoutParams.MATCH_PARENT, LayoutParams.WRAP_CONTENT);
layoutParams2.gravity = Gravity.BOTTOM | Gravity.CENTER_HORIZONTAL;

won't work. This will set the gravity for the widget and not for it's text.

I got the same error in ReactJS function component, using ReactJS useState hook. The solution was to declare the type of useState at initialisation:

const [items , setItems] = useState<IItem[]>([]); // replace IItem[] with your own typing: string, boolean...

I wanted a flexible sticky footer, which is why I came here. Top answers got me in the right direction.

The current (2 Oct 16) Bootstrap 3 css Sticky footer (Fixed size) looks like this:

html {
  position: relative;
  min-height: 100%;
}
body {
  /* Margin bottom by footer height */
  margin-bottom: 60px;
}
.footer {
  position: absolute;
  bottom: 0;
  width: 100%;
  /* Set the fixed height of the footer here */
  height: 60px;
  background-color: #f5f5f5;
}

As long as the footer has a fixed size, the body margin-bottom creates a push to allow a pocket for the footer to sit in. In this case, both are set to 60px. But if the footer is not fixed and exceeds 60px height, it will cover your page content.

Make Flexible: Delete the css body margin and footer height. Then add JavaScript to get the footer height and set the body marginBottom. That is done with the setfooter() function. Next add event listeners for when the page first loads and on resizing that run the setfooter. Note: If you footer has an accordion or anything else that triggers a size change, without a resize of window, you must call the setfooter() function again.

Run the snippet and then fullscreen to demo it.

function setfooter(){_x000D_
 var ht = document.getElementById("footer").scrollHeight;_x000D_
 document.body.style.marginBottom = ht + "px";_x000D_
}_x000D_
_x000D_
window.addEventListener('resize', function(){_x000D_
  setfooter();_x000D_
 }, true);_x000D_
window.addEventListener('load', function(){_x000D_
 setfooter();_x000D_
}, true);

html {_x000D_
  position: relative;_x000D_
  min-height: 100%;_x000D_
}_x000D_
.footer {_x000D_
  position: absolute;_x000D_
  bottom: 0;_x000D_
  width: 100%;_x000D_
  _x000D_
  /* additional style for effect only */_x000D_
   text-align: center;_x000D_
    background-color: #333;_x000D_
    color: #fff;_x000D_
}_x000D_
  _x000D_
_x000D_
_x000D_
body{_x000D_
/* additional style for effect only not needed in bootstrap*/_x000D_
  padding:0;_x000D_
  margin: 0;_x000D_
  }

<div>_x000D_
  Page content_x000D_
  <br>  <br>_x000D_
  line 3_x000D_
  <br>  <br>_x000D_
  line 5_x000D_
  <br>  <br>_x000D_
  line 7_x000D_
  _x000D_
 </div>_x000D_
_x000D_
_x000D_
<footer id="footer" class="footer">_x000D_
      <div class="container">_x000D_
        <p class="text-muted">Footer with a long text, so that resizing, to a smaller screen size, will cause the footer to grow taller. But the footer will not overflow onto the main page.</p>_x000D_
      </div>_x000D_
    </footer>

Instead of editing the bringup service, add a post-start delay to the service which it depends on. Edit cassandra.service like so:

ExecStartPost=/bin/sleep 30

This way the added sleep shouldn't slow down restarts of starting services that depend on it (though does slow down its own start, maybe that's desirable?).

Instead of using the "c" tags, you could also do the following:

<h:outputLink value="Images/thumb_02.jpg" target="_blank" rendered="#{not empty user or user.userId eq 0}" />
<h:graphicImage value="Images/thumb_02.jpg" rendered="#{not empty user or user.userId eq 0}" />

<h:outputLink value="/DisplayBlobExample?userId=#{user.userId}" target="_blank" rendered="#{not empty user and user.userId neq 0}" />
<h:graphicImage value="/DisplayBlobExample?userId=#{user.userId}" rendered="#{not empty user and user.userId neq 0}"/>

I think that's a little more readable alternative to skuntsel's alternative answer and is utilizing the JSF rendered attribute instead of nesting a ternary operator. And off the answer, did you possibly mean to put your image in between the anchor tags so the image is clickable?

I've used Beej's Guide to Network Programming in the past. It's in C, not C++, but the examples are good. Go directly to section 6 for the simple client and server example programs.

Here is a simple function that returns true or false (has / doesn't have a hashtag):

var urlToCheck = 'http://www.domain.com/#hashtag';

function hasHashtag(url) {
    return (url.indexOf("#") != -1) ? true : false;
}

// Condition
if(hasHashtag(urlToCheck)) {
    // Do something if has
}
else {
    // Do something if doesn't
}

Returns true in this case.

Based on @jon-skeet's comment.

If post data is malformed, $_POST will not contain anything. Yet, php://input will have the malformed string.

For example there is some ajax applications, that do not form correct post key-value sequence for uploading a file, and just dump all the file as post data, without variable names or anything. $_POST will be empty, $_FILES empty also, and php://input will contain exact file, written as a string.

You can use NGBindHTML or NGbindHtmlUnsafe this will not escape the html content of your model.

http://jsfiddle.net/n9rQr/

<div ng-app ng-controller="MyCtrl">
    <ul>
    <li ng-repeat=" opt in opts"  ng-bind-html-unsafe="opt.text">
        {{ opt.text }}
    </li>
    </ul>

    <p>{{opt}}</p>
</div>

This works, anyway you should be very careful when using unsanitized html content, you should really trust the source of the content.

I ran into this problem and inspired by @Jeremy Cook's answer, I bit the bullet to find out what the heck caused IIS 7 Integrated mode to not like my web.config. Here's my scenario:

1. Web API (version 4.0.030506.0 aka the old one)
2. .NET 4.0
3. Attribute Routing 3.5.6 for Web API [spoiler alert: it was this guy!]

I wanted to use attribute routing in a project that (unfortunately) had to use .NET 4 and hence could not use Web API 2.2 (which needs .NET 4.5). The well meaning NuGet package added this section under the <system.web> section:

<system.web>
<httpHandlers>
      <add verb="*" path="routes.axd" type="AttributeRouting.Web.Logging.LogRoutesHandler, AttributeRouting.Web" />
    </httpHandlers>
</system.web>

[I say well meaning, because this part is required on older versions of IIS]

Removing this section got me past the HTTP 500.23!!

Summary: I second Jeremy's words that it is important to understand why things don't work rather than just "masking the symptom". Even if you have to mask the symptom, you know what you are doing (and why) :-)

.card-img-top {
width: 100%;
height: 40vh;
object-fit: cover;
}

As shown above but when you add height i suggest using "vh" (Viewport Height units) for a more mobile-friendly experience.

I believe the more modern and simpler way to do this now is hg uncommit. Note this leaves behind an empty commit which can be useful if you want to reuse the commit message later. If you don't, use hg uncommit --no-keep to not leave the empty commit.

hg uncommit [OPTION]... [FILE]...

uncommit part or all of a local changeset

This command undoes the effect of a local commit, returning the affected
files to their uncommitted state. This means that files modified or
deleted in the changeset will be left unchanged, and so will remain
modified in the working directory.

If no files are specified, the commit will be left empty, unless --no-keep

Sorry, I am not sure what the equivalent is TortoiseHg.

This can be done through the youtube player API:

http://jsfiddle.net/7Gznb/

Working example:

    <div id="player"></div>

    <script src="http://www.youtube.com/player_api"></script>

    <script>

        // create youtube player
        var player;
        function onYouTubePlayerAPIReady() {
            player = new YT.Player('player', {
              width: '640',
              height: '390',
              videoId: '0Bmhjf0rKe8',
              events: {
                onReady: onPlayerReady,
                onStateChange: onPlayerStateChange
              }
            });
        }

        // autoplay video
        function onPlayerReady(event) {
            event.target.playVideo();
        }

        // when video ends
        function onPlayerStateChange(event) {        
            if(event.data === 0) {          
                alert('done');
            }
        }

    </script>

Get the process object using the Process.

>>> import psutil
>>> p = psutil.Process(23442)
>>> p
psutil.Process(pid=23442, name='python3.6', started='09:24:16')
>>> p.kill()
>>> 

In this case, the most proper way to exit the application in to override onExit() method in App.xaml.cs:

protected override void OnExit(ExitEventArgs e) {
    base.OnExit(e); 
}

You are getting Floating point exception because Number % i, when i is 0:

int Is_Prime( int Number ){

  int i ;

  for( i = 0 ; i < Number / 2 ; i++ ){

    if( Number % i != 0 ) return -1 ;

  }

  return Number ;

}

Just start the loop at i = 2. Since i = 1 in Number % i it always be equal to zero, since Number is a int.

Swift 2 Version

As @Johan Karlsson pointed out... I was doing it wrong. Here's the proper way to send and receive information with NSNotificationCenter.

First, we look at the initializer for postNotificationName:

init(name name: String,
   object object: AnyObject?,
 userInfo userInfo: [NSObject : AnyObject]?)

source

We'll be passing our information using the userInfo param. The [NSObject : AnyObject] type is a hold-over from Objective-C. So, in Swift land, all we need to do is pass in a Swift dictionary that has keys that are derived from NSObject and values which can be AnyObject.

With that knowledge we create a dictionary which we'll pass into the object parameter:

 var userInfo = [String:String]()
 userInfo["UserName"] = "Dan"
 userInfo["Something"] = "Could be any object including a custom Type."

Then we pass the dictionary into our object parameter.

Sender

NSNotificationCenter.defaultCenter()
    .postNotificationName("myCustomId", object: nil, userInfo: userInfo)

Receiver Class

First we need to make sure our class is observing for the notification

override func viewDidLoad() {
    super.viewDidLoad()

    NSNotificationCenter.defaultCenter().addObserver(self, selector: Selector("btnClicked:"), name: "myCustomId", object: nil)   
}
    

Then we can receive our dictionary:

func btnClicked(notification: NSNotification) {
   let userInfo : [String:String!] = notification.userInfo as! [String:String!]
   let name = userInfo["UserName"]
   print(name)
}

For Schema related stuff

Model.column_names         
Model.columns_hash         
Model.columns 

For instance variables/attributes in an AR object

object.attribute_names                    
object.attribute_present?          
object.attributes

For instance methods without inheritance from super class

Model.instance_methods(false)

late in the game , but this worked for me:

$("#container>table>tbody>tr:first").trigger('click');

A good place to look at is the man page of bash. Here's an online version. Look for "INVOCATION" section.

@Jay Mooney: A generic Dictionary class in .NET is actually a hash table, just with fixed types.

The code you've shown shouldn't convince anyone to use Hashtable instead of Dictionary, since both code pieces can be used for both types.

For hashtable:

foreach(object key in h.keys)
{
     string keyAsString = key.ToString(); // btw, this is unnecessary
     string valAsString = h[key].ToString();

     System.Diagnostics.Debug.WriteLine(keyAsString + " " + valAsString);
}

For dictionary:

foreach(string key in d.keys)
{
     string valAsString = d[key].ToString();

     System.Diagnostics.Debug.WriteLine(key + " " + valAsString);
}

And just the same for the other one with KeyValuePair, just use the non-generic version for Hashtable, and the generic version for Dictionary.

So it's just as easy both ways, but Hashtable uses Object for both key and value, which means you will box all value types, and you don't have type safety, and Dictionary uses generic types and is thus better.

Your code is working fine using bootatrap v3.3.7, but you can use word-break: break-word if it's not working at your end.

which would then look like this -

<html>_x000D_
_x000D_
<head>_x000D_
    <link rel="stylesheet" href="https://maxcdn.bootstrapcdn.com/bootstrap/3.3.7/css/bootstrap.min.css"_x000D_
        integrity="sha384-BVYiiSIFeK1dGmJRAkycuHAHRg32OmUcww7on3RYdg4Va+PmSTsz/K68vbdEjh4u" crossorigin="anonymous">_x000D_
</head>_x000D_
_x000D_
<body>_x000D_
    <div class="row" style="box-shadow: 0 0 30px black;">_x000D_
        <div class="col-6 col-sm-6 col-lg-4">_x000D_
            <h3 style="word-break: break-word;">2005 Volkswagen Jetta 2.5 Sedan (worcester http://www.massmotorcars.com)_x000D_
                $6900</h3>_x000D_
            <p>_x000D_
                <small>2005 volkswagen jetta 2.5 for sale has 110,000 miles powere doors,power windows,has ,car drives_x000D_
                    excellent ,comes with warranty if you&#39;re ...</small>_x000D_
            </p>_x000D_
            <p>_x000D_
                <a class="btn btn-default" href="/search/1355/detail/" role="button">View details &raquo;</a>_x000D_
                <button type="button" class="btn bookmark" id="1355">_x000D_
                    <span class="_x000D_
                      glyphicon glyphicon-star-empty "></span>_x000D_
                </button>_x000D_
            </p>_x000D_
        </div>_x000D_
        <!--/span-->_x000D_
        <div class="col-6 col-sm-6 col-lg-4">_x000D_
            <h3 style="word-break: break-word;">2006 Honda Civic EX Sedan (Worcester www.massmotorcars.com) $7950</h3>_x000D_
            <p>_x000D_
                <small>2006 honda civic ex has 110,176 miles, has power doors ,power windows,sun roof,alloy wheels,runs_x000D_
                    great, cd player, 4 cylinder engen, ...</small>_x000D_
            </p>_x000D_
            <p>_x000D_
                <a class="btn btn-default" href="/search/1356/detail/" role="button">View details &raquo;</a>_x000D_
                <button type="button" class="btn bookmark" id="1356">_x000D_
                    <span class="_x000D_
                      glyphicon glyphicon-star-empty "></span>_x000D_
                </button>_x000D_
            </p>_x000D_
_x000D_
        </div>_x000D_
        <!--/span-->_x000D_
        <div class="col-6 col-sm-6 col-lg-4">_x000D_
            <h3 style="word-break: break-word;">2004 Honda Civic LX Sedan (worcester www.massmotorcars.com) $5900</h3>_x000D_
            <p>_x000D_
                <small>2004 honda civic lx sedan has 134,000 miles, great looking car, interior and exterior looks_x000D_
                    nice,has_x000D_
                    cd player, power windows ...</small>_x000D_
            </p>_x000D_
            <p>_x000D_
                <a class="btn btn-default" href="/search/1357/detail/" role="button">View details &raquo;</a>_x000D_
                <button type="button" class="btn bookmark" id="1357">_x000D_
                    <span class="_x000D_
                      glyphicon glyphicon-star-empty "></span>_x000D_
                </button>_x000D_
            </p>_x000D_
        </div>_x000D_
    </div>_x000D_
</body>_x000D_
_x000D_
</html>

I call it "positional expansion", as opposed to ** which I call "keyword expansion".

Add environment variable for Android Home Targetting Platform Tools

echo 'export ANDROID_HOME=/Users/$USER/Library/Android/sdk' >> ~/.bash_profile

echo 'export PATH=${PATH}:$ANDROID_HOME/tools:$ANDROID_HOME/platform-tools' >> ~/.bash_profile

Restart Bash

source ~/.bash_profile

Now Check adb

Simply type

adb

on terminal

There are two BeanUtils.copyProperties(parameter1, parameter2) in Java.

One is

org.apache.commons.beanutils.BeanUtils.copyProperties(Object dest, Object orig)

Another is

org.springframework.beans.BeanUtils.copyProperties(Object source, Object target)

Pay attention to the opposite position of parameters.

Here is an example , How to search images in a document by src attribute :

document.querySelectorAll("img[src='https://pbs.twimg.com/profile_images/........jpg']");

Here you go:

public static void main(String[] args) throws ParseException {

        SimpleDateFormat sdf = new SimpleDateFormat("MM/dd/yyyy");

        String oeStartDateStr = "04/01/";
        String oeEndDateStr = "11/14/";

        Calendar cal = Calendar.getInstance();
        Integer year = cal.get(Calendar.YEAR);

        oeStartDateStr = oeStartDateStr.concat(year.toString());
        oeEndDateStr = oeEndDateStr.concat(year.toString());

        Date startDate = sdf.parse(oeStartDateStr);
        Date endDate = sdf.parse(oeEndDateStr);
        Date d = new Date();
        String currDt = sdf.format(d);


        if((d.after(startDate) && (d.before(endDate))) || (currDt.equals(sdf.format(startDate)) ||currDt.equals(sdf.format(endDate)))){
            System.out.println("Date is between 1st april to 14th nov...");
        }
        else{
            System.out.println("Date is not between 1st april to 14th nov...");
        }
    }

see here: Java Tool Doc, it says,

-Xmxn
Specify the maximum size, in bytes, of the memory allocation pool. This value must a multiple of 1024 greater than 2MB. Append the letter k or K to indicate kilobytes, or m or M to indicate megabytes. The default value is 64MB. The upper limit for this value will be approximately 4000m on Solaris 7 and Solaris 8 SPARC platforms and 2000m on Solaris 2.6 and x86 platforms, minus overhead amounts. Examples:

           -Xmx83886080
           -Xmx81920k
           -Xmx80m

So, in simple words, you are setting Java heap memory to a maximum of 1024 MB from the available memory, not more.

Notice there is NO SPACE between -Xmx and 1024m

It does not matter if you use uppercase or lowercase. For example: "-Xmx10G" and "-Xmx10g" do the exact same thing.

Here's what I'm using :

.text_with_1px_border
{
    text-shadow: 
        -1px -1px 0px #000,
         0px -1px 0px #000,
         1px -1px 0px #000,
        -1px  0px 0px #000,
         1px  0px 0px #000,
        -1px  1px 0px #000,
         0px  1px 0px #000,
         1px  1px 0px #000;
}

.text_with_2px_border
{
    text-shadow: 
        /* first layer at 1px */
        -1px -1px 0px #000,
         0px -1px 0px #000,
         1px -1px 0px #000,
        -1px  0px 0px #000,
         1px  0px 0px #000,
        -1px  1px 0px #000,
         0px  1px 0px #000,
         1px  1px 0px #000,
        /* second layer at 2px */
        -2px -2px 0px #000,
        -1px -2px 0px #000,
         0px -2px 0px #000,
         1px -2px 0px #000,
         2px -2px 0px #000,
         2px -1px 0px #000,
         2px  0px 0px #000,
         2px  1px 0px #000,
         2px  2px 0px #000,
         1px  2px 0px #000,
         0px  2px 0px #000,
        -1px  2px 0px #000,
        -2px  2px 0px #000,
        -2px  1px 0px #000,
        -2px  0px 0px #000,
        -2px -1px 0px #000;
}

Remember that stringToEdit.replaceAll(String, String) returns the result string. It doesn't modify stringToEdit because Strings are immutable in Java. To get any change to stick, you should use

stringToEdit = stringToEdit.replaceAll("'", "\\'");

Here is a working plunkr with a filter and sortBy pipe. https://plnkr.co/edit/vRvnNUULmBpkbLUYk4uw?p=preview

As developer033 mentioned in a comment, you are passing in a single value to the filter pipe, when the filter pipe is expecting an array of values. I would tell the pipe to expect a single value instead of an array

export class FilterPipe implements PipeTransform {
    transform(items: any[], term: string): any {
        // I am unsure what id is here. did you mean title?
        return items.filter(item => item.id.indexOf(term) !== -1);
    }
}

I would agree with DeborahK that impure pipes should be avoided for performance reasons. The plunkr includes console logs where you can see how much the impure pipe is called.

If you're dealing with a single element preferably you should use the id selector as stated on GenericTypeTea answer and get the name like $("#id").attr("name");.

But if you want, as I did when I found this question, a list with all the input names of a specific class (in my example a list with the names of all unchecked checkboxes with .selectable-checkbox class) you could do something like:

var listOfUnchecked = $('.selectable-checkbox:unchecked').toArray().map(x=>x.name);

or

var listOfUnchecked = [];
$('.selectable-checkbox:unchecked').each(function () {
    listOfUnchecked.push($(this).attr('name'));
});

An IP gives you an quite unreliable location, you could Ajax the location upon load with JS if it isn't critical to have the location at first. (Also, the user need's to give you it's permission to access it.)

Html5 Geolocation

The .success syntax was correct up to Angular v1.4.3.

For versions up to Angular v.1.6, you have to use then method. The then() method takes two arguments: a success and an error callback which will be called with a response object.

Using the then() method, attach a callback function to the returned promise.

Something like this:

app.controller('MainCtrl', function ($scope, $http){
   $http({
      method: 'GET',
      url: 'api/url-api'
   }).then(function (response){

   },function (error){

   });
}

See reference here.

Shortcut methods are also available.

$http.get('api/url-api').then(successCallback, errorCallback);

function successCallback(response){
    //success code
}
function errorCallback(error){
    //error code
}

The data you get from the response is expected to be in JSON format. JSON is a great way of transporting data, and it is easy to use within AngularJS

The major difference between the 2 is that .then() call returns a promise (resolved with a value returned from a callback) while .success() is more traditional way of registering callbacks and doesn't return a promise.

As to me, easier: (int) (a +.5) // a is a Float. Return rounded value.

Not dependent on Java Math.round() types

in input field make name same like

<input type="radio" name="option" value="option1">
<input type="radio" name="option" value="option2" >
<input type="radio" name="option" value="option3" >
<input type="radio" name="option" value="option3" >

If the texts has different sizes and they must be underlined this is the solution:

<table>
  <tr>
    <td class='left'>January</td>
    <td class='right'>2014</td>
  </tr>
</table>

css:

table{
    width: 100%;
    border-bottom: 2px solid black;
    /*this is the size of the small text's baseline over part  (˜25px*3/4)*/
    line-height: 19.5px; 
}
table td{
    vertical-align: baseline;
}
.left{
    font-family: Arial;
    font-size: 40px;
    text-align: left;

}
.right{
    font-size: 25px;
    text-align: right;
}

demo here

So, your input is 'dan|warrior|54' and you want "warrior". You do this like so:

>>> dan = 'dan|warrior|54'
>>> dan.split('|')[1]
"warrior"

If you know you're on bash, and still get this error, make sure you write the if with spaces.

[[1==1]] # This outputs error

[[ 1==1 ]] # OK

Without group by SUM(NVL(regular, 0) + NVL(overtime, 0)) will thrown an error and to avoid this we can simply use NVL(regular, 0) + NVL(overtime, 0)

I don't think that the hasEventListener plugin mentioned will handle custom events e.g.

var obj = {id:'test'};
$(obj).bind('custom', function(){
    alert('custom');
}).trigger('custom');

alert($(obj).hasEventListener('custom'));

Also, at least in jQuery 1.5 I think you need to be careful using $(target).data('events') because it returns differently for events that have been bound to objects as above.

You need to do something like:

var events = $(target).data("events");
if(typeof events === "function"){
   events = events.events;
}

I am using this sort of approach and it works but it feels a bit like I am at the mercy of jquery internals and that really I shouldn't be doing it!

Yes, there is a way. Its called custom fonts in CSS.Your CSS needs to be modified, and you need to upload those fonts to your website.

The CSS required for this is:

@font-face {
     font-family: Thonburi-Bold;
     src: url('pathway/Thonburi-Bold.otf'); 
}

Just use this code

QPixmap pixmap("path_to_icon");
QIcon iconBack(pixmap);

Note that:"path_to_icon" is the path of image icon in file .qrc of your project You can find how to add .qrc file here

Try adding the following line at the top of your python script.

# _*_ coding:utf-8 _*_

So there's loads of posts on the web that show how to do this, I've found 3 ways, same as pointed out by Johan & Sjoerd. I couldn't get any of these queries to work, well obviously they work fine it's my database that's not working correctly and those queries all ran slow.

So I worked out another way that someone else may find useful:

The basic jist of it is to create a temporary table and fill it with all the information, then remove all the rows that ARE in the other table.

So I did these 3 queries, and it ran quickly (in a couple moments).

CREATE TEMPORARY TABLE

`database1`.`newRows`

SELECT

`t1`.`id` AS `columnID`

FROM

`database2`.`table` AS `t1`

.

CREATE INDEX `columnID` ON `database1`.`newRows`(`columnID`)

.

DELETE FROM `database1`.`newRows`

WHERE

EXISTS(
    SELECT `columnID` FROM `database1`.`product_details` WHERE `columnID`=`database1`.`newRows`.`columnID`
)

var option_user_selection = document.getElementById("maincourse").options[document.getElementById("maincourse").selectedIndex ].text

The only way to retrieve the correct value in your context is to run $.ajax() function synchronously (what actually contradicts to main AJAX idea). There is the special configuration attribute async you should set to false. In that case the main scope which actually contains $.ajax() function call is paused until the synchronous function is done, so, the return is called only after $.ajax().

function doSomething() {
    var status = 0;
    $.ajax({
        url: 'action.php',
        type: 'POST',
        data: dataString,
        async: false,
        success: function (txtBack) {
            if (txtBack == 1)
                status = 1;
        }
    });

    return status;
}

var response = doSomething();

$_SERVER['REQUEST_URI']

For more details on what info is available in the $_SERVER array, see the PHP manual page for it.

If you also need the query string (the bit after the ? in a URL), that part is in this variable:

$_SERVER['QUERY_STRING']

After trying as many of the other answers as were applicable in my situation and having no luck with any of them, I went into the properties for the Web project (the server-side project for a Silverlight app using RIA Services), clicked on the "Web" tab and changed the selected Server from "Local IIS" to "IIS Express". (Note I'm using VS2013.) This solved the problem. Application_Start executes under "IIS Express" but not under "Local IIS". Interesting...

Your question is a bit vague about what you are actually thinking about doing. "Cloud computing" can mean almost anything. If you're looking for languages with specific cloud computing advantages, Java has several because it's a compiled language that compiles to operating-system independent byte code.

I also chime in with the others about C++ being a low-level language. Yes, it is. But you're always going to have more than just the C++ language. If you separate both Java and C++ from the classes that come with them, Java and C++ are extremely similar. You have to adopt some rigid criterion like "pointers = low-level, garbage collection = high-level" to make the distinction stick. (And, of course, you can make pointers smart and invisible in C++ and you can use garbage collection in C++ too if you want to.)

The <ul> element has browser inherent padding & margin by default. In your case, Use

#footer ul {
    margin: 0; /* To remove default bottom margin */ 
    padding: 0; /* To remove default left padding */
}

or a CSS browser reset ( https://cssreset.com/ ) to deal with this.

It depends on what next is.

If it's a string (as in your example), then in checks for substrings.

>>> "in" in "indigo"
True
>>> "in" in "violet"
False
>>> "0" in "10"
True
>>> "1" in "10"
True

If it's a different kind of iterable (list, tuple, set, dictionary...), then in checks for membership.

>>> "in" in ["in", "out"]
True
>>> "in" in ["indigo", "violet"]
False

In a dictionary, membership is seen as "being one of the keys":

>>> "in" in {"in": "out"}
True
>>> "in" in {"out": "in"}
False

May I suggest that you initialize your "max and min so far" variables not to infinity, but to the first number in the array?

I think you want to specify

-H "Content-Type:text/xml"

with a colon, not an equals.

First, it's usually better to be explicit about your intent. So if you know the string ends in .rtf, and you want to remove that .rtf, you can just use var2=${var%.rtf}. One potentially-useful aspect of this approach is that if the string doesn't end in .rtf, it is not changed at all; var2 will contain an unmodified copy of var.

If you want to remove a filename suffix but don't know or care exactly what it is, you can use var2=${var%.*} to remove everything starting with the last .. Or, if you only want to keep everything up to but not including the first ., you can use var2=${var%%.*}. Those options have the same result if there's only one ., but if there might be more than one, you get to pick which end of the string to work from. On the other hand, if there's no . in the string at all, var2 will again be an unchanged copy of var.

If you really want to always remove a specific number of characters, here are some options.

You tagged this bash specifically, so we'll start with bash builtins. The one which has worked the longest is the same suffix-removal syntax I used above: to remove four characters, use var2=${var%????}. Or to remove four characters only if the first one is a dot, use var2=${var%.???}, which is like var2=${var%.*} but only removes the suffix if the part after the dot is exactly three characters. As you can see, to count characters this way, you need one question mark per unknown character removed, so this approach gets unwieldy for larger substring lengths.

An option in newer shell versions is substring extraction: var2=${var:0:${#var}-4}. Here you can put any number in place of the 4 to remove a different number of characters. The ${#var} is replaced by the length of the string, so this is actually asking to extract and keep (length - 4) characters starting with the first one (at index 0). With this approach, you lose the option to make the change only if the string matches a pattern; no matter what the actual value of the string is, the copy will include all but its last four characters.

Bash lets you leave the start index out; it defaults to 0, so you can shorten that to just var2=${var::${#var}-4}. In fact, newer versions of bash (specifically 4+, which means the one that ships with MacOS won't work) recognize negative lengths as end indexes counting back from the end of the string, so you can get rid of the string-length expression, too: var2=${var::-4}.

If you're not actually using bash but some other POSIX-type shell, the pattern-based suffix removal with % will still work – even in plain old dash, where the index-based substring extraction won't. Ksh and zsh do both support substring extraction, but require the explicit 0 start index; zsh also supports the negative end index, while ksh requires the length expression. Note that zsh, which indexes arrays starting at 1, nonetheless indexes strings starting at 0 if you use this bash-compatible syntax; but you can also treat parameters as arrays of characters, in which case it uses a 1-based count and expects a start and inclusive end position in brackets: var2=$var[1,-5].

Instead of using built-in shell parameter expansion, you can of course run some utility program to modify the string and capture its output with command substitution. There are several commands that will work; one is var2=$(sed 's/.\{4\}$//' <<<"$var").

What Chad says, except its better to use .keyup in this case because with .keydown and .keypress the value of the input is still the older value i.e. the newest key pressed would not be reflected if .val() is called.

This should probably be a comment on Chad's answer but I dont have privileges to comment yet.

I had the same issue while adding firebase to my Ionic App. To fix the issue I followed these steps:

npm install @angular/fire firebase --save

In my app/app.module.ts:

...
import { AngularFireModule } from '@angular/fire';
import { environment } from '../environments/environment';
import { AngularFirestoreModule, SETTINGS } from '@angular/fire/firestore';

@NgModule({
  declarations: [AppComponent],
  entryComponents: [],
  imports: [
    BrowserModule, 
    AppRoutingModule,
    AngularFireModule.initializeApp(environment.firebase),
    AngularFirestoreModule
  ],
  providers: [
    { provide: SETTINGS, useValue: {} }
  ],
  bootstrap: [AppComponent]
})

Previously we used FirestoreSettingsToken instead of SETTINGS. But that bug got resolved, now we use SETTINGS. (link)

In my app/services/myService.ts I imported as:

import { AngularFirestore } from "@angular/fire/firestore";

For some reason vscode was importing it as "@angular/fire/firestore/firestore";I After changing it for "@angular/fire/firestore"; the issue got resolved!

(('a a a').match(/b/g) || []).length; // 0
(('a a a').match(/a/g) || []).length; // 3

Based on https://stackoverflow.com/a/48195124/16777 but fixed to actually work in zero-results case.

To delete the last output only:

? + L

To clear the terminal completely:

? + K

I use often abstract classes in conjuction with Template method pattern.
In main abstract class I wrote the skeleton of main algorithm and make abstract methods as hooks where suclasses can make a specific implementation; I used often when writing data parser (or processor) that need to read data from one different place (file, database or some other sources), have similar processing step (maybe small differences) and different output.
This pattern looks like Strategy pattern but it give you less granularity and can degradated to a difficult mantainable code if main code grow too much or too exceptions from main flow are required (this considerations came from my experience).
Just a small example:

abstract class MainProcess {
  public static class Metrics {
    int skipped;
    int processed;
    int stored;
    int error;
  }
  private Metrics metrics;
  protected abstract Iterator<Item> readObjectsFromSource();
  protected abstract boolean storeItem(Item item);
  protected Item processItem(Item item) {
    /* do something on item and return it to store, or null to skip */
    return item;
  }
  public Metrics getMetrics() {
    return metrics;
  }
  /* Main method */
  final public void process() {
    this.metrics = new Metrics();
    Iterator<Item> items = readObjectsFromSource();
    for(Item item : items) {
      metrics.processed++;
      item = processItem(item);
      if(null != item) {

        if(storeItem(item))
          metrics.stored++;
        else
          metrics.error++;
      }
      else {
        metrics.skipped++;
      }
    }
  } 
}

class ProcessFromDatabase extends MainProcess {
  ProcessFromDatabase(String query) {
    this.query = query;
  }
  protected Iterator<Item> readObjectsFromSource() {
    return sessionFactory.getCurrentSession().query(query).list();
  }
  protected boolean storeItem(Item item) {
    return sessionFactory.getCurrentSession().saveOrUpdate(item);
  }
}

Here another example.

Use this

tvHide.setPaintFlags(tvHide.getPaintFlags() | Paint.UNDERLINE_TEXT_FLAG);

if you aren't yet using .net 4.5:

/// <summary>
/// TODO: AFTER WE UPGRADE TO .NET 4.5 THIS WILL NO LONGER BE NECESSARY.
/// </summary>
public class EmailAnnotation : RegularExpressionAttribute
{
    static EmailAnnotation()
    {
        DataAnnotationsModelValidatorProvider.RegisterAdapter(typeof(EmailAnnotation), typeof(RegularExpressionAttributeAdapter));
    }

    /// <summary>
    /// from: http://stackoverflow.com/a/6893571/984463
    /// </summary>
    public EmailAnnotation()
        : base(@"^[\w!#$%&'*+\-/=?\^_`{|}~]+(\.[\w!#$%&'*+\-/=?\^_`{|}~]+)*"
            + "@"
            + @"((([\-\w]+\.)+[a-zA-Z]{2,4})|(([0-9]{1,3}\.){3}[0-9]{1,3}))$") { }

    public override string FormatErrorMessage(string name)
    {
        return "E-mail is not valid";
    }
}

Then you can do this:

    public class ContactEmailAddressDto
    {
        public int ContactId { get; set; }
        [Required]
        [Display(Name = "New Email Address")]
        [EmailAnnotation] //**<----- Nifty.**
        public string EmailAddressToAdd { get; set; }
    }

just use a property

int  _theVariable;
public int TheVariable{
  get{return _theVariable;}
  set{
    _theVariable = value; 
    if ( _theVariable == 1){
      //Do stuff here.
    }
  }
}

When adding a column you need to make that column an integer and if possible stick with rails conventions. So for your case I am assuming you already have a Tester and User models, and testers and users tables.

To add the foreign key you need to create an integer column with the name user_id (convention):

add_column :tester, :user_id, :integer

Then add a belongs_to to the tester model:

class Tester < ActiveRecord::Base
  belongs_to :user
end

And you might also want to add an index for the foreign key (this is something the references already does for you):

add_index :tester, :user_id

Error 127 means one of two things:

1. file not found: the path you're using is incorrect. double check that the program is actually in your $PATH, or in this case, the relative path is correct -- remember that the current working directory for a random terminal might not be the same for the IDE you're using. it might be better to just use an absolute path instead.
2. ldso is not found: you're using a pre-compiled binary and it wants an interpreter that isn't on your system. maybe you're using an x86_64 (64-bit) distro, but the prebuilt is for x86 (32-bit). you can determine whether this is the answer by opening a terminal and attempting to execute it directly. or by running file -L on /bin/sh (to get your default/native format) and on the compiler itself (to see what format it is).

if the problem is (2), then you can solve it in a few diff ways:

1. get a better binary. talk to the vendor that gave you the toolchain and ask them for one that doesn't suck.
2. see if your distro can install the multilib set of files. most x86_64 64-bit distros allow you to install x86 32-bit libraries in parallel.
3. build your own cross-compiler using something like crosstool-ng.
4. you could switch between an x86_64 & x86 install, but that seems a bit drastic ;).

If you are looking for a quick and manual process with UI. I always use Mozilla Firefox to convert from PFX to P12. First import the certificate into the Firefox browser (Options > Privacy & Security > View Certificates... > Import...). Once installed, perform the export to create the P12 file by choosing the certificate name from the Certificate Manager and then click Backup... and enter the file name and then enter the password.

if you dont wanna use DISTINCT use GROUP BY

 SELECT * FROM myTABLE GROUP BY EmailAddress

If you have Qt/KDE installed, you can use kdialog, which pops up a Qt dialog window. You can easily specify to display a Yes/No dialog, OK/Cancel, simple text input, password input etc. You then have access to the return values from these dialogs at the shell.

This happens because firewall blocks the database connection.

Disable the firewall and then try running the program again. It worked for me... :D

You need to use a pointer to a member function, not just a pointer to a function.

class A { 
    int f() { return 1; }
public:
    int (A::*x)();

    A() : x(&A::f) {}
};

int main() { 
   A a;
   std::cout << (a.*a.x)();
   return 0;
}

Candidate Key: The candidate key can be defined as minimal set of attribute which can uniquely identify a tuple is known as candidate key. For Example, STUD_NO in below STUDENT relation.

• The value of Candidate Key is unique and non-null for every tuple.
• There can be more than one candidate key in a relation. For Example, STUD_NO as well as STUD_PHONE both are candidate keys for relation STUDENT.
• The candidate key can be simple (having only one attribute) or composite as well. For Example, {STUD_NO, COURSE_NO} is a composite
  candidate key for relation STUDENT_COURSE.

Super Key: The set of attributes which can uniquely identify a tuple is known as Super Key. For Example, STUD_NO, (STUD_NO, STUD_NAME) etc. Adding zero or more attributes to candidate key generates super key. A candidate key is a super key but vice versa is not true. Primary Key: There can be more than one candidate key in a relation out of which one can be chosen as primary key. For Example, STUD_NO as well as STUD_PHONE both are candidate keys for relation STUDENT but STUD_NO can be chosen as primary key (only one out of many candidate keys).

Alternate Key: The candidate key other than primary key is called as alternate key. For Example, STUD_NO as well as STUD_PHONE both are candidate keys for relation STUDENT but STUD_PHONE will be alternate key (only one out of many candidate keys).

Foreign Key: If an attribute can only take the values which are present as values of some other attribute, it will be foreign key to the attribute to which it refers. The relation which is being referenced is called referenced relation and corresponding attribute is called referenced attribute and the relation which refers to referenced relation is called referencing relation and corresponding attribute is called referencing attribute. Referenced attribute of referencing attribute should be primary key. For Example, STUD_NO in STUDENT_COURSE is a foreign key to STUD_NO in STUDENT relation.

I am going to assume you were having the same issue I was. Even though you specify larger sizes for the TextBox and mark it as important, the box would not get larger. That is likely because in your site.css file the MaxWidth is being set to 280px.

Add a style attribute to your input to remove the MaxWidth like this:

<input type="text"  style="max-width:none !important" class="input-medium">

<a [routerLink]="['../']" [queryParams]="{name: 'ferret'}" [fragment]="nose">Ferret Nose</a>

foo://example.com:8042/over/there?name=ferret#nose
\_/   \______________/\_________/ \_________/ \__/
 |           |            |            |        |
scheme    authority      path        query   fragment

For more info - https://angular.io/guide/router#query-parameters-and-fragments

As others have said, this is bad practice, but if you don't have a choice because you need to integrate with a third-party library that uses the default package, then you could create your own class in the default package and access the other class that way. Classes in the default package basically share a single namespace, so you can access the other class even if it resides in a separate JAR file. Just make sure the JAR file is in the classpath.

This trick doesn't work if your class is not in the default package.

I'm surprised that the answers here got so many upvotes when none of them really answer the question. Here's how to make sure that ONLY LATIN characters are in a given string.

const hasOnlyLetters = !!value.match(/^[a-z]*$/i);

The !! takes transforms something that's not boolean into a boolean value. (It's exactly the same as applying a ! twice, and in fact you can use as many ! as you'd like to toggle the truthiness multiple times.)

As for the RegEx, here's the breakdown.

• /.../i The delimiter is a / and the i means to assess the statement in a case-insensitive fashion.
• ^...$ The ^ means to look at the very beginning of a string. The $ means to look at the end of the string, and when used together, it means to consider the entire string. You can add more to the RegEx outside of these boundaries for things like appending/prepending a required suffix or prefix.
• [a-z]*This part says to look for all lowercase letters. (The case-insensitive modifier means that we don't need to look at uppercase letters, too.) The * at the end says that we should match whats in the brackets any number of times. That way "abc" will match instead of just "a" or "b", and so forth.

To ask permission for the photo app you need to add this code (Swift 3):

PHPhotoLibrary.requestAuthorization({ 
       (newStatus) in 
         if newStatus ==  PHAuthorizationStatus.authorized { 
          /* do stuff here */ 
    } 
})

I'm not quite sure if I'm allowed to answer a question that was asked like 2 years ago as this is my first answer on stackoverflow but, here's my solution;

If you once retrieved the date from your MySQL database, split it and then use the splitted values.

$(document).ready(function () {
    var datefrommysql = $('.date-from-mysql').attr("date");
    var arraydate = datefrommysql.split('.');
    var yearfirstdigit = arraydate[2][2];
    var yearlastdigit = arraydate[2][3];
    var day = arraydate[0];
    var month = arraydate[1];
    $('.formatted-date').text(day + "/" + month + "/" + yearfirstdigit + yearlastdigit);
});

Here's a fiddle.

Seems like you expected the query to return running totals, but it must have given you the same values for both partitions of AccountID.

To obtain running totals with SUM() OVER (), you need to add an ORDER BY sub-clause after PARTITION BY …, like this:

SUM(Quantity) OVER (PARTITION BY AccountID ORDER BY ID)

But remember, not all database systems support ORDER BY in the OVER clause of a window aggregate function. (For instance, SQL Server didn't support it until the latest version, SQL Server 2012.)