Swift 4

You can somewhat think about it as array of object vs. array of references.

• [SKSpriteNode] must contain actual objects
• [SKSpriteNode?] can contain either references to objects, or nil

Examples

1. Creating an array with 64 default SKSpriteNode:

   var sprites = [SKSpriteNode](repeatElement(SKSpriteNode(texture: nil),
                                              count: 64))
   

2. Creating an array with 64 empty slots (a.k.a optionals):

   var optionalSprites = [SKSpriteNode?](repeatElement(nil,
                                         count: 64))
   

3. Converting an array of optionals into an array of objects (collapsing [SKSpriteNode?] into [SKSpriteNode]):

   let flatSprites = optionalSprites.flatMap { $0 }
   

   The count of the resulting flatSprites depends on the count of objects in optionalSprites: empty optionals will be ignored, i.e. skipped.

Cache-Control: private

Indicates that all or part of the response message is intended for a single user and MUST NOT be cached by a shared cache, such as a proxy server.

From RFC2616 section 14.9.1

There's a lot of typedef going on here. Personally I'm against "hiding the asterisk", i.e. typedef:ing pointer types into something that doesn't look like a pointer. In C, pointers are quite important and really affect the code, there's a lot of difference between foo and foo *.

Many of the answers are also confused about this, I think.

Your allocation of an array of Chess values, which are pointers to values of type chess (again, a very confusing nomenclature that I really can't recommend) should be like this:

Chess *array = malloc(n * sizeof *array);

Then, you need to initialize the actual instances, by looping:

for(i = 0; i < n; ++i)
  array[i] = NULL;

This assumes you don't want to allocate any memory for the instances, you just want an array of pointers with all pointers initially pointing at nothing.

If you wanted to allocate space, the simplest form would be:

for(i = 0; i < n; ++i)
  array[i] = malloc(sizeof *array[i]);

See how the sizeof usage is 100% consistent, and never starts to mention explicit types. Use the type information inherent in your variables, and let the compiler worry about which type is which. Don't repeat yourself.

Of course, the above does a needlessly large amount of calls to malloc(); depending on usage patterns it might be possible to do all of the above with just one call to malloc(), after computing the total size needed. Then you'd still need to go through and initialize the array[i] pointers to point into the large block, of course.

This problem also arises when you have mockito-all on your class path, which is already deprecated.

If possible just include mockito-core.

Maven config for mixing junit, mockito and hamcrest:

<dependencies>
  <dependency>
    <groupId>org.hamcrest</groupId>
    <artifactId>hamcrest-core</artifactId>
    <version>1.3</version>
    <scope>test</scope>
  </dependency>
  <dependency>
    <groupId>org.hamcrest</groupId>
    <artifactId>hamcrest-library</artifactId>
    <version>1.3</version>
    <scope>test</scope>
  </dependency>
  <dependency>
    <groupId>org.mockito</groupId>
    <artifactId>mockito-all</artifactId>
    <version>1.9.5</version>
    <scope>test</scope>
  </dependency>
  <dependency>
    <groupId>junit</groupId>
    <artifactId>junit</artifactId>
    <version>4.11</version>
    <scope>test</scope>
  </dependency>
</dependencies>

1. Your jsfiddle uses background-image instead of background
2. It seems to be a case of "not supported by this browser yet".

This works in Opera : http://jsfiddle.net/ZNsbU/5/
But it doesn't work in FF5 nor IE8. (yay for outdated browsers :D )

Code :

body {
  background:url(http://www.google.com/intl/en_com/images/srpr/logo3w.png) 400px 200px / 600px 400px no-repeat;
}

You could do it like this :

body {
    background:url(http://www.google.com/intl/en_com/images/srpr/logo3w.png) 400px 400px no-repeat;
    background-size:20px 20px
}

Which works in FF5 and Opera but not in IE8.

Cookie is just another HTTP header.

import urllib2
opener = urllib2.build_opener()
opener.addheaders.append(('Cookie', 'cookiename=cookievalue'))
f = opener.open("http://example.com/")

See urllib2 examples for other ways how to add HTTP headers to your request.

There are more ways how to handle cookies. Some modules like cookielib try to behave like web browser - remember what cookies did you get previously and automatically send them again in following requests.

To avoid update names that contain .com like [email protected] to [email protected], you can do this:

UPDATE Yourtable
SET Email = LEFT(@Email, LEN(@Email) - 4) + REPLACE(RIGHT(@Email, 4), '.com', '.org')

You can generate scripts to a file via SQL Server Management Studio, here are the steps:

1. Right click the database you want to generate scripts for (not the table) and select tasks - generate scripts
2. Next, select the requested table/tables, views, stored procedures, etc (from select specific database objects)
3. Click advanced - select the types of data to script
4. Click Next and finish

MSDN Generate Scripts

When generating the scripts, there is an area that will allow you to script, constraints, keys, etc. From SQL Server 2008 R2 there is an Advanced Option under scripting:

Bash 3.0+ can use this syntax:

for i in {1..10} ; do ... ; done

..which avoids spawning an external program to expand the sequence (such as seq 1 10).

Of course, this has the same problem as the for(()) solution, being tied to bash and even a particular version (if this matters to you).

Try viewports

You can use the width data and calculate the height accordingly

This example is for an 150x200px image

width: calc(100vw / 2 - 30px);
height: calc((100vw/2 - 30px) * 1.34);

To redirect Without Query String add below lines in Server block under listen port line:

if ($uri ~ .*.containingString$) {
           return 301 https://$host/$uri/;
}

With Query String:

if ($uri ~ .*.containingString$) {
           return 301 https://$host/$uri/?$query_string;
}

Another way to remove the "save image" context menu is to use some CSS. This also leaves the rest of the context-menu intact.

img {
    pointer-events: none;
}

It makes all img elements non-reactive to any mouse events such as dragging, hovering, clicking etc.

See spec for more info.

Nobody suggested Vagrant yet, so here it is, Vagrant box for OSX

vagrant init https://vagrant-osx.nyc3.digitaloceanspaces.com/osx-sierra-0.3.1.box
vagrant up

and you have a MACOS virtual machine. But according to Apple's EULA, you still need to run it on MacOS hardware :D But anywhere, here's one to all of you geeks who wiped MacOS and installed Ubuntu :D

Unfortunately, you can't run the editors from inside using SSH X-forwarding option.

An index is used to speed up searching in the database. MySQL have some good documentation on the subject (which is relevant for other SQL servers as well): http://dev.mysql.com/doc/refman/5.0/en/mysql-indexes.html

An index can be used to efficiently find all rows matching some column in your query and then walk through only that subset of the table to find exact matches. If you don't have indexes on any column in the WHERE clause, the SQL server has to walk through the whole table and check every row to see if it matches, which may be a slow operation on big tables.

The index can also be a UNIQUE index, which means that you cannot have duplicate values in that column, or a PRIMARY KEY which in some storage engines defines where in the database file the value is stored.

In MySQL you can use EXPLAIN in front of your SELECT statement to see if your query will make use of any index. This is a good start for troubleshooting performance problems. Read more here: http://dev.mysql.com/doc/refman/5.0/en/explain.html

Loop like

foreach (GridViewRow row in grid.Rows)
{
   if (((CheckBox)row.FindControl("chkboxid")).Checked)
   {
    //read the label            
   }            
}

The accepted answer gave two locations:

here

C:\Documents and Settings\Administrator\Local Settings\Temp\VWDWebCache

and possibly here

C:\Documents and Settings\Administrator\Local Settings\Application Data\Microsoft\WebsiteCache

Did you try those?

Edited to add

On my Windows Vista machine, it's located in

%Temp%\VWDWebCache

and in

%LocalAppData%\Microsoft\WebsiteCache

From your additional information (regarding team edition) this comes from Clear Client TFS Cache:

Clear Client TFS Cache

Visual Studio and Team Explorer provide a caching mechanism which can get out of sync. If I have multiple instances of a single TFS which can be connected to from a single Visual Studio client, that client can become confused.

To solve it..

For Windows Vista delete contents of this folder

%LocalAppData%\Microsoft\Team Foundation\1.0\Cache

How about this solution

$order = array(1,5,2,4,3,6);

$array = array(
    1 => 'one',
    2 => 'two',
    3 => 'three',
    4 => 'four',
    5 => 'five',
    6 => 'six'
);

uksort($array, function($key1, $key2) use ($order) {
    return (array_search($key1, $order) > array_search($key2, $order));
});

I was trying to solve the same with a list of objects and was having issues because I was trying to repack the list of groups into the original list. So I came up with looping through the groups to repack the original List with items that have duplicates.

public List<MediaFileInfo> GetDuplicatePictures()
{
    List<MediaFileInfo> dupes = new List<MediaFileInfo>();
    var grpDupes = from f in _fileRepo
                   group f by f.Length into grps
                   where grps.Count() >1
                   select grps;
    foreach (var item in grpDupes)
    {
        foreach (var thing in item)
        {
            dupes.Add(thing);
        }
    }
    return dupes;
}

Sounds like a perfect job for grep or perhaps ack

Or this wonderful construction:

find . -type f \( -name *.php -o -name *.html -o -name *.js \) -exec grep "document.cookie\|setcookie" /dev/null {} \;

Rows("2:2").Select
ActiveWindow.FreezePanes = True

Select a different range for a different effect, much the same way you would do manually. The "Freeze Top Row" really just is a shortcut new in Excel 2007 (and up), it contains no added functionality compared to earlier versions of Excel.

I was facing the same problem in one of my projects and have decided to make a custom widget that has both the date and the time picker in one user-friendly dialog. You can get the source code along with an example at http://code.google.com/p/datetimepicker/. The code is licensed under Apache 2.0.

The best thing I've found for diagnosing things like this is the service trace viewer. It's pretty simple to set up (assuming you can edit the configs):

http://msdn.microsoft.com/en-us/library/ms732023.aspx

Hope this helps.

I think you are right by saying that people cannot click half pixels, so personally, I would use rounded jQuery offset...

.m2 directory on linux box usually would be $HOME/.m2

you could get the $HOME :

echo $HOME

or simply:

cd <enter>

to go to your home directory.

other information from maven site: http://maven.apache.org/download.html#Installation

In Eclipse, make sure you add your source folder in the project properties -> java build path -> source. Otherwise, the main() function may not be included in your project.

I had this issue with MacOS High Sierria.

You can set up locale as well as language to UTF-8 format using below command :

export LC_ALL=en_US.UTF-8
export LANG=en_US.UTF-8

Now in order to check whether locale environment is updated use below command :

Locale

Like this:

@Html.DropDownListFor(model => model.Status, new List<SelectListItem> 
       { new SelectListItem{Text="Active", Value="True"},
         new SelectListItem{Text="Deactive", Value="False"}},"Select One")

If you want Active to be selected by default then use Selected property of SelectListItem:

@Html.DropDownListFor(model => model.Status, new List<SelectListItem> 
           { new SelectListItem{Text="Active", Value="True",Selected=true},
             new SelectListItem{Text="Deactive", Value="False"}},"Select One")

If using SelectList, then you have to use this overload and specify SelectListItem Value property which you want to set selected:

@Html.DropDownListFor(model => model.title, 
                     new SelectList(new List<SelectListItem>
  {
      new SelectListItem { Text = "Active" , Value = "True"},
      new SelectListItem { Text = "InActive", Value = "False" }
  },
    "Value", // property to be set as Value of dropdown item
    "Text",  // property to be used as text of dropdown item
    "True"), // value that should be set selected of dropdown
     new { @class = "form-control" })

As far as I know, strong and retain are synonyms, so they do exactly the same.

Then the weak is almost like assign, but automatically set to nil after the object, it is pointing to, is deallocated.

That means, you can simply replace them.

However, there is one special case I've encountered, where I had to use assign, rather than weak. Let's say we have two properties delegateAssign and delegateWeak. In both is stored our delegate, that is owning us by having the only strong reference. The delegate is deallocating, so our -dealloc method is called too.

// Our delegate is deallocating and there is no other strong ref.
- (void)dealloc {
    [delegateWeak doSomething];
    [delegateAssign doSomething];
}

The delegate is already in deallocation process, but still not fully deallocated. The problem is that weak references to him are already nullified! Property delegateWeak contains nil, but delegateAssign contains valid object (with all properties already released and nullified, but still valid).

// Our delegate is deallocating and there is no other strong ref.
- (void)dealloc {
    [delegateWeak doSomething]; // Does nothing, already nil.
    [delegateAssign doSomething]; // Successful call.
}

It is quite special case, but it reveal us how those weak variables work and when they are nullified.

Try dropping the \ in front of the >.

Edit: I just tested your regex and it works fine. This is what I used:

<?
    $content = "this is something with an <img src=\"test.png\"/> in it.";
    $content = preg_replace("/<img[^>]+\>/i", "(image) ", $content); 
    echo $content;
?>

The result is:

this is something with an (image)  in it.

 //Trying to do more than one thing to the object in the same context, 
//the solution is to work on single context objects

public class SingletonContext<TContext>
    where TContext: DbContext,new()
{
    private static TContext _context;

    private SingletonContext()
    {

    }
    public static TContext GetInstance()
    {
        if (_context == null)
        {
            _context = new TContext();
        }
        return _context;
    }

}

From here:

http://www.christianengvall.se/undo-pushed-merge-git/

git revert -m 1 <merge commit hash>

Git revert adds a new commit that rolls back the specified commit.

Using -m 1 tells it that this is a merge and we want to roll back to the parent commit on the master branch. You would use -m 2 to specify the develop branch.

Isn't this maybe the most elegant?

REPLACE 
INTO component_psar (tbl_id, row_nr, col_1, col_2, col_3, col_4, col_5, col_6, unit, add_info, fsar_lock) 
VALUES('2', '1', '1', '1', '1', '1', '1', '1', '1', '1', 'N')

see: http://dev.mysql.com/doc/refman/5.7/en/replace.html

You can access values in the $_POST array by their key. $_POST is an associative array, so to access taskOption you would use $_POST['taskOption'];.

Make sure to check if it exists in the $_POST array before proceeding though.

<form method="post" action="process.php">
  <select name="taskOption">
    <option value="first">First</option>
    <option value="second">Second</option>
    <option value="third">Third</option>
  </select>
  <input type="submit" value="Submit the form"/>
</form>

process.php

<?php
   $option = isset($_POST['taskOption']) ? $_POST['taskOption'] : false;
   if ($option) {
      echo htmlentities($_POST['taskOption'], ENT_QUOTES, "UTF-8");
   } else {
     echo "task option is required";
     exit; 
   }

Here is the class you asked for:

namespace AI.Collections {
    using System;
    using System.Collections;
    using System.Collections.Generic;
    using System.Linq;
    using System.Runtime.Serialization;
    using System.Threading.Tasks;
    using System.Threading.Tasks.Dataflow;

    /// <summary>
    ///     Just a simple thread safe collection.
    /// </summary>
    /// <typeparam name="T"></typeparam>
    /// <value>Version 1.5</value>
    /// <remarks>TODO replace locks with AsyncLocks</remarks>
    [DataContract( IsReference = true )]
    public class ThreadSafeList<T> : IList<T> {
        /// <summary>
        ///     TODO replace the locks with a ReaderWriterLockSlim
        /// </summary>
        [DataMember]
        private readonly List<T> _items = new List<T>();

        public ThreadSafeList( IEnumerable<T> items = null ) { this.Add( items ); }

        public long LongCount {
            get {
                lock ( this._items ) {
                    return this._items.LongCount();
                }
            }
        }

        public IEnumerator<T> GetEnumerator() { return this.Clone().GetEnumerator(); }

        IEnumerator IEnumerable.GetEnumerator() { return this.GetEnumerator(); }

        public void Add( T item ) {
            if ( Equals( default( T ), item ) ) {
                return;
            }
            lock ( this._items ) {
                this._items.Add( item );
            }
        }

        public Boolean TryAdd( T item ) {
            try {
                if ( Equals( default( T ), item ) ) {
                    return false;
                }
                lock ( this._items ) {
                    this._items.Add( item );
                    return true;
                }
            }
            catch ( NullReferenceException ) { }
            catch ( ObjectDisposedException ) { }
            catch ( ArgumentNullException ) { }
            catch ( ArgumentOutOfRangeException ) { }
            catch ( ArgumentException ) { }
            return false;
        }

        public void Clear() {
            lock ( this._items ) {
                this._items.Clear();
            }
        }

        public bool Contains( T item ) {
            lock ( this._items ) {
                return this._items.Contains( item );
            }
        }

        public void CopyTo( T[] array, int arrayIndex ) {
            lock ( this._items ) {
                this._items.CopyTo( array, arrayIndex );
            }
        }

        public bool Remove( T item ) {
            lock ( this._items ) {
                return this._items.Remove( item );
            }
        }

        public int Count {
            get {
                lock ( this._items ) {
                    return this._items.Count;
                }
            }
        }

        public bool IsReadOnly { get { return false; } }

        public int IndexOf( T item ) {
            lock ( this._items ) {
                return this._items.IndexOf( item );
            }
        }

        public void Insert( int index, T item ) {
            lock ( this._items ) {
                this._items.Insert( index, item );
            }
        }

        public void RemoveAt( int index ) {
            lock ( this._items ) {
                this._items.RemoveAt( index );
            }
        }

        public T this[ int index ] {
            get {
                lock ( this._items ) {
                    return this._items[ index ];
                }
            }
            set {
                lock ( this._items ) {
                    this._items[ index ] = value;
                }
            }
        }

        /// <summary>
        ///     Add in an enumerable of items.
        /// </summary>
        /// <param name="collection"></param>
        /// <param name="asParallel"></param>
        public void Add( IEnumerable<T> collection, Boolean asParallel = true ) {
            if ( collection == null ) {
                return;
            }
            lock ( this._items ) {
                this._items.AddRange( asParallel
                                              ? collection.AsParallel().Where( arg => !Equals( default( T ), arg ) )
                                              : collection.Where( arg => !Equals( default( T ), arg ) ) );
            }
        }

        public Task AddAsync( T item ) {
            return Task.Factory.StartNew( () => { this.TryAdd( item ); } );
        }

        /// <summary>
        ///     Add in an enumerable of items.
        /// </summary>
        /// <param name="collection"></param>
        public Task AddAsync( IEnumerable<T> collection ) {
            if ( collection == null ) {
                throw new ArgumentNullException( "collection" );
            }

            var produce = new TransformBlock<T, T>( item => item, new ExecutionDataflowBlockOptions { MaxDegreeOfParallelism = Environment.ProcessorCount } );

            var consume = new ActionBlock<T>( action: async obj => await this.AddAsync( obj ), dataflowBlockOptions: new ExecutionDataflowBlockOptions { MaxDegreeOfParallelism = Environment.ProcessorCount } );
            produce.LinkTo( consume );

            return Task.Factory.StartNew( async () => {
                collection.AsParallel().ForAll( item => produce.SendAsync( item ) );
                produce.Complete();
                await consume.Completion;
            } );
        }

        /// <summary>
        ///     Returns a new copy of all items in the <see cref="List{T}" />.
        /// </summary>
        /// <returns></returns>
        public List<T> Clone( Boolean asParallel = true ) {
            lock ( this._items ) {
                return asParallel
                               ? new List<T>( this._items.AsParallel() )
                               : new List<T>( this._items );
            }
        }

        /// <summary>
        ///     Perform the <paramref name="action" /> on each item in the list.
        /// </summary>
        /// <param name="action">
        ///     <paramref name="action" /> to perform on each item.
        /// </param>
        /// <param name="performActionOnClones">
        ///     If true, the <paramref name="action" /> will be performed on a <see cref="Clone" /> of the items.
        /// </param>
        /// <param name="asParallel">
        ///     Use the <see cref="ParallelQuery{TSource}" /> method.
        /// </param>
        /// <param name="inParallel">
        ///     Use the
        ///     <see
        ///         cref="Parallel.ForEach{TSource}(System.Collections.Generic.IEnumerable{TSource},System.Action{TSource})" />
        ///     method.
        /// </param>
        public void ForEach( Action<T> action, Boolean performActionOnClones = true, Boolean asParallel = true, Boolean inParallel = false ) {
            if ( action == null ) {
                throw new ArgumentNullException( "action" );
            }
            var wrapper = new Action<T>( obj => {
                try {
                    action( obj );
                }
                catch ( ArgumentNullException ) {
                    //if a null gets into the list then swallow an ArgumentNullException so we can continue adding
                }
            } );
            if ( performActionOnClones ) {
                var clones = this.Clone( asParallel: asParallel );
                if ( asParallel ) {
                    clones.AsParallel().ForAll( wrapper );
                }
                else if ( inParallel ) {
                    Parallel.ForEach( clones, wrapper );
                }
                else {
                    clones.ForEach( wrapper );
                }
            }
            else {
                lock ( this._items ) {
                    if ( asParallel ) {
                        this._items.AsParallel().ForAll( wrapper );
                    }
                    else if ( inParallel ) {
                        Parallel.ForEach( this._items, wrapper );
                    }
                    else {
                        this._items.ForEach( wrapper );
                    }
                }
            }
        }

        /// <summary>
        ///     Perform the <paramref name="action" /> on each item in the list.
        /// </summary>
        /// <param name="action">
        ///     <paramref name="action" /> to perform on each item.
        /// </param>
        /// <param name="performActionOnClones">
        ///     If true, the <paramref name="action" /> will be performed on a <see cref="Clone" /> of the items.
        /// </param>
        /// <param name="asParallel">
        ///     Use the <see cref="ParallelQuery{TSource}" /> method.
        /// </param>
        /// <param name="inParallel">
        ///     Use the
        ///     <see
        ///         cref="Parallel.ForEach{TSource}(System.Collections.Generic.IEnumerable{TSource},System.Action{TSource})" />
        ///     method.
        /// </param>
        public void ForAll( Action<T> action, Boolean performActionOnClones = true, Boolean asParallel = true, Boolean inParallel = false ) {
            if ( action == null ) {
                throw new ArgumentNullException( "action" );
            }
            var wrapper = new Action<T>( obj => {
                try {
                    action( obj );
                }
                catch ( ArgumentNullException ) {
                    //if a null gets into the list then swallow an ArgumentNullException so we can continue adding
                }
            } );
            if ( performActionOnClones ) {
                var clones = this.Clone( asParallel: asParallel );
                if ( asParallel ) {
                    clones.AsParallel().ForAll( wrapper );
                }
                else if ( inParallel ) {
                    Parallel.ForEach( clones, wrapper );
                }
                else {
                    clones.ForEach( wrapper );
                }
            }
            else {
                lock ( this._items ) {
                    if ( asParallel ) {
                        this._items.AsParallel().ForAll( wrapper );
                    }
                    else if ( inParallel ) {
                        Parallel.ForEach( this._items, wrapper );
                    }
                    else {
                        this._items.ForEach( wrapper );
                    }
                }
            }
        }
    }
}

I do the following for my .NET Standard 2.0 projects.

Create a Directory.Build.props file (e.g. in the root of your repo) and move the properties to be shared from the .csproj file to this file.

MSBuild will pick it up automatically and apply them to the autogenerated AssemblyInfo.cs.

They also get applied to the nuget package when building one with dotnet pack or via the UI in Visual Studio 2017.

See https://docs.microsoft.com/en-us/visualstudio/msbuild/customize-your-build

Example:

<Project>
    <PropertyGroup>
        <Company>Some company</Company>
        <Copyright>Copyright © 2020</Copyright>
        <AssemblyVersion>1.0.0.1</AssemblyVersion>
        <FileVersion>1.0.0.1</FileVersion>
        <Version>1.0.0.1</Version>
        <!-- ... -->
    </PropertyGroup>
</Project>

I was having the same problem so I decided to download the source kit and install it according to how you posted above...

1. Downloaded Source Kit
2. Opened command prompt on that folder and typed python setup.py build
3. Then I typed python setup.py install

It worked perfectly!

Now, some notes: when I typed python setup.py build, I saw that Microsoft Visual Studio v9.0 C compiler was being used to build everything.

So probably it's something with your compiler not correctly configured or something...

Anyways, that worked with me so thank you!

There is no default value to control deleting old log files created by DailyRollingFileAppender. But you can write your own custom Appender that deletes old log files in much the same way as setting maxBackupIndex does for RollingFileAppender.

Simple instructions found here

From 1:

If you are trying to use the Apache Log4J DailyRollingFileAppender for a daily log file, you may need to want to specify the maximum number of files which should be kept. Just like rolling RollingFileAppender supports maxBackupIndex. But the current version of Log4j (Apache log4j 1.2.16) does not provide any mechanism to delete old log files if you are using DailyRollingFileAppender. I tried to make small modifications in the original version of DailyRollingFileAppender to add maxBackupIndex property. So, it would be possible to clean up old log files which may not be required for future usage.

Totally agree with @tir38 and @android_griezmann. This would be the version in kotlin:

interface servicesEndPoint {
@Multipart
@POST("user/updateprofile")
fun updateProfile(@Part("user_id") id:RequestBody, @Part("full_name") other:fullName, @Part image: MultipartBody.Part, @Part("other") other:RequestBody): Single<UploadPhotoResponse>

companion object {
        val API_BASE_URL = "YOUR_URL"

        fun create(): servicesPhotoEndPoint {
            val retrofit = Retrofit.Builder()
                .addCallAdapterFactory(RxJava2CallAdapterFactory.create())
                .addConverterFactory(GsonConverterFactory.create())
                .baseUrl(API_BASE_URL)
                .build()
            return retrofit.create(servicesPhotoEndPoint::class.java)
        }
    }
}

// pass it like this
val file = File(RealPathUtils.getRealPathFromURI_API19(context, uri))  
val requestFile: RequestBody = RequestBody.create(MediaType.parse("multipart/form-data"), file)

// MultipartBody.Part is used to send also the actual file name
val body: MultipartBody.Part = MultipartBody.Part.createFormData("image", file.name, requestFile)

// add another part within the multipart request
val fullName: RequestBody = RequestBody.create(MediaType.parse("multipart/form-data"), "Your Name")

servicesEndPoint.create().updateProfile(id, fullName, body, fullName)

To obtain the real path, use RealPathUtils. Check this class in the answers of @Harsh Bhavsar in this question: How to get the Full file path from URI.

To getRealPathFromURI_API19 you need permissions of READ_EXTERNAL_STORAGE

<Grid>
    <Grid.ColumnDefinitions>
        <ColumnDefinition Width="*"/>
        <ColumnDefinition Width="*"/>
    </Grid.ColumnDefinitions>
    <TextBlock Text="Left"  />
    <Button Width="30" Grid.Column="1" >Right</Button>
</Grid>

Spring Boot 2.2.2 / Gradle:

Gradle (build.gradle):

implementation("com.fasterxml.jackson.datatype:jackson-datatype-jsr310")

Entity (User.class):

LocalDate dateOfBirth;

Code:

ObjectMapper mapper = new ObjectMapper();
mapper.registerModule(new JavaTimeModule());
User user = mapper.readValue(json, User.class);

I'VE SOLVED THIS WAY:

In my Windows8 64 bit, just restarting the service: postgresql-x64-9.5

Android Developer has the right answer, but the provided source code is pretty verbose and doesn't actually implement the pattern described in the diagram.

Here is a better template:

<?xml version="1.0" encoding="utf-8"?>
<ScrollView xmlns:android="http://schemas.android.com/apk/res/android"
            android:layout_width="match_parent"
            android:layout_height="match_parent"
            android:fillViewport="true">

    <RelativeLayout android:layout_width="match_parent"
                    android:layout_height="match_parent">

        <LinearLayout android:layout_width="match_parent"
                      android:layout_height="wrap_content"
                      android:orientation="vertical">

                <!-- stuff to scroll -->

        </LinearLayout>

        <FrameLayout
            android:layout_width="match_parent"
            android:layout_height="wrap_content"
            android:layout_alignParentBottom="true">

            <!-- footer -->

        </FrameLayout>

    </RelativeLayout>

</ScrollView>

Its up to you to decide what views you use for the "scrolling" and "footer" parts. Also know that you probably have to set the ScrollViews fillViewPort .

You can achieve the opening/closing of a tab by the combination of keys COMMAND + T or COMMAND + W (OSX). On other OSs you can use CONTROL + T / CONTROL + W.

In selenium you can emulate such behavior. You will need to create one webdriver and as many tabs as the tests you need.

Here it is the code.

from selenium import webdriver
from selenium.webdriver.common.keys import Keys

driver = webdriver.Firefox()
driver.get("http://www.google.com/")

#open tab
driver.find_element_by_tag_name('body').send_keys(Keys.COMMAND + 't') 
# You can use (Keys.CONTROL + 't') on other OSs

# Load a page 
driver.get('http://stackoverflow.com/')
# Make the tests...

# close the tab
# (Keys.CONTROL + 'w') on other OSs.
driver.find_element_by_tag_name('body').send_keys(Keys.COMMAND + 'w') 


driver.close()

Yes by using spring-boot with hibernate configuration files we can persist the data to the database. keep hibernating .cfg.xml in your src/main/resources folder for reading the configurations related to database.

Filter: - A filter as the name suggests is a Java class executed by the servlet container for each incoming HTTP request and for each http response. This way, is possible to manage HTTP incoming requests before them reach the resource, such as a JSP page, a servlet or a simple static page; in the same way is possible to manage HTTP outbound response after resource execution.

Interceptor: - Spring Interceptors are similar to Servlet Filters but they acts in Spring Context so are many powerful to manage HTTP Request and Response but they can implement more sophisticated behavior because can access to all Spring context.

tray this:

getSupportActionBar().setHomeAsUpIndicator(R.drawable.ic_close);

inside onCreate();

Use a for loop to iterate through your array. For each string, create a new option element, assign the string as its innerHTML and value, and then append it to the select element.

var cuisines = ["Chinese","Indian"];     
var sel = document.getElementById('CuisineList');
for(var i = 0; i < cuisines.length; i++) {
    var opt = document.createElement('option');
    opt.innerHTML = cuisines[i];
    opt.value = cuisines[i];
    sel.appendChild(opt);
}

DEMO

UPDATE: Using createDocumentFragment and forEach

If you have a very large list of elements that you want to append to a document, it can be non-performant to append each new element individually. The DocumentFragment acts as a light weight document object that can be used to collect elements. Once all your elements are ready, you can execute a single appendChild operation so that the DOM only updates once, instead of n times.

var cuisines = ["Chinese","Indian"];     

var sel = document.getElementById('CuisineList');
var fragment = document.createDocumentFragment();

cuisines.forEach(function(cuisine, index) {
    var opt = document.createElement('option');
    opt.innerHTML = cuisine;
    opt.value = cuisine;
    fragment.appendChild(opt);
});

sel.appendChild(fragment);

DEMO

I had the same problem. i was using windows8 with 64 bit OS. I just changed the path to Program Files(*86) and then it started work. I put this line in eclipse.ini file like,

-vm
 C:\Program Files (x86)\Java\jre7\bin\javaw.exe

No, you don't have to bother grep.

find $dir -size 0 ! -name "*.xml"

@Mikael Svenson's answer is correct. I just wanted to add a small addition to it:

The Messagebox icon can also be included has an additional property like below:

DialogResult dialogResult = MessageBox.Show("Sure", "Please Confirm Your Action", MessageBoxButtons.YesNo, MessageBoxIcon.Question);

Use toggleClass().

$('.parent').hover(function(){
$(this).find('.child').toggleClass('color')
});

where color is the class. You can style the class as you like to achieve the behavior you want. The example demonstrates how class is added and removed upon mouse in and out.

Check Working example here.

Requirements

This will require Node.js 7 or later with a support for Promises and Async/Await.

Solution

Create a wrapper function that leverage promises to control the behavior of the child_process.exec command.

Explanation

Using promises and an asynchronous function, you can mimic the behavior of a shell returning the output, without falling into a callback hell and with a pretty neat API. Using the await keyword, you can create a script that reads easily, while still be able to get the work of child_process.exec done.

Code sample

const childProcess = require("child_process");

/**
 * @param {string} command A shell command to execute
 * @return {Promise<string>} A promise that resolve to the output of the shell command, or an error
 * @example const output = await execute("ls -alh");
 */
function execute(command) {
  /**
   * @param {Function} resolve A function that resolves the promise
   * @param {Function} reject A function that fails the promise
   * @see https://developer.mozilla.org/en-US/docs/Web/JavaScript/Reference/Global_Objects/Promise
   */
  return new Promise(function(resolve, reject) {
    /**
     * @param {Error} error An error triggered during the execution of the childProcess.exec command
     * @param {string|Buffer} standardOutput The result of the shell command execution
     * @param {string|Buffer} standardError The error resulting of the shell command execution
     * @see https://nodejs.org/api/child_process.html#child_process_child_process_exec_command_options_callback
     */
    childProcess.exec(command, function(error, standardOutput, standardError) {
      if (error) {
        reject();

        return;
      }

      if (standardError) {
        reject(standardError);

        return;
      }

      resolve(standardOutput);
    });
  });
}

Usage

async function main() {
  try {
    const passwdContent = await execute("cat /etc/passwd");

    console.log(passwdContent);
  } catch (error) {
    console.error(error.toString());
  }

  try {
    const shadowContent = await execute("cat /etc/shadow");

    console.log(shadowContent);
  } catch (error) {
    console.error(error.toString());
  }
}

main();

Sample Output

root:x:0:0::/root:/bin/bash
[output trimmed, bottom line it succeeded]

Error: Command failed: cat /etc/shadow
cat: /etc/shadow: Permission denied

Try it online.

Repl.it.

External resources

Promises.

child_process.exec.

Node.js support table.

This happened to me too, but the problem was actually different: file encoding.

The file was correct, but the file encoding was wrong. It was generated by the export utility of SQL Server and I saved it as Unicode.

The file itself looked good in the text editor, but when I opened the *.bad file that the SQL*loader generated with the rejected lines, I saw it had bad characters between every original character. Then I though about the encoding.

I opened the original file with Notepad++ and converted it to ANSI, and everything loaded properly.

keyboard

• sudo pip install keyboard
• https://github.com/boppreh/keyboard

Take full control of your keyboard with this small Python library. Hook global events, register hotkeys, simulate key presses and much more.

Global event hook on all keyboards (captures keys regardless of focus). Listen and sends keyboard events. Works with Windows and Linux (requires sudo), with experimental OS X support (thanks @glitchassassin!). Pure Python, no C modules to be compiled. Zero dependencies. Trivial to install and deploy, just copy the files. Python 2 and 3. Complex hotkey support (e.g. Ctrl+Shift+M, Ctrl+Space) with controllable timeout. Includes high level API (e.g. record and play, add_abbreviation). Maps keys as they actually are in your layout, with full internationalization support (e.g. Ctrl+ç). Events automatically captured in separate thread, doesn't block main program. Tested and documented. Doesn't break accented dead keys (I'm looking at you, pyHook). Mouse support available via project mouse (pip install mouse).

From README.md:

import keyboard

keyboard.press_and_release('shift+s, space')

keyboard.write('The quick brown fox jumps over the lazy dog.')

# Press PAGE UP then PAGE DOWN to type "foobar".
keyboard.add_hotkey('page up, page down', lambda: keyboard.write('foobar'))

# Blocks until you press esc.
keyboard.wait('esc')

# Record events until 'esc' is pressed.
recorded = keyboard.record(until='esc')
# Then replay back at three times the speed.
keyboard.play(recorded, speed_factor=3)

# Type @@ then press space to replace with abbreviation.
keyboard.add_abbreviation('@@', '[email protected]')
# Block forever.
keyboard.wait()

I was facing the same problems and found a easy solution now.

Using pathman.

pathman /as %M2%

Adds for example %M2% to the system path. Nothing more and nothing less. No more problems getting a mixture of user PATH and system PATH. No more hardly trying to get the correct values from registry...

Tried at Windows 10

package main                                                                                                                                                           

import (
    "fmt"
    "time"
)

// @link https://golang.org/pkg/time/

func main() {

    //caution : format string is `2006-01-02 15:04:05.000000000`
    current := time.Now()

    fmt.Println("origin : ", current.String())
    // origin :  2016-09-02 15:53:07.159994437 +0800 CST

    fmt.Println("mm-dd-yyyy : ", current.Format("01-02-2006"))
    // mm-dd-yyyy :  09-02-2016

    fmt.Println("yyyy-mm-dd : ", current.Format("2006-01-02"))
    // yyyy-mm-dd :  2016-09-02

    // separated by .
    fmt.Println("yyyy.mm.dd : ", current.Format("2006.01.02"))
    // yyyy.mm.dd :  2016.09.02

    fmt.Println("yyyy-mm-dd HH:mm:ss : ", current.Format("2006-01-02 15:04:05"))
    // yyyy-mm-dd HH:mm:ss :  2016-09-02 15:53:07

    // StampMicro
    fmt.Println("yyyy-mm-dd HH:mm:ss: ", current.Format("2006-01-02 15:04:05.000000"))
    // yyyy-mm-dd HH:mm:ss:  2016-09-02 15:53:07.159994

    //StampNano
    fmt.Println("yyyy-mm-dd HH:mm:ss: ", current.Format("2006-01-02 15:04:05.000000000"))
    // yyyy-mm-dd HH:mm:ss:  2016-09-02 15:53:07.159994437
}    

Expanding @Martin Thoma's answer

def one_hot_encode(y):
    """Convert an iterable of indices to one-hot encoded labels."""
    y = y.flatten() # Sometimes not flattened vector is passed e.g (118,1) in these cases
    # the function ends up creating a tensor e.g. (118, 2, 1). flatten removes this issue
    nb_classes = len(np.unique(y)) # get the number of unique classes
    standardised_labels = dict(zip(np.unique(y), np.arange(nb_classes))) # get the class labels as a dictionary
    # which then is standardised. E.g imagine class labels are (4,7,9) if a vector of y containing 4,7 and 9 is
    # directly passed then np.eye(nb_classes)[4] or 7,9 throws an out of index error.
    # standardised labels fixes this issue by returning a dictionary;
    # standardised_labels = {4:0, 7:1, 9:2}. The values of the dictionary are mapped to keys in y array.
    # standardised_labels also removes the error that is raised if the labels are floats. E.g. 1.0; element
    # cannot be called by an integer index e.g y[1.0] - throws an index error.
    targets = np.vectorize(standardised_labels.get)(y) # map the dictionary values to array.
    return np.eye(nb_classes)[targets]

Just a little addition to the answer of @dAm2k :

In addition to sudo apt-get remove --purge mysql\*

I've done a sudo apt-get remove --purge mariadb\*.

I seems that in the new release of debian (stretch), when you install mysql it install mariadb package with it.

Hope it helps.

Controller

public ActionResult Index()
    {


        //you don't need to include the category bc it does it by itself
        //var model = db.Product.Include(c => c.Category).ToList()

        ViewBag.Categories = db.Category.OrderBy(c => c.Name).ToList();
        var model = db.Product.ToList()
        return View(model);
    }

View

you need to filter the model with the given category

like :=> Model.where(p=>p.CategoryID == category.CategoryID)

try this...

@foreach (var category in ViewBag.Categories)
{
    <h3><u>@category.Name</u></h3>

    <div>

        @foreach (var product in Model.where(p=>p.CategoryID == category.CategoryID))
        {

                <table cellpadding="5" cellspacing"5" style="border:1px solid black; width:100%;background-color:White;">
                    <thead>
                        <tr>
                            <th style="background-color:black; color:white;">
                                @product.Title  
                                @if (System.Web.Security.UrlAuthorizationModule.CheckUrlAccessForPrincipal("/admin", User, "GET"))
                                {
                                    @Html.Raw(" - ")  
                                    @Html.ActionLink("Edit", "Edit", new { id = product.ID }, new { style = "background-color:black; color:white !important;" })
                                }
                            </th>
                        </tr>
                    </thead>

                    <tbody>
                        <tr>
                            <td style="background-color:White;">
                                @product.Description
                            </td>
                        </tr>
                    </tbody>      
                </table>                       
            }


    </div>
}  

Try this:

preg_match("/net(.*)\.php$/","http://php.net/manual/en/function.preg-match.php", $matches);
echo $matches[1];
// prints /manual/en/function.preg-match

You can use a watchpoint for this (A breakpoint on data instead of code).

You can start by using watch i.
Then set a condition for it using condition <breakpoint num> i == 5

You can get the breakpoint number by using info watch

public void surfaceCreated(SurfaceHolder holder) {
    try {
        mCamera = Camera.open();
        mCamera.setDisplayOrientation(90);
        mCamera.setPreviewDisplay(holder);

        Camera.Parameters p = mCamera.getParameters();
        p.set("camera-id",2);
        mCamera.setParameters(p);   
    } catch (IOException e) {
        // TODO Auto-generated catch block
        e.printStackTrace();
    }
}

This is not possible with the magic find methods. Try using the query builder:

$result = $em->getRepository("Orders")->createQueryBuilder('o')
   ->where('o.OrderEmail = :email')
   ->andWhere('o.Product LIKE :product')
   ->setParameter('email', '[email protected]')
   ->setParameter('product', 'My Products%')
   ->getQuery()
   ->getResult();

If you have Windows Vista or above please run this from a command prompt as Administrator:

sc delete [your service name as shown in service.msc e.g moneytransfer]

For example: sc delete moneytransfer

Delete the folder C:\Program Files\BBRTL\moneytransfer\

Find moneytransfer registry keys and delete them:

 HKEY_CLASSES_ROOT\Installer\Products\
 HKEY_LOCAL_MACHINE\Software\Microsoft\Windows\CurrentVersion\Uninstall\
 HKEY_LOCAL_MACHINE\System\CurrentControlSet\Services\EventLog\
 HKEY_LOCAL_MACHINE\System\CurrentControlSet002\Services\
 HKEY_LOCAL_MACHINE\System\CurrentControlSet002\Services\EventLog\
 HKEY_LOCAL_MACHINE\Software\Classes\Installer\Assemblies\ [remove .exe references]
 HKEY_LOCAL_MACHINE\Software\Microsoft\Windows\CurrentVersion\Installer\Folders

These steps have been tested on Windows XP, Windows 7, Windows Vista, Windows Server 2003, and Windows Server 2008.

To remove the scrollbar add the following CSS:

select[multiple] {
    overflow-y: auto;
}

Here's a snippet:

select[multiple] {_x000D_
  overflow-y: auto;_x000D_
}

<select>_x000D_
  <option value="1">One</option>_x000D_
  <option value="2">Two</option>_x000D_
  <option value="3">Three</option>_x000D_
</select>_x000D_
_x000D_
<select multiple size="3">_x000D_
  <option value="1">One</option>_x000D_
  <option value="2">Two</option>_x000D_
  <option value="3">Three</option>_x000D_
</select>

If you are on windows, what i suppose you need to do set the PATH like this:

SET PATH=%M2%

furthermore i assume you need to set your path to something like C:...\apache-maven-3.0.3\ cause this is the default folder for the windows archive. On the other i assume you need to add the path of maven to your and not set it to only maven so you setting should look like this:

SET PATH=%PATH%;%M2%

import scala.io.Source

object Demo {

  def main(args: Array[String]): Unit = {

    val ipfileStream = getClass.getResourceAsStream("/folder/a-words.txt")
    val readlines = Source.fromInputStream(ipfileStream).getLines
    readlines.foreach(readlines => println(readlines))

  }

}

I have made it from fastboot mode (Phone - Xiomi Mi5 Android 6.0.1)

Here is steps:

# check if device available
fastboot devices
# remove user data
fastboot erase userdata
# remove cache
fastboot erase cache 
# reboot device
fastboot reboot

Real, User and Sys process time statistics

One of these things is not like the other. Real refers to actual elapsed time; User and Sys refer to CPU time used only by the process.

• Real is wall clock time - time from start to finish of the call. This is all elapsed time including time slices used by other processes and time the process spends blocked (for example if it is waiting for I/O to complete).

• User is the amount of CPU time spent in user-mode code (outside the kernel) within the process. This is only actual CPU time used in executing the process. Other processes and time the process spends blocked do not count towards this figure.

• Sys is the amount of CPU time spent in the kernel within the process. This means executing CPU time spent in system calls within the kernel, as opposed to library code, which is still running in user-space. Like 'user', this is only CPU time used by the process. See below for a brief description of kernel mode (also known as 'supervisor' mode) and the system call mechanism.

User+Sys will tell you how much actual CPU time your process used. Note that this is across all CPUs, so if the process has multiple threads (and this process is running on a computer with more than one processor) it could potentially exceed the wall clock time reported by Real (which usually occurs). Note that in the output these figures include the User and Sys time of all child processes (and their descendants) as well when they could have been collected, e.g. by wait(2) or waitpid(2), although the underlying system calls return the statistics for the process and its children separately.

Origins of the statistics reported by time (1)

The statistics reported by time are gathered from various system calls. 'User' and 'Sys' come from wait (2) (POSIX) or times (2) (POSIX), depending on the particular system. 'Real' is calculated from a start and end time gathered from the gettimeofday (2) call. Depending on the version of the system, various other statistics such as the number of context switches may also be gathered by time.

On a multi-processor machine, a multi-threaded process or a process forking children could have an elapsed time smaller than the total CPU time - as different threads or processes may run in parallel. Also, the time statistics reported come from different origins, so times recorded for very short running tasks may be subject to rounding errors, as the example given by the original poster shows.

A brief primer on Kernel vs. User mode

On Unix, or any protected-memory operating system, 'Kernel' or 'Supervisor' mode refers to a privileged mode that the CPU can operate in. Certain privileged actions that could affect security or stability can only be done when the CPU is operating in this mode; these actions are not available to application code. An example of such an action might be manipulation of the MMU to gain access to the address space of another process. Normally, user-mode code cannot do this (with good reason), although it can request shared memory from the kernel, which could be read or written by more than one process. In this case, the shared memory is explicitly requested from the kernel through a secure mechanism and both processes have to explicitly attach to it in order to use it.

The privileged mode is usually referred to as 'kernel' mode because the kernel is executed by the CPU running in this mode. In order to switch to kernel mode you have to issue a specific instruction (often called a trap) that switches the CPU to running in kernel mode and runs code from a specific location held in a jump table. For security reasons, you cannot switch to kernel mode and execute arbitrary code - the traps are managed through a table of addresses that cannot be written to unless the CPU is running in supervisor mode. You trap with an explicit trap number and the address is looked up in the jump table; the kernel has a finite number of controlled entry points.

The 'system' calls in the C library (particularly those described in Section 2 of the man pages) have a user-mode component, which is what you actually call from your C program. Behind the scenes, they may issue one or more system calls to the kernel to do specific services such as I/O, but they still also have code running in user-mode. It is also quite possible to directly issue a trap to kernel mode from any user space code if desired, although you may need to write a snippet of assembly language to set up the registers correctly for the call.

More about 'sys'

There are things that your code cannot do from user mode - things like allocating memory or accessing hardware (HDD, network, etc.). These are under the supervision of the kernel, and it alone can do them. Some operations like malloc orfread/fwrite will invoke these kernel functions and that then will count as 'sys' time. Unfortunately it's not as simple as "every call to malloc will be counted in 'sys' time". The call to malloc will do some processing of its own (still counted in 'user' time) and then somewhere along the way it may call the function in kernel (counted in 'sys' time). After returning from the kernel call, there will be some more time in 'user' and then malloc will return to your code. As for when the switch happens, and how much of it is spent in kernel mode... you cannot say. It depends on the implementation of the library. Also, other seemingly innocent functions might also use malloc and the like in the background, which will again have some time in 'sys' then.

simple do id:("12345") OR id:("7890") .... and so on

Yes if you have no idea that how many arguments are possible at the time of function declaration then you can declare the function with no parameters and can access all variables by arguments array which are passed at the time of function calling.

This will also checks in leap year. This is pure regex, so it's faster than any lib (also faster than moment.js). But if you gonna use a lot of dates in ur code, I do recommend to use moment.js

var dateRegex = /^(?=\d)(?:(?:31(?!.(?:0?[2469]|11))|(?:30|29)(?!.0?2)|29(?=.0?2.(?:(?:(?:1[6-9]|[2-9]\d)?(?:0[48]|[2468][048]|[13579][26])|(?:(?:16|[2468][048]|[3579][26])00)))(?:\x20|$))|(?:2[0-8]|1\d|0?[1-9]))([-.\/])(?:1[012]|0?[1-9])\1(?:1[6-9]|[2-9]\d)?\d\d(?:(?=\x20\d)\x20|$))?(((0?[1-9]|1[012])(:[0-5]\d){0,2}(\x20[AP]M))|([01]\d|2[0-3])(:[0-5]\d){1,2})?$/;

console.log(dateRegex.test('21/01/1986'));

http://regexper.com/....

Casting int to char involves losing data and the compiler will probably warn you.

Extracting a particular byte from an int sounds more reasonable and can be done like this:

number & 0x000000ff; /* first byte */
(number & 0x0000ff00) >> 8; /* second byte */
(number & 0x00ff0000) >> 16; /* third byte */
(number & 0xff000000) >> 24; /* fourth byte */

Since I just lost two days of my life trying to solve for tryCatch for an irr function, I thought I should share my wisdom (and what is missing). FYI - irr is an actual function from FinCal in this case where got errors in a few cases on a large data set.

1. Set up tryCatch as part of a function. For example:

   irr2 <- function (x) {
     out <- tryCatch(irr(x), error = function(e) NULL)
     return(out)
   }
   

2. For the error (or warning) to work, you actually need to create a function. I originally for error part just wrote error = return(NULL) and ALL values came back null.

3. Remember to create a sub-output (like my "out") and to return(out).

private DataTable GetDataTableFromExcel(String Path)
    {
        XSSFWorkbook wb;
        XSSFSheet sh;
        String Sheet_name;

        using (var fs = new FileStream(Path, FileMode.Open, FileAccess.Read))
        {
            wb = new XSSFWorkbook(fs);

               Sheet_name= wb.GetSheetAt(0).SheetName;  //get first sheet name
        }
        DataTable DT = new DataTable();
        DT.Rows.Clear();
        DT.Columns.Clear();

        // get sheet
        sh = (XSSFSheet)wb.GetSheet(Sheet_name);

        int i = 0;
        while (sh.GetRow(i) != null)
        {
            // add neccessary columns
            if (DT.Columns.Count < sh.GetRow(i).Cells.Count)
            {
                for (int j = 0; j < sh.GetRow(i).Cells.Count; j++)
                {
                    DT.Columns.Add("", typeof(string));
                }
            }

            // add row
            DT.Rows.Add();

            // write row value
            for (int j = 0; j < sh.GetRow(i).Cells.Count; j++)
            {
                var cell = sh.GetRow(i).GetCell(j);

                if (cell != null)
                {
                    // TODO: you can add more cell types capatibility, e. g. formula
                    switch (cell.CellType)
                    {
                        case NPOI.SS.UserModel.CellType.Numeric:
                            DT.Rows[i][j] = sh.GetRow(i).GetCell(j).NumericCellValue;
                            //dataGridView1[j, i].Value = sh.GetRow(i).GetCell(j).NumericCellValue;

                            break;
                        case NPOI.SS.UserModel.CellType.String:
                            DT.Rows[i][j] = sh.GetRow(i).GetCell(j).StringCellValue;

                            break;
                    }
                }
            }

            i++;
        }

        return DT;
    }

:last-child only works when the element in question is the last child of the container, not the last of a specific type of element. For that, you want :last-of-type

http://jsfiddle.net/C23g6/3/

As per @BoltClock's comment, this is only checking for the last article element, not the last element with the class of .comment.

body {_x000D_
  background: black;_x000D_
}_x000D_
_x000D_
.comment {_x000D_
  width: 470px;_x000D_
  border-bottom: 1px dotted #f0f0f0;_x000D_
  margin-bottom: 10px;_x000D_
}_x000D_
_x000D_
.comment:last-of-type {_x000D_
  border-bottom: none;_x000D_
  margin-bottom: 0;_x000D_
}

<div class="commentList">_x000D_
  <article class="comment " id="com21"></article>_x000D_
_x000D_
  <article class="comment " id="com20"></article>_x000D_
_x000D_
  <article class="comment " id="com19"></article>_x000D_
_x000D_
  <div class="something"> hello </div>_x000D_
</div>

In GNUC++ (seems to be obsolete since 2.5, a long time ago :) See the answers here: C struct initialization using labels. It works, but how?), it is possible to initialize a struct like this:

struct inventory_item {
    int bananas;
    int apples;
    int pineapples;
};

inventory_item first_item = {
    bananas: 2,
    apples: 49,
    pineapples: 4
};

the problem mainly is because the width have to be == to the height, and in the case of bs, the height is set to auto so here is a fix for that in js instead

function img_circle() {
    $('.img-circle').each(function() {
        $w = $(this).width();
        $(this).height($w);
    });
}

$(document).ready(function() {
    img_circle();
});

$(window).resize(function() {
    img_circle();
});

This worked for me:

var start = new Date("2020-10-15T00:00:00.000+0000");
 //or
start = new date("2020-10-15T00:00:00.000Z");

collection.find({
    start_date:{
        $gte: start
    }
})...etc

Your program will continue with the second if statement in the case of y == x, causing a ZeroDivisionError. You need to make the statements mutually exclusive; the way to do that is to use elif ("else if") instead of if:

import math
x = int(input("Enter a value for x: "))
y = int(input("Enter a value for y: "))
if y == x:
    print(1)
elif y == 1:         # see georg's comment
    print(x)
elif y > x:          # will be executed only if y != 1 and y != x
    print(0)
else:                # will be executed only if y != 1 and y != x and x <= y
    a = math.factorial(x)
    b = math.factorial(y)
    c = math.factorial(x-y)  # that appears to be useful to get the correct result
    div = a // (b * c)
    print(div)  

inside the Form, You can use this code. Replace your variable name (i use $variable)

<input type="text" value="<?php echo (isset($variable))?$variable:'';?>">

Try:

void myfunc(string& val)
{
    // Do stuff to the string pointer
}

// sometime later 
{
    // ...
    string s;
    myfunc(s);
    // ...
}

or

void myfunc(string* val)
{
    // Do stuff to the string pointer
}

// sometime later 
{
    // ...
    string s;
    myfunc(&s);
    // ...
}

You want to use BigInteger.toByteArray()

String msg = "Hello there!";
BigInteger bi = new BigInteger(msg.getBytes());
System.out.println(new String(bi.toByteArray())); // prints "Hello there!"

The way I understand it is that you're doing the following transformations:

  String  -----------------> byte[] ------------------> BigInteger
          String.getBytes()         BigInteger(byte[])

And you want the reverse:

  BigInteger ------------------------> byte[] ------------------> String
             BigInteger.toByteArray()          String(byte[])

Note that you probably want to use overloads of String.getBytes() and String(byte[]) that specifies an explicit encoding, otherwise you may run into encoding issues.

In case you installed yarn globally like this

$ sudo npm install -g yarn

Just run this in terminal

$ sudo npm uninstall -g yarn

Tested now on my local machine running Ubuntu. Works perfect!

Head, or before closure of body tag. When DOM loads JS is then executed, that is exactly what jQuery document.ready does.

Using the Excel Text import wizard to import it if it is a text file, like a CSV file, is another option and can be done based on which row number to which row numbers you specify. See: This link

It's /public_html/stats/*.

$ ~/myrepo> ls public_html/stats/
bar baz foo
$ ~/myrepo> cat .gitignore 
public_html/stats/*
$ ~/myrepo> git status
# On branch master
#
# Initial commit
#
# Untracked files:
#   (use "git add <file>..." to include in what will be committed)
#
#   .gitignore
nothing added to commit but untracked files present (use "git add" to track)
$ ~/myrepo>

I have the log4j.properties configured properly. That's not the problem. After a while I discovered that the problem was in Eclipse IDE which had an old build in "cache" and didn't create a new one (Maven dependecy problem). I had to build the project manually and now it works.

Use a BindingList and set the DataPropertyName-Property of the column.

Try the following:

...
private void BindGrid()
{
    gvFilesOnServer.AutoGenerateColumns = false;

    //create the column programatically
    DataGridViewCell cell = new DataGridViewTextBoxCell();
    DataGridViewTextBoxColumn colFileName = new DataGridViewTextBoxColumn()
    {
        CellTemplate = cell, 
        Name = "Value",
        HeaderText = "File Name",
        DataPropertyName = "Value" // Tell the column which property of FileName it should use
     };

    gvFilesOnServer.Columns.Add(colFileName);

    var filelist = GetFileListOnWebServer().ToList();
    var filenamesList = new BindingList<FileName>(filelist); // <-- BindingList

    //Bind BindingList directly to the DataGrid, no need of BindingSource
    gvFilesOnServer.DataSource = filenamesList 
}

#!/usr/bin/python

# encoding=utf8

Try This to starting of python file

I was experiencing this problem on Samsung devices (fine on others). like zyamys suggested in his/her comment, I added the manifest.permission line but in addition to rather than instead of the original line, so:

<uses-permission android:name="android.permission.READ_PHONE_STATE" />
<uses-permission android:name="android.Manifest.permission.READ_PHONE_STATE" />

I'm targeting API 22, so don't need to explicitly ask for permissions.

I just find this solution but in my case it doesn't work:

@OneToMany(cascade = CascadeType.ALL, targetEntity = MyClass.class, mappedBy = "xxx", fetch = FetchType.LAZY, orphanRemoval = true) 

orphanRemoval = true has no effect.

An easier way for me was:

var activeurl = window.location;
$('a[href="'+activeurl+'"]').parent('li').addClass('active');

because my links go to absolute url, but if your links are relative then you can use:

 window.location**.pathname**

If you want to set title in Java file, then write in your activity onCreate

setTitle("Your Title");

if you want to in Manifest then write

    <activity
        android:name=".MainActivity"
        android:label="Your Title" >
        <intent-filter>
            <action android:name="android.intent.action.MAIN" />

            <category android:name="android.intent.category.LAUNCHER" />
        </intent-filter>
    </activity>

The FULLY WORKING SOLUTION for both Android or React-native users facing this issue just add this android:usesCleartextTraffic="true" in AndroidManifest.xml file like this:

android:usesCleartextTraffic="true"
tools:ignore="GoogleAppIndexingWarning">
<uses-library
    android:name="org.apache.http.legacy"
    android:required="false" />

in between <application>.. </application> tag like this:

<application
      android:name=".MainApplication"
      android:label="@string/app_name"
      android:icon="@mipmap/ic_launcher"
      android:allowBackup="false"
      android:theme="@style/AppTheme"
        android:usesCleartextTraffic="true"
        tools:ignore="GoogleAppIndexingWarning">
        <uses-library
            android:name="org.apache.http.legacy"
            android:required="false" />
      <activity
        android:name=".MainActivity"
        android:label="@string/app_name"/>
 </application>

For people looking this up now:

It seems that now setting the User-Agent header is allowed since Firefox 43. See https://developer.mozilla.org/en-US/docs/Glossary/Forbidden_header_name for the current list of forbidden headers.

The previously mentioned wmic command is the way to go, as it is installed by default in recent versions of Windows.

Here is my small improvement to generalize it, by retrieving the current name from the environment:

wmic computersystem where name="%COMPUTERNAME%" 
     call rename name="NEW-NAME"

NOTE: The command must be given in one line, but I've broken it into two to make scrolling unnecessary. As @rbeede mentions you'll have to reboot to complete the update.

In Eclipse

Right click Project --> Java Build Path --> Libraries

1. Remove the JRE
2. Click on Add Library --> JRE System Library -->Next -->Alternate JRE --> installed JRE --> Add JDK and select and Apply

Don't change the DNS on the phone. Instead, connect with wifi to the local network and you are all set.

At my office, we have internal servers with internal DNS that are not exposed to the Internet. I just connect with iPhone to the office wifi and can then access them fine.

YMMV, but instead of configuring the phone DNS, it feels to me that just setting up local internal DNS and wifi is a cleaner and easier solution.

The Address property of a cell can get this for you:

MsgBox Cells(1, 1).Address(RowAbsolute:=False, ColumnAbsolute:=False)

returns A1.

The other way around can be done with the Row and Column property of Range:

MsgBox Range("A1").Row & ", " & Range("A1").Column

returns 1,1.

Fatal Error gave a straightforward possibility: source your second script! if you're worried that this second script may alter some of your precious variables, you can always source it in a subshell:

( . ./test2.sh )

The parentheses will make the source happen in a subshell, so that the parent shell will not see the modifications test2.sh could perform.

There's another possibility that should definitely be referenced here: use set -a.

From the POSIX set reference:

-a: When this option is on, the export attribute shall be set for each variable to which an assignment is performed; see the Base Definitions volume of IEEE Std 1003.1-2001, Section 4.21, Variable Assignment. If the assignment precedes a utility name in a command, the export attribute shall not persist in the current execution environment after the utility completes, with the exception that preceding one of the special built-in utilities causes the export attribute to persist after the built-in has completed. If the assignment does not precede a utility name in the command, or if the assignment is a result of the operation of the getopts or read utilities, the export attribute shall persist until the variable is unset.

From the Bash Manual:

-a: Mark variables and function which are modified or created for export to the environment of subsequent commands.

So in your case:

set -a
TESTVARIABLE=hellohelloheloo
# ...
# Here put all the variables that will be marked for export
# and that will be available from within test2 (and all other commands).
# If test2 modifies the variables, the modifications will never be
# seen in the present script!
set +a

./test2.sh

 # Here, even if test2 modifies TESTVARIABLE, you'll still have
 # TESTVARIABLE=hellohelloheloo

Observe that the specs only specify that with set -a the variable is marked for export. That is:

set -a
a=b
set +a
a=c
bash -c 'echo "$a"'

will echo c and not an empty line nor b (that is, set +a doesn't unmark for export, nor does it “save” the value of the assignment only for the exported environment). This is, of course, the most natural behavior.

Conclusion: using set -a/set +a can be less tedious than exporting manually all the variables. It is superior to sourcing the second script, as it will work for any command, not only the ones written in the same shell language.

$string="1,2,3,4,5";
$array=array_map('intval', explode(',', $string));
$array = implode("','",$array);
$query=mysqli_query($conn, "SELECT name FROM users WHERE id IN ('".$array."')");

NB: the syntax is:

SELECT * FROM table WHERE column IN('value1','value2','value3')

This should work:

IDTSVariables100 vars = null;
VariableDispenser.LockForRead("System::TaskName");
VariableDispenser.GetVariables(vars);
string TaskName = vars("System::TaskName").Value.ToString();
vars.Unlock();

Your initial code lacks call of the GetVariables() method.

Use Following Method to Update GUI.

     Public Void UpdateUI()
     {
         //Here update your label, button or any string related object.

         //Dispatcher.CurrentDispatcher.Invoke(DispatcherPriority.Background, new ThreadStart(delegate { }));    
         Application.Current.Dispatcher.Invoke(DispatcherPriority.Background, new ThreadStart(delegate { }));
     }

Keep it in Mind when you use this method at that time do not Update same object direct from dispatcher thread otherwise you get only that updated string and this method is helpless/useless. If still not working then Comment that line inside method and un-comment commented one both have nearly same effect just different way to access it.

You would use an expression when you want to treat your function as data and not as code. You can do this if you want to manipulate the code (as data). Most of the time if you don't see a need for expressions then you probably don't need to use one.

You can revert all your files under your working directory and index by typing following this command

git reset --hard <SHAsum of your commit>

You can also type

git reset --hard HEAD #your current head point

or

git reset --hard HEAD^ #your previous head point

Hope it helps

For Windows, you can also whitelist your extension through Windows policies. The full steps are details in this answer, but there are quicker steps:

1. Create the registry key HKEY_LOCAL_MACHINE\SOFTWARE\Policies\Google\Chrome\ExtensionInstallWhitelist.
2. For each extension you want to whitelist, add a string value whose name should be a sequence number (starting at 1) and value is the extension ID.

For instance, in order to whitelist 2 extensions with ID aaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa and bbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbb, create a string value with name 1 and value aaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa, and a second value with name 2 and value bbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbb. This can be sum up by this registry file:

Windows Registry Editor Version 5.00

[HKEY_LOCAL_MACHINE\SOFTWARE\Policies\Google\Chrome]

[HKEY_LOCAL_MACHINE\SOFTWARE\Policies\Google\Chrome\ExtensionInstallWhitelist]
"1"="aaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa"
"2"="bbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbb"

EDIT: actually, Chromium docs also indicate how to do it for other OS.

This solution produces a result list, that contains all differences from both input lists. You can compare your objects by any property, in my example it is ID. The only restriction is that the lists should be of the same type:

var DifferencesList = ListA.Where(x => !ListB.Any(x1 => x1.id == x.id))
            .Union(ListB.Where(x => !ListA.Any(x1 => x1.id == x.id)));

In ES6, imports are live read-only views on exported-values. As a result, when you do import a from "somemodule";, you cannot assign to a no matter how you declare a in the module.

However, since imported variables are live views, they do change according to the "raw" exported variable in exports. Consider the following code (borrowed from the reference article below):

//------ lib.js ------
export let counter = 3;
export function incCounter() {
    counter++;
}

//------ main1.js ------
import { counter, incCounter } from './lib';

// The imported value `counter` is live
console.log(counter); // 3
incCounter();
console.log(counter); // 4

// The imported value can’t be changed
counter++; // TypeError

As you can see, the difference really lies in lib.js, not main1.js.

To summarize:

• You cannot assign to import-ed variables, no matter how you declare the corresponding variables in the module.
• The traditional let-vs-const semantics applies to the declared variable in the module.
  • If the variable is declared const, it cannot be reassigned or rebound in anywhere.
  • If the variable is declared let, it can only be reassigned in the module (but not the user). If it is changed, the import-ed variable changes accordingly.

Reference: http://exploringjs.com/es6/ch_modules.html#leanpub-auto-in-es6-imports-are-live-read-only-views-on-exported-values

Basically, you check if an object is an instance of a specific class. You normally use it, when you have a reference or parameter to an object that is of a super class or interface type and need to know whether the actual object has some other type (normally more concrete).

Example:

public void doSomething(Number param) {
  if( param instanceof Double) {
    System.out.println("param is a Double");
  }
  else if( param instanceof Integer) {
    System.out.println("param is an Integer");
  }

  if( param instanceof Comparable) {
    //subclasses of Number like Double etc. implement Comparable
    //other subclasses might not -> you could pass Number instances that don't implement that interface
    System.out.println("param is comparable"); 
  }
}

Note that if you have to use that operator very often it is generally a hint that your design has some flaws. So in a well designed application you should have to use that operator as little as possible (of course there are exceptions to that general rule).

'SET' is forgotten

ALTER TABLE ONLY users ALTER COLUMN lang SET DEFAULT 'en_GB';

The Collections.reverse method actually returns a new list with the elements of the original list copied into it in reverse order, so this has O(n) performance with regards to the size of the original list.

As a more efficient solution, you could write a decorator that presents a reversed view of a List as an Iterable. The iterator returned by your decorator would use the ListIterator of the decorated list to walk over the elements in reverse order.

For example:

public class Reversed<T> implements Iterable<T> {
    private final List<T> original;

    public Reversed(List<T> original) {
        this.original = original;
    }

    public Iterator<T> iterator() {
        final ListIterator<T> i = original.listIterator(original.size());

        return new Iterator<T>() {
            public boolean hasNext() { return i.hasPrevious(); }
            public T next() { return i.previous(); }
            public void remove() { i.remove(); }
        };
    }

    public static <T> Reversed<T> reversed(List<T> original) {
        return new Reversed<T>(original);
    }
}

And you would use it like:

import static Reversed.reversed;

...

List<String> someStrings = getSomeStrings();
for (String s : reversed(someStrings)) {
    doSomethingWith(s);
}

You say you don't necessarily know that 'key2' is in position [1]. Well, it's not. Position 1 would be occupied by myHash[1].

You're abusing JavaScript arrays, which (like functions) allow key/value hashes. Even though JavaScript allows it, it does not give you facilities to deal with it, as a language designed for associative arrays would. JavaScript's array methods work with the numbered properties only.

The first thing you should do is switch to objects rather than arrays. You don't have a good reason to use an array here rather than an object, so don't do it. If you want to use an array, just number the elements and give up on the idea of hashes. The intent of an array is to hold information which can be indexed into numerically.

You can, of course, put a hash (object) into an array if you like.

myhash[1]={"key1","brightOrangeMonkey"};

You can use append or prepend

The .append() method inserts the specified content as the last child of each element in the jQuery collection (To insert it as the first child, use .prepend()).

$("#tagscloud span").append(second);
$("#tagscloud span").append(third);
$("#tagscloud span").prepend(first);

Try import tkinter because pycharm already installed tkinter for you, I looked Install tkinter for Python

You can maybe try:

import tkinter
import matplotlib
matplotlib.use('TkAgg')
plt.plot([1,2,3],[5,7,4])
plt.show()

as a tkinter-installing way

I've tried your way, it seems no error to run at my computer, it successfully shows the figure. maybe because pycharm have tkinter as a system package, so u don't need to install it. But if u can't find tkinter inside, you can go to Tkdocs to see the way of installing tkinter, as it mentions, tkinter is a core package for python.

The default path of Android SDK is /Users/<username>/Library/Android/sdk, you can refer to this post.

add this to your .bash_profile to add the environment variable

export PATH="/Users/<username>/Library/Android/sdk/tools:/Users/<username>/Library/Android/sdk/build-tools:${PATH}"

Then save the file.

load it

source ./.bash_profile 

I recently discovered a couple of image tracing libraries for JavaScript that indeed are able to build an acceptable approximation to the bitmap, both size and quality. I'm developing this JavaScript library and CLI :

https://www.npmjs.com/package/svg-png-converter

Which provides unified API for all of them, supporting browser and node, non depending on DOM, and a Command line tool.

For converting logos/cartoon/like images it does excellent job. For photos / realism some tweaking is needed since the output size can grow a lot.

It has a playground although right now I'm working on a better one, easier to use, since more features has been added:

https://cancerberosgx.github.io/demos/svg-png-converter/playground/#

See Davion's anwser in this post: https://stackoverflow.com/a/26429849/1804068

HTML:

<div class="parent">
    <span id="mySpan">Something in English</span>
</div>

JQUERY

$('#mySpan').animate({'opacity': 0}, 400, function(){
        $(this).html('Something in Spanish').animate({'opacity': 1}, 400);    
    });

Live example

You have to sort it if you want the data to come back a certain way. When you say you are expecting "Mohit" to be the first row, I am assuming you say that because "Mohit" is the first row in the [One] table. However, when SQL Server joins tables, it doesn't necessarily join in the order you think.

If you want the first row from [One] to be returned, then try sorting by [One].[ID]. Alternatively, you can order by any other column.

While the previous answers are correct, some compilers have options to break the standard and use the smallest type that will contain all values.

Example with GCC (documentation in the GCC Manual):

enum ord {
    FIRST = 1,
    SECOND,
    THIRD
} __attribute__ ((__packed__));
STATIC_ASSERT( sizeof(enum ord) == 1 )

The error also happens when trying to use the

with multiprocessing.Pool() as pool:
   # ...

with a Python version that is too old (like Python 2.X) and does not support using with together with multiprocessing pools.

(See this answer https://stackoverflow.com/a/25968716/1426569 to another question for more details)

Building slightly off Ben's answer, I added attributes for the ID so I could use labels.

<%: Html.Label("isBlahYes", "Yes")%><%= Html.RadioButtonFor(model => model.blah, true, new { @id = "isBlahYes" })%>
<%: Html.Label("isBlahNo", "No")%><%= Html.RadioButtonFor(model => model.blah, false, new { @id = "isBlahNo" })%>

I hope this helps.

The line

when(someObject.doSomething(argumentCaptor.capture())).thenReturn(true);

would do the same as

when(someObject.doSomething(Matchers.any())).thenReturn(true);

So, using argumentCaptor.capture() when stubbing has no added value. Using Matchers.any() shows better what really happens and therefor is better for readability. With argumentCaptor.capture(), you can't read what arguments are really matched. And instead of using any(), you can use more specific matchers when you have more information (class of the expected argument), to improve your test.

And another problem: If using argumentCaptor.capture() when stubbing it becomes unclear how many values you should expect to be captured after verification. We want to capture a value during verification, not during stubbing because at that point there is no value to capture yet. So what does the argument captors capture method capture during stubbing? It capture anything because there is nothing to be captured yet. I consider it to be undefined behavior and I don't want to use undefined behavior.

I learned something really useful and fundamental from here.

chaining functions is very usefull in this case which works on most jQuery Functions including on function output too.

It works because output of most jQuery functions are the input objects sets so you can use them right away and make it shorter and smarter

function showPhotos() {
    $(this).find("span").slideToggle();
}

$(".photos")
    .on("mouseenter", "li", showPhotos)
    .on("mouseleave", "li", showPhotos);

Unless you have more style sheets than that, you've messed up your break points:

#1 (max-width: 700px)
#2 (min-width: 701px) and (max-width: 900px)
#3 (max-width: 901px)

The 3rd media query is probably meant to be min-width: 901px. Right now, it overlaps #1 and #2, and only controls the page layout by itself when the screen is exactly 901px wide.

Edit for updated question:

(max-width: 640px)
(max-width: 800px)
(max-width: 1024px)
(max-width: 1280px)

Media queries aren't like catch or if/else statements. If any of the conditions match, then it will apply all of the styles from each media query it matched. If you only specify a min-width for all of your media queries, it's possible that some or all of the media queries are matched. In your case, a device that's 640px wide matches all 4 of your media queries, so all for style sheets are loaded. What you are most likely looking for is this:

(max-width: 640px)
(min-width: 641px) and (max-width: 800px)
(min-width: 801px) and (max-width: 1024px)
(min-width: 1025px)

Now there's no overlap. The styles will only apply if the device's width falls between the widths specified.

As was stated in the comments to the original post, this seemed to be an issue with the python interpreter I was using for whatever reason, and not something wrong with the python scripts. I switched over from the WinPython bundle to the official python 3.6 from python.org and it worked just fine. thanks for the help everyone :)

You could use a php compiler:

Roadsend

phc

Responding to your question about List<T>:

List<T> is a class; specifying an interface allows more flexibility of implementation. A better question is "why not IList<T>?"

To answer that question, consider what IList<T> adds to ICollection<T>: integer indexing, which means the items have some arbitrary order, and can be retrieved by reference to that order. This is probably not meaningful in most cases, since items probably need to be ordered differently in different contexts.

EF Core: Using "ThenInclude" to load mutiple levels: For example:

var blogs = context.Blogs
    .Include(blog => blog.Posts)
        .ThenInclude(post => post.Author)
        .ThenInclude(author => author.Photo)
    .ToList();

To my knowledge none of the given answers guarantee correct behavior with null termination. Until someone shows me differently I wrote my own static class for handling this with the following methods:

// Mimics the functionality of strlen() in c/c++
// Needed because niether StringBuilder or Encoding.*.GetString() handle \0 well
static int StringLength(byte[] buffer, int startIndex = 0)
{
    int strlen = 0;
    while
    (
        (startIndex + strlen + 1) < buffer.Length // Make sure incrementing won't break any bounds
        && buffer[startIndex + strlen] != 0       // The typical null terimation check
    )
    {
        ++strlen;
    }
    return strlen;
}

// This is messy, but I haven't found a built-in way in c# that guarentees null termination
public static string ParseBytes(byte[] buffer, out int strlen, int startIndex = 0)
{
    strlen = StringLength(buffer, startIndex);
    byte[] c_str = new byte[strlen];
    Array.Copy(buffer, startIndex, c_str, 0, strlen);
    return Encoding.UTF8.GetString(c_str);
}

The reason for the startIndex was in the example I was working on specifically I needed to parse a byte[] as an array of null terminated strings. It can be safely ignored in the simple case

I am working with code first, C# 7 and entity framework 6.0.0.0. it works for me

Add()
{
     bool isDuplicate = false;
     try
     {
       //add to database 
     }
     catch (DbUpdateException ex)
     {
       if (dbUpdateException.InnerException != null)
       {
          var sqlException = dbUpdateException.InnerException.InnerException as SqlException;
          if(sqlException != null)
             isDuplicate = IsDuplicate(sqlException);
       } 
     }
     catch (SqlException ex)
     {
        isDuplicate = IsDuplicate(ex);
     }  
     if(isDuplicate){
       //handle here
     }
}

bool IsDuplicate(SqlException sqlException)
{
    switch (sqlException.Number)
    {
        case 2627:
            return true;
        default:
            return false;
    }
}

N.B: my query for add item to db is in another project(layer)

A much simpler approach that doesn't involve manipulating active windows:

Dim wb As Workbook
Set wb = Workbooks.Open("workbook.xlsx")
wb.Windows(1).Visible = False

From what I can tell the Windows index on the workbook should always be 1. If anyone knows of any race conditions that would make this untrue please let me know.

u could try this it produces randomly generated array of true and false :

a=[bool(i) for i in np.array(np.random.randint(0,2,10))]

out: [True, True, True, True, True, False, True, False, True, False]

If The question is the see the history of queries executed in the Command line. Answer is

As per Postgresql 9.3, Try \? in your command line, you will find all possible commands, in that search for history,

  \s [FILE]              display history or save it to file

in your command line, try \s. This will list the history of queries, you have executed in the current session. you can also save to the file, as shown below.

hms=# \s /tmp/save_queries.sql
Wrote history to file ".//tmp/save_queries.sql".
hms=# 

It is worth mentioning that one can check the characters in the string against Unicode categories - numbers, uppercase, lowercase, currencies and more. Here are two examples checking for numbers in a string using Linq:

var containsNumbers = s.Any(Char.IsNumber);
var isNumber = s.All(Char.IsNumber);

For clarity, the syntax above is a shorter version of:

var containsNumbers = s.Any(c=>Char.IsNumber(c));
var isNumber = s.All(c=>Char.IsNumber(c));

Link to unicode categories on MSDN:

UnicodeCategory Enumeration

If the browser people see this as a security and/or usability problem, then the answer to your question is to simply not close the window, since by definition they will come up with solutions for your workaround anyway. There is a nice summation about the reasoning why the choice have been in the firefox bug database https://bugzilla.mozilla.org/show_bug.cgi?id=190515#c70

So what can you do?

Change the specification of your website, so that you have a solution for these people. You could for instance take it as an opportunity to direct them to a partner.

That is, see it as a handoff to someone else that (potentially) needs it. As an example, Hanselman had a recent article about what to do in the other similar situation, namely 404 errors: http://www.hanselman.com/blog/PutMissingKidsOnYour404PageEntirelyClientSideSolutionWithYQLJQueryAndMSAjax.aspx

Instead of this:

var o = new { Id = 1, Name = "Foo" }; 
var o1 = new { Id = 2, Name = "Bar" }; 

List <var> list = new List<var>(); 
list.Add(o); 
list.Add(o1);

You could do this:

var o = new { Id = 1, Name = "Foo" }; 
var o1 = new { Id = 2, Name = "Bar" }; 

List<object> list = new List<object>(); 
list.Add(o); 
list.Add(o1);

However, you will get a compiletime error if you try to do something like this in another scope, although it works at runtime:

private List<object> GetList()
{ 
    List<object> list = new List<object>();
    var o = new { Id = 1, Name = "Foo" }; 
    var o1 = new { Id = 2, Name = "Bar" }; 
    list.Add(o); 
    list.Add(o1);
    return list;
}

private void WriteList()
{
    foreach (var item in GetList()) 
    { 
        Console.WriteLine("Name={0}{1}", item.Name, Environment.NewLine); 
    }
}

The problem is that only the members of Object are available at runtime, although intellisense will show the properties id and name.

In .net 4.0 a solution is to use the keyword dynamic istead of object in the code above.

Another solution is to use reflection to get the properties

using System;
using System.Collections.Generic;
using System.Reflection;

namespace ConsoleApplication1
{
    class Program
    {
        static void Main(string[] args)
        {
            Program p = new Program();
            var anonymous = p.GetList(new[]{
                new { Id = 1, Name = "Foo" },       
                new { Id = 2, Name = "Bar" }
            });

            p.WriteList(anonymous);
        }

        private List<T> GetList<T>(params T[] elements)
        {
            var a = TypeGenerator(elements);
            return a;
        }

        public static List<T> TypeGenerator<T>(T[] at)
        {
            return new List<T>(at);
        }

        private void WriteList<T>(List<T> elements)
        {
            PropertyInfo[] pi = typeof(T).GetProperties();
            foreach (var el in elements)
            {
                foreach (var p in pi)
                {
                    Console.WriteLine("{0}", p.GetValue(el, null));
                }
            }
            Console.ReadLine();
        }
    }
}

It helps in correct sorting in the case that you will need to concatenate this "integer" with something else (another number or text) which will require to be sorted as a "text" then.

for example,

if you will need to use the integer field numbers (let's say 5) concatenated as A-005 or 10/0005

Walkthrough of creating and deleting an environment variable in bash:

Test if the DUALCASE variable exists:

el@apollo:~$ env | grep DUALCASE
el@apollo:~$ 

It does not, so create the variable and export it:

el@apollo:~$ DUALCASE=1
el@apollo:~$ export DUALCASE

Check if it is there:

el@apollo:~$ env | grep DUALCASE
DUALCASE=1

It is there. So get rid of it:

el@apollo:~$ unset DUALCASE

Check if it's still there:

el@apollo:~$ env | grep DUALCASE
el@apollo:~$ 

The DUALCASE exported environment variable is deleted.

Extra commands to help clear your local and environment variables:

Unset all local variables back to default on login:

el@apollo:~$ CAN="chuck norris"
el@apollo:~$ set | grep CAN
CAN='chuck norris'
el@apollo:~$ env | grep CAN
el@apollo:~$
el@apollo:~$ exec bash
el@apollo:~$ set | grep CAN
el@apollo:~$ env | grep CAN
el@apollo:~$

exec bash command cleared all the local variables but not environment variables.

Unset all environment variables back to default on login:

el@apollo:~$ export DOGE="so wow"
el@apollo:~$ env | grep DOGE
DOGE=so wow
el@apollo:~$ env -i bash
el@apollo:~$ env | grep DOGE
el@apollo:~$

env -i bash command cleared all the environment variables to default on login.

Yes, there is a maximum, but it's system dependent. Try it and see, doubling until you hit a limit then searching down. At least with Sun JRE 1.6 on linux you get interesting if not always informative error messages (peregrino is netbook running 32 bit ubuntu with 2G RAM and no swap):

peregrino:$ java -Xmx4096M -cp bin WheelPrimes 
Invalid maximum heap size: -Xmx4096M
The specified size exceeds the maximum representable size.
Could not create the Java virtual machine.

peregrino:$ java -Xmx4095M -cp bin WheelPrimes 
Error occurred during initialization of VM
Incompatible minimum and maximum heap sizes specified

peregrino:$ java -Xmx4092M -cp bin WheelPrimes 
Error occurred during initialization of VM
The size of the object heap + VM data exceeds the maximum representable size

peregrino:$ java -Xmx4000M -cp bin WheelPrimes 
Error occurred during initialization of VM
Could not reserve enough space for object heap
Could not create the Java virtual machine.

(experiment reducing from 4000M until)

peregrino:$ java -Xmx2686M -cp bin WheelPrimes 
(normal execution)

Most are self explanatory, except -Xmx4095M which is rather odd (maybe a signed/unsigned comparison?), and that it claims to reserve 2686M on a 2GB machine with no swap. But it does hint that the maximum size is 4G not 2G for a 32 bit VM, if the OS allows you to address that much.

Make a Facebook app with these simple steps I have written below:

1. Go to Developer tab and click on it.
2. Then go to Website Option.
3. Enter the app name which you have want.
4. Click on Create Facebook App.
5. After this you have to choose category, you can choose App for Pages.
6. Your AppId and Appkey is created automatically. The AppSecretKey is obfuscated. You can click on the show button to see your AppId and AppSecurityKey.

Create custom directive

masterApp.directive('ngRenderCallback', function() {
    return {
        restrict: "A",
        link: function ($scope, element, attrs) {
            setTimeout(function(){ 
                $scope[attrs.ngEl] = element[0];
                $scope.$eval(attrs.ngRenderCallback);               
            }, 30);
        }
    }
});

code for html template

<div ng-render-callback="fnRenderCarousel('carouselA')" ng-el="carouselA"></div>

function in controller

$scope.fnRenderCarousel = function(elName){
    $($scope[elName]).carousel();
}

It's basically how association is made to the element. .click applies to the current DOM, while .on (using delegation) will continue to be valid for new elements added to the DOM after event association.

Which is better to use, I'd say it depends on the case.

Example:

<ul id="todo">
   <li>Do 1</li>
   <li>Do 2</li>
   <li>Do 3</li>
   <li>Do 4</li>
</ul>

.Click Event:

$("li").click(function () {
   $(this).remove ();
});

Event .on:

$("#todo").on("click", "li", function () {
   $(this).remove();
});

Note that I've separated the selector in the .on. I'll explain why.

Let us suppose that after this association, let us do the following:

$("#todo").append("<li>Do 5</li>");

That is where you will notice the difference.

If the event was associated via .click, task 5 will not obey the click event, and so it will not be removed.

If it was associated via .on, with the selector separate, it will obey.

If you just want a very quick way to debug the result:

$ch = curl_init();
curl_exec($ch);
$curl_error = curl_error($ch);
echo "<script>console.log($curl_error);</script>"

Given below is PHP code to generate tomorrow's date using mktime() and change its format to dd/mm/yyyy format and then print it using echo.

$tomorrow = mktime(0, 0, 0, date("m"), date("d") + 1, date("Y"));
echo date("d", $tomorrow) . "/" . date("m", $tomorrow). "/" . date("Y", $tomorrow);

No, it won't, unless you do some work.

The important part here is what DEBUG really is, and it's a kind of constant defined that the compiler can check against.

If you check the project properties, under the Build tab, you'll find three things:

• A text box labelled "Conditional compilation symbols"
• A check box labelled "Define DEBUG constant"
• A check box labelled "Define TRACE constant"

There is no such checkbox, nor constant/symbol pre-defined that has the name RELEASE.

However, you can easily add that name to the text box labelled Conditional compilation symbols, but make sure you set the project configuration to Release-mode before doing so, as these settings are per configuration.

So basically, unless you add that to the text box, #if RELEASE won't produce any code under any configuration.

I needed to do this from Jenkins pipeline, so, needed to upload files to specific folder name but not to the root container folder. I use --destination-path that can be folder or folder1/folder2

az storage blob upload-batch --account-name $AZURE_STORAGE_ACCOUNT --destination ${CONTAINER_NAME} --destination-path ${VERSION_FOLDER} --source ${BUILD_FOLDER} --account-key $ACCESS_KEY

hope this help to someone

I'm late to the game here, but another approach could be:

1) create a branch from the tag ($ git checkout -b [new branch name] [tag name])

2) create a pull-request to merge with your new branch into the destination branch

Library:

It is just a collection of routines (functional programming) or class definitions(object oriented programming). The reason behind is simply code reuse, i.e. get the code that has already been written by other developers. The classes or routines normally define specific operations in a domain specific area. For example, there are some libraries of mathematics which can let developer just call the function without redo the implementation of how an algorithm works.

Framework:

In framework, all the control flow is already there, and there are a bunch of predefined white spots that we should fill out with our code. A framework is normally more complex. It defines a skeleton where the application defines its own features to fill out the skeleton. In this way, your code will be called by the framework when appropriately. The benefit is that developers do not need to worry about if a design is good or not, but just about implementing domain specific functions.

Library,Framework and your Code image representation:

KeyDifference:

The key difference between a library and a framework is “Inversion of Control”. When you call a method from a library, you are in control. But with a framework, the control is inverted: the framework calls you. Source.

Relation:

Both of them defined API, which is used for programmers to use. To put those together, we can think of a library as a certain function of an application, a framework as the skeleton of the application, and an API is connector to put those together. A typical development process normally starts with a framework, and fill out functions defined in libraries through API.

It's been some years since I last worked with Access but larger database files always used to have more problems and be more prone to corruption than smaller files.

Unless the database file is only being accessed by one person or stored on a robust network you may find this is a problem before the 2GB database size limit is reached.

I needed a variation on this, which I expect will be useful to others:

function diffs() {
        diff "${@:3}" <(sort "$1") <(sort "$2")
}

The "${@:3}" part means all the members of the array starting at 3. So this function implements a sorted diff by passing the first two arguments to diff through sort and then passing all other arguments to diff, so you can call it similarly to diff:

diffs file1 file2 [other diff args, e.g. -y]

There is also the function unit_vector() to normalize vectors in the popular transformations module by Christoph Gohlke:

import transformations as trafo
import numpy as np

data = np.array([[1.0, 1.0, 0.0],
                 [1.0, 1.0, 1.0],
                 [1.0, 2.0, 3.0]])

print(trafo.unit_vector(data, axis=1))

<SELECT id="sel" onmouseover="alert(this.options[1].text);"
<option value=1>my love</option>
<option value=2>for u</option>
</SELECT>

When you create the colorbar try using the fraction and/or shrink parameters.

From the documents:

fraction 0.15; fraction of original axes to use for colorbar

shrink 1.0; fraction by which to shrink the colorbar

According to Google Android Development guide, the variable scope should be limited. Please check this link:

Limit Variable Scope

I want to warn you that $('a[data-attribute=true]') doesn't work, as per Ashley's reply, if you attached data to a DOM element via the data() function.

It works as you'd expect if you added an actual data-attr in your HTML, but jQuery stores the data in memory, so the results you'd get from $('a[data-attribute=true]') would not be correct.

You'll need to use the data plugin http://code.google.com/p/jquerypluginsblog/, use Dmitri's filter solution, or do a $.each over all the elements and check .data() iteratively

The accepted solution doesn't cover edge cases. I found the way to do this with 4KB script. Handle your input and convert a data.

Examples:

00:00:00 -> 00:00:00
12:01 -> 12:01:00
12 -> 12:00:00
25 -> 00:00:00
12:60:60 -> 12:00:00
1dg46 -> 14:06

You got the idea... Check it https://github.com/alekspetrov/time-input-js

Given a file named Me.Jar:

1. Go to cmd
2. Hit Enter

3. Use the Java jar command -- I am using jdk1.8.0_31 so I would type

   C:\Program Files (x86)\Java\jdk1.8.0_31\bin\jar xf me.jar

That should extract the file to the folder bin. Look for the file .class in my case my Me.jar contains a Valentine.class

Type java Valentine and press Enter and your message file will be opened.

As an empty string is not valid JSON it would be incorrect for JSON.parse('') to return null because "null" is valid JSON. e.g.

JSON.parse("null");

returns null. It would be a mistake for invalid JSON to also be parsed to null.

While an empty string is not valid JSON two quotes is valid JSON. This is an important distinction.

Which is to say a string that contains two quotes is not the same thing as an empty string.

JSON.parse('""');

will parse correctly, (returning an empty string). But

JSON.parse('');

will not.

Valid minimal JSON strings are

The empty object '{}'

The empty array '[]'

The string that is empty '""'

A number e.g. '123.4'

The boolean value true 'true'

The boolean value false 'false'

The null value 'null'

I feel I need to clarify one very important thing, for others (like my co-worker) who came across this thread and got the wrong information.

The answer given ("Try decimal(9,2) or decimal(10,2) or whatever.") is correct, but the reason ("increase the number of digits before the decimal") is wrong.

decimal(p,s) and numeric(p,s) both specify a Precision and a Scale. The "precision" is not the number of digits to the left of the decimal, but instead is the total precision of the number.

For example: decimal(2,1) covers 0.0 to 9.9, because the precision is 2 digits (00 to 99) and the scale is 1. decimal(4,1) covers 000.0 to 999.9 decimal(4,2) covers 00.00 to 99.99 decimal(4,3) covers 0.000 to 9.999

$scope.printDiv = function(divName) {
  var printContents = document.getElementById(divName).innerHTML;
  var popupWin = window.open('', '_blank', 'width=300,height=300');
  popupWin.document.open();
  popupWin.document.write('<html><head><link rel="stylesheet" type="text/css" href="style.css" /></head><body onload="window.print()">' + printContents + '</body></html>');
  popupWin.document.close();
} 

If your requirements are to have no duplicates, you should be using a HashSet.

HashSet.Add will return false when the item already exists (if that even matters to you).

You can use the constructor that @pstrjds links to below (or here) to define the equality operator or you'll need to implement the equality methods in RemoteDevice (GetHashCode & Equals).

It looks like you are trying to use (almost) straight up C code here. Go has a few differences.

• First off, you can't initialize arrays and slices as const. The term const has a different meaning in Go, as it does in C. The list should be defined as var instead.
• Secondly, as a style rule, Go prefers basenameOpts as opposed to basename_opts.
• There is no char type in Go. You probably want byte (or rune if you intend to allow unicode codepoints).
• The declaration of the list must have the assignment operator in this case. E.g.: var x = foo.
• Go's parser requires that each element in a list declaration ends with a comma. This includes the last element. The reason for this is because Go automatically inserts semi-colons where needed. And this requires somewhat stricter syntax in order to work.

For example:

type opt struct {
    shortnm      byte
    longnm, help string
    needArg      bool
}

var basenameOpts = []opt { 
    opt {
        shortnm: 'a', 
        longnm: "multiple", 
        needArg: false, 
        help: "Usage for a",
    },
    opt {
        shortnm: 'b', 
        longnm: "b-option", 
        needArg: false, 
        help: "Usage for b",
    },
}

An alternative is to declare the list with its type and then use an init function to fill it up. This is mostly useful if you intend to use values returned by functions in the data structure. init functions are run when the program is being initialized and are guaranteed to finish before main is executed. You can have multiple init functions in a package, or even in the same source file.

    type opt struct {
        shortnm      byte
        longnm, help string
        needArg      bool
    }

    var basenameOpts []opt

    func init() { 
        basenameOpts = []opt{
            opt {
                shortnm: 'a', 
                longnm: "multiple", 
                needArg: false, 
                help: "Usage for a",
            },
            opt {
                shortnm: 'b', 
                longnm: "b-option", 
                needArg: false, 
               help: "Usage for b",
            },
        }
    }

Since you are new to Go, I strongly recommend reading through the language specification. It is pretty short and very clearly written. It will clear a lot of these little idiosyncrasies up for you.

As myJSON is an object you can just set its properties, for example:

myJSON.list1 = ["1","2"];

If you dont know the name of the properties, you have to use the array access syntax:

myJSON['list'+listnum] = ["1","2"];

If you want to add an element to one of the properties, you can do;

myJSON.list1.push("3");

One of the easiest solution is

$objectData = (object) $arrayData

try this

Jobs

select s.name,l.name
 from  msdb..sysjobs s 
 left join master.sys.syslogins l on s.owner_sid = l.sid

Packages

select s.name,l.name 
from msdb..sysssispackages s 
 left join master.sys.syslogins l on s.ownersid = l.sid

you can use help on command prompt on cd command by writing this command cd /? as shown in this figure

Try using ctoc from npm. https://www.npmjs.com/package/ctoc_timezone

It has got simple functionality to change timezones (most timezones around 400) and all custom formats u want it to display.

Error: java.lang.NoSuchMethodError: javax.persistence.JoinTable.indexes()[Ljavax/persistence/Index;

The only thing that solved my problem was removing the following dependency in pom.xml: <dependency> <groupId>org.hibernate.javax.persistence</groupId> <artifactId>hibernate-jpa-2.1-api</artifactId> <version>1.0.0.Final</version> </dependency>

And replace it for:

<dependency>
  <groupId>javax.persistence</groupId>
  <artifactId>persistence-api</artifactId>
  <version>1.0.2</version>
</dependency>

Hope it helps someone.

Here is a simple analogy; Imagine you are downloading movies online, with O(1), if it takes 5 minutes to download one movie, it will still take the same time to download 20 movies. So it doesn't matter how many movies you are downloading, they will take the same time(5 minutes) whether it's one or 20 movies. A normal example of this analogy is when you go to a movie library, whether you are taking one movie or 5, you will simply just pick them at once. Hence spending the same time.

However, with O(n), if it takes 5 minutes to download one movie, it will take about 50 minutes to download 10 movies. So time is not constant or is somehow proportional to the number of movies you are downloading.

I had this problem too. I solved it by removing the unnecessary blank line between equation tags. This gives the error:

\begin{equation}
P(\underline{\hat{X}} | \underline{Y}) = ...

\end{equation}

while this code compiles succesfully:

\begin{equation}
P(\underline{\hat{X}} | \underline{Y}) = ...
\end{equation}

Use a scalar-valued UDF, not a table-value one, then you can use it in a SELECT as you want.

I would use return instead of break.

angular.forEach([0,1,2], function(count){
  if(count == 1){
    return;
  }
});

Works like a charm.

As the error messages stated, ngFor only supports Iterables such as Array, so you cannot use it for Object.

change

private extractData(res: Response) {
  let body = <Afdelingen[]>res.json();
  return body || {};       // here you are return an object
}

to

private extractData(res: Response) {
  let body = <Afdelingen[]>res.json().afdelingen;    // return array from json file
  return body || [];     // also return empty array if there is no data
}

Make use of WebkitTransform / -moz-transform: rotate(Xdeg). This will not work in IE, but Matt's zachstronaut solution doesn't work in IE either.

If you want to support IE too, you'll have to look into using a canvas like I believe Raphael does.

Here is a simple jQuery snippet that rotates the elements in a jQuery object. Rotation can be started and stopped:

$(function() {_x000D_
    var $elie = $("img"), degree = 0, timer;_x000D_
    rotate();_x000D_
    function rotate() {_x000D_
        _x000D_
        $elie.css({ WebkitTransform: 'rotate(' + degree + 'deg)'});  _x000D_
        $elie.css({ '-moz-transform': 'rotate(' + degree + 'deg)'});                      _x000D_
        timer = setTimeout(function() {_x000D_
            ++degree; rotate();_x000D_
        },5);_x000D_
    }_x000D_
    _x000D_
    $("input").toggle(function() {_x000D_
        clearTimeout(timer);_x000D_
    }, function() {_x000D_
        rotate();_x000D_
    });_x000D_
}); 

<script src="https://ajax.googleapis.com/ajax/libs/jquery/1.4.2/jquery.min.js"></script>_x000D_
<input type="button" value=" Toggle Spin " />_x000D_
<br/><br/><br/><br/>_x000D_
<img src="http://i.imgur.com/ABktns.jpg" />

You can generate all combinations of a list in Python using this simple code:

import itertools

a = [1,2,3,4]
for i in xrange(0,len(a)+1):
   print list(itertools.combinations(a,i))

Result would be:

[()]
[(1,), (2,), (3,), (4,)]
[(1, 2), (1, 3), (1, 4), (2, 3), (2, 4), (3, 4)]
[(1, 2, 3), (1, 2, 4), (1, 3, 4), (2, 3, 4)]
[(1, 2, 3, 4)]

I had a similar problem. This helps me across main email clients. Add:

• attributes cellpadding="0", cellspacing="0" and border="0" to tables
• style border-collapse: collapse; to tables
• styles padding: 0; margin: 0; to each element
• and styles font-size: 0px; line-height: 0px; to each element which is empty

If you want to make that you said, you can use quotes. Something like this

$name = "Joe Blow, CFA.";
$arr[] = "\"".$name."\"";

so now, you can use comma in your name variable.

You have to create a new customer object in every iteration and then add that newly created object into the ArrayList at the lase of your iteration.

The equals (=) operator is a "comparison operator compares two values for equality." In other words, in an SQL statement, it won't return true unless both sides of the equation are equal. For example:

SELECT * FROM Store WHERE Quantity = 200;

The LIKE operator "implements a pattern match comparison" that attempts to match "a string value against a pattern string containing wild-card characters." For example:

SELECT * FROM Employees WHERE Name LIKE 'Chris%';

LIKE is generally used only with strings and equals (I believe) is faster. The equals operator treats wild-card characters as literal characters. The difference in results returned are as follows:

SELECT * FROM Employees WHERE Name = 'Chris';

And

SELECT * FROM Employees WHERE Name LIKE 'Chris';

Would return the same result, though using LIKE would generally take longer as its a pattern match. However,

SELECT * FROM Employees WHERE Name = 'Chris%';

And

SELECT * FROM Employees WHERE Name LIKE 'Chris%';

Would return different results, where using "=" results in only results with "Chris%" being returned and the LIKE operator will return anything starting with "Chris".

Hope that helps. Some good info can be found here.

php's email() function hands the email over to a underlying mail transfer agent which is usually postfix on linux systems

so the preferred method on linux is to configure your postfix to use a relayhost, which is done by a line of

relayhost = smtp.example.com

in /etc/postfix/main.cf

however in the OP's scenario I somehow suspect that it's a job that his hosting team should have done

The simplest one:

<div id="myIframe" style="width:640px; height:480px;">
   <div style="background:transparent; position:absolute; z-index:1; width:100%; height:100%; cursor:pointer;" onClick="style.pointerEvents='none'"></div>
   <iframe src="https://www.google.com/maps/d/embed?mid=XXXXXXXXXXXXXX" style="width:640px; height:480px;"></iframe>
</div>

Check your build types of each project under project properties - I bet one or the other will be set to build against .NET XX - Client Profile.

With inconsistent versions, specifically with one being Client Profile and the other not, then it works at design time but fails at compile time. A real gotcha.

There is something funny going on in Visual Studio 2010 for me, which keeps setting projects seemingly randomly to Client Profile, sometimes when I create a project, and sometimes a few days later. Probably some keyboard shortcut I'm accidentally hitting...

This can achieve using two SQL functions- SUBSTRING and CHARINDEX

You can read strings to a variable as shown in the above answers, or can add it to a SELECT statement as below:

SELECT SUBSTRING('Net Operating Loss - 2007' ,0, CHARINDEX('-','Net Operating Loss - 2007'))

The following is my configuration:

cmake_minimum_required(VERSION 2.8)
set(Boost_INCLUDE_DIR /usr/local/src/boost_1_46_1)
set(Boost_LIBRARY_DIR /usr/local/src/boost_1_46_1/stage/lib)
find_package(Boost COMPONENTS system filesystem REQUIRED)
include_directories(${Boost_INCLUDE_DIR})
link_directories(${Boost_LIBRARY_DIR})

add_executable(main main.cpp)
target_link_libraries( main ${Boost_LIBRARIES} )

If the above doesn't work, find the loginname of the spid and disable it in Security - Logins

Suppose your DF is having those extra character in between numbers as well.The last entry.

  result   time
0   +52A  09:00
1   +62B  10:00
2   +44a  11:00
3   +30b  12:00
4  -110a  13:00
5   3+b0  14:00

You can try str.replace to remove characters not only from start and end but also from in between.

DF['result'] = DF['result'].str.replace('\+|a|b|\-|A|B', '')

Output:

  result   time
0     52  09:00
1     62  10:00
2     44  11:00
3     30  12:00
4    110  13:00
5     30  14:00

The solution is to set the cell style through this function:

$sheet->getStyle('A1')->getAlignment()->applyFromArray(
    array('horizontal' => PHPExcel_Style_Alignment::HORIZONTAL_CENTER,)
);

Full code

<?php
/** Error reporting */
error_reporting(E_ALL);
ini_set('display_errors', TRUE);
ini_set('display_startup_errors', TRUE);
date_default_timezone_set('Europe/London');

/** Include PHPExcel */
require_once '../Classes/PHPExcel.php';

$objPHPExcel = new PHPExcel();
$sheet = $objPHPExcel->getActiveSheet();
$sheet->setCellValueByColumnAndRow(0, 1, "test");
$sheet->mergeCells('A1:B1');
$sheet->getStyle('A1')->getAlignment()->applyFromArray(
    array('horizontal' => PHPExcel_Style_Alignment::HORIZONTAL_CENTER,)
);
$objWriter = PHPExcel_IOFactory::createWriter($objPHPExcel, 'Excel2007');
$objWriter->save("test.xlsx");

In short:

• Read the files using the HTML5 FileReader API with .readAsArrayBuffer
• Create a Blob with the file data and get its url with window.URL.createObjectURL(blob)
• Create new Image element and set it's src to the file blob url
• Send the image to the canvas. The canvas size is set to desired output size
• Get the scaled-down data back from canvas via canvas.toDataURL("image/jpeg",0.7) (set your own output format and quality)
• Attach new hidden inputs to the original form and transfer the dataURI images basically as normal text
• On backend, read the dataURI, decode from Base64, and save it

Source: code.

I've tried all the previous answers and found the answer on MSDN after none of these worked for me. See 'UserName4' for the correct one for me.

I'm after the Logged in User, as displayed by:

<asp:LoginName ID="LoginName1" runat="server" />

Here's a little function I wrote to try them all. My result is in the comments after each row.

protected string GetLoggedInUsername()
{
    string UserName = System.Security.Principal.WindowsIdentity.GetCurrent().Name; // Gives NT AUTHORITY\SYSTEM
    String UserName2 = Request.LogonUserIdentity.Name; // Gives NT AUTHORITY\SYSTEM
    String UserName3 = Environment.UserName; // Gives SYSTEM
    string UserName4 = HttpContext.Current.User.Identity.Name; // Gives actual user logged on (as seen in <ASP:Login />)
    string UserName5 = System.Windows.Forms.SystemInformation.UserName; // Gives SYSTEM
    return UserName4;
}

Calling this function returns the logged in username by return.

Update: I would like to point out that running this code on my Local server instance shows me that Username4 returns "" (an empty string), but UserName3 and UserName5 return the logged in User. Just something to beware of.

In my case, I had to uninstall pip and reinstall it. So I could install my specific version.

sudo apt-get purge --auto-remove python-pip
sudo easy_install pip 

You can fix the issue with the following steps:

1. Verify the folder exists with sudo cd /var/lib/php/session. If it does not exist then sudo mkdir /var/lib/php/session or double check the logs to make sure you have the correct path.
2. Give the folder full read and write permissions with sudo chmod 666 /var/lib/php/session.

Rerun you script and it should be working fine, however, it's not recommended to leave the folder with full permissions. For security, files and folders should only have the minimum permissions required. The following steps will fix that:

1. You should already be in the session folder so just run sudo ls -l to find out the owner of the session file.
2. Set the correct owner of the session folder with sudo chown user /var/lib/php/session.
3. Give just the owner full read and write permissions with sudo chmod 600 /var/lib/php/session.

NB

You might not need to use the sudo command.

Here is what I did

ul {_x000D_
      display: block;_x000D_
      width: 100%;_x000D_
}_x000D_
_x000D_
ul li{_x000D_
    display: block;_x000D_
    min-width: calc(30% - 10px);_x000D_
    float: left;_x000D_
}_x000D_
_x000D_
ul li:nth-child(2n + 1){_x000D_
    clear: left;_x000D_
}

<ul>_x000D_
  <li>1</li>_x000D_
  <li>2</li>_x000D_
  <li>3</li>_x000D_
  <li>4</li>_x000D_
  <li>5</li>_x000D_
  <li>6</li>_x000D_
  <li>7</li>_x000D_
  <li>8</li>_x000D_
  <li>9</li>_x000D_
  <li>0</li>_x000D_
</ul>

Use the body of this loop to do whatever you want to with the digits

for digit in map(int, str(my_number)):

Check this article for the 5 laws of API dates and times HERE:

• Law #1: Use ISO-8601 for your dates
• Law #2: Accept any timezone
• Law #3: Store it in UTC
• Law #4: Return it in UTC
• Law #5: Don’t use time if you don’t need it

More info in the docs.

I for myself prefer Lukas Edger's solution.

But you might want to know there is also a function SYS_GUID which can be applied as a default value to a column and generate unique ids.

you can read more about pros and cons here

var d = new Date();

// calling the function
formatDate(d,4);


function formatDate(dateObj,format)
{
    var monthNames = [ "January", "February", "March", "April", "May", "June", "July", "August", "September", "October", "November", "December" ];
    var curr_date = dateObj.getDate();
    var curr_month = dateObj.getMonth();
    curr_month = curr_month + 1;
    var curr_year = dateObj.getFullYear();
    var curr_min = dateObj.getMinutes();
    var curr_hr= dateObj.getHours();
    var curr_sc= dateObj.getSeconds();
    if(curr_month.toString().length == 1)
    curr_month = '0' + curr_month;      
    if(curr_date.toString().length == 1)
    curr_date = '0' + curr_date;
    if(curr_hr.toString().length == 1)
    curr_hr = '0' + curr_hr;
    if(curr_min.toString().length == 1)
    curr_min = '0' + curr_min;

    if(format ==1)//dd-mm-yyyy
    {
        return curr_date + "-"+curr_month+ "-"+curr_year;       
    }
    else if(format ==2)//yyyy-mm-dd
    {
        return curr_year + "-"+curr_month+ "-"+curr_date;       
    }
    else if(format ==3)//dd/mm/yyyy
    {
        return curr_date + "/"+curr_month+ "/"+curr_year;       
    }
    else if(format ==4)// MM/dd/yyyy HH:mm:ss
    {
        return curr_month+"/"+curr_date +"/"+curr_year+ " "+curr_hr+":"+curr_min+":"+curr_sc;       
    }
}

I am nothing adding new here but another alternate way.

 var newCodes = function() {
     var dCodes = fg.codecsCodes.rs;
     var dCodes2 = fg.codecsCodes2.rs;
     let [...val] = [dCodes,dCodes2];
     return [...val];
 };

I came here with similar error:

System.InvalidOperationException: 'The entity type 'MyType' requires a primary key to be defined.'

After reading answer by hvd, realized I had simply forgotten to make my key property 'public'. This..

namespace MyApp.Models.Schedule
{
    public class MyType
    {
        [Key]
        int Id { get; set; }

        // ...

Should be this..

namespace MyApp.Models.Schedule
{
    public class MyType
    {
        [Key]
        public int Id { get; set; }  // must be public!

        // ...

its kind of hacky but it works well-ish

 function close_frame(){
    if(!window.should_close){
        window.should_close=1;
    }else if(window.should_close==1){
        location.reload();
        //or iframe hide or whatever
    }
 }

 <iframe src="iframe_index.php" onload="close_frame()"></iframe>

then inside the frame

$('#close_modal_main').click(function(){
        window.location = 'iframe_index.php?close=1';
});

and if you want to get fancy through a

if(isset($_GET['close'])){
  die;
}

at the top of your frame page to make that reload unnoticeable

so basically the first time the frame loads it doesnt hide itself but the next time it loads itll call the onload function and the parent will have a the window var causing the frame to close

Another method is has_key() (if still using Python 2.X):

>>> a={"1":"one","2":"two"}
>>> a.has_key("1")
True

another one:

if(this.checkValidity() == false) {

                $(this).addClass('was-validated');
                e.preventDefault();
                e.stopPropagation();
                e.stopImmediatePropagation();

                return false;
}

This error can come if there is validation error either in your wsdl or xsd file. For instance I too got the same issue while running wsdl2java to convert my wsdl file to generate the client. In one of my xsd it was defined as below

<xs:import schemaLocation="" namespace="http://MultiChoice.PaymentService/DataContracts" />

Where the schemaLocation was empty. By providing the proper data in schemaLocation resolved my problem.

<xs:import schemaLocation="multichoice.paymentservice.DataContracts.xsd" namespace="http://MultiChoice.PaymentService/DataContracts" />

for block elements:

<textarea style="width:100px; word-wrap:break-word;">_x000D_
  ACTGATCGAGCTGAAGCGCAGTGCGATGCTTCGATGATGCTGACGATGCTACGATGCGAGCATCTACGATCAGTC_x000D_
</textarea>

for inline elements:

<span style="width:100px; word-wrap:break-word; display:inline-block;"> _x000D_
   ACTGATCGAGCTGAAGCGCAGTGCGATGCTTCGATGATGCTGACGATGCTACGATGCGAGCATCTACGATCAGTC_x000D_
</span>

The regular filter options in Excel don't allow for more than 2 criteria settings. To do 2+ criteria settings, you need to use the Advanced Filter option. Below are the steps I did to try this out.

http://www.bettersolutions.com/excel/EDZ483/QT419412321.htm

Set up the criteria. I put this above the values I want to filter. You could do that or put on a different worksheet. Note that putting the criteria in rows will make it an 'OR' filter and putting them in columns will make it an 'AND' filter.

1. E1 : Letters
2. E2 : =m
3. E3 : =h
4. E4 : =j

I put the data starting on row 5:

1. A5 : Letters
2. A6 :
3. A7 :
4. ...

Select the first data row (A6) and click the Advanced Filter option. The List Range should be pre-populated. Select the Criteria range as E1:E4 and click OK.

That should be it. Note that I use the '=' operator. You will want to use something a bit different to test for file extensions.