Jquery resizing image

$(function() {
    $('.story-small img').each(function() {
        var maxWidth = 100; // Max width for the image
        var maxHeight = 100;    // Max height for the image
        var width = $(this).width();    // Current image width
        var height = $(this).height();  // Current image height
        // Check if the current width is larger than the max
        if(width>height && width>maxWidth)
        {
            ratio = maxWidth / width;   // get ratio for scaling image
            $(this).css("width", maxWidth); // Set new width
            $(this).css("height", height * ratio); // Scale height based on ratio
        }
        else if(height>width && height>maxHeight)
        {
            ratio = maxHeight / height; // get ratio for scaling image
            $(this).css("height", maxHeight);   // Set new height
            $(this).css("width", width * ratio);    // Scale width based on ratio
        }
    });
});

Why should I prefer to use member initialization lists?

Next to the performance issues, there is another one very important which I'd call code maintainability and extendibility.

If a T is POD and you start preferring initialization list, then if one time T will change to a non-POD type, you won't need to change anything around initialization to avoid unnecessary constructor calls because it is already optimised.

If type T does have default constructor and one or more user-defined constructors and one time you decide to remove or hide the default one, then if initialization list was used, you don't need to update code if your user-defined constructors because they are already correctly implemented.

Same with const members or reference members, let's say initially T is defined as follows:

struct T
{
    T() { a = 5; }
private:
    int a;
};

Next, you decide to qualify a as const, if you would use initialization list from the beginning, then this was a single line change, but having the T defined as above, it also requires to dig the constructor definition to remove assignment:

struct T
{
    T() : a(5) {} // 2. that requires changes here too
private:
    const int a; // 1. one line change
};

It's not a secret that maintenance is far easier and less error-prone if code was written not by a "code monkey" but by an engineer who makes decisions based on deeper consideration about what he is doing.

Xcode 6 Bug: Unknown class in Interface Builder file

I solved this problem by typing in the Module name (unfortunately the drop list will show nothing...) in the Custom Class of the identity inspector for all the View controller and views.

You may also need to indicate the target provider. To achieve this objective you can open the storyboard in sourcecode mode and add the "customModuleProvider" attribute in both ViewController and View angle brackets.

How to convert JSON object to JavaScript array?

If you have a well-formed JSON string, you should be able to do

var as = JSON.parse(jstring);

I do this all the time when transfering arrays through AJAX.

What's the difference between "Write-Host", "Write-Output", or "[console]::WriteLine"?

For usages of Write-Host, PSScriptAnalyzer produces the following diagnostic:

Avoid using Write-Host because it might not work in all hosts, does not work when there is no host, and (prior to PS 5.0) cannot be suppressed, captured, or redirected. Instead, use Write-Output, Write-Verbose, or Write-Information.

See the documentation behind that rule for more information. Excerpts for posterity:

The use of Write-Host is greatly discouraged unless in the use of commands with the Show verb. The Show verb explicitly means "show on the screen, with no other possibilities".

Commands with the Show verb do not have this check applied.

Jeffrey Snover has a blog post Write-Host Considered Harmful in which he claims Write-Host is almost always the wrong thing to do because it interferes with automation and provides more explanation behind the diagnostic, however the above is a good summary.

How to generate different random numbers in a loop in C++?

The way the function rand() works is that every time you call it, it generates a random number. In your code, you've called it once and stored it into the variable random_x. To get your desired random numbers instead of storing it into a variable, just call the function like this:

for (int t=0;t<10;t++)
{
    cout << "\nRandom X = " << rand() % 100;
}

What is the best way to initialize a JavaScript Date to midnight?

I have made a couple prototypes to handle this for me.

// This is a safety check to make sure the prototype is not already defined.
Function.prototype.method = function (name, func) {
    if (!this.prototype[name]) {
        this.prototype[name] = func;
        return this;
    }
};

Date.method('endOfDay', function () {
    var date = new Date(this);
    date.setHours(23, 59, 59, 999);
    return date;
});

Date.method('startOfDay', function () {
    var date = new Date(this);
    date.setHours(0, 0, 0, 0);
    return date;
});

if you dont want the saftey check, then you can just use

Date.prototype.startOfDay = function(){
  /*Method body here*/
};

Example usage:

var date = new Date($.now()); // $.now() requires jQuery
console.log('startOfDay: ' + date.startOfDay());
console.log('endOfDay: ' + date.endOfDay());

How do I display image in Alert/confirm box in Javascript?

You can emojis!

$('#test').on('click', () => {
    alert(' Build is too fast');
})

Setting the correct encoding when piping stdout in Python

On Windows, I had this problem very often when running a Python code from an editor (like Sublime Text), but not if running it from command-line.

In this case, check your editor's parameters. In the case of SublimeText, this Python.sublime-build solved it:

{
  "cmd": ["python", "-u", "$file"],
  "file_regex": "^[ ]*File \"(...*?)\", line ([0-9]*)",
  "selector": "source.python",
  "encoding": "utf8",
  "env": {"PYTHONIOENCODING": "utf-8", "LANG": "en_US.UTF-8"}
}

How do you create a Distinct query in HQL

My main query looked like this in the model:

@NamedQuery(name = "getAllCentralFinancialAgencyAccountCd", 
    query = "select distinct i from CentralFinancialAgencyAccountCd i")

And I was still not getting what I considered "distinct" results. They were just distinct based on a primary key combination on the table.

So in the DaoImpl I added an one line change and ended up getting the "distinct" return I wanted. An example would be instead of seeing 00 four times I now just see it once. Here is the code I added to the DaoImpl:

@SuppressWarnings("unchecked")
public List<CacheModelBase> getAllCodes() {

    Session session = (Session) entityManager.getDelegate();
    org.hibernate.Query q = session.getNamedQuery("getAllCentralFinancialAgencyAccountCd");
    q.setResultTransformer(Criteria.DISTINCT_ROOT_ENTITY); // This is the one line I had to add to make it do a more distinct query.
    List<CacheModelBase> codes;
    codes = q.list();
    return codes;       
}

I hope this helped! Once again, this might only work if you are following coding practices that implement the service, dao, and model type of project.

MIN and MAX in C

I wrote this version that works for MSVC, GCC, C, and C++.

#if defined(__cplusplus) && !defined(__GNUC__)
#   include <algorithm>
#   define MIN std::min
#   define MAX std::max
//#   define TMIN(T, a, b) std::min<T>(a, b)
//#   define TMAX(T, a, b) std::max<T>(a, b)
#else
#       define _CHOOSE2(binoper, lexpr, lvar, rexpr, rvar) \
                ({ \
                        decltype(lexpr) lvar = (lexpr); \
                        decltype(rexpr) rvar = (rexpr); \
                        lvar binoper rvar ? lvar : rvar; \
                })
#       define _CHOOSE_VAR2(prefix, unique) prefix##unique
#       define _CHOOSE_VAR(prefix, unique) _CHOOSE_VAR2(prefix, unique)
#       define _CHOOSE(binoper, lexpr, rexpr) \
                _CHOOSE2( \
                        binoper, \
                        lexpr, _CHOOSE_VAR(_left, __COUNTER__), \
                        rexpr, _CHOOSE_VAR(_right, __COUNTER__) \
                )
#       define MIN(a, b) _CHOOSE(<, a, b)
#       define MAX(a, b) _CHOOSE(>, a, b)
#endif

Position buttons next to each other in the center of page

This can be solved using the following CSS:

#container {
  text-align: center;
}

button {
  display: inline-block;
}

display: inline-block will put the buttons side by side and text-align: center places the buttons in the center of the page.

JsFiddle: https://jsfiddle.net/026tbk13/

SQLAlchemy: What's the difference between flush() and commit()?

commit () records these changes in the database. flush () is always called as part of the commit () (1) call. When you use a Session object to query a database, the query returns results from both the database and the reddened parts of the unrecorded transaction it is performing.

What is private bytes, virtual bytes, working set?

The short answer to this question is that none of these values are a reliable indicator of how much memory an executable is actually using, and none of them are really appropriate for debugging a memory leak.

Private Bytes refer to the amount of memory that the process executable has asked for - not necessarily the amount it is actually using. They are "private" because they (usually) exclude memory-mapped files (i.e. shared DLLs). But - here's the catch - they don't necessarily exclude memory allocated by those files. There is no way to tell whether a change in private bytes was due to the executable itself, or due to a linked library. Private bytes are also not exclusively physical memory; they can be paged to disk or in the standby page list (i.e. no longer in use, but not paged yet either).

Working Set refers to the total physical memory (RAM) used by the process. However, unlike private bytes, this also includes memory-mapped files and various other resources, so it's an even less accurate measurement than the private bytes. This is the same value that gets reported in Task Manager's "Mem Usage" and has been the source of endless amounts of confusion in recent years. Memory in the Working Set is "physical" in the sense that it can be addressed without a page fault; however, the standby page list is also still physically in memory but not reported in the Working Set, and this is why you might see the "Mem Usage" suddenly drop when you minimize an application.

Virtual Bytes are the total virtual address space occupied by the entire process. This is like the working set, in the sense that it includes memory-mapped files (shared DLLs), but it also includes data in the standby list and data that has already been paged out and is sitting in a pagefile on disk somewhere. The total virtual bytes used by every process on a system under heavy load will add up to significantly more memory than the machine actually has.

So the relationships are:

Private Bytes are what your app has actually allocated, but include pagefile usage;
Working Set is the non-paged Private Bytes plus memory-mapped files;
Virtual Bytes are the Working Set plus paged Private Bytes and standby list.

There's another problem here; just as shared libraries can allocate memory inside your application module, leading to potential false positives reported in your app's Private Bytes, your application may also end up allocating memory inside the shared modules, leading to false negatives. That means it's actually possible for your application to have a memory leak that never manifests itself in the Private Bytes at all. Unlikely, but possible.

Private Bytes are a reasonable approximation of the amount of memory your executable is using and can be used to help narrow down a list of potential candidates for a memory leak; if you see the number growing and growing constantly and endlessly, you would want to check that process for a leak. This cannot, however, prove that there is or is not a leak.

One of the most effective tools for detecting/correcting memory leaks in Windows is actually Visual Studio (link goes to page on using VS for memory leaks, not the product page). Rational Purify is another possibility. Microsoft also has a more general best practices document on this subject. There are more tools listed in this previous question.

I hope this clears a few things up! Tracking down memory leaks is one of the most difficult things to do in debugging. Good luck.

How do I trap ctrl-c (SIGINT) in a C# console app

In my case, I passed an async lambda to Console.CancelKeyPress, which won't work.

Android App Not Install. An existing package by the same name with a conflicting signature is already installed

Same package error:

Create a new Package in your app with different name.
Copy and paste all file in your old package to new Package.
Save Code.
Delete old Package And Clean and rebuild project.

Docker compose port mapping

It seems like the other answers here all misunderstood your question. If I understand correctly, you want to make requests to localhost:6379 (the default for redis) and have them be forwarded, automatically, to the same port on your redis container.

https://unix.stackexchange.com/a/101906/38639 helped me get to the right answer.

First, you'll need to install the nc command on your image. On CentOS, this package is called nmap-ncat, so in the example below, just replace this with the appropriate package if you are using a different OS as your base image.

Next, you'll need to tell it to run a certain command each time the container boots up. You can do this using CMD.

# Add this to your Dockerfile
RUN yum install -y --setopt=skip_missing_names_on_install=False nmap-ncat
COPY cmd.sh /usr/local/bin/cmd.sh
RUN chmod +x /usr/local/bin/cmd.sh
CMD ["/usr/local/bin/cmd.sh"]

Finally, we'll need to set up port-forwarding in cmd.sh. I found that nc, even with the -l and -k options, will occasionally terminate when a request is completed, so I'm using a while-loop to ensure that it's always running.

# cmd.sh
#! /usr/bin/env bash

while nc -l -p 6379 -k -c "nc redis 6379" || true; do true; done &

tail -f /dev/null # Or any other command that never exits

C#: How would I get the current time into a string?

I'd just like to point out something in these answers. In a date/time format string, '/' will be replaced with whatever the user's date separator is, and ':' will be replaced with whatever the user's time separator is. That is, if I've defined my date separator to be '.' (in the Regional and Language Options control panel applet, "intl.cpl"), and my time separator to be '?' (just pretend I'm crazy like that), then

DateTime.Now.ToString("MM/dd/yyyy h:mm tt")

would return

01.05.2009 6?01 PM

In most cases, this is what you want, because you want to respect the user's settings. If, however, you require the format be something specific (say, if it's going to parsed back out by somebody else down the wire), then you need to escape these special characters:

DateTime.Now.ToString("MM\\/dd\\/yyyy h\\:mm tt")

DateTime.Now.ToString(@"MM\/dd\/yyyy h\:mm tt")

which would now return

01/05/2009 6:01 PM

EDIT:

Then again, if you really want to respect the user's settings, you should use one of the standard date/time format strings, so that you respect not only the user's choices of separators, but also the general format of the date and/or time.

DateTime.Now.ToShortDateString()
DateTime.Now.ToString("d")

Both would return "1/5/2009" using standard US options, or "05/01/2009" using standard UK options, for instance.

DateTime.Now.ToLongDateString()
DateTime.Now.ToString("D")

Both would return "Monday, January 05, 2009" in US locale, or "05 January 2009" in UK.

DateTime.Now.ToShortTimeString()
DateTime.Now.ToString("t");

"6:01 PM" in US, "18:01" in UK.

DateTime.Now.ToLongTimeString()
DateTime.Now.ToString("T");

"6:01:04 PM" in US, "18:01:04" in UK.

DateTime.Now.ToString()
DateTime.Now.ToString("G");

"1/5/2009 6:01:04 PM" in US, "05/01/2009 18:01:04" in UK.

Many other options are available. See docs for standard date and time format strings and custom date and time format strings.

What is the difference between 'java', 'javaw', and 'javaws'?

See Java tools documentation for:

java command¹/javaw command²

The java tool launches a Java application. It does this by starting a Java runtime environment, loading a specified class, and invoking that class's main method.

The javaw command is identical to java, except that with javaw there is no associated console window. Use javaw when you don't want a command prompt window to appear.

javaws command, the "Java Web Start command"

The javaws command launches Java Web Start, which is the reference implementation of the Java Network Launching Protocol (JNLP). Java Web Start launches Java applications/applets hosted on a network.

If a JNLP file is specified, javaws will launch the Java application/applet specified in the JNLP file.

The javaws launcher has a set of options that are supported in the current release. However, the options may be removed in a future release.

Java Deployment Technologies are deprecated and will be removed in a future release
Java Applet and WebStart functionality, including the Applet API, the Java plug-in, the Java Applet Viewer, JNLP and Java Web Start, including the javaws tool, are all deprecated in JDK 9 and will be removed in a future release.

What is referencedColumnName used for in JPA?

Quoting API on referencedColumnName:

The name of the column referenced by this foreign key column.

Default (only applies if single join column is being used): The same name as the primary key column of the referenced table.

Q/A

Where this would be used?

When there is a composite PK in referenced table, then you need to specify column name you are referencing.

What is the difference between `Enum.name()` and `Enum.toString()`?

The main difference between name() and toString() is that name() is a final method, so it cannot be overridden. The toString() method returns the same value that name() does by default, but toString() can be overridden by subclasses of Enum.

Therefore, if you need the name of the field itself, use name(). If you need a string representation of the value of the field, use toString().

For instance:

public enum WeekDay {
    MONDAY, TUESDAY, WEDNESDAY, THURSDAY, FRIDAY;

    public String toString() {
        return name().charAt(0) + name().substring(1).toLowerCase();
    }
}

In this example, WeekDay.MONDAY.name() returns "MONDAY", and WeekDay.MONDAY.toString() returns "Monday".

WeekDay.valueOf(WeekDay.MONDAY.name()) returns WeekDay.MONDAY, but WeekDay.valueOf(WeekDay.MONDAY.toString()) throws an IllegalArgumentException.

Modulo operation with negative numbers

Modulus operator gives the remainder. Modulus operator in c usually takes the sign of the numerator

x = 5 % (-3) - here numerator is positive hence it results in 2
y = (-5) % (3) - here numerator is negative hence it results -2
z = (-5) % (-3) - here numerator is negative hence it results -2

Also modulus(remainder) operator can only be used with integer type and cannot be used with floating point.

CSS z-index not working (position absolute)

JSFiddle

You have to put the second div on top of the first one because the both have an z-index of zero so that the order in the dom will decide which is on top. This also affects the relative positioned div because its z-index relates to elements inside the parent div.

<div class="absolute" style="top: 54px"></div>
<div class="absolute">
    <div id="relative"></div>
</div>

Css stays the same.

Copy a variable's value into another

A solution for AngularJS:

$scope.targetObject = angular.copy($scope.sourceObject)

Unable to set data attribute using jQuery Data() API

It is mentioned in the .data() documentation

The data- attributes are pulled in the first time the data property is accessed and then are no longer accessed or mutated (all data values are then stored internally in jQuery)

This was also covered on Why don't changes to jQuery $.fn.data() update the corresponding html 5 data-* attributes?

The demo on my original answer below doesn't seem to work any more.

Updated answer

Again, from the .data() documentation

The treatment of attributes with embedded dashes was changed in jQuery 1.6 to conform to the W3C HTML5 specification.

So for <div data-role="page"></div> the following is true $('div').data('role') === 'page'

I'm fairly sure that $('div').data('data-role') worked in the past but that doesn't seem to be the case any more. I've created a better showcase which logs to HTML rather than having to open up the Console and added an additional example of the multi-hyphen to camelCase data- attributes conversion.

Updated demo (2015-07-25)

Also see jQuery Data vs Attr?

HTML

<div id="changeMe" data-key="luke" data-another-key="vader"></div>
<a href="#" id="changeData"></a>
<table id="log">
    <tr><th>Setter</th><th>Getter</th><th>Result of calling getter</th><th>Notes</th></tr>
</table>

JavaScript (jQuery 1.6.2+)

var $changeMe = $('#changeMe');
var $log = $('#log');

var logger;
(logger = function(setter, getter, note) {
    note = note || '';
    eval('$changeMe' + setter);
    var result = eval('$changeMe' + getter);
    $log.append('<tr><td><code>' + setter + '</code></td><td><code>' + getter + '</code></td><td>' + result + '</td><td>' + note + '</td></tr>');
})('', ".data('key')", "Initial value");

$('#changeData').click(function() {
    // set data-key to new value
    logger(".data('key', 'leia')", ".data('key')", "expect leia on jQuery node object but DOM stays as luke");
    // try and set data-key via .attr and get via some methods
    logger(".attr('data-key', 'yoda')", ".data('key')", "expect leia (still) on jQuery object but DOM now yoda");
    logger("", ".attr('key')", "expect undefined (no attr <code>key</code>)");
    logger("", ".attr('data-key')", "expect yoda in DOM and on jQuery object");

    // bonus points
    logger('', ".data('data-key')", "expect undefined (cannot get via this method)");
    logger(".data('anotherKey')", ".data('anotherKey')", "jQuery 1.6+ get multi hyphen <code>data-another-key</code>");
    logger(".data('another-key')", ".data('another-key')", "jQuery < 1.6 get multi hyphen <code>data-another-key</code> (also supported in jQuery 1.6+)");

    return false;
});

$('#changeData').click();

Older demo

Original answer

For this HTML:

<div id="foo" data-helptext="bar"></div>
<a href="#" id="changeData">change data value</a>

and this JavaScript (with jQuery 1.6.2)

console.log($('#foo').data('helptext'));

$('#changeData').click(function() {
    $('#foo').data('helptext', 'Testing 123');
//  $('#foo').attr('data-helptext', 'Testing 123');
    console.log($('#foo').data('data-helptext'));
    return false;
});

See demo

Using the Chrome DevTools Console to inspect the DOM, the $('#foo').data('helptext', 'Testing 123'); does not update the value as seen in the Console but $('#foo').attr('data-helptext', 'Testing 123'); does.

Format date to MM/dd/yyyy in JavaScript

Try this; bear in mind that JavaScript months are 0-indexed, whilst days are 1-indexed.

_x000D_

var date = new Date('2010-10-11T00:00:00+05:30');_x000D_
    alert(((date.getMonth() > 8) ? (date.getMonth() + 1) : ('0' + (date.getMonth() + 1))) + '/' + ((date.getDate() > 9) ? date.getDate() : ('0' + date.getDate())) + '/' + date.getFullYear());

_x000D_

How to delete a file or folder?

For deleting files:

os.unlink(path, *, dir_fd=None)

os.remove(path, *, dir_fd=None)

Both functions are semantically same. This functions removes (deletes) the file path. If path is not a file and it is directory, then exception is raised.

For deleting folders:

shutil.rmtree(path, ignore_errors=False, onerror=None)

os.rmdir(path, *, dir_fd=None)

In order to remove whole directory trees, shutil.rmtree() can be used. os.rmdir only works when the directory is empty and exists.

For deleting folders recursively towards parent:

os.removedirs(name)

It remove every empty parent directory with self until parent which has some content

ex. os.removedirs('abc/xyz/pqr') will remove the directories by order 'abc/xyz/pqr', 'abc/xyz' and 'abc' if they are empty.

For more info check official doc: os.unlink , os.remove, os.rmdir , shutil.rmtree, os.removedirs

URL encode sees “&” (ampersand) as “&” HTML entity

There is HTML and URI encodings. & is & encoded in HTML while %26 is & in URI encoding.

So before URI encoding your string you might want to HTML decode and then URI encode it :)

var div = document.createElement('div');
div.innerHTML = '&amp;AndOtherHTMLEncodedStuff';
var htmlDecoded = div.firstChild.nodeValue;
var urlEncoded = encodeURIComponent(htmlDecoded);

result %26AndOtherHTMLEncodedStuff

Hope this saves you some time

USB Debugging option greyed out

After countless attempts, I found the following quote:

If you are using My KNOX, you cannot enable USB debugging mode while the container is installed. Unfortunately, you have to root your device ... - continue reading

Furthermore make sure:

your USB-cable works
your connection type is MTP (or PTP in some cases)
to enable USB debugging before pluging your device via USB-cable

I switched to another device without KNOX (not rooted as well) to save time. Maybe this quote will save someone some time. It was the only explanation to me in this case.

Cheers!

How can I generate random number in specific range in Android?

Random r = new Random();
int i1 = r.nextInt(80 - 65) + 65;

This gives a random integer between 65 (inclusive) and 80 (exclusive), one of 65,66,...,78,79.

How to add an element at the end of an array?

As many others pointed out if you are trying to add a new element at the end of list then something like, array[array.length-1]=x; should do. But this will replace the existing element.

For something like continuous addition to the array. You can keep track of the index and go on adding elements till you reach end and have the function that does the addition return you the next index, which in turn will tell you how many more elements can fit in the array.

Of course in both the cases the size of array will be predefined. Vector can be your other option since you do not want arraylist, which will allow you all the same features and functions and additionally will take care of incrementing the size.

Coming to the part where you want StringBuffer to array. I believe what you are looking for is the getChars(int srcBegin, int srcEnd,char[] dst,int dstBegin) method. Look into it that might solve your doubts. Again I would like to point out that after managing to get an array out of it, you can still only replace the last existing element(character in this case).

Warning: mysqli_error() expects exactly 1 parameter, 0 given error

mysqli_error function requires $myConnection as parameters, that's why you get the warning

How to get the first 2 letters of a string in Python?

to print first two letter of a string

str = "string"

print(str[0:2])

Test if number is odd or even

Try this one with #Input field

<?php
    //checking even and odd
    echo '<form action="" method="post">';
    echo "<input type='text' name='num'>\n";
    echo "<button type='submit' name='submit'>Check</button>\n";
    echo "</form>";

    $num = 0;
    if ($_SERVER["REQUEST_METHOD"] == "POST") {
      if (empty($_POST["num"])) {
        $numErr = "<span style ='color: red;'>Number is required.</span>";
        echo $numErr;
        die();
      } else {
          $num = $_POST["num"];
      }


    $even = ($num % 2 == 0);
    $odd = ($num % 2 != 0);
    if ($num > 0){
        if($even){
            echo "Number is even.";
        } else {
            echo "Number is odd.";
        }
    } else {
        echo "Not a number.";
    }
    }
?>

PHP DOMDocument loadHTML not encoding UTF-8 correctly

This worked for me.

In php.ini file, change the following property.

Before:

mbstring.encoding_transration = On

After:

mbstring.encoding_transration = Off

ShowAllData method of Worksheet class failed

AutoFilterMode will be True if engaged, regardless of whether there is actually a filter applied to a specific column or not. When this happens, ActiveSheet.ShowAllData will still run, throwing an error (because there is no actual filtering).

I had the same issue and got it working with

If (ActiveSheet.AutoFilterMode And ActiveSheet.FilterMode) Or ActiveSheet.FilterMode Then
  ActiveSheet.ShowAllData
End If

This seems to prevent ShowAllData from running when there is no actual filter applied but with AutoFilterMode turned on.

The second catch Or ActiveSheet.FilterMode should catch advanced filters

jQuery: get parent tr for selected radio button

Try this.

You don't need to prefix attribute name by @ in jQuery selector. Use closest() method to get the closest parent element matching the selector.

$("#MwDataList input[name=selectRadioGroup]:checked").closest('tr');

You can simplify your method like this

function getSelectedRowGuid() {
    return GetRowGuid(
      $("#MwDataList > input:radio[@name=selectRadioGroup]:checked :parent tr"));
}

closest() - Gets the first element that matches the selector, beginning at the current element and progressing up through the DOM tree.

As a side note, the ids of the elements should be unique on the page so try to avoid having same ids for radio buttons which I can see in your markup. If you are not going to use the ids then just remove it from the markup.

Tell Ruby Program to Wait some amount of time

I find until very useful with sleep. example:

> time = Time.now
> sleep 2.seconds until Time.now > time + 10.seconds # breaks when true
# or something like
> sleep 1.seconds until !req.loading # suggested by ohsully

Limit file format when using <input type="file">?

Yes, you are right. It's impossible with HTML. User will be able to pick whatever file he/she wants.

You could write a piece of JavaScript code to avoid submitting a file based on its extension. But keep in mind that this by no means will prevent a malicious user to submit any file he/she really wants to.

Something like:

function beforeSubmit()
{
    var fname = document.getElementById("ifile").value;
    // check if fname has the desired extension
    if (fname hasDesiredExtension) {
        return true;
    } else {
        return false;
    }
}

HTML code:

<form method="post" onsubmit="return beforeSubmit();">
    <input type="file" id="ifile" name="ifile"/>
</form>

How is length implemented in Java Arrays?

It is a public final field for the array type. You can refer to the document below:

http://java.sun.com/docs/books/jls/third_edition/html/arrays.html#10.7

Plot Normal distribution with Matplotlib

Note: This solution is using `pylab`, not `matplotlib.pyplot`

You may try using hist to put your data info along with the fitted curve as below:

import numpy as np
import scipy.stats as stats
import pylab as pl

h = sorted([186, 176, 158, 180, 186, 168, 168, 164, 178, 170, 189, 195, 172,
     187, 180, 186, 185, 168, 179, 178, 183, 179, 170, 175, 186, 159,
     161, 178, 175, 185, 175, 162, 173, 172, 177, 175, 172, 177, 180])  #sorted

fit = stats.norm.pdf(h, np.mean(h), np.std(h))  #this is a fitting indeed

pl.plot(h,fit,'-o')

pl.hist(h,normed=True)      #use this to draw histogram of your data

pl.show()                   #use may also need add this

enter image description here

How to customize <input type="file">?

Here is one way which I like because it makes the input fill out the whole container. The trick is the "font-size: 100px", and it need to go with the "overflow: hidden" and the relative position.

<div id="upload-file-container" >
   <input type="file" />
</div>

#upload-file-container {
   width: 200px;
   height: 50px;
   position: relative;
   border: dashed 1px black;
   overflow: hidden;
}

#upload-file-container input[type="file"]
{
   margin: 0;
   opacity: 0;   
   font-size: 100px;
}

Check if element is clickable in Selenium Java

wait.until(ExpectedConditions) won't return null, it will either meet the condition or throw TimeoutException.

You can check if the element is displayed and enabled

WebElement element = driver.findElement(By.xpath);
if (element.isDisplayed() && element.isEnabled()) {
    element.click();
}

A Windows equivalent of the Unix tail command

I prefer TailMe because of the possibility to watch several log files simultaneously in one window: http://www.dschensky.de/Software/Staff/tailme_en.htm

Could not execute menu item (internal error)[Exception] - When changing PHP version from 5.3.1 to 5.2.9

Some applications like skype uses wamp's default port:80 so you have to find out which application is accessing this port you can easily find it by using TCP View. End the service accessing this port and restart wamp server. Now it will work.

How to delete an SVN project from SVN repository

It's easy to believe that deleting the whole Subversion repository requires "informing" Subversion that you're going to delete the repository. But Subversion only cares about managing a repository once it's created, not whether the repository exists or not ( if that makes sense ). It goes like this: the Subversion tools and commands are not adversely affected by just deleting your repository directory with the regular operating system utilities (like rm -R). A repository directory is not the same thing as an installed program directory, where deleting a program without uninstalling it might leave behind erratic config files or other dependencies. A repository is 100% self-contained in its directory, and deleting it is harmless (besides losing your project history). You just clean the slate to create a new Subversion repository and import your next project.

How do I find an element position in std::vector?

Take a vector of integer and a key (that we find in vector )....Now we are traversing the vector until found the key value or last index(otherwise).....If we found key then print the position , otherwise print "-1".

     #include <bits/stdc++.h>  
     using namespace std;  

     int main()  
      {  
          vector<int>str;  
          int flag,temp key, ,len,num;

           flag=0;
           cin>>len;

           for(int i=1; i<=len; i++)  
           {
               cin>>key;
               v.push_back(key);
           }

           cin>>num;

           for(int i=1; i<=len; i++)  
           {  
             if(str[i]==num)  
             {  
                flag++;  
                temp=i-1;
                break;
             }  
           }

         if(flag!=0)    cout<<temp<<endl;
         else           cout<<"-1"<<endl;   
         str.clear();   

         return 0;  
      }

sudo echo "something" >> /etc/privilegedFile doesn't work

sudo sh -c "echo 127.0.0.1 localhost >> /etc/hosts"

iPhone UITextField - Change placeholder text color

The best i can do for both iOS7 and less is:

- (CGRect)placeholderRectForBounds:(CGRect)bounds {
  return [self textRectForBounds:bounds];
}

- (CGRect)editingRectForBounds:(CGRect)bounds {
  return [self textRectForBounds:bounds];
}

- (CGRect)textRectForBounds:(CGRect)bounds {
  CGRect rect = CGRectInset(bounds, 0, 6); //TODO: can be improved by comparing font size versus bounds.size.height
  return rect;
}

- (void)drawPlaceholderInRect:(CGRect)rect {
  UIColor *color =RGBColor(65, 65, 65);
  if (SYSTEM_VERSION_GREATER_THAN_OR_EQUAL_TO(@"7.0")) {
    [self.placeholder drawInRect:rect withAttributes:@{NSFontAttributeName:self.font, UITextAttributeTextColor:color}];
  } else {
    [color setFill];
    [self.placeholder drawInRect:rect withFont:self.font];
  }
}

Javascript String to int conversion

The parseInt() function parses a string and returns an integer,10 is the Radix or Base [DOC]

var number = parseInt(id.substring(indexPos) , 10 ) + 1;

Select DataFrame rows between two dates

Inspired by unutbu

print(df.dtypes)                                 #Make sure the format is 'object'. Rerunning this after index will not show values.
columnName = 'YourColumnName'
df[columnName+'index'] = df[columnName]          #Create a new column for index
df.set_index(columnName+'index', inplace=True)   #To build index on the timestamp/dates
df.loc['2020-09-03 01:00':'2020-09-06']          #Select range from the index. This is your new Dataframe.

Install python 2.6 in CentOS

Chris Lea provides a YUM repository for python26 RPMs that can co-exist with the 'native' 2.4 that is needed for quite a few admin tools on CentOS.

Quick instructions that worked at least for me:

$ sudo rpm -Uvh http://yum.chrislea.com/centos/5/i386/chl-release-5-3.noarch.rpm
$ sudo rpm --import /etc/pki/rpm-gpg/RPM-GPG-KEY-CHL
$ sudo yum install python26
$ python26

Get index of clicked element in collection with jQuery

check this out https://forum.jquery.com/topic/get-index-of-same-class-element-on-click then http://jsfiddle.net/me2loveit2/d6rFM/2/

var index = $('selector').index(this);
console.log(index)

Create dataframe from a matrix

You can use stack from the base package. But, you need first to coerce your matrix to a data.frame and to reorder the columns once the data is stacked.

mat <- as.data.frame(mat)
res <- data.frame(time= mat$time,stack(mat,select=-time))
res[,c(3,1,2)]

  ind time values
1 C_0  0.0    0.1
2 C_0  0.5    0.2
3 C_0  1.0    0.3
4 C_1  0.0    0.3
5 C_1  0.5    0.4
6 C_1  1.0    0.5

Note that stack is generally more efficient than the reshape2 package.

What good are SQL Server schemas?

Just like Namespace of C# codes.

How To Save Canvas As An Image With canvas.toDataURL()?

You cannot use the methods previously mentioned to download an image when running in Cordova. You will need to use the Cordova File Plugin. This will allow you to pick where to save it and leverage different persistence settings. Details here: https://cordova.apache.org/docs/en/latest/reference/cordova-plugin-file/

Alternatively, you can convert the image to base64 then store the string in localStorage but this will fill your quota pretty quickly if you have many images or high-res.

How to return a PNG image from Jersey REST service method to the browser

I built a general method for that with following features:

returning "not modified" if the file hasn't been modified locally, a Status.NOT_MODIFIED is sent to the caller. Uses Apache Commons Lang
using a file stream object instead of reading the file itself

Here the code:

import org.apache.commons.lang3.time.DateUtils;
import org.slf4j.Logger;
import org.slf4j.LoggerFactory;

private static final Logger logger = LoggerFactory.getLogger(Utils.class);

@GET
@Path("16x16")
@Produces("image/png")
public Response get16x16PNG(@HeaderParam("If-Modified-Since") String modified) {
    File repositoryFile = new File("c:/temp/myfile.png");
    return returnFile(repositoryFile, modified);
}

/**
 * 
 * Sends the file if modified and "not modified" if not modified
 * future work may put each file with a unique id in a separate folder in tomcat
 *   * use that static URL for each file
 *   * if file is modified, URL of file changes
 *   * -> client always fetches correct file 
 * 
 *     method header for calling method public Response getXY(@HeaderParam("If-Modified-Since") String modified) {
 * 
 * @param file to send
 * @param modified - HeaderField "If-Modified-Since" - may be "null"
 * @return Response to be sent to the client
 */
public static Response returnFile(File file, String modified) {
    if (!file.exists()) {
        return Response.status(Status.NOT_FOUND).build();
    }

    // do we really need to send the file or can send "not modified"?
    if (modified != null) {
        Date modifiedDate = null;

        // we have to switch the locale to ENGLISH as parseDate parses in the default locale
        Locale old = Locale.getDefault();
        Locale.setDefault(Locale.ENGLISH);
        try {
            modifiedDate = DateUtils.parseDate(modified, org.apache.http.impl.cookie.DateUtils.DEFAULT_PATTERNS);
        } catch (ParseException e) {
            logger.error(e.getMessage(), e);
        }
        Locale.setDefault(old);

        if (modifiedDate != null) {
            // modifiedDate does not carry milliseconds, but fileDate does
            // therefore we have to do a range-based comparison
            // 1000 milliseconds = 1 second
            if (file.lastModified()-modifiedDate.getTime() < DateUtils.MILLIS_PER_SECOND) {
                return Response.status(Status.NOT_MODIFIED).build();
            }
        }
    }        
    // we really need to send the file

    try {
        Date fileDate = new Date(file.lastModified());
        return Response.ok(new FileInputStream(file)).lastModified(fileDate).build();
    } catch (FileNotFoundException e) {
        return Response.status(Status.NOT_FOUND).build();
    }
}

/*** copied from org.apache.http.impl.cookie.DateUtils, Apache 2.0 License ***/

/**
 * Date format pattern used to parse HTTP date headers in RFC 1123 format.
 */
public static final String PATTERN_RFC1123 = "EEE, dd MMM yyyy HH:mm:ss zzz";

/**
 * Date format pattern used to parse HTTP date headers in RFC 1036 format.
 */
public static final String PATTERN_RFC1036 = "EEEE, dd-MMM-yy HH:mm:ss zzz";

/**
 * Date format pattern used to parse HTTP date headers in ANSI C
 * <code>asctime()</code> format.
 */
public static final String PATTERN_ASCTIME = "EEE MMM d HH:mm:ss yyyy";

public static final String[] DEFAULT_PATTERNS = new String[] {
    PATTERN_RFC1036,
    PATTERN_RFC1123,
    PATTERN_ASCTIME
};

Note that the Locale switching does not seem to be thread-safe. I think, it's better to switch the locale globally. I am not sure about the side-effects though...

How do I set 'semi-bold' font via CSS? Font-weight of 600 doesn't make it look like the semi-bold I see in my Photoshop file

In CSS, for the font-weight property, the value: normal defaults to the numeric value 400, and bold to 700.

If you want to specify other weights, you need to give the number value. That number value needs to be supported for the font family that you are using.

For example you would define semi-bold like this:

font-weight: 600;

Here an JSFiddle using 'Open Sans' font family, loaded with the above weights.

loading json data from local file into React JS

install json-loader:

npm i json-loader --save
create data folder in src:

mkdir data
put your file(s) there
load your file

var data = require('json!../data/yourfile.json');

Iterating over every two elements in a list

A simple solution.

l = [1, 2, 3, 4, 5, 6]

for i in range(0, len(l), 2):
    print str(l[i]), '+', str(l[i + 1]), '=', str(l[i] + l[i + 1])

Why is a div with "display: table-cell;" not affected by margin?

If you have div next each other like this

<div id="1" style="float:left; margin-right:5px">

</div>
<div id="2" style="float:left">

</div>

This should work!

CSS On hover show another element

It is indeed possible with the following code

 <div href="#" id='a'>
     Hover me
 </div>

<div id='b'>
    Show me
</div>

and css

#a {
  display: block;
}

#a:hover + #b {
  display:block;
}

#b {
  display:none;
  }

Now by hovering on element #a shows element #b.

Difference between int and double

int is a binary representation of a whole number, double is a double-precision floating point number.

Eclipse - "Workspace in use or cannot be created, chose a different one."

Running eclipse in Administrator Mode fixed it for me. You can do this by [Right Click] -> Run as Administrator on the eclipse.exe from your install dir.

I was on a working environment with win7 machine having restrictive permission. I also did remove the .lock and .log files but that did not help. It can be a combination of all as well that made it work.

Start redis-server with config file

I think that you should make the reference to your config file

26399:C 16 Jan 08:51:13.413 # Warning: no config file specified, using the default config. In order to specify a config file use ./redis-server /path/to/redis.conf

you can try to start your redis server like

./redis-server /path/to/redis-stable/redis.conf

Java Convert GMT/UTC to Local time doesn't work as expected

I strongly recommend using Joda Time http://joda-time.sourceforge.net/faq.html

Making authenticated POST requests with Spring RestTemplate for Android

I was recently dealing with an issue when I was trying to get past authentication while making a REST call from Java, and while the answers in this thread (and other threads) helped, there was still a bit of trial and error involved in getting it working.

What worked for me was encoding credentials in Base64 and adding them as Basic Authorization headers. I then added them as an HttpEntity to restTemplate.postForEntity, which gave me the response I needed.

Here's the class I wrote for this in full (extending RestTemplate):

public class AuthorizedRestTemplate extends RestTemplate{

    private String username;
    private String password;

    public AuthorizedRestTemplate(String username, String password){
        this.username = username;
        this.password = password;
    }

    public String getForObject(String url, Object... urlVariables){
        return authorizedRestCall(this, url, urlVariables);
    }

    private String authorizedRestCall(RestTemplate restTemplate, 
            String url, Object... urlVariables){
        HttpEntity<String> request = getRequest();
        ResponseEntity<String> entity = restTemplate.postForEntity(url, 
                request, String.class, urlVariables);
        return entity.getBody();
    }

    private HttpEntity<String> getRequest(){
        HttpHeaders headers = new HttpHeaders();
        headers.add("Authorization", "Basic " + getBase64Credentials());
        return new HttpEntity<String>(headers);
    }

    private String getBase64Credentials(){
        String plainCreds = username + ":" + password;
        byte[] plainCredsBytes = plainCreds.getBytes();
        byte[] base64CredsBytes = Base64.encodeBase64(plainCredsBytes);
        return new String(base64CredsBytes);
    }
}

HTTP 404 when accessing .svc file in IIS

Verifies that you directory has been converted into an Application is your IIS.

Remove empty space before cells in UITableView

I just found a solution for this.

Just select tableview and clic Editor -> Arrange -> Send to Front

It worked for me and hope it helps you all.

go to link on button click - jquery

Why not just change the second line to

document.location.href="www.example.com/index.php?id=" + $(this).attr('id');

How to auto-remove trailing whitespace in Eclipse?

I assume your questions is with regards to Java code. If that's the case, you don't actually need any extra plugins to accomplish 1). You can just go to Preferences -> Java -> Editor -> Save Actions and configure it to remove trailing whitespace.

By the sounds of it you also want to make this a team-wide setting, right? To make life easier and avoid having to remember setting it up every time you have a new workspace you can set the save action as a project specific preference that gets stored into your SCM along with the code.

In order to do that right-click on your project and go to Properties -> Java Editor -> Save Actions. From there you can enable project specific settings and configure it to remove trailing whitespace (among other useful things).

NB: This option has been removed in Eclipse Kepler (4.3) and following releases.

NB #2: The option seems to be back in Eclipse Luna - Luna Service Release 1a (4.4.1)

Set textarea width to 100% in bootstrap modal

If i understand right this is what your looking for.

.form-control { width: 100%; }

See demo on JSFiddle.

How to handle windows file upload using Selenium WebDriver?

First add the file to your project resource directory

then

public YourPage uploadFileBtnSendKeys() {
    final ClassLoader classLoader = getClass().getClassLoader();
    final File file = new File(classLoader.getResource("yourFile.whatever").getPath());
    uploadFileBtn.sendKeys(file.getPath());
    return this;
}

Walla, you will see your choosen selected file, and have skipped the file explorer window

How do I clear the content of a div using JavaScript?

Just Javascript (as requested)

Add this function somewhere on your page (preferably in the <head>)

function clearBox(elementID)
{
    document.getElementById(elementID).innerHTML = "";
}

Then add the button on click event:

<button onclick="clearBox('cart_item')" />

In JQuery (for reference)

If you prefer JQuery you could do:

$("#cart_item").html("");

how to get the cookies from a php curl into a variable

someone here may find it useful. hhb_curl_exec2 works pretty much like curl_exec, but arg3 is an array which will be populated with the returned http headers (numeric index), and arg4 is an array which will be populated with the returned cookies ($cookies["expires"]=>"Fri, 06-May-2016 05:58:51 GMT"), and arg5 will be populated with... info about the raw request made by curl.

the downside is that it requires CURLOPT_RETURNTRANSFER to be on, else it error out, and that it will overwrite CURLOPT_STDERR and CURLOPT_VERBOSE, if you were already using them for something else.. (i might fix this later)

example of how to use it:

<?php
header("content-type: text/plain;charset=utf8");
$ch=curl_init();
$headers=array();
$cookies=array();
$debuginfo="";
$body="";
curl_setopt($ch,CURLOPT_SSL_VERIFYPEER,false);
curl_setopt($ch,CURLOPT_RETURNTRANSFER,true);
$body=hhb_curl_exec2($ch,'https://www.youtube.com/',$headers,$cookies,$debuginfo);
var_dump('$cookies:',$cookies,'$headers:',$headers,'$debuginfo:',$debuginfo,'$body:',$body);

and the function itself..

function hhb_curl_exec2($ch, $url, &$returnHeaders = array(), &$returnCookies = array(), &$verboseDebugInfo = "")
{
    $returnHeaders    = array();
    $returnCookies    = array();
    $verboseDebugInfo = "";
    if (!is_resource($ch) || get_resource_type($ch) !== 'curl') {
        throw new InvalidArgumentException('$ch must be a curl handle!');
    }
    if (!is_string($url)) {
        throw new InvalidArgumentException('$url must be a string!');
    }
    $verbosefileh = tmpfile();
    $verbosefile  = stream_get_meta_data($verbosefileh);
    $verbosefile  = $verbosefile['uri'];
    curl_setopt($ch, CURLOPT_VERBOSE, 1);
    curl_setopt($ch, CURLOPT_STDERR, $verbosefileh);
    curl_setopt($ch, CURLOPT_HEADER, 1);
    $html             = hhb_curl_exec($ch, $url);
    $verboseDebugInfo = file_get_contents($verbosefile);
    curl_setopt($ch, CURLOPT_STDERR, NULL);
    fclose($verbosefileh);
    unset($verbosefile, $verbosefileh);
    $headers       = array();
    $crlf          = "\x0d\x0a";
    $thepos        = strpos($html, $crlf . $crlf, 0);
    $headersString = substr($html, 0, $thepos);
    $headerArr     = explode($crlf, $headersString);
    $returnHeaders = $headerArr;
    unset($headersString, $headerArr);
    $htmlBody = substr($html, $thepos + 4); //should work on utf8/ascii headers... utf32? not so sure..
    unset($html);
    //I REALLY HOPE THERE EXIST A BETTER WAY TO GET COOKIES.. good grief this looks ugly..
    //at least it's tested and seems to work perfectly...
    $grabCookieName = function($str)
    {
        $ret = "";
        $i   = 0;
        for ($i = 0; $i < strlen($str); ++$i) {
            if ($str[$i] === ' ') {
                continue;
            }
            if ($str[$i] === '=') {
                break;
            }
            $ret .= $str[$i];
        }
        return urldecode($ret);
    };
    foreach ($returnHeaders as $header) {
        //Set-Cookie: crlfcoookielol=crlf+is%0D%0A+and+newline+is+%0D%0A+and+semicolon+is%3B+and+not+sure+what+else
        /*Set-Cookie:ci_spill=a%3A4%3A%7Bs%3A10%3A%22session_id%22%3Bs%3A32%3A%22305d3d67b8016ca9661c3b032d4319df%22%3Bs%3A10%3A%22ip_address%22%3Bs%3A14%3A%2285.164.158.128%22%3Bs%3A10%3A%22user_agent%22%3Bs%3A109%3A%22Mozilla%2F5.0+%28Windows+NT+6.1%3B+WOW64%29+AppleWebKit%2F537.36+%28KHTML%2C+like+Gecko%29+Chrome%2F43.0.2357.132+Safari%2F537.36%22%3Bs%3A13%3A%22last_activity%22%3Bi%3A1436874639%3B%7Dcab1dd09f4eca466660e8a767856d013; expires=Tue, 14-Jul-2015 13:50:39 GMT; path=/
        Set-Cookie: sessionToken=abc123; Expires=Wed, 09 Jun 2021 10:18:14 GMT;
        //Cookie names cannot contain any of the following '=,; \t\r\n\013\014'
        //
        */
        if (stripos($header, "Set-Cookie:") !== 0) {
            continue;
            /**/
        }
        $header = trim(substr($header, strlen("Set-Cookie:")));
        while (strlen($header) > 0) {
            $cookiename                 = $grabCookieName($header);
            $returnCookies[$cookiename] = '';
            $header                     = substr($header, strlen($cookiename) + 1); //also remove the = 
            if (strlen($header) < 1) {
                break;
            }
            ;
            $thepos = strpos($header, ';');
            if ($thepos === false) { //last cookie in this Set-Cookie.
                $returnCookies[$cookiename] = urldecode($header);
                break;
            }
            $returnCookies[$cookiename] = urldecode(substr($header, 0, $thepos));
            $header                     = trim(substr($header, $thepos + 1)); //also remove the ;
        }
    }
    unset($header, $cookiename, $thepos);
    return $htmlBody;
}

function hhb_curl_exec($ch, $url)
{
    static $hhb_curl_domainCache = "";
    //$hhb_curl_domainCache=&$this->hhb_curl_domainCache;
    //$ch=&$this->curlh;
    if (!is_resource($ch) || get_resource_type($ch) !== 'curl') {
        throw new InvalidArgumentException('$ch must be a curl handle!');
    }
    if (!is_string($url)) {
        throw new InvalidArgumentException('$url must be a string!');
    }

    $tmpvar = "";
    if (parse_url($url, PHP_URL_HOST) === null) {
        if (substr($url, 0, 1) !== '/') {
            $url = $hhb_curl_domainCache . '/' . $url;
        } else {
            $url = $hhb_curl_domainCache . $url;
        }
    }
    ;

    curl_setopt($ch, CURLOPT_URL, $url);
    $html = curl_exec($ch);
    if (curl_errno($ch)) {
        throw new Exception('Curl error (curl_errno=' . curl_errno($ch) . ') on url ' . var_export($url, true) . ': ' . curl_error($ch));
        // echo 'Curl error: ' . curl_error($ch);
    }
    if ($html === '' && 203 != ($tmpvar = curl_getinfo($ch, CURLINFO_HTTP_CODE)) /*203 is "success, but no output"..*/ ) {
        throw new Exception('Curl returned nothing for ' . var_export($url, true) . ' but HTTP_RESPONSE_CODE was ' . var_export($tmpvar, true));
    }
    ;
    //remember that curl (usually) auto-follows the "Location: " http redirects..
    $hhb_curl_domainCache = parse_url(curl_getinfo($ch, CURLINFO_EFFECTIVE_URL), PHP_URL_HOST);
    return $html;
}

How to trim whitespace from a Bash variable?

I've always done it with sed

  var=`hg st -R "$path" | sed -e 's/  *$//'`

If there is a more elegant solution, I hope somebody posts it.

Why doesn't GCC optimize aaaaaa to (aaa)(aaa)?

Another similar case: most compilers won't optimize a + b + c + d to (a + b) + (c + d) (this is an optimization since the second expression can be pipelined better) and evaluate it as given (i.e. as (((a + b) + c) + d)). This too is because of corner cases:

float a = 1e35, b = 1e-5, c = -1e35, d = 1e-5;
printf("%e %e\n", a + b + c + d, (a + b) + (c + d));

This outputs 1.000000e-05 0.000000e+00

Convert from lowercase to uppercase all values in all character variables in dataframe

If you need to deal with data.frames that include factors you can use:

df = data.frame(v1=letters[1:5],v2=1:5,v3=letters[10:14],v4=as.factor(letters[1:5]),v5=runif(5),stringsAsFactors=FALSE)

df
    v1 v2 v3 v4        v5
    1  a  1  j  a 0.1774909
    2  b  2  k  b 0.4405019
    3  c  3  l  c 0.7042878
    4  d  4  m  d 0.8829965
    5  e  5  n  e 0.9702505


sapply(df,class)
         v1          v2          v3          v4          v5
"character"   "integer" "character"    "factor"   "numeric"

Use mutate_each_ to convert factors to character then convert all to uppercase

   upper_it = function(X){X %>% mutate_each_( funs(as.character(.)), names( .[sapply(., is.factor)] )) %>%
   mutate_each_( funs(toupper), names( .[sapply(., is.character)] ))}   # convert factor to character then uppercase

Gives

  upper_it(df)
      v1 v2 v3 v4
    1  A  1  J  A
    2  B  2  K  B
    3  C  3  L  C
    4  D  4  M  D
    5  E  5  N  E

While

sapply( upper_it(df),class)
         v1          v2          v3          v4          v5
"character"   "integer" "character" "character"   "numeric"

Why does corrcoef return a matrix?

The function Correlate of numpy works with 2 1D arrays that you want to correlate and returns one correlation value.

Can't find AVD or SDK manager in Eclipse

Chances are that you may be running your eclipse using Java 1.5.

Latest Plugin requires that the JRE be 1.6 or higher.

You will have to use Eclipse that runs on JRE 1.6

Edit: I had run into same problems. If it is not JRE problem then you can debug this. Follow below procedure:

Window -> show View -> other -> Plugin Development -> Plugin Registry
In the plugin registry search for com.android.ide.eclipse.adt or any other plugin related to android (depending on your installation there maybe 7-8)
Select , Right Click -> Diagnose. This will show the problem why the plugin was not loaded

How can I force a long string without any blank to be wrapped?

If you're using PHP then the wordwrap function works well for this: http://php.net/manual/en/function.wordwrap.php

The CSS solution word-wrap: break-word; does not seem to be consistent across all browsers.

Other server-side languages have similar functions - or can be hand built.

Here's how the the PHP wordwrap function works:

$string = "ACTGATCGAGCTGAAGCGCAGTGCGATGCTTCGATGATGCTGACGATGCTACGATGCGAGCATCTACGATCAGTCGATGTAGCTAGTAGCATGTAGTGA";

$wrappedstring = wordwrap($string,50,"&lt;br&gt;",true);

This wraps the string at 50 characters with a <br> tag. The 'true' parameter forces the string to be cut.

Prevent Sequelize from outputting SQL to the console on execution of query?

I solved a lot of issues by using the following code. Issues were : -

Not connecting with database
Database connection Rejection issues
Getting rid of logs in console (specific for this).

const sequelize = new Sequelize("test", "root", "root", {
  host: "127.0.0.1",
  dialect: "mysql",
  port: "8889",
  connectionLimit: 10,
  socketPath: "/Applications/MAMP/tmp/mysql/mysql.sock",
  // It will disable logging
  logging: false
});

C Programming: How to read the whole file contents into a buffer

Portability between Linux and Windows is a big headache, since Linux is a POSIX-conformant system with - generally - a proper, high quality toolchain for C, whereas Windows doesn't even provide a lot of functions in the C standard library.

However, if you want to stick to the standard, you can write something like this:

#include <stdio.h>
#include <stdlib.h>

FILE *f = fopen("textfile.txt", "rb");
fseek(f, 0, SEEK_END);
long fsize = ftell(f);
fseek(f, 0, SEEK_SET);  /* same as rewind(f); */

char *string = malloc(fsize + 1);
fread(string, 1, fsize, f);
fclose(f);

string[fsize] = 0;

Here string will contain the contents of the text file as a properly 0-terminated C string. This code is just standard C, it's not POSIX-specific (although that it doesn't guarantee it will work/compile on Windows...)

What is the HTML tabindex attribute?

When the user presses the tab button the user will be taken through the form in the order 1, 2, and 3 as indicated in the example below.

For example:

Name: <input name="name" tabindex="1"  />
Age: <input name="age" tabindex="3"  />
Email: <input name="email" tabindex="2"  />

How to define servlet filter order of execution using annotations in WAR

The Servlet 3.0 spec doesn't seem to provide a hint on how a container should order filters that have been declared via annotations. It is clear how about how to order filters via their declaration in the web.xml file, though.

Be safe. Use the web.xml file order filters that have interdependencies. Try to make your filters all order independent to minimize the need to use a web.xml file.

How to add image background to btn-default twitter-bootstrap button?

Have you tried using a icon font like http://fortawesome.github.io/Font-Awesome/

Bootstrap comes with their own library, but it doesn't have as many icons as Font Awesome.

http://getbootstrap.com/components/#glyphicons

Remove all child elements of a DOM node in JavaScript

Option 1 A: Clearing `innerHTML`.

This approach is simple, but might not be suitable for high-performance applications because it invokes the browser's HTML parser (though browsers may optimize for the case where the value is an empty string).

_x000D_

doFoo.onclick = () => {_x000D_
  const myNode = document.getElementById("foo");_x000D_
  myNode.innerHTML = '';_x000D_
}

_x000D_

<div id='foo' style="height: 100px; width: 100px; border: 1px solid black;">_x000D_
  <span>Hello</span>_x000D_
</div>_x000D_
<button id='doFoo'>Remove via innerHTML</button>

_x000D_

Option 1 B: Clearing `textContent`

As above, but use .textContent. According to MDN this will be faster than innerHTML as browsers won't invoke their HTML parsers and will instead immediately replace all children of the element with a single #text node.

_x000D_

doFoo.onclick = () => {_x000D_
  const myNode = document.getElementById("foo");_x000D_
  myNode.textContent = '';_x000D_
}

_x000D_

<div id='foo' style="height: 100px; width: 100px; border: 1px solid black;">_x000D_
  <span>Hello</span>_x000D_
</div>_x000D_
<button id='doFoo'>Remove via textContent</button>

_x000D_

Option 2 A: Looping to remove every `lastChild`:

An earlier edit to this answer used firstChild, but this is updated to use lastChild as in computer-science, in general, it's significantly faster to remove the last element of a collection than it is to remove the first element (depending on how the collection is implemented).
The loop continues to check for firstChild just in case it's faster to check for firstChild than lastChild (e.g. if the element list is implemented as a directed linked-list by the UA).

_x000D_

doFoo.onclick = () => {_x000D_
  const myNode = document.getElementById("foo");_x000D_
  while (myNode.firstChild) {_x000D_
    myNode.removeChild(myNode.lastChild);_x000D_
  }_x000D_
}

_x000D_

<div id='foo' style="height: 100px; width: 100px; border: 1px solid black;">_x000D_
  <span>Hello</span>_x000D_
</div>_x000D_
<button id='doFoo'>Remove via lastChild-loop</button>

_x000D_

Option 2 B: Looping to remove every `lastElementChild`:

This approach preserves all non-Element (namely #text nodes and  ) children of the parent (but not their descendants) - and this may be desirable in your application (e.g. some templating systems that use inline HTML comments to store template instructions).
This approach wasn't used until recent years as Internet Explorer only added support for lastElementChild in IE9.

_x000D_

doFoo.onclick = () => {_x000D_
  const myNode = document.getElementById("foo");_x000D_
  while (myNode.lastElementChild) {_x000D_
    myNode.removeChild(myNode.lastElementChild);_x000D_
  }_x000D_
}

_x000D_

<div id='foo' style="height: 100px; width: 100px; border: 1px solid black;">_x000D_
  <!-- This comment won't be removed -->_x000D_
  <span>Hello <!-- This comment WILL be removed --></span>_x000D_
  <!-- But this one won't. -->_x000D_
</div>_x000D_
<button id='doFoo'>Remove via lastElementChild-loop</button>

_x000D_

Bonus: `Element.clearChildren` monkey-patch:

We can add a new method-property to the Element prototype in JavaScript to simplify invoking it to just el.clearChildren() (where el is any HTML element object).
(Strictly speaking this is a monkey-patch, not a polyfill, as this is not a standard DOM feature or missing feature. Note that monkey-patching is rightfully discouraged in many situations.)

_x000D_

if( typeof Element.prototype.clearChildren === 'undefined' ) {_x000D_
    Object.defineProperty(Element.prototype, 'clearChildren', {_x000D_
      configurable: true,_x000D_
      enumerable: false,_x000D_
      value: function() {_x000D_
        while(this.firstChild) this.removeChild(this.lastChild);_x000D_
      }_x000D_
    });_x000D_
}

_x000D_

<div id='foo' style="height: 100px; width: 100px; border: 1px solid black;">_x000D_
  <span>Hello <!-- This comment WILL be removed --></span>_x000D_
</div>_x000D_
<button onclick="this.previousElementSibling.clearChildren()">Remove via monkey-patch</button>

_x000D_

What does upstream mean in nginx?

It's used for proxying requests to other servers.

An example from http://wiki.nginx.org/LoadBalanceExample is:

http {
  upstream myproject {
    server 127.0.0.1:8000 weight=3;
    server 127.0.0.1:8001;
    server 127.0.0.1:8002;    
    server 127.0.0.1:8003;
  }

  server {
    listen 80;
    server_name www.domain.com;
    location / {
      proxy_pass http://myproject;
    }
  }
}

This means all requests for / go to the any of the servers listed under upstream XXX, with a preference for port 8000.

How to save a figure in MATLAB from the command line?

If you want to save it as .fig file, hgsave is the function in Matlab R2012a. In later versions, savefig may also work.

Override console.log(); for production

It would be super useful to be able to toggle logging in the production build. The code below turns the logger off by default.

When I need to see logs, I just type debug(true) into the console.

var consoleHolder = console;
function debug(bool){
    if(!bool){
        consoleHolder = console;
        console = {};
        Object.keys(consoleHolder).forEach(function(key){
            console[key] = function(){};
        })
    }else{
        console = consoleHolder;
    }
}
debug(false);

To be thorough, this overrides ALL of the console methods, not just console.log.

How to print instances of a class using print()?

As Chris Lutz mentioned, this is defined by the __repr__ method in your class.

From the documentation of repr():

For many types, this function makes an attempt to return a string that would yield an object with the same value when passed to eval(), otherwise the representation is a string enclosed in angle brackets that contains the name of the type of the object together with additional information often including the name and address of the object. A class can control what this function returns for its instances by defining a __repr__() method.

Given the following class Test:

class Test:
    def __init__(self, a, b):
        self.a = a
        self.b = b

    def __repr__(self):
        return "<Test a:%s b:%s>" % (self.a, self.b)

    def __str__(self):
        return "From str method of Test: a is %s, b is %s" % (self.a, self.b)

..it will act the following way in the Python shell:

>>> t = Test(123, 456)
>>> t
<Test a:123 b:456>
>>> print repr(t)
<Test a:123 b:456>
>>> print(t)
From str method of Test: a is 123, b is 456
>>> print(str(t))
From str method of Test: a is 123, b is 456

If no __str__ method is defined, print(t) (or print(str(t))) will use the result of __repr__ instead

If no __repr__ method is defined then the default is used, which is pretty much equivalent to..

def __repr__(self):
    return "<%s instance at %s>" % (self.__class__.__name__, id(self))

How to define a variable in a Dockerfile?

To my knowledge, only ENV allows that, as mentioned in "Environment replacement"

Environment variables (declared with the ENV statement) can also be used in certain instructions as variables to be interpreted by the Dockerfile.

They have to be environment variables in order to be redeclared in each new containers created for each line of the Dockerfile by docker build.

In other words, those variables aren't interpreted directly in a Dockerfile, but in a container created for a Dockerfile line, hence the use of environment variable.

This day, I use both ARG (docker 1.10+, and docker build --build-arg var=value) and ENV.
Using ARG alone means your variable is visible at build time, not at runtime.

My Dockerfile usually has:

ARG var
ENV var=${var}

In your case, ARG is enough: I use it typically for setting http_proxy variable, that docker build needs for accessing internet at build time.

Meaning of tilde in Linux bash (not home directory)

If you're using autofs then the expansion might actually be coming from /etc/auto.home (or similar for your distro). For example, my /etc/auto.master looks like:

/home2 auto.home --timeout 60

and /etc/auto.home looks like:

mgalgs -rw,noquota,intr space:/space/mgalgs

Object comparison in JavaScript

I wrote this piece of code for object comparison, and it seems to work. check the assertions:


function countProps(obj) {
    var count = 0;
    for (k in obj) {
        if (obj.hasOwnProperty(k)) {
            count++;
        }
    }
    return count;
};

function objectEquals(v1, v2) {

    if (typeof(v1) !== typeof(v2)) {
        return false;
    }

    if (typeof(v1) === "function") {
        return v1.toString() === v2.toString();
    }

    if (v1 instanceof Object && v2 instanceof Object) {
        if (countProps(v1) !== countProps(v2)) {
            return false;
        }
        var r = true;
        for (k in v1) {
            r = objectEquals(v1[k], v2[k]);
            if (!r) {
                return false;
            }
        }
        return true;
    } else {
        return v1 === v2;
    }
}

assert.isTrue(objectEquals(null,null));
assert.isFalse(objectEquals(null,undefined));

assert.isTrue(objectEquals("hi","hi"));
assert.isTrue(objectEquals(5,5));
assert.isFalse(objectEquals(5,10));

assert.isTrue(objectEquals([],[]));
assert.isTrue(objectEquals([1,2],[1,2]));
assert.isFalse(objectEquals([1,2],[2,1]));
assert.isFalse(objectEquals([1,2],[1,2,3]));

assert.isTrue(objectEquals({},{}));
assert.isTrue(objectEquals({a:1,b:2},{a:1,b:2}));
assert.isTrue(objectEquals({a:1,b:2},{b:2,a:1}));
assert.isFalse(objectEquals({a:1,b:2},{a:1,b:3}));

assert.isTrue(objectEquals({1:{name:"mhc",age:28}, 2:{name:"arb",age:26}},{1:{name:"mhc",age:28}, 2:{name:"arb",age:26}}));
assert.isFalse(objectEquals({1:{name:"mhc",age:28}, 2:{name:"arb",age:26}},{1:{name:"mhc",age:28}, 2:{name:"arb",age:27}}));

assert.isTrue(objectEquals(function(x){return x;},function(x){return x;}));
assert.isFalse(objectEquals(function(x){return x;},function(y){return y+2;}));

How do I prevent an Android device from going to sleep programmatically?

Set flags on Activity's Window as below

@Override public void onResume() {
 super.onResume();
 getWindow().addFlags(WindowManager.LayoutParams.FLAG_KEEP_SCREEN_ON);
}

@Override public void onPause() {
 super.onPause();
 getWindow().clearFlags(WindowManager.LayoutParams.FLAG_KEEP_SCREEN_ON);
}

Find all elements with a certain attribute value in jquery

Use string concatenation. Try this:

$('div[imageId="'+imageN +'"]').each(function() {
    $(this);   
});

Adding onClick event dynamically using jQuery

$("#bfCaptchaEntry").click(function(){
    myFunction();
});

Copy Files from Windows to the Ubuntu Subsystem

You should only access Linux files system (those located in lxss folder) from inside WSL; DO NOT create/modify any files in lxss folder in Windows - it's dangerous and WSL will not see these files.

Files can be shared between WSL and Windows, though; put the file outside of lxss folder. You can access them via drvFS (/mnt) such as /mnt/c/Users/yourusername/files within WSL. These files stay synced between WSL and Windows.

For details and why, see: https://blogs.msdn.microsoft.com/commandline/2016/11/17/do-not-change-linux-files-using-windows-apps-and-tools/

target input by type and name (selector)

input[type='checkbox', name='ProductCode']

That's the CSS way and I'm almost sure it will work in jQuery.

How to parse a CSV in a Bash script?

I was looking for an elegant solution that support quoting and wouldn't require installing anything fancy on my VMware vMA appliance. Turns out this simple python script does the trick! (I named the script csv2tsv.py, since it converts CSV into tab-separated values - TSV)

#!/usr/bin/env python

import sys, csv

with sys.stdin as f:
    reader = csv.reader(f)
    for row in reader:
        for col in row:
            print col+'\t',
        print

Tab-separated values can be split easily with the cut command (no delimiter needs to be specified, tab is the default). Here's a sample usage/output:

> esxcli -h $VI_HOST --formatter=csv network vswitch standard list |csv2tsv.py|cut -f12
Uplinks
vmnic4,vmnic0,
vmnic5,vmnic1,
vmnic6,vmnic2,

In my scripts I'm actually going to parse tsv output line by line and use read or cut to get the fields I need.

Error retrieving parent for item: No resource found that matches the given name after upgrading to AppCompat v23

I wanted to downgrade from API 23 to 22 and got this error. I had to change all build.gradle files in a project in order to compile.

android {
    compileSdkVersion 22
    buildToolsVersion "22.0.1"

    defaultConfig {
        applicationId "com.yourapp.app"
        minSdkVersion 14
        targetSdkVersion 22
    }
...
dependencies {
    compile 'com.android.support:appcompat-v7:22.2.1'
    compile 'com.android.support:support-v4:22.2.1'
    compile 'com.android.support:design:22.2.1'
    compile 'com.google.android.gms:play-services-gcm:10.0.1'
}

How to determine if a list of polygon points are in clockwise order?

My C# / LINQ solution is based on the cross product advice of @charlesbretana is below. You can specify a reference normal for the winding. It should work as long as the curve is mostly in the plane defined by the up vector.

using System.Collections.Generic;
using System.Linq;
using System.Numerics;

namespace SolidworksAddinFramework.Geometry
{
    public static class PlanePolygon
    {
        /// <summary>
        /// Assumes that polygon is closed, ie first and last points are the same
        /// </summary>
       public static bool Orientation
           (this IEnumerable<Vector3> polygon, Vector3 up)
        {
            var sum = polygon
                .Buffer(2, 1) // from Interactive Extensions Nuget Pkg
                .Where(b => b.Count == 2)
                .Aggregate
                  ( Vector3.Zero
                  , (p, b) => p + Vector3.Cross(b[0], b[1])
                                  /b[0].Length()/b[1].Length());

            return Vector3.Dot(up, sum) > 0;

        } 

    }
}

with a unit test

namespace SolidworksAddinFramework.Spec.Geometry
{
    public class PlanePolygonSpec
    {
        [Fact]
        public void OrientationShouldWork()
        {

            var points = Sequences.LinSpace(0, Math.PI*2, 100)
                .Select(t => new Vector3((float) Math.Cos(t), (float) Math.Sin(t), 0))
                .ToList();

            points.Orientation(Vector3.UnitZ).Should().BeTrue();
            points.Reverse();
            points.Orientation(Vector3.UnitZ).Should().BeFalse();



        } 
    }
}

Conditional formatting, entire row based

You want to apply a custom formatting rule. The "Applies to" field should be your entire row (If you want to format row 5, put in =$5:$5. The custom formula should be =IF($B$5="X", TRUE, FALSE), shown in the example below.

Multi-line strings in PHP

To put the strings "l" and "vv" on separate lines in the code alone:

$xml = "l";
$xml .= "vv"
echo $xml;

In this instance you're saying to append .= the string to the end of the previous version of that string variable. Remember that = is only an assignment operator so in your original code you're assigning the variable a new string value.

To put the strings "l" and "vv" on separate lines in the echo alone:

$xml = "l\nvv"
echo $xml;

You don't need multiple strings in this instance, as the new line character \n will take care of that for you.

To put the strings "l" and "vv" on separate lines in code and when echoing:

$xml = "l";
$xml .= "\nvv"
echo $xml;

How do I remove a property from a JavaScript object?

Property Removal in JavaScript

There are many different options presented on this page, not because most of the options are wrong—or because the answers are duplicates—but because the appropriate technique depends on the situation you're in and the goals of the tasks you and/or you team are trying to fulfill. To answer you question unequivocally, one needs to know:

The version of ECMAScript you're targeting
The range of object types you want to remove properties on and the type of property names you need to be able to omit (Strings only? Symbols? Weak references mapped from arbitrary objects? These have all been types of property pointers in JavaScript for years now)
The programming ethos/patterns you and your team use. Do you favor functional approaches and mutation is verboten on your team, or do you employ wild west mutative object-oriented techniques?
Are you looking to achieve this in pure JavaScript or are you willing & able to use a 3rd-party library?

Once those four queries have been answered, there are essentially four categories of "property removal" in JavaScript to chose from in order to meet your goals. They are:

Mutative object property deletion, unsafe

This category is for operating on object literals or object instances when you want to retain/continue to use the original reference and aren't using stateless functional principles in your code. An example piece of syntax in this category:

'use strict'
const iLikeMutatingStuffDontI = { myNameIs: 'KIDDDDD!', [Symbol.for('amICool')]: true }
delete iLikeMutatingStuffDontI[Symbol.for('amICool')] // true
Object.defineProperty({ myNameIs: 'KIDDDDD!', 'amICool', { value: true, configurable: false })
delete iLikeMutatingStuffDontI['amICool'] // throws

This category is the oldest, most straightforward & most widely supported category of property removal. It supports Symbol & array indexes in addition to strings and works in every version of JavaScript except for the very first release. However, it's mutative which violates some programming principles and has performance implications. It also can result in uncaught exceptions when used on non-configurable properties in strict mode.

Rest-based string property omission

This category is for operating on plain object or array instances in newer ECMAScript flavors when a non-mutative approach is desired and you don't need to account for Symbol keys:

const foo = { name: 'KIDDDDD!', [Symbol.for('isCool')]: true }
const { name, ...coolio } = foo // coolio doesn't have "name"
const { isCool, ...coolio2 } = foo // coolio2 has everything from `foo` because `isCool` doesn't account for Symbols :(

Mutative object property deletion, safe

This category is for operating on object literals or object instances when you want to retain/continue to use the original reference while guarding against exceptions being thrown on unconfigurable properties:

'use strict'
const iLikeMutatingStuffDontI = { myNameIs: 'KIDDDDD!', [Symbol.for('amICool')]: true }
Reflect.deleteProperty(iLikeMutatingStuffDontI, Symbol.for('amICool')) // true
Object.defineProperty({ myNameIs: 'KIDDDDD!', 'amICool', { value: true, configurable: false })
Reflect.deleteProperty(iLikeMutatingStuffDontI, 'amICool') // false

In addition, while mutating objects in-place isn't stateless, you can use the functional nature of Reflect.deleteProperty to do partial application and other functional techniques that aren't possible with delete statements.

Syntax-based string property omission

This category is for operating on plain object or array instances in newer ECMAScript flavors when a non-mutative approach is desired and you don't need to account for Symbol keys:

const foo = { name: 'KIDDDDD!', [Symbol.for('isCool')]: true }
const { name, ...coolio } = foo // coolio doesn't have "name"
const { isCool, ...coolio2 } = foo // coolio2 has everything from `foo` because `isCool` doesn't account for Symbols :(

Library-based property omission

This category is generally allows for greater functional flexibility, including accounting for Symbols & omitting more than one property in one statement:

const o = require("lodash.omit")
const foo = { [Symbol.for('a')]: 'abc', b: 'b', c: 'c' }
const bar = o(foo, 'a') // "'a' undefined"
const baz = o(foo, [ Symbol.for('a'), 'b' ]) // Symbol supported, more than one prop at a time, "Symbol.for('a') undefined"

Url.Action parameters?

Here is another simple way to do it

<a class="nav-link"
   href='@Url.Action("Print1", "DeviceCertificates", new { Area = "Diagnostics"})\@Model.ID'>Print</a>

Where is @Model.ID is a parameter

And here there is a second example.

<a class="nav-link"
   href='@Url.Action("Print1", "DeviceCertificates", new { Area = "Diagnostics"})\@Model.ID?param2=ViewBag.P2&param3=ViewBag.P3'>Print</a>

How to access the last value in a vector?

Package data.table includes last function

library(data.table)
last(c(1:10))
# [1] 10

Switch statement for greater-than/less-than

When I looked at the solutions in the other answers I saw some things that I know are bad for performance. I was going to put them in a comment but I thought it was better to benchmark it and share the results. You can test it yourself. Below are my results (ymmv) normalized after the fastest operation in each browser (multiply the 1.0 time with the normalized value to get the absolute time in ms).

                    Chrome  Firefox Opera   MSIE    Safari  Node
-------------------------------------------------------------------
1.0 time               37ms    73ms    68ms   184ms    73ms    21ms
if-immediate            1.0     1.0     1.0     2.6     1.0     1.0
if-indirect             1.2     1.8     3.3     3.8     2.6     1.0
switch-immediate        2.0     1.1     2.0     1.0     2.8     1.3
switch-range           38.1    10.6     2.6     7.3    20.9    10.4
switch-range2          31.9     8.3     2.0     4.5     9.5     6.9
switch-indirect-array  35.2     9.6     4.2     5.5    10.7     8.6
array-linear-switch     3.6     4.1     4.5    10.0     4.7     2.7
array-binary-switch     7.8     6.7     9.5    16.0    15.0     4.9

Test where performed on Windows 7 32bit with the folowing versions: Chrome 21.0.1180.89m, Firefox 15.0, Opera 12.02, MSIE 9.0.8112, Safari 5.1.7. Node was run on a Linux 64bit box because the timer resolution on Node.js for Windows was 10ms instead of 1ms.

if-immediate

This is the fastest in all tested environments, except in ... drumroll MSIE! (surprise, surprise). This is the recommended way to implement it.

if (val < 1000) { /*do something */ } else
if (val < 2000) { /*do something */ } else
...
if (val < 30000) { /*do something */ } else

if-indirect

This is a variant of switch-indirect-array but with if-statements instead and performs much faster than switch-indirect-array in almost all tested environments.

values=[
   1000,  2000, ... 30000
];
if (val < values[0]) { /* do something */ } else
if (val < values[1]) { /* do something */ } else
...
if (val < values[29]) { /* do something */ } else

switch-immediate

This is pretty fast in all tested environments, and actually the fastest in MSIE. It works when you can do a calculation to get an index.

switch (Math.floor(val/1000)) {
  case 0: /* do something */ break;
  case 1: /* do something */ break;
  ...
  case 29: /* do something */ break;
}

switch-range

This is about 6 to 40 times slower than the fastest in all tested environments except for Opera where it takes about one and a half times as long. It is slow because the engine has to compare the value twice for each case. Surprisingly it takes Chrome almost 40 times longer to complete this compared to the fastest operation in Chrome, while MSIE only takes 6 times as long. But the actual time difference was only 74ms in favor to MSIE at 1337ms(!).

switch (true) {
  case (0 <= val &&  val < 1000): /* do something */ break;
  case (1000 <= val &&  val < 2000): /* do something */ break;
  ...
  case (29000 <= val &&  val < 30000): /* do something */ break;
}

switch-range2

This is a variant of switch-range but with only one compare per case and therefore faster, but still very slow except in Opera. The order of the case statement is important since the engine will test each case in source code order ECMAScript262:5 12.11

switch (true) {
  case (val < 1000): /* do something */ break;
  case (val < 2000): /* do something */ break;
  ...
  case (val < 30000): /* do something */ break;
}

switch-indirect-array

In this variant the ranges is stored in an array. This is slow in all tested environments and very slow in Chrome.

values=[1000,  2000 ... 29000, 30000];

switch(true) {
  case (val < values[0]): /* do something */ break;
  case (val < values[1]): /* do something */ break;
  ...
  case (val < values[29]): /* do something */ break;
}

array-linear-search

This is a combination of a linear search of values in an array, and the switch statement with fixed values. The reason one might want to use this is when the values isn't known until runtime. It is slow in every tested environment, and takes almost 10 times as long in MSIE.

values=[1000,  2000 ... 29000, 30000];

for (sidx=0, slen=values.length; sidx < slen; ++sidx) {
  if (val < values[sidx]) break;
}

switch (sidx) {
  case 0: /* do something */ break;
  case 1: /* do something */ break;
  ...
  case 29: /* do something */ break;
}

array-binary-switch

This is a variant of array-linear-switch but with a binary search. Unfortunately it is slower than the linear search. I don't know if it is my implementation or if the linear search is more optimized. It could also be that the keyspace is to small.

values=[0, 1000,  2000 ... 29000, 30000];

while(range) {
  range = Math.floor( (smax - smin) / 2 );
  sidx = smin + range;
  if ( val < values[sidx] ) { smax = sidx; } else { smin = sidx; }
}

switch (sidx) {
  case 0: /* do something */ break;
  ...
  case 29: /* do something */ break;
}

Conclusion

If performance is important, use if-statements or switch with immediate values.

Recursively add the entire folder to a repository

I ran into this problem that cost me a little time, then remembered that git won't store empty folders. Remember that if you have a folder tree you want stored, put a file in at least the deepest folder of that tree, something like a file called ".gitkeep", just to affect storage by git.

How do I run Google Chrome as root?

I tried this with Kali linux, Debian, CentOs 7,And Ubuntu

(Permanent Method)

Edit the file with any text editor (I used Leafpad) Run this code your terminal leafpad/opt/google/chrome/google-chrome
(Normally its end line) find exec -a "$0" "$HERE/chrome" "$@" or exec -a "$0" "$HERE/chrome" "$PROFILE_DIRECTORY_FLAG" \ "$@"
change as exec -a "$0" "$HERE/chrome" "$@" --no-sandbox --user-data-dir

(Just Simple Method)

Run This command in your terminal

$ google-chrome --no-sandbox --user-data-dir

$ google-chrome-stable --no-sandbox --user-data-dir

Prevent WebView from displaying "web page not available"

I've been working on this problem of ditching those irritable Google error pages today. It is possible with the Android example code seen above and in plenty of other forums (ask how I know):

wv.setWebViewClient(new WebViewClient() {
    public void onReceivedError(WebView view, int errorCode,
                            String description, String failingUrl) {
       if (view.canGoBack()) {
          view.goBack();
        }
       Toast.makeText(getBaseContext(), description, Toast.LENGTH_LONG).show();
       }
    }
});

IF you put it in shouldOverrideUrlLoading() as one more webclient. At least, this is working for me on my 2.3.6 device. We'll see where else it works later. That would only depress me now, I'm sure. The goBack bit is mine. You may not want it.

How to set border on jPanel?

To get fixed padding, I will set layout to java.awt.GridBagLayout with one cell. You can then set padding for each cell. Then you can insert inner JPanel to that cell and (if you need) delegate proper JPanel methods to the inner JPanel.

"You tried to execute a query that does not include the specified aggregate function"

GROUP BY can be selected from Total row in query design view in MS Access.
If Total row not shown in design view (as in my case). You can go to SQL View and add GROUP By fname etc. Then Total row will automatically show in design view.
You have to select as Expression in this row for calculated fields.

How to properly reference local resources in HTML?

A leading slash tells the browser to start at the root directory.
If you don't have the leading slash, you're referencing from the current directory.
If you add two dots before the leading slash, it means you're referencing the parent of the current directory.

Take the following folder structure

demo folder structure

notice:

the ROOT checkmark is green,
the second checkmark is orange,
the third checkmark is purple,
the forth checkmark is yellow

Now in the index.html.en file you'll want to put the following markup

<p>
    <span>src="check_mark.png"</span>
    <img src="check_mark.png" />
    <span>I'm purple because I'm referenced from this current directory</span>
</p>

<p>
    <span>src="/check_mark.png"</span>
    <img src="/check_mark.png" />
    <span>I'm green because I'm referenced from the ROOT directory</span>
</p>

<p>
    <span>src="subfolder/check_mark.png"</span>
    <img src="subfolder/check_mark.png" />
    <span>I'm yellow because I'm referenced from the child of this current directory</span>
</p>

<p>
    <span>src="/subfolder/check_mark.png"</span>
    <img src="/subfolder/check_mark.png" />
    <span>I'm orange because I'm referenced from the child of the ROOT directory</span>
</p>

<p>
    <span>src="../subfolder/check_mark.png"</span>
    <img src="../subfolder/check_mark.png" />
    <span>I'm purple because I'm referenced from the parent of this current directory</span>
</p>

<p>
    <span>src="subfolder/subfolder/check_mark.png"</span>
    <img src="subfolder/subfolder/check_mark.png" />
    <span>I'm [broken] because there is no subfolder two children down from this current directory</span>
</p>

<p>
    <span>src="/subfolder/subfolder/check_mark.png"</span>
    <img src="/subfolder/subfolder/check_mark.png" />
    <span>I'm purple because I'm referenced two children down from the ROOT directory</span>
</p>

Now if you load up the index.html.en file located in the second subfolder
http://example.com/subfolder/subfolder/

This will be your output

enter image description here

How to install PostgreSQL's pg gem on Ubuntu?

I was trying to setup a Rails project in my freshly installed Ubuntu 16.04. I ran into the same issue while running bundle. Running

sudo apt-get install aptitude

followed by

sudo apt-get install libpq-dev

Solved it for me.

java.util.regex - importance of Pattern.compile()?

The compile() method is always called at some point; it's the only way to create a Pattern object. So the question is really, why should you call it explicitly? One reason is that you need a reference to the Matcher object so you can use its methods, like group(int) to retrieve the contents of capturing groups. The only way to get ahold of the Matcher object is through the Pattern object's matcher() method, and the only way to get ahold of the Pattern object is through the compile() method. Then there's the find() method which, unlike matches(), is not duplicated in the String or Pattern classes.

The other reason is to avoid creating the same Pattern object over and over. Every time you use one of the regex-powered methods in String (or the static matches() method in Pattern), it creates a new Pattern and a new Matcher. So this code snippet:

for (String s : myStringList) {
    if ( s.matches("\\d+") ) {
        doSomething();
    }
}

...is exactly equivalent to this:

for (String s : myStringList) {
    if ( Pattern.compile("\\d+").matcher(s).matches() ) {
        doSomething();
    }
}

Obviously, that's doing a lot of unnecessary work. In fact, it can easily take longer to compile the regex and instantiate the Pattern object, than it does to perform an actual match. So it usually makes sense to pull that step out of the loop. You can create the Matcher ahead of time as well, though they're not nearly so expensive:

Pattern p = Pattern.compile("\\d+");
Matcher m = p.matcher("");
for (String s : myStringList) {
    if ( m.reset(s).matches() ) {
        doSomething();
    }
}

If you're familiar with .NET regexes, you may be wondering if Java's compile() method is related to .NET's RegexOptions.Compiled modifier; the answer is no. Java's Pattern.compile() method is merely equivalent to .NET's Regex constructor. When you specify the Compiled option:

Regex r = new Regex(@"\d+", RegexOptions.Compiled);

...it compiles the regex directly to CIL byte code, allowing it to perform much faster, but at a significant cost in up-front processing and memory use--think of it as steroids for regexes. Java has no equivalent; there's no difference between a Pattern that's created behind the scenes by String#matches(String) and one you create explicitly with Pattern#compile(String).

(EDIT: I originally said that all .NET Regex objects are cached, which is incorrect. Since .NET 2.0, automatic caching occurs only with static methods like Regex.Matches(), not when you call a Regex constructor directly. ref)

T-SQL and the WHERE LIKE %Parameter% clause

The correct answer is, that, because the '%'-sign is part of your search expression, it should be part of your VALUE, so whereever you SET @LastName (be it from a programming language or from TSQL) you should set it to '%' + [userinput] + '%'

or, in your example:

DECLARE @LastName varchar(max)
SET @LastName = 'ning'
SELECT Employee WHERE LastName LIKE '%' + @LastName + '%'

Get the value of input text when enter key pressed

Try this:

<input type="text" placeholder="some text" class="search" onkeydown="search(this)"/>  
<input type="text" placeholder="some text" class="search" onkeydown="search(this)"/>

JS Code

function search(ele) {
    if(event.key === 'Enter') {
        alert(ele.value);        
    }
}

DEMO Link

In HTML I can make a checkmark with ✓ . Is there a corresponding X-mark?

A corresponding cross for ✓ ✓ would be ✗ ✗ I think (Dingbats).

Logical Operators, || or OR?

Source: http://wallstreetdeveloper.com/php-logical-operators/

Here is sample code for working with logical operators:

<html>

<head>
    <title>Logical</title>
</head>

<body>
    <?php
        $a = 10;
        $b = 20;
        if ($a>$b)
        {
            echo " A is Greater";
        }
        elseif ($a<$b)
        {
            echo " A is lesser";
        }
        else
        {
             echo "A and B are equal";
        }
    ?>
    <?php
        $c = 30;
        $d = 40;
        //if (($a<$c) AND ($b<$d))
        if (($a<$c) && ($b<$d))
        {
            echo "A and B are larger";
        }
        if (isset($d))
            $d = 100;
        echo $d;
        unset($d);
    ?>
    <?php
        $var1 = 2;
        switch($var1)
        {
            case 1:  echo "var1 is 1";
                     break;
            case 2:  echo "var1 is 2";
                     break;
            case 3:  echo "var1 is 3";
                     break;
            default: echo "var1 is unknown";
        }
    ?>
</body>
</html>

Shuffling a list of objects

random.shuffle should work. Here's an example, where the objects are lists:

from random import shuffle
x = [[i] for i in range(10)]
shuffle(x)

# print(x)  gives  [[9], [2], [7], [0], [4], [5], [3], [1], [8], [6]]
# of course your results will vary

Note that shuffle works in place, and returns None.

Translating touch events from Javascript to jQuery

jQuery 'fixes up' events to account for browser differences. When it does so, you can always access the 'native' event with event.originalEvent (see the Special Properties subheading on this page).

Install Application programmatically on Android

This can help others a lot!

First:

private static final String APP_DIR = Environment.getExternalStorageDirectory().getAbsolutePath() + "/MyAppFolderInStorage/";

private void install() {
    File file = new File(APP_DIR + fileName);

    if (file.exists()) {
        Intent intent = new Intent(Intent.ACTION_VIEW);
        String type = "application/vnd.android.package-archive";

        if (Build.VERSION.SDK_INT >= Build.VERSION_CODES.N) {
            Uri downloadedApk = FileProvider.getUriForFile(getContext(), "ir.greencode", file);
            intent.setDataAndType(downloadedApk, type);
            intent.addFlags(Intent.FLAG_GRANT_READ_URI_PERMISSION);
        } else {
            intent.setDataAndType(Uri.fromFile(file), type);
            intent.setFlags(Intent.FLAG_ACTIVITY_NEW_TASK);
        }

        getContext().startActivity(intent);
    } else {
        Toast.makeText(getContext(), "?File not found!", Toast.LENGTH_SHORT).show();
    }
}

Second: For android 7 and above you should define a provider in manifest like below!

    <provider
        android:name="android.support.v4.content.FileProvider"
        android:authorities="ir.greencode"
        android:exported="false"
        android:grantUriPermissions="true">
        <meta-data
            android:name="android.support.FILE_PROVIDER_PATHS"
            android:resource="@xml/paths" />
    </provider>

Third: Define path.xml in res/xml folder like below! I'm using this path for internal storage if you want to change it to something else there is a few way! You can go to this link: FileProvider

<?xml version="1.0" encoding="utf-8"?>
<paths xmlns:android="http://schemas.android.com/apk/res/android">
    <external-path name="your_folder_name" path="MyAppFolderInStorage/"/>
</paths>

Forth: You should add this permission in manifest:

<uses-permission android:name="android.permission.REQUEST_INSTALL_PACKAGES"/>

Allows an application to request installing packages. Apps targeting APIs greater than 25 must hold this permission in order to use Intent.ACTION_INSTALL_PACKAGE.

Please make sure the provider authorities are the same!

What is the difference between CHARACTER VARYING and VARCHAR in PostgreSQL?

The PostgreSQL documentation on Character Types is a good reference for this. They are two different names for the same type.

Where do I find the current C or C++ standard documents?

PDF versions of the standard

As of 1st September 2014, the best locations by price for C and C++ standards documents in PDF are:

C++17 – ISO/IEC 14882:2017: $116 from ansi.org
C++14 – ISO/IEC 14882:2014: $90 NZD (about $60 US) from Standards New Zealand
C++11 – ISO/IEC 14882:2011: ~~$60 from ansi.org~~ $60 from Techstreet
C++03 – ISO 14882:2003: ~~$30 from ansi.org~~ $48 from SAI Global
C++98 – ISO/IEC 14882:1998: $90 NZD (about $60 US) from Standards New Zealand
C17/C18 – ISO/IEC 9899:2018: $185 from SAI Global / $116 from INCITS/ANSI / N2176 / c17_updated_proposed_fdis.pdf draft from November 2017 (Link broken, see Wayback Machine N2176)
C11 – ISO/IEC 9899:2011: ~~$30~~ $60 from ansi.org / WG14 draft version N1570
C99 – ISO 9899:1999: ~~$30~~ $60 from ansi.org / WG14 draft version N1256
C90 – AS 3955-1991: ~~$141 from ansi.org~~ $175 from Techstreet (the Australian version of C90, identical to ISO 9899:1990)
C90 – 9899:1990 Hardcopy available from SAI Global ($88 + shipping)

You cannot usually get old revisions of a standard (any standard) directly from the standards bodies shortly after a new edition of the standard is released. Thus, standards for C89, C90, C99, C++98, C++03 will be hard to find for purchase from a standards body. If you need an old revision of a standard, check Techstreet as one possible source. For example, it can still provide the Canadian version CAN/CSA-ISO/IEC 9899:1990 standard in PDF, for a fee.

Non-PDF electronic versions of the standard

C89 – Draft version in ANSI text format: (https://web.archive.org/web/20161223125339/http://flash-gordon.me.uk/ansi.c.txt)
C90 TC1; ISO/IEC 9899 TCOR1, single-page HTML document: (http://www.open-std.org/jtc1/sc22/wg14/www/docs/tc1.htm)
C90 TC2; ISO/IEC 9899 TCOR2, single-page HTML document: (http://www.open-std.org/jtc1/sc22/wg14/www/docs/tc2.htm)

Print versions of the standard

Print copies of the standards are available from national standards bodies and ISO but are very expensive.

If you want a hardcopy of the C90 standard for much less money than above, you may be able to find a cheap used copy of Herb Schildt's book The Annotated ANSI Standard at Amazon, which contains the actual text of the standard (useful) and commentary on the standard (less useful - it contains several dangerous and misleading errors).

The C99 and C++03 standards are available in book form from Wiley and the BSI (British Standards Institute):

C++03 Standard on Amazon
C99 Standard on Amazon

Standards committee draft versions (free)

The working drafts for future standards are often available from the committee websites:

If you want to get drafts from the current or earlier C/C++ standards, there are some available for free on the internet:

For C:

ANSI X3.159-198 (C89): I cannot find a PDF of C89, but it is almost the same as the below draft for ISO/IEC 9899:1990 (C90). The only differences are in the boilerplate and section numbering.
ISO/IEC 9899:1990 (C90): https://www.pdf-archive.com/2014/10/02/ansi-iso-9899-1990-1/ansi-iso-9899-1990-1.pdf

(Almost the same as ANSI X3.159-198 (C89) except for the frontmatter and section numbering. Note that the conversion between ANSI and ISO/IEC Standard is seen inside this document, the document refers to its name as "ANSI/ISO: 9899/99" although this isn't the right name of the later made standard of it, the right name is "ISO/IEC 9899:1990")

ISO/IEC 9899:1999 (C99): http://www.open-std.org/jtc1/sc22/wg14/www/docs/n1256.pdf
ISO/IEC 9899:2011 (C11): http://www.open-std.org/jtc1/sc22/wg14/www/docs/n1570.pdf
ISO/IEC 9899:2018 (C17/C18): https://web.archive.org/web/20181230041359if_/http://www.open-std.org/jtc1/sc22/wg14/www/abq/c17_updated_proposed_fdis.pdf (N2176)

For C++:

ISO/IEC 14882:1998 (C++98): http://www.lirmm.fr/~ducour/Doc-objets/ISO+IEC+14882-1998.pdf
ISO/IEC 14882:2003 (C++03): https://cs.nyu.edu/courses/fall11/CSCI-GA.2110-003/documents/c++2003std.pdf
ISO/IEC 14882:2011 (C++11): http://www.open-std.org/jtc1/sc22/wg21/docs/papers/2012/n3337.pdf
ISO/IEC 14882:2014 (C++14): https://github.com/cplusplus/draft/blob/master/papers/n4140.pdf?raw=true
ISO/IEC 14882:2017 (C++17): http://www.open-std.org/jtc1/sc22/wg21/docs/papers/2017/n4659.pdf
ISO/IEC 14882:2020 (C++20): https://isocpp.org/files/papers/N4860.pdf

Note that these documents are not the same as the standard, though the versions just prior to the meetings that decide on a standard are usually very close to what is in the final standard. The FCD (Final Committee Draft) versions are password protected; you need to be on the standards committee to get them.

Even though the draft versions might be very close to the final ratified versions of the standards, some of this post's editors would strongly advise you to get a copy of the actual documents — especially if you're planning on quoting them as references. Of course, starving students should go ahead and use the drafts if strapped for cash.

It appears that, if you are willing and able to wait a few months after ratification of a standard, to search for "INCITS/ISO/IEC" instead of "ISO/IEC" when looking for a standard is the key. By doing so, one of this post's editors was able to find the C11 and C++11 standards at reasonable prices. For example, if you search for "INCITS/ISO/IEC 9899:2011" instead of "ISO/IEC 9899:2011" on webstore.ansi.org you will find the reasonably priced PDF version.

The site https://wg21.link/ provides short-URL links to the C++ current working draft and draft standards, and committee papers:

https://wg21.link/std11 - C++11
https://wg21.link/std14 - C++14
https://wg21.link/std17 - C++17
https://wg21.link/std20 - C++20
https://wg21.link/std - current working draft

The current draft of the standard is maintained as LaTeX sources on Github. These sources can be converted to HTML using cxxdraft-htmlgen. The following sites maintain HTML pages so generated:

Tim Song - Current working draft - C++11 - C++14 - C++17 - C++20
Eelis - Current working draft

Tim Song also maintains generated HTML and PDF versions of the Networking TS and Ranges TS.

How to set null to a GUID property

You can use typeof(Guid), "00000000-0000-0000-0000-000000000000" for DefaultValue of the property.

Maximum request length exceeded.

The maximum request size is, by default, 4MB (4096 KB)

This is explained here.

The above article also explains how to fix this issue :)

How merge two objects array in angularjs?

$scope.actions.data.concat is not a function

same problem with me but i solve the problem by

 $scope.actions.data = [].concat($scope.actions.data , data)

Return list from async/await method

Instead of doing all these, one can simply use ".Result" to get the result from a particular task.

eg: List list = GetListAsync().Result;

Which as per the definition => Gets the result value of this Task < TResult >

Execute a PHP script from another PHP script

I prefer to use

require_once('phpfile.php');

lots of options out there for you. and a good way to keep things clean.

FFMPEG mp4 from http live streaming m3u8 file?

Your command is completely incorrect. The output format is not rawvideo and you don't need the bitstream filter h264_mp4toannexb which is used when you want to convert the h264 contained in an mp4 to the Annex B format used by MPEG-TS for example. What you want to use instead is the aac_adtstoasc for the AAC streams.

ffmpeg -i http://.../playlist.m3u8 -c copy -bsf:a aac_adtstoasc output.mp4

The permissions granted to user ' are insufficient for performing this operation. (rsAccessDenied)"}

Thanks for Sharing. After struggling for 1.5 days, noticed that Report Server was configured with wrong domain IP. It was configured with backup domain IP which is offline. I have identified this in the user group configuration where Domain name was not listed. Changed IP and reboot the Report server. Issue resolved.

How to convert a std::string to const char* or char*?

I am working with an API with a lot of functions get as an input a char*.

I have created a small class to face this kind of problem, I have implemented the RAII idiom.

class DeepString
{
        DeepString(const DeepString& other);
        DeepString& operator=(const DeepString& other);
        char* internal_; 

    public:
        explicit DeepString( const string& toCopy): 
            internal_(new char[toCopy.size()+1]) 
        {
            strcpy(internal_,toCopy.c_str());
        }
        ~DeepString() { delete[] internal_; }
        char* str() const { return internal_; }
        const char* c_str()  const { return internal_; }
};

And you can use it as:

void aFunctionAPI(char* input);

//  other stuff

aFunctionAPI("Foo"); //this call is not safe. if the function modified the 
                     //literal string the program will crash
std::string myFoo("Foo");
aFunctionAPI(myFoo.c_str()); //this is not compiling
aFunctionAPI(const_cast<char*>(myFoo.c_str())); //this is not safe std::string 
                                                //implement reference counting and 
                                                //it may change the value of other
                                                //strings as well.
DeepString myDeepFoo(myFoo);
aFunctionAPI(myFoo.str()); //this is fine

I have called the class DeepString because it is creating a deep and unique copy (the DeepString is not copyable) of an existing string.

How to get the clicked link's href with jquery?

this in your callback function refers to the clicked element.

   $(".addressClick").click(function () {
        var addressValue = $(this).attr("href");
        alert(addressValue );
    });

Html.Partial vs Html.RenderPartial & Html.Action vs Html.RenderAction

Here is what I have found:

Use RenderAction when you do not have a model to send to the view and have a lot of html to bring back that doesn't need to be stored in a variable.

Use Action when you do not have a model to send to the view and have a little bit of text to bring back that needs to be stored in a variable.

Use RenderPartial when you have a model to send to the view and there will be a lot of html that doesn't need to be stored in a variable.

Use Partial when you have a model to send to the view and there will be a little bit of text that needs to be stored in a variable.

RenderAction and RenderPartial are faster.

How to check for valid email address?

For check of email use email_validator

from email_validator import validate_email, EmailNotValidError

def check_email(email):
    try:
        v = validate_email(email)  # validate and get info
        email = v["email"]  # replace with normalized form
        print("True")
    except EmailNotValidError as e:
        # email is not valid, exception message is human-readable
        print(str(e))

check_email("test@gmailcom")

How to make a programme continue to run after log out from ssh?

You could use screen, detach and reattach

ng-if, not equal to?

It is better to use ng-switch

<div ng-switch on="details.Payment[0].Status">
    <div ng-switch-when="1">
        <!-- code to render a large video block-->
    </div>
    <div ng-switch-default>
        <!-- code to render the regular video block -->
    </div>
</div>

Java - Reading XML file

Reading xml the easy way:

http://www.mkyong.com/java/jaxb-hello-world-example/

package com.mkyong.core;

import javax.xml.bind.annotation.XmlAttribute;
import javax.xml.bind.annotation.XmlElement;
import javax.xml.bind.annotation.XmlRootElement;

@XmlRootElement
public class Customer {

    String name;
    int age;
    int id;

    public String getName() {
        return name;
    }

    @XmlElement
    public void setName(String name) {
        this.name = name;
    }

    public int getAge() {
        return age;
    }

    @XmlElement
    public void setAge(int age) {
        this.age = age;
    }

    public int getId() {
        return id;
    }

    @XmlAttribute
    public void setId(int id) {
        this.id = id;
    }

}

package com.mkyong.core;

import java.io.File;
import javax.xml.bind.JAXBContext;
import javax.xml.bind.JAXBException;
import javax.xml.bind.Marshaller;

public class JAXBExample {
    public static void main(String[] args) {

      Customer customer = new Customer();
      customer.setId(100);
      customer.setName("mkyong");
      customer.setAge(29);

      try {

        File file = new File("C:\\file.xml");
        JAXBContext jaxbContext = JAXBContext.newInstance(Customer.class);
        Marshaller jaxbMarshaller = jaxbContext.createMarshaller();

        // output pretty printed
        jaxbMarshaller.setProperty(Marshaller.JAXB_FORMATTED_OUTPUT, true);

        jaxbMarshaller.marshal(customer, file);
        jaxbMarshaller.marshal(customer, System.out);

          } catch (JAXBException e) {
              e.printStackTrace();
          }

    }
}

Create code first, many to many, with additional fields in association table

I'll just post the code to do this using the fluent API mapping.

public class User {
    public int UserID { get; set; }
    public string Username { get; set; }
    public string Password { get; set; }

    public ICollection<UserEmail> UserEmails { get; set; }
}

public class Email {
    public int EmailID { get; set; }
    public string Address { get; set; }

    public ICollection<UserEmail> UserEmails { get; set; }
}

public class UserEmail {
    public int UserID { get; set; }
    public int EmailID { get; set; }
    public bool IsPrimary { get; set; }
}

On your DbContext derived class you could do this:

public class MyContext : DbContext {
    protected override void OnModelCreating(DbModelBuilder builder) {
        // Primary keys
        builder.Entity<User>().HasKey(q => q.UserID);
        builder.Entity<Email>().HasKey(q => q.EmailID);
        builder.Entity<UserEmail>().HasKey(q => 
            new { 
                q.UserID, q.EmailID
            });

        // Relationships
        builder.Entity<UserEmail>()
            .HasRequired(t => t.Email)
            .WithMany(t => t.UserEmails)
            .HasForeignKey(t => t.EmailID)

        builder.Entity<UserEmail>()
            .HasRequired(t => t.User)
            .WithMany(t => t.UserEmails)
            .HasForeignKey(t => t.UserID)
    }
}

It has the same effect as the accepted answer, with a different approach, which is no better nor worse.

How to insert a value that contains an apostrophe (single quote)?

The apostrophe character can be inserted by calling the CHAR function with the apostrophe's ASCII table lookup value, 39. The string values can then be concatenated together with a concatenate operator.

Insert into Person
  (First, Last)
Values
  'Joe',
  concat('O',char(39),'Brien')

Check if String contains only letters

What do you want? Speed or simplicity? For speed, go for a loop based approach. For simplicity, go for a one liner RegEx based approach.

Speed

public boolean isAlpha(String name) {
    char[] chars = name.toCharArray();

    for (char c : chars) {
        if(!Character.isLetter(c)) {
            return false;
        }
    }

    return true;
}

Simplicity

public boolean isAlpha(String name) {
    return name.matches("[a-zA-Z]+");
}

SQL Insert into table only if record doesn't exist

This might be a simple solution to achieve this:

INSERT INTO funds (ID, date, price)
SELECT 23, DATE('2013-02-12'), 22.5
  FROM dual
 WHERE NOT EXISTS (SELECT 1 
                     FROM funds 
                    WHERE ID = 23
                      AND date = DATE('2013-02-12'));

p.s. alternatively (if ID a primary key):

 INSERT INTO funds (ID, date, price)
    VALUES (23, DATE('2013-02-12'), 22.5)
        ON DUPLICATE KEY UPDATE ID = 23; -- or whatever you need

see this Fiddle.

How to set proper codeigniter base url?

After declaring the base url in config.php, (note, if you are still getting the same error, check autoload.php)

$config['base_url'] = "http://somesite.com/somedir/";

Check "autoload"

CodeIgniter file structure:

\application\config\autoload.php

And enable on autoload:

$autoload['helper'] = array(**'url',** 'file');

And it works.

Python error "ImportError: No module named"

My problem was that I added the directory with the __init__.py file to PYTHONPATH, when actually I needed to add its parent directory.

How to get attribute of element from Selenium?

As the recent developed Web Applications are using JavaScript, jQuery, AngularJS, ReactJS etc there is a possibility that to retrieve an attribute of an element through Selenium you have to induce WebDriverWait to synchronize the WebDriver instance with the lagging Web Client i.e. the Web Browser before trying to retrieve any of the attributes.

Some examples:

Python:
- To retrieve any attribute form a visible element (e.g. <h1> tag) you need to use the expected_conditions as visibility_of_element_located(locator) as follows:
```
attribute_value = WebDriverWait(driver, 20).until(EC.visibility_of_element_located((By.ID, "org"))).get_attribute("attribute_name")
```
- To retrieve any attribute form an interactive element (e.g. <input> tag) you need to use the expected_conditions as element_to_be_clickable(locator) as follows:
```
attribute_value = WebDriverWait(driver, 20).until(EC.element_to_be_clickable((By.ID, "org"))).get_attribute("attribute_name")
```

HTML Attributes

Below is a list of some attributes often used in HTML

Note: A complete list of all attributes for each HTML element, is listed in: HTML Attribute Reference

How to Customize a Progress Bar In Android

For using custom drawable:

<?xml version="1.0" encoding="utf-8"?>
<rotate xmlns:android="http://schemas.android.com/apk/res/android"
android:fromDegrees="0"
android:toDegrees="360"
android:drawable="@drawable/my_drawable"
android:pivotX="50%"
android:pivotY="50%" />

(add under res/drawable progress.xml). my_drawable may be xml, png

Then in your layout use

<ProgressBar
        android:id="@+id/progressBar"
        android:indeterminateDrawable="@drawable/progress_circle"
...
/>

Singleton with Arguments in Java

If you want to create a Singleton class serving as a Context, a good way is to have a configuration file and read the parameters from the file inside instance().

If the parameters feeding the Singleton class are got dynamically during the running of your program, simply use a static HashMap storing different instances in your Singleton class to ensure that for each parameter(s), only one instance is created.

How to upgrade scikit-learn package in anaconda

Following Worked for me for scikit-learn on Anaconda-Jupyter Notebook.

Upgrading my scikit-learn from 0.19.1 to 0.19.2 in anaconda installed on Ubuntu on Google VM instance:

Run the following commands in the terminal:

First, check existing available packages with versions by using:

conda list

It will show different packages and their installed versions in the output. Here check for scikit-learn. e.g. for me, the output was:

scikit-learn              0.19.1           py36hedc7406_0

Now I want to Upgrade to 0.19.2 July 2018 release i.e. latest available version.

conda config --append channels conda-forge
conda install scikit-learn=0.19.2

As you are trying to upgrade to 0.17 version try the following command:

conda install scikit-learn=0.17

Now check the required version of the scikit-learn is installed correctly or not by using:

conda list

For me the Output was:

scikit-learn              0.19.2          py36_blas_openblasha84fab4_201  [blas_openblas]  conda-forge

Note: Don't use pip command if you are using Anaconda or Miniconda

I tried following commands:

!conda update conda 
!pip install -U scikit-learn

It will install the required packages also will show in the conda list but if you try to import that package it will not work.

On the website http://scikit-learn.org/stable/install.html it is mentioned as: Warning To upgrade or uninstall scikit-learn installed with Anaconda or conda you should not use the pip.

Best TCP port number range for internal applications

I decided to download the assigned port numbers from IANA, filter out the used ports, and sort each "Unassigned" range in order of most ports available, descending. This did not work, since the csv file has ranges marked as "Unassigned" that overlap other port number reservations. I manually expanded the ranges of assigned port numbers, leaving me with a list of all assigned port numbers. I then sorted that list and generated my own list of unassigned ranges.

Since this stackoverflow.com page ranked very high in my search about the topic, I figured I'd post the largest ranges here for anyone else who is interested. These are for both TCP and UDP where the number of ports in the range is at least 500.

Total   Start   End
829     29170   29998
815     38866   39680
710     41798   42507
681     43442   44122
661     46337   46997
643     35358   36000
609     36866   37474
596     38204   38799
592     33657   34248
571     30261   30831
563     41231   41793
542     21011   21552
528     28590   29117
521     14415   14935
510     26490   26999

Source (via the CSV download button):

http://www.iana.org/assignments/service-names-port-numbers/service-names-port-numbers.xhtml

jQuery Data vs Attr?

You can use data-* attribute to embed custom data. The data-* attributes gives us the ability to embed custom data attributes on all HTML elements.

jQuery .data() method allows you to get/set data of any type to DOM elements in a way that is safe from circular references and therefore from memory leaks.

jQuery .attr() method get/set attribute value for only the first element in the matched set.

Example:

<span id="test" title="foo" data-kind="primary">foo</span>

$("#test").attr("title");
$("#test").attr("data-kind");
$("#test").data("kind");
$("#test").data("value", "bar");

custom facebook share button

The best way is to use your code and then store the image in OG tags in the page you are linking to, then Facebook will pick them up.

<meta property="og:title" content="Facebook Open Graph Demo">
<meta property="og:image" content="http://example.com/main-image.png">
<meta property="og:site_name" content="Example Website">
<meta property="og:description" content="Here is a nice description">

You can find documentation to OG tags and how to use them with share buttons here

In MVC, how do I return a string result?

You can also just return string if you know that's the only thing the method will ever return. For example:

public string MyActionName() {
  return "Hi there!";
}

How to change DatePicker dialog color for Android 5.0

try this, work for me

Put the two options, colorAccent and android:colorAccent

<style name="AppTheme" parent="@style/Theme.AppCompat.Light.NoActionBar">
    <!-- Customize your theme here. -->
   ....
    <item name="android:dialogTheme">@style/AppTheme.DialogTheme</item>
    <item name="android:datePickerDialogTheme">@style/Dialog.Theme</item>
</style>

<style name="AppTheme.DialogTheme" parent="Theme.AppCompat.Light.Dialog">

<!-- Put the two options, colorAccent and android:colorAccent. -->
    <item name="colorAccent">@color/colorPrimary</item>
    <item name="android:colorPrimary">@color/colorPrimary</item>
    <item name="android:colorPrimaryDark">@color/colorPrimaryDark</item>
    <item name="android:colorAccent">@color/colorPrimary</item>
 </style>

How is the AND/OR operator represented as in Regular Expressions?

Or you can use this:

^(?:part[12]|(part)1,\12)$

WordPress path url in js script file

According to the Wordpress documentation, you should use wp_localize_script() in your functions.php file. This will create a Javascript Object in the header, which will be available to your scripts at runtime.

See Codex

Example:

<?php wp_localize_script('mylib', 'WPURLS', array( 'siteurl' => get_option('siteurl') )); ?>

To access this variable within in Javascript, you would simply do:

<script type="text/javascript">
    var url = WPURLS.siteurl;
</script>

SyntaxError: expected expression, got '<'

This problem occurs when your are including file with wrong path and server gives some 404 error in loading file.

How do I solve this error, "error while trying to deserialize parameter"

I have a solution for this but not sure on the reason why this would be different from one environment to the other - although one big difference between the two environments is WSS svc pack 1 was installed on the environment where the error was occurring.

To fix this issue I got a good clue from this link - http://silverlight.net/forums/t/22787.aspx ie to "please check the Xml Schema of your service" and "the sequence in the schema is sorted alphabetically"

Looking at the wsdl generated I noticed that for the serialized class that was causing the error, the properties of this class were not visible in the wsdl.

The Definition of the class had private setters for most of the properties, but not for CustomFields property ie..

[Serializable]
public class FileMetaDataDto
{
    .
    . a constructor...   etc and several other properties edited for brevity
    . 

    public int Id { get; private set; }
    public string Version { get; private set; }
    public List<MetaDataValueDto> CustomFields { get; set; }

}

On removing private from the setter and redeploying the service then looking at the wsdl again, these properties were now visible, and the original error was fixed.

So the wsdl before update was

- <s:complexType name="ArrayOfFileMetaDataDto">
- <s:sequence>
  <s:element minOccurs="0" maxOccurs="unbounded" name="FileMetaDataDto" nillable="true" type="tns:FileMetaDataDto" /> 
  </s:sequence>
  </s:complexType>
- <s:complexType name="FileMetaDataDto">
- <s:sequence>
  <s:element minOccurs="0" maxOccurs="1" name="CustomFields" type="tns:ArrayOfMetaDataValueDto" /> 
  </s:sequence>
  </s:complexType>

The wsdl after update was

- <s:complexType name="ArrayOfFileMetaDataDto">
- <s:sequence>
  <s:element minOccurs="0" maxOccurs="unbounded" name="FileMetaDataDto" nillable="true" type="tns:FileMetaDataDto" /> 
  </s:sequence>
  </s:complexType>
- <s:complexType name="FileMetaDataDto">
- <s:sequence>
  <s:element minOccurs="1" maxOccurs="1" name="Id" type="s:int" /> 
  <s:element minOccurs="0" maxOccurs="1" name="Name" type="s:string" /> 
  <s:element minOccurs="0" maxOccurs="1" name="Title" type="s:string" /> 
  <s:element minOccurs="0" maxOccurs="1" name="ContentType" type="s:string" /> 
  <s:element minOccurs="0" maxOccurs="1" name="Icon" type="s:string" /> 
  <s:element minOccurs="0" maxOccurs="1" name="ModifiedBy" type="s:string" /> 
  <s:element minOccurs="1" maxOccurs="1" name="ModifiedDateTime" type="s:dateTime" /> 
  <s:element minOccurs="1" maxOccurs="1" name="FileSizeBytes" type="s:int" /> 
  <s:element minOccurs="0" maxOccurs="1" name="Url" type="s:string" /> 
  <s:element minOccurs="0" maxOccurs="1" name="RelativeFolderPath" type="s:string" /> 
  <s:element minOccurs="0" maxOccurs="1" name="DisplayVersion" type="s:string" /> 
  <s:element minOccurs="0" maxOccurs="1" name="Version" type="s:string" /> 
  <s:element minOccurs="0" maxOccurs="1" name="CustomFields" type="tns:ArrayOfMetaDataValueDto" /> 
  <s:element minOccurs="0" maxOccurs="1" name="CheckoutBy" type="s:string" /> 
  </s:sequence>
  </s:complexType>

Python convert csv to xlsx

First install openpyxl:

pip install openpyxl

Then:

from openpyxl import Workbook
import csv


wb = Workbook()
ws = wb.active
with open('test.csv', 'r') as f:
    for row in csv.reader(f):
        ws.append(row)
wb.save('name.xlsx')

Making href (anchor tag) request POST instead of GET?

Using jQuery it is very simple assuming the URL you wish to post to is on the same server or has implemented CORS

$(function() {
  $("#employeeLink").on("click",function(e) {
    e.preventDefault(); // cancel the link itself
    $.post(this.href,function(data) {
      $("#someContainer").html(data);
    });
  });
});

If you insist on using frames which I strongly discourage, have a form and submit it with the link

<form action="employee.action" method="post" target="myFrame" id="myForm"></form>

and use (in plain JS)

 window.addEventListener("load",function() {
   document.getElementById("employeeLink").addEventListener("click",function(e) {
     e.preventDefault(); // cancel the link
     document.getElementById("myForm").submit(); // but make sure nothing has name or ID="submit"
   });
 });

Without a form we need to make one

 window.addEventListener("load",function() {
   document.getElementById("employeeLink").addEventListener("click",function(e) {
     e.preventDefault(); // cancel the actual link
     var myForm = document.createElement("form");
     myForm.action=this.href;// the href of the link
     myForm.target="myFrame";
     myForm.method="POST";
     myForm.submit();
   });
 });

How can I call a WordPress shortcode within a template?

Make sure to enable the use of shortcodes in text widgets.

// To enable the use, add this in your *functions.php* file:
add_filter( 'widget_text', 'do_shortcode' );

// and then you can use it in any PHP file:  
<?php echo do_shortcode('[YOUR-SHORTCODE-NAME/TAG]'); ?>

Check the documentation for more.

Could not load NIB in bundle

In my case, I was creating a framework with Cocoapods. The problems was this line:

s.static_framework = true

in my framework.podspec file

After commented this line above all problems to access storyboards or XIBs went out.

Execution failed app:processDebugResources Android Studio

You're hitting bug https://code.google.com/p/android/issues/detail?id=42752. The cause usually seems to be a reference to a nonexistent string in one of your menu resources.

CSS Transition doesn't work with top, bottom, left, right

Something that is not relevant for the OP, but maybe for someone else in the future:

For pixels (px), if the value is "0", the unit can be omitted: right: 0 and right: 0px both work.

However I noticed that in Firefox and Chrome this is not the case for the seconds unit (s). While transition: right 1s ease 0s works, transition: right 1s ease 0 (missing unit s for last value transition-delay) does not (it does work in Edge however).

In the following example, you'll see that right works for both 0px and 0, but transition only works for 0s and it doesn't work with 0.

_x000D_

#box {_x000D_
    border: 1px solid black;_x000D_
    height: 240px;_x000D_
    width: 260px;_x000D_
    margin: 50px;_x000D_
    position: relative;_x000D_
}_x000D_
.jump {_x000D_
    position: absolute;_x000D_
    width: 200px;_x000D_
    height: 50px;_x000D_
    color: white;_x000D_
    padding: 5px;_x000D_
}_x000D_
#jump1 {_x000D_
    background-color: maroon;_x000D_
    top: 0px;_x000D_
    right: 0px;_x000D_
    transition: right 1s ease 0s;_x000D_
}_x000D_
#jump2 {_x000D_
    background-color: green;_x000D_
    top: 60px;_x000D_
    right: 0;_x000D_
    transition: right 1s ease 0s;_x000D_
}_x000D_
#jump3 {_x000D_
    background-color: blue;_x000D_
    top: 120px;_x000D_
    right: 0px;_x000D_
    transition: right 1s ease 0;_x000D_
}_x000D_
#jump4 {_x000D_
    background-color: gray;_x000D_
    top: 180px;_x000D_
    right: 0;_x000D_
    transition: right 1s ease 0;_x000D_
}_x000D_
#box:hover .jump {_x000D_
    right: 50px;_x000D_
}

_x000D_

<div id="box">_x000D_
  <div class="jump" id="jump1">right: 0px<br>transition: right 1s ease 0s</div>_x000D_
  <div class="jump" id="jump2">right: 0<br>transition: right 1s ease 0s</div>_x000D_
  <div class="jump" id="jump3">right: 0px<br>transition: right 1s ease 0</div>_x000D_
  <div class="jump" id="jump4">right: 0<br>transition: right 1s ease 0</div>_x000D_
</div>

_x000D_

Creating temporary files in bash

The mktemp(1) man page explains it fairly well:

Traditionally, many shell scripts take the name of the program with the pid as a suffix and use that as a temporary file name. This kind of naming scheme is predictable and the race condition it creates is easy for an attacker to win. A safer, though still inferior, approach is to make a temporary directory using the same naming scheme. While this does allow one to guarantee that a temporary file will not be subverted, it still allows a simple denial of service attack. For these reasons it is suggested that mktemp be used instead.

In a script, I invoke mktemp something like

mydir=$(mktemp -d "${TMPDIR:-/tmp/}$(basename $0).XXXXXXXXXXXX")

which creates a temporary directory I can work in, and in which I can safely name the actual files something readable and useful.

mktemp is not standard, but it does exist on many platforms. The "X"s will generally get converted into some randomness, and more will probably be more random; however, some systems (busybox ash, for one) limit this randomness more significantly than others

By the way, safe creation of temporary files is important for more than just shell scripting. That's why python has tempfile, perl has File::Temp, ruby has Tempfile, etc…

How can I select all elements without a given class in jQuery?

You could use this to pick all li elements without class:

$('ul#list li:not([class])')

LINQ: combining join and group by

Once you've done this

group p by p.SomeId into pg

you no longer have access to the range variables used in the initial from. That is, you can no longer talk about p or bp, you can only talk about pg.

Now, pg is a group and so contains more than one product. All the products in a given pg group have the same SomeId (since that's what you grouped by), but I don't know if that means they all have the same BaseProductId.

To get a base product name, you have to pick a particular product in the pg group (As you are doing with SomeId and CountryCode), and then join to BaseProducts.

var result = from p in Products                         
 group p by p.SomeId into pg                         
 // join *after* group
 join bp in BaseProducts on pg.FirstOrDefault().BaseProductId equals bp.Id         
 select new ProductPriceMinMax { 
       SomeId = pg.FirstOrDefault().SomeId, 
       CountryCode = pg.FirstOrDefault().CountryCode, 
       MinPrice = pg.Min(m => m.Price), 
       MaxPrice = pg.Max(m => m.Price),
       BaseProductName = bp.Name  // now there is a 'bp' in scope
 };

That said, this looks pretty unusual and I think you should step back and consider what you are actually trying to retrieve.

How to get file creation & modification date/times in Python?

There are two methods to get the mod time, os.path.getmtime() or os.stat(), but the ctime is not reliable cross-platform (see below).

os.path.getmtime()

getmtime(path)
Return the time of last modification of path. The return value is a number giving the number of seconds since the epoch (see the time module). Raise os.error if the file does not exist or is inaccessible. New in version 1.5.2. Changed in version 2.3: If os.stat_float_times() returns True, the result is a floating point number.

os.stat()

stat(path)
Perform a stat() system call on the given path. The return value is an object whose attributes correspond to the members of the stat structure, namely: st_mode (protection bits), st_ino (inode number), st_dev (device), st_nlink (number of hard links), st_uid (user ID of owner), st_gid (group ID of owner), st_size (size of file, in bytes), st_atime (time of most recent access), st_mtime (time of most recent content modification), st_ctime (platform dependent; time of most recent metadata change on Unix, or the time of creation on Windows):

>>> import os
>>> statinfo = os.stat('somefile.txt')
>>> statinfo
(33188, 422511L, 769L, 1, 1032, 100, 926L, 1105022698,1105022732, 1105022732)
>>> statinfo.st_size
926L
>>>

In the above example you would use statinfo.st_mtime or statinfo.st_ctime to get the mtime and ctime, respectively.

Start/Stop and Restart Jenkins service on Windows

To Start Jenkins through Command Line

Run CMD with admin
You can run following commands

"net start servicename" to start

"net restart servicename" to restart

"net stop servicename" to stop service

for more reference https://www.windows-commandline.com/start-stop-service-command-line/

Detecting request type in PHP (GET, POST, PUT or DELETE)

When a method was requested, it will have an array. So simply check with count().

$m=['GET'=>$_GET,'POST'=>$_POST];
foreach($m as$k=>$v){
    echo count($v)?
    $k.' was requested.':null;
}

3v4l.org/U51TE

Format SQL in SQL Server Management Studio

There is a special trick I discovered by accident.

Select the query you wish to format.
Ctrl+Shift+Q (This will open your query in the query designer)
Then just go OK Voila! Query designer will format your query for you. Caveat is that you can only do this for statements and not procedural code, but its better than nothing.

Error while inserting date - Incorrect date value:

This is the date format:

The DATE type is used for values with a date part but no time part. MySQL retrieves and displays DATE values in 'YYYY-MM-DD' format. The supported range is '1000-01-01' to '9999-12-31'.

Why do you insert '07-25-2012' format when MySQL format is '2012-07-25'?. Actually you get this error if the sql_mode is traditional/strict mode else it just enters 0000-00-00 and gives a warning: 1265 - Data truncated for column 'col1' at row 1.

How to create and handle composite primary key in JPA

Key class:

@Embeddable
@Access (AccessType.FIELD)
public class EntryKey implements Serializable {

    public EntryKey() {
    }

    public EntryKey(final Long id, final Long version) {
        this.id = id;
        this.version = version;
    }

    public Long getId() {
        return this.id;
    }

    public void setId(Long id) {
        this.id = id;
    }

    public Long getVersion() {
        return this.version;
    }

    public void setVersion(Long version) {
        this.version = version;
    }

    public boolean equals(Object other) {
        if (this == other)
            return true;
        if (!(other instanceof EntryKey))
            return false;
        EntryKey castOther = (EntryKey) other;
        return id.equals(castOther.id) && version.equals(castOther.version);
    }

    public int hashCode() {
        final int prime = 31;
        int hash = 17;
        hash = hash * prime + this.id.hashCode();
        hash = hash * prime + this.version.hashCode();
        return hash;
    }

    @Column (name = "ID")
    private Long id;
    @Column (name = "VERSION")
    private Long operatorId;
}

Entity class:

@Entity
@Table (name = "YOUR_TABLE_NAME")
public class Entry implements Serializable {

    @EmbeddedId
    public EntryKey getKey() {
        return this.key;
    }

    public void setKey(EntryKey id) {
        this.id = id;
    }

    ...

    private EntryKey key;
    ...
}

How can I duplicate it with another Version?

You can detach entity which retrieved from provider, change the key of Entry and then persist it as a new entity.

How to get last key in an array?

It is strange, but why this topic is not have this answer:

$lastKey = array_keys($array)[count($array)-1];

How do I set up the database.yml file in Rails?

At first I would use http://ruby.railstutorial.org/.

And database.yml is place where you put setup for database your application use - username, password, host - for each database. With new application you dont need to change anything - simply use default sqlite setup.

What is the 'dynamic' type in C# 4.0 used for?

The dynamic keyword is new to C# 4.0, and is used to tell the compiler that a variable's type can change or that it is not known until runtime. Think of it as being able to interact with an Object without having to cast it.

dynamic cust = GetCustomer();
cust.FirstName = "foo"; // works as expected
cust.Process(); // works as expected
cust.MissingMethod(); // No method found!

Notice we did not need to cast nor declare cust as type Customer. Because we declared it dynamic, the runtime takes over and then searches and sets the FirstName property for us. Now, of course, when you are using a dynamic variable, you are giving up compiler type checking. This means the call cust.MissingMethod() will compile and not fail until runtime. The result of this operation is a RuntimeBinderException because MissingMethod is not defined on the Customer class.

The example above shows how dynamic works when calling methods and properties. Another powerful (and potentially dangerous) feature is being able to reuse variables for different types of data. I'm sure the Python, Ruby, and Perl programmers out there can think of a million ways to take advantage of this, but I've been using C# so long that it just feels "wrong" to me.

dynamic foo = 123;
foo = "bar";

OK, so you most likely will not be writing code like the above very often. There may be times, however, when variable reuse can come in handy or clean up a dirty piece of legacy code. One simple case I run into often is constantly having to cast between decimal and double.

decimal foo = GetDecimalValue();
foo = foo / 2.5; // Does not compile
foo = Math.Sqrt(foo); // Does not compile
string bar = foo.ToString("c");

The second line does not compile because 2.5 is typed as a double and line 3 does not compile because Math.Sqrt expects a double. Obviously, all you have to do is cast and/or change your variable type, but there may be situations where dynamic makes sense to use.

dynamic foo = GetDecimalValue(); // still returns a decimal
foo = foo / 2.5; // The runtime takes care of this for us
foo = Math.Sqrt(foo); // Again, the DLR works its magic
string bar = foo.ToString("c");

What is the optimal way to compare dates in Microsoft SQL server?

Here is an example:

I've an Order table with a DateTime field called OrderDate. I want to retrieve all orders where the order date is equals to 01/01/2006. there are next ways to do it:

1) WHERE DateDiff(dd, OrderDate, '01/01/2006') = 0
2) WHERE Convert(varchar(20), OrderDate, 101) = '01/01/2006'
3) WHERE Year(OrderDate) = 2006 AND Month(OrderDate) = 1 and Day(OrderDate)=1
4) WHERE OrderDate LIKE '01/01/2006%'
5) WHERE OrderDate >= '01/01/2006'  AND OrderDate < '01/02/2006'

Is found here

PHP salt and hash SHA256 for login password

According to php.net the Salt option has been deprecated as of PHP 7.0.0, so you should use the salt that is generated by default and is far more simpler

Example for store the password:

$hashPassword = password_hash("password", PASSWORD_BCRYPT);

Example to verify the password:

$passwordCorrect = password_verify("password", $hashPassword);

Nested select statement in SQL Server

You need to alias the subquery.

SELECT name FROM (SELECT name FROM agentinformation) a

or to be more explicit

SELECT a.name FROM (SELECT name FROM agentinformation) a

Java 8: Difference between two LocalDateTime in multiple units

After more than five years I answer my question. I think that the problem with a negative duration can be solved by a simple correction:

LocalDateTime fromDateTime = LocalDateTime.of(2014, 9, 9, 7, 46, 45);
LocalDateTime toDateTime = LocalDateTime.of(2014, 9, 10, 6, 46, 45);

Period period = Period.between(fromDateTime.toLocalDate(), toDateTime.toLocalDate());
Duration duration = Duration.between(fromDateTime.toLocalTime(), toDateTime.toLocalTime());

if (duration.isNegative()) {
    period = period.minusDays(1);
    duration = duration.plusDays(1);
}
long seconds = duration.getSeconds();
long hours = seconds / SECONDS_PER_HOUR;
long minutes = ((seconds % SECONDS_PER_HOUR) / SECONDS_PER_MINUTE);
long secs = (seconds % SECONDS_PER_MINUTE);
long time[] = {hours, minutes, secs};
System.out.println(period.getYears() + " years "
            + period.getMonths() + " months "
            + period.getDays() + " days "
            + time[0] + " hours "
            + time[1] + " minutes "
            + time[2] + " seconds.");

Note: The site https://www.epochconverter.com/date-difference now correctly calculates the time difference.

Thank you all for your discussion and suggestions.

With android studio no jvm found, JAVA_HOME has been set

Though, the question is asked long back, I see this same issue recently after installing Android Studio 2.1.0v, and JDK 7.80 on my PC Windows 10, 32 bit OS. I got this error.

No JVM installation found. Please install a 32 bit JDK. If you already have a JDK installed define a JAVA_HOME variable in Computer > System Properties > System Settings > Environment Variables.

I tried different ways to fix this nothing worked. But As per System Requirements in this Android developer website link.

Its solved after installing JDK 8(jdk-8u101-windows-i586.exe) JDK download site link.

Hope it helps somebody.

Python 3.1.1 string to hex

Yet another method:

s = 'hello'

h = ''.join([hex(ord(i)) for i in s]);

# outputs: '0x680x650x6c0x6c0x6f'

This basically splits the string into chars, does the conversion through hex(ord(char)), and joins the chars back together. In case you want the result without the prefix 0x then do:

h = ''.join([str(hex(ord(i)))[2:4] for i in s]);

# outputs: '68656c6c6f'

Tested with Python 3.5.3.

How to find the socket buffer size of linux

Atomic size is 4096 bytes, max size is 65536 bytes. Sendfile uses 16 pipes each of 4096 bytes size. cmd : ioctl(fd, FIONREAD, &buff_size).

PreparedStatement setNull(..)

This guide says:

6.1.5 Sending JDBC NULL as an IN parameter

The setNull method allows a programmer to send a JDBC NULL (a generic SQL NULL) value to the database as an IN parameter. Note, however, that one must still specify the JDBC type of the parameter.

A JDBC NULL will also be sent to the database when a Java null value is passed to a setXXX method (if it takes Java objects as arguments). The method setObject, however, can take a null value only if the JDBC type is specified.

So yes they're equivalent.

How do I automatically scroll to the bottom of a multiline text box?

This only worked for me...

txtSerialLogging->Text = "";

txtSerialLogging->AppendText(s);

I tried all the cases above, but the problem is in my case text s can decrease, increase and can also remain static for a long time. static means , static length(lines) but content is different.

So, I was facing one line jumping situation at the end when the length(lines) remains same for some times...

Selecting non-blank cells in Excel with VBA

This might be completely off base, but can't you just copy the whole column into a new spreadsheet and then sort the column? I'm assuming that you don't need to maintain the order integrity.

How to delete a record by id in Flask-SQLAlchemy

Another possible solution specially if you want batch delete

deleted_objects = User.__table__.delete().where(User.id.in_([1, 2, 3]))
session.execute(deleted_objects)
session.commit()

How to get all registered routes in Express?

This worked for me

let routes = []
app._router.stack.forEach(function (middleware) {
    if(middleware.route) {
        routes.push(Object.keys(middleware.route.methods) + " -> " + middleware.route.path);
    }
});

console.log(JSON.stringify(routes, null, 4));

O/P:

[
    "get -> /posts/:id",
    "post -> /posts",
    "patch -> /posts"
]

How to do 3 table JOIN in UPDATE query?

An alternative General Plan, which I'm only adding as an independent Answer because the blasted "comment on an answer" won't take newlines without posting the entire edit, even though it isn't finished yet.

UPDATE table A
JOIN table B ON {join fields}
JOIN table C ON {join fields}
JOIN {as many tables as you need}
SET A.column = {expression}

Example:

UPDATE person P
JOIN address A ON P.home_address_id = A.id
JOIN city C ON A.city_id = C.id
SET P.home_zip = C.zipcode;

Extract regression coefficient values

A summary.lm object stores these values in a matrix called 'coefficients'. So the value you are after can be accessed with:

a2Pval <- summary(mg)$coefficients[2, 4]

Or, more generally/readably, coef(summary(mg))["a2","Pr(>|t|)"]. See here for why this method is preferred.

Telling gcc directly to link a library statically

You can add .a file in the linking command:

  gcc yourfiles /path/to/library/libLIBRARY.a

But this is not talking with gcc driver, but with ld linker as options like -Wl,anything are.

When you tell gcc or ld -Ldir -lLIBRARY, linker will check both static and dynamic versions of library (you can see a process with -Wl,--verbose). To change order of library types checked you can use -Wl,-Bstatic and -Wl,-Bdynamic. Here is a man page of gnu LD: http://linux.die.net/man/1/ld

To link your program with lib1, lib3 dynamically and lib2 statically, use such gcc call:

gcc program.o -llib1 -Wl,-Bstatic -llib2 -Wl,-Bdynamic -llib3

Assuming that default setting of ld is to use dynamic libraries (it is on Linux).

android pinch zoom

I have an open source library that does this very well. It's a four gesture library that comes with an out-of-the-box pan zoom setting. You can find it here: https://bitbucket.org/warwick/hacergestov3 Or you can download the demo app here: https://play.google.com/store/apps/details?id=com.WarwickWestonWright.HacerGestoV3Demo This is a pure canvas library so it can be used in pretty any scenario. Hope this helps.

Remove trailing newline from the elements of a string list

This can be done using list comprehensions as defined in PEP 202

[w.strip() for w in  ['this\n', 'is\n', 'a\n', 'list\n', 'of\n', 'words\n']]

Conditionally Remove Dataframe Rows with R

Use the which function:

A <- c('a','a','b','b','b')
B <- c(1,0,1,1,0)
d <- data.frame(A, B)

r <- with(d, which(B==0, arr.ind=TRUE))
newd <- d[-r, ]

regex match any single character (one character only)

Simple answer

If you want to match single character, put it inside those brackets [ ]

Examples

match + ...... [+] or +
match a ...... a
match & ...... &

...and so on. You can check your regular expresion online on this site: https://regex101.com/

(updated based on comment)

Javascript | Set all values of an array

Actually, you can use this perfect approach:

let arr = Array.apply(null, Array(5)).map(() => 0);
// [0, 0, 0, 0, 0]

This code will create array and fill it with zeroes. Or just:

let arr = new Array(5).fill(0)

Spring Data JPA find by embedded object property

According to me, Spring doesn't handle all the cases with ease. In your case the following should do the trick

Page<QueuedBook> findByBookIdRegion(Region region, Pageable pageable);

Page<QueuedBook> findByBookId_Region(Region region, Pageable pageable);

However, it also depends on the naming convention of fields that you have in your @Embeddable class,

e.g. the following field might not work in any of the styles that mentioned above

private String cRcdDel;

I tried with both the cases (as follows) and it didn't work (it seems like Spring doesn't handle this type of naming conventions(i.e. to many Caps , especially in the beginning - 2nd letter (not sure about if this is the only case though)

Page<QueuedBook> findByBookIdCRcdDel(String cRcdDel, Pageable pageable);

Page<QueuedBook> findByBookIdCRcdDel(String cRcdDel, Pageable pageable);

When I renamed column to

private String rcdDel;

my following solutions work fine without any issue:

Page<QueuedBook> findByBookIdRcdDel(String rcdDel, Pageable pageable);

Page<QueuedBook> findByBookIdRcdDel(String rcdDel, Pageable pageable);

How do I print the percent sign(%) in c

Try printing out this way

printf("%%");

Delete cookie by name?

In my case I used blow code for different environment.

  document.cookie = name +`=; Path=/; Expires=Thu, 01 Jan 1970 00:00:01 GMT;Domain=.${document.domain.split('.').splice(1).join('.')}`;

Eclipse error "Could not find or load main class"

you should add bin folder - run->run Configuration tab classpath advanced button - add folder - choose bin folder (yourproyect/bin)

Programs & Examples On #Rinari

Jquery resizing image

Why should I prefer to use member initialization lists?

Xcode 6 Bug: Unknown class in Interface Builder file

How to convert JSON object to JavaScript array?

What's the difference between "Write-Host", "Write-Output", or "[console]::WriteLine"?

How to generate different random numbers in a loop in C++?

What is the best way to initialize a JavaScript Date to midnight?

How do I display image in Alert/confirm box in Javascript?

Setting the correct encoding when piping stdout in Python

How do you create a Distinct query in HQL

MIN and MAX in C

Position buttons next to each other in the center of page

SQLAlchemy: What's the difference between flush() and commit()?

What is private bytes, virtual bytes, working set?

How do I trap ctrl-c (SIGINT) in a C# console app

Android App Not Install. An existing package by the same name with a conflicting signature is already installed

Docker compose port mapping

C#: How would I get the current time into a string?

What is the difference between 'java', 'javaw', and 'javaws'?

What is referencedColumnName used for in JPA?

Q/A

What is the difference between `Enum.name()` and `Enum.toString()`?

Modulo operation with negative numbers

CSS z-index not working (position absolute)

Copy a variable's value into another

Unable to set data attribute using jQuery Data() API

Format date to MM/dd/yyyy in JavaScript

How to delete a file or folder?

For deleting files:

For deleting folders:

For deleting folders recursively towards parent:

URL encode sees “&” (ampersand) as “&amp;” HTML entity

USB Debugging option greyed out

How can I generate random number in specific range in Android?

How to add an element at the end of an array?

Warning: mysqli_error() expects exactly 1 parameter, 0 given error

How to get the first 2 letters of a string in Python?

Test if number is odd or even

PHP DOMDocument loadHTML not encoding UTF-8 correctly

ShowAllData method of Worksheet class failed

jQuery: get parent tr for selected radio button

Tell Ruby Program to Wait some amount of time

Limit file format when using <input type="file">?

How is length implemented in Java Arrays?

Plot Normal distribution with Matplotlib

Note: This solution is using pylab, not matplotlib.pyplot

How to customize <input type="file">?

Check if element is clickable in Selenium Java

A Windows equivalent of the Unix tail command

Could not execute menu item (internal error)[Exception] - When changing PHP version from 5.3.1 to 5.2.9

How to delete an SVN project from SVN repository

How do I find an element position in std::vector?

sudo echo "something" >> /etc/privilegedFile doesn't work

iPhone UITextField - Change placeholder text color

Javascript String to int conversion

Select DataFrame rows between two dates

Install python 2.6 in CentOS

Get index of clicked element in collection with jQuery

Create dataframe from a matrix

What good are SQL Server schemas?

How To Save Canvas As An Image With canvas.toDataURL()?

How to return a PNG image from Jersey REST service method to the browser

How do I set 'semi-bold' font via CSS? Font-weight of 600 doesn't make it look like the semi-bold I see in my Photoshop file

loading json data from local file into React JS

Iterating over every two elements in a list

Why is a div with "display: table-cell;" not affected by margin?

CSS On hover show another element

Difference between int and double

Eclipse - "Workspace in use or cannot be created, chose a different one."

Start redis-server with config file

Java Convert GMT/UTC to Local time doesn't work as expected

Making authenticated POST requests with Spring RestTemplate for Android

HTTP 404 when accessing .svc file in IIS

Remove empty space before cells in UITableView

go to link on button click - jquery

How to auto-remove trailing whitespace in Eclipse?

Set textarea width to 100% in bootstrap modal

How to handle windows file upload using Selenium WebDriver?

How do I clear the content of a div using JavaScript?

URL encode sees “&” (ampersand) as “&” HTML entity

Note: This solution is using `pylab`, not `matplotlib.pyplot`

Why doesn't GCC optimize aaaaaa to (aaa)(aaa)?

Option 1 A: Clearing `innerHTML`.

Option 1 B: Clearing `textContent`

Option 2 A: Looping to remove every `lastChild`:

Option 2 B: Looping to remove every `lastElementChild`:

Bonus: `Element.clearChildren` monkey-patch:

In HTML I can make a checkmark with ✓ . Is there a corresponding X-mark?