Double quotes around the filename in the header is the standard per MDN web docs. Omitting the quotes creates multiple opportunities for problems arising from characters in the filename.

Incomplete information: we need to know which line is throwing the NullReferenceException in order to tell precisely where the problem lies.

Obviously, you are using an uninitialized variable (i.e., a variable that has been declared but not initialized) and try to access one of its non-static method/property/whatever.

Solution: - Find the line that is throwing the exception from the exception details - In this line, check that every variable you are using has been correctly initialized (i.e., it is not null)

Good luck.

Silent is not a solution. You need fix your mock in your test. See official documentation here.

Unnecessary stubs are stubbed method calls that were never realized during test execution (see also MockitoHint), example:

//code under test:
 ...
 String result = translator.translate("one")
 ...

 //test:
 ...
 when(translator.translate("one")).thenReturn("jeden"); // <- stubbing realized during code execution
 when(translator.translate("two")).thenReturn("dwa"); // <- stubbing never realized
 ...

Notice that one of the stubbed methods were never realized in the code under test, during test execution. The stray stubbing might be an oversight of the developer, the artifact of copy-paste or the effect not understanding the test/code. Either way, the developer ends up with unnecessary test code. In order to keep the codebase clean & maintainable it is necessary to remove unnecessary code. Otherwise tests are harder to read and reason about.

To find out more about detecting unused stubbings see MockitoHint.

git reset and git clean can be overkill in some situations (and be a huge waste of time).

If you simply have a message like "The following untracked files would be overwritten..." and you want the remote/origin/upstream to overwrite those conflicting untracked files, then git checkout -f <branch> is the best option.

If you're like me, your other option was to clean and perform a --hard reset then recompile your project.

You might want to try this example for version 2.6 of Python.

def my_print(text, begin, end):
    "Print text in UPPER between 'begin' and 'end' in lower."
    for obj in (text, begin, end):
        assert isinstance(obj, str), 'Argument of wrong type!'
    print begin.lower() + text.upper() + end.lower()

However, have you considered letting the function fail naturally instead?

There is a brilliant blog post from Taiseer Joudeh with a detailed step-by-step description.

1. Part 1: Token Based Authentication using ASP.NET Web API 2, Owin, and Identity
2. Part 2: AngularJS Token Authentication using ASP.NET Web API 2, Owin, and Identity
3. Part 3: Enable OAuth Refresh Tokens in AngularJS App using ASP .NET Web API 2, and Owin
4. Part 4: ASP.NET Web API 2 external logins with Facebook and Google in AngularJS app
5. Part 5: Decouple OWIN Authorization Server from Resource Server

When creating a PWA, a service worker used on an non https server also generates this error.

Actually. If you look into sources of HttpClientTransport you will notice that it is also writing messages into java.util.logging.Logger. Which means you can see those messages in your logs too.

For example if you are using Log4J2 all you need to do is the following:

• add JUL-Log4J2 bridge into your class path
• set TRACE level for com.sun.xml.internal.ws.transport.http.client package.
• add -Djava.util.logging.manager=org.apache.logging.log4j.jul.LogManager system property to your applicaton start command line

After these steps you start seeing SOAP messages in your logs.

I don't know of any explicit fork call in bash. What you probably want to do is append & to a command that you want to run in the background. You can also use & on functions that you define within a bash script:

do_something_with_line()
{
  line=$1
  foo
  foo2
  foo3
}

for line in file
do
  do_something_with_line $line &
done

EDIT: to put a limit on the number of simultaneous background processes, you could try something like this:

for line in file
do
  while [`jobs | wc -l` -ge 50 ]
  do
    sleep 5
  done
  do_something_with_line $line &
done

another solution is to add toggle=false to the collapse target, this will stop it randomly opening and closing which happens if you just remove the "in"

eg

<div class="accordion-heading">
    <a class="accordion-toggle"
        data-toggle="collapse"
        data-parent="#accordion2"
        href="#collapseOne">Open!</a>
</div>
<div
    id="collapseOne"
    class="accordion-body collapse"
    data-toggle="false"
    >
    <div class="span6">
        <div class="well well-small">
            <div class="accordion-toggle">
                ...some text...
            </div>
        </div>
    </div>
    <div class="span2"></div>                            
</div>

Until version 4.6

The dash type of a linestyle is given by the linetype, which does also select the line color unless you explicitely set an other one with linecolor.

However, the support for dashed lines depends on the selected terminal:

1. Some terminals don't support dashed lines, like png (uses libgd)
2. Other terminals, like pngcairo, support dashed lines, but it is disables by default. To enable it, use set termoption dashed, or set terminal pngcairo dashed ....
3. The exact dash patterns differ between terminals. To see the defined linetype, use the test command:

Running

set terminal pngcairo dashed
set output 'test.png'
test
set output

gives:

whereas, the postscript terminal shows different dash patterns:

set terminal postscript eps color colortext
set output 'test.eps'
test
set output

Version 5.0

Starting with version 5.0 the following changes related to linetypes, dash patterns and line colors are introduced:

• A new dashtype parameter was introduced:

  To get the predefined dash patterns, use e.g.

  plot x dashtype 2
  

  You can also specify custom dash patterns like

  plot x dashtype (3,5,10,5),\
       2*x dashtype '.-_'
  

• The terminal options dashed and solid are ignored. By default all lines are solid. To change them to dashed, use e.g.

  set for [i=1:8] linetype i dashtype i
  

• The default set of line colors was changed. You can select between three different color sets with set colorsequence default|podo|classic:

For those like me who wonder how legacy apps are treated, I did a bit of testing and computation on the subject.

Thanks to @hannes-sverrisson hint, I started on the assumption that a legacy app is treated with a 320x568 view in iPhone 6 and iPhone 6 plus.

The test was made with a simple black background [email protected] with a white border. The background has a size of 640x1136 pixels, and it is black with an inner white border of 1 pixel.

Below are the screenshots provided by the simulator:

• iPhone 5 simulator : http://i.stack.imgur.com/b2E5K.png
• iPhone 6 simulator : http://i.stack.imgur.com/4Qz8N.png
• iPhone 6 plus simulator : http://i.stack.imgur.com/hQisc.png

On the iPhone 6 screenshot, we can see a 1 pixel margin on top and bottom of the white border, and a 2 pixel margin on the iPhone 6 plus screenshot. This gives us a used space of 1242x2204 on iPhone 6 plus, instead of 1242x2208, and 750x1332 on the iPhone 6, instead of 750x1334.

We can assume that those dead pixels are meant to respect the iPhone 5 aspect ratio:

iPhone 5               640 / 1136 = 0.5634
iPhone 6 (used)        750 / 1332 = 0.5631
iPhone 6 (real)        750 / 1334 = 0.5622
iPhone 6 plus (used)  1242 / 2204 = 0.5635
iPhone 6 plus (real)  1242 / 2208 = 0.5625

Second, it is important to know that @2x resources will be scaled not only on iPhone 6 plus (which expects @3x assets), but also on iPhone 6. This is probably because not scaling the resources would have led to unexpected layouts, due to the enlargement of the view.

However, that scaling is not equivalent in width and height. I tried it with a 264x264 @2x resource. Given the results, I have to assume that the scaling is directly proportional to the pixels / points ratio.

Device         Width scale             Computed width   Screenshot width
iPhone 5        640 /  640 = 1.0                        264 px
iPhone 6        750 /  640 = 1.171875  309.375          309 px
iPhone 6 plus  1242 /  640 = 1.940625  512.325          512 px

Device         Height scale            Computed height  Screenshot height
iPhone 5       1136 / 1136 = 1.0                        264 px
iPhone 6       1332 / 1136 = 1.172535  309.549          310 px
iPhone 6 plus  2204 / 1136 = 1.940141  512.197          512 px

It's important to note the iPhone 6 scaling is not the same in width and height (309x310). This tends to confirm the above theory that scaling is not proportional in width and height, but uses the pixels / points ratio.

I hope this helps.

////////////////////////// 1] File to Byte [] ///////////////////

Path path = Paths.get(p);
                    byte[] data = null;                         
                    try {
                        data = Files.readAllBytes(path);
                    } catch (IOException ex) {
                        Logger.getLogger(Agent1.class.getName()).log(Level.SEVERE, null, ex);
                    }

/////////////////////// 2] Byte [] to File ///////////////////////////

 File f = new File(fileName);
 byte[] fileContent = msg.getByteSequenceContent();
Path path = Paths.get(f.getAbsolutePath());
                            try {
                                Files.write(path, fileContent);
                            } catch (IOException ex) {
                                Logger.getLogger(Agent2.class.getName()).log(Level.SEVERE, null, ex);
                            }

If you want to reuse the HttpClient, it is advised to not use the DefaultRequestHeaders as they are used to send with each request.

You could try this:

var requestMessage = new HttpRequestMessage
    {
        Method = HttpMethod.Post,
        Content = new StringContent("...", Encoding.UTF8, "application/json"),
        RequestUri = new Uri("...")
    };

requestMessage.Headers.Authorization = new AuthenticationHeaderValue("Basic", 
    Convert.ToBase64String(System.Text.ASCIIEncoding.ASCII.GetBytes($"{user}:{password}")));

var response = await _httpClient.SendAsync(requestMessage);

SELECT * 
  FROM TABLENAME 
 WHERE [DateTime] >= '2011-04-12 12:00:00 AM'
   AND [DateTime] <= '2011-05-25 3:35:04 AM'

If this doesn't work, please script out your table and post it here. this will help us get you the correct answer quickly.

You'll want to use the formatting macros from inttypes.h.

See this question: Cross platform format string for variables of type size_t?

Using hbm.xml

    <composite-id>

        <!--<key-many-to-one name="productId" class="databaselayer.users.UserDB" column="user_name"/>-->
        <key-property name="productId" column="PRODUCT_Product_ID" type="int"/>
        <key-property name="categoryId" column="categories_id" type="int" />
    </composite-id>  

Using Annotation

Composite Key Class

public  class PK implements Serializable{
    private int PRODUCT_Product_ID ;    
    private int categories_id ;

    public PK(int productId, int categoryId) {
        this.PRODUCT_Product_ID = productId;
        this.categories_id = categoryId;
    }

    public int getPRODUCT_Product_ID() {
        return PRODUCT_Product_ID;
    }

    public void setPRODUCT_Product_ID(int PRODUCT_Product_ID) {
        this.PRODUCT_Product_ID = PRODUCT_Product_ID;
    }

    public int getCategories_id() {
        return categories_id;
    }

    public void setCategories_id(int categories_id) {
        this.categories_id = categories_id;
    }

    private PK() { }

    @Override
    public boolean equals(Object o) {
        if ( this == o ) {
            return true;
        }

        if ( o == null || getClass() != o.getClass() ) {
            return false;
        }

        PK pk = (PK) o;
        return Objects.equals(PRODUCT_Product_ID, pk.PRODUCT_Product_ID ) &&
                Objects.equals(categories_id, pk.categories_id );
    }

    @Override
    public int hashCode() {
        return Objects.hash(PRODUCT_Product_ID, categories_id );
    }
}

Entity Class

@Entity(name = "product_category")
@IdClass( PK.class )
public  class ProductCategory implements Serializable {
    @Id    
    private int PRODUCT_Product_ID ;   

    @Id 
    private int categories_id ;

    public ProductCategory(int productId, int categoryId) {
        this.PRODUCT_Product_ID = productId ;
        this.categories_id = categoryId;
    }

    public ProductCategory() { }

    public int getPRODUCT_Product_ID() {
        return PRODUCT_Product_ID;
    }

    public void setPRODUCT_Product_ID(int PRODUCT_Product_ID) {
        this.PRODUCT_Product_ID = PRODUCT_Product_ID;
    }

    public int getCategories_id() {
        return categories_id;
    }

    public void setCategories_id(int categories_id) {
        this.categories_id = categories_id;
    }

    public void setId(PK id) {
        this.PRODUCT_Product_ID = id.getPRODUCT_Product_ID();
        this.categories_id = id.getCategories_id();
    }

    public PK getId() {
        return new PK(
            PRODUCT_Product_ID,
            categories_id
        );
    }    
}

If you are using Windows, the virtual machine should have it's own process that is visible in task manager. Use sysinternals Process Explorer to find the right one and then kill it from there.

I found it to be extremely easy to do this with the npm request package (https://www.npmjs.com/package/request)

Then I based my solution on this post http://blog.javascripting.com/2015/01/17/dont-hassle-with-cors/

'use strict'

const express = require('express');
const request = require('request');

let proxyConfig = {
    url : {
        base: 'http://servertoreach.com?id=',
    }
}

/* setting up and configuring node express server for the application */
let server = express();
server.set('port', 3000);


/* methods forwarded to the servertoreach proxy  */
server.use('/somethingElse', function(req, res)
{
    let url = proxyConfig.url.base + req.query.id;
    req.pipe(request(url)).pipe(res);
});


/* start the server */
server.listen(server.get('port'), function() {
    console.log('express server with a proxy listening on port ' + server.get('port'));
});

Instead of

css=#container

use

css=div.container:nth-of-type(1),css=div.container:nth-of-type(2)

It´s possible via Github Organizations. You have to create a new account.

https://github.com/organizations/new

above answer didnt help me as my string value was "700.00"

with Swift 2.2 this works for me

let myString = "700.00"
let myInt = (myString as NSString).integerValue

I passed myInt to NSFormatterClass

let formatter = NSNumberFormatter()
formatter.numberStyle = .CurrencyStyle
formatter.maximumFractionDigits = 0

let priceValue = formatter.stringFromNumber(myInt!)!

//Now priceValue is ? 700

Thanks to this blog post.

This worked for me in Ubuntu LTS 20.04:

$ sudo service mongod start

Bootstrap 4 (4.0.0-alpha.2) uses the css property column-count in the card-columns class to define how many columns of cards would be displayed inside the div element.
But this property has only two values:

• The default value 1 for small screens (max-width: 34em)
• The value 3 for all other sizes (min-width: 34em)

Here's how it is implemented in bootstrap.min.css :

@media (min-width: 34em) {
    .card-columns {
        -webkit-column-count:3;
        -moz-column-count:3;
        column-count:3;
        ?
    }
    ?
}

To make the card stacking responsive, you can add the following media queries to your css file and modify the values for min-width as per your requirements :

@media (min-width: 34em) {
    .card-columns {
        -webkit-column-count: 2;
        -moz-column-count: 2;
        column-count: 2;
    }
}

@media (min-width: 48em) {
    .card-columns {
        -webkit-column-count: 3;
        -moz-column-count: 3;
        column-count: 3;
    }
}

@media (min-width: 62em) {
    .card-columns {
        -webkit-column-count: 4;
        -moz-column-count: 4;
        column-count: 4;
    }
}

@media (min-width: 75em) {
    .card-columns {
        -webkit-column-count: 5;
        -moz-column-count: 5;
        column-count: 5;
    }
}

assuming that string1 is your whole operation

use mdas

double result;
string recurAndCheck(string operation){
  if(operation.indexOf("/")){
     String leftSide = recurAndCheck(operation.split("/")[0]);
     string rightSide = recurAndCheck(operation.split("/")[1]);
     result = Double.parseDouble(leftSide)/Double.parseDouble(rightSide);

  } else if (..continue w/ *...) {
    //same as above but change / with *
  } else if (..continue w/ -) { 
    //change as above but change with -
  } else if (..continuew with +) {
    //change with add
  } else {
    return;
  }
}

I have had the same error. And after I have already thought my mind is broken, because I had rename almost all my models properties the solution was delete one reference on All Syncfusion Controls and add references to the individual controls of this controls. (From Nuget)

This is what I use to have VB wait for process to complete before continuing. I did not write this and do not take credit.

It was offered in some other open forum and works very well for me:

The following declarations are needed for the RunShell subroutine:

Option Explicit

Private Declare Function OpenProcess Lib "kernel32" (ByVal dwDesiredAccess As Long, ByVal bInheritHandle As Long, ByVal dwProcessId As Long) As Long

Private Declare Function GetExitCodeProcess Lib "kernel32" (ByVal hProcess As Long, lpExitCode As Long) As Long

Private Declare Function CloseHandle Lib "kernel32" (ByVal hObject As Long) As Long

Private Const PROCESS_QUERY_INFORMATION = &H400

Private Const STATUS_PENDING = &H103&

'then in your subroutine where you need to shell:

RunShell (path and filename or command, as quoted text)

When you assign a variable to empty curly braces {} eg: new_set = {}, it becomes a dictionary. To create an empty set, assign the variable to a 'set()' ie: new_set = set()

you can add this line: word-break:break-all; to your CSS-code

using Newtonsoft.Json;

Install this class in package console This class works fine in all .NET Versions, for example in my project: I have DNX 4.5.1 and DNX CORE 5.0 and everything works.

Firstly before JSON deserialization, you need to declare a class to read normally and store some data somewhere This is my class:

public class ToDoItem
{
    public string text { get; set; }
    public string complete { get; set; }
    public string delete { get; set; }
    public string username { get; set; }
    public string user_password { get; set; }
    public string eventID { get; set; }
}

In HttpContent section where you requesting data by GET request for example:

HttpContent content = response.Content;
string mycontent = await content.ReadAsStringAsync();
//deserialization in items
ToDoItem[] items = JsonConvert.DeserializeObject<ToDoItem[]>(mycontent);

If you know what class the field is on you can access it using reflection. This example (it's in Groovy but the method calls are identical) gets a Field object for the class Foo and gets its value for the object b. It shows that you don't have to care about the exact concrete class of the object, what matters is that you know the class the field is on and that that class is either the concrete class or a superclass of the object.

groovy:000> class Foo { def stuff = "asdf"}
===> true
groovy:000> class Bar extends Foo {}
===> true
groovy:000> b = new Bar()
===> Bar@1f2be27
groovy:000> f = Foo.class.getDeclaredField('stuff')
===> private java.lang.Object Foo.stuff
groovy:000> f.getClass()
===> class java.lang.reflect.Field
groovy:000> f.setAccessible(true)
===> null
groovy:000> f.get(b)
===> asdf

I still had a dark grey line after attempting the other answers. I had to add the following two lines to make everything "invisible" in terms of row lines between cells.

self.tableView.separatorStyle = UITableViewCellSeparatorStyleNone;
self.tableView.separatorColor = [UIColor clearColor];

you can save them into a $_SESSION variable and then when the user calls that page again populate all the inputs with their respective session variables.

The mappedBy attribute is referencing customer while the property is mCustomer, hence the error message. So either change your mapping into:

/** The collection of stores. */
@OneToMany(mappedBy = "mCustomer", cascade = CascadeType.ALL, fetch = FetchType.LAZY)
private Collection<Store> stores;

Or change the entity property into customer (which is what I would do).

The mappedBy reference indicates "Go look over on the bean property named 'customer' on the thing I have a collection of to find the configuration."

if it is standalone program, download mysql connector jar and add it to your classpath.

if it is a maven project, add below dependency and run your program.

<dependency>
    <groupId>mysql</groupId>
    <artifactId>mysql-connector-java</artifactId>
    <version>5.1.37</version>
</dependency>

The window is the first thing that gets loaded into the browser. This window object has the majority of the properties like length, innerWidth, innerHeight, name, if it has been closed, its parents, and more.

The document object is your html, aspx, php, or other document that will be loaded into the browser. The document actually gets loaded inside the window object and has properties available to it like title, URL, cookie, etc. What does this really mean? That means if you want to access a property for the window it is window.property, if it is document it is window.document.property which is also available in short as document.property.

• See more at: http://eligeske.com/jquery/what-is-the-difference-between-document-and-window-objects-2/#sthash.CVkTMIL7.dpuf

I found the below code very useful, it might help anyone who comes searching here

<html>_x000D_
<body>_x000D_
    <div style="width: 50%; height: 50%; background-color: green; float:left;">-</div>_x000D_
    <div style="width: 50%; height: 50%; background-color: blue; float:right;">-</div>_x000D_
    <div style="width: 100%; height: 50%; background-color: red; clear:both">-</div>_x000D_
</body>_x000D_
</html>

You need the following functions to do this in PHP:

strpos Find the position of the first occurrence of a substring in a string

strrpos Find the position of the last occurrence of a substring in a string

substr Return part of a string

Here's the signature of the substr function:

string substr ( string $string , int $start [, int $length ] )

The signature of the substring function (Java) looks a bit different:

string substring( int beginIndex, int endIndex )

substring (Java) expects the end-index as the last parameter, but substr (PHP) expects a length.

It's not hard, to get the desired length by the end-index in PHP:

$sub = substr($str, $start, $end - $start);

Here is the working code

$start = strpos($message, '-') + 1;
if ($req_type === 'RMT') {
    $pt_password = substr($message, $start);
}
else {
    $end = strrpos($message, '-');
    $pt_password = substr($message, $start, $end - $start);
}

In my case I was using Gradle files that work under Windows but failed on Linux. The include ':SomeProject' and compile project(':SomeProject') were case sensitive and were not found.

<%@ Page Language="C#" AutoEventWireup="True" %>
<!DOCTYPE html>
<html xmlns="http://www.w3.org/1999/xhtml">    
<head>
    <title> HtmlSelect Example </title>
    <script runat="server">
      void Button_Click (Object sender, EventArgs e)
      {
         Label1.Text = "Selected index: " + Select1.SelectedIndex.ToString()
                       + ", value: " + Select1.Value;    
      }    
   </script>    
</head>    
<body>    
   <form id="form1" runat="server">

      Select an item: 

      <select id="Select1" runat="server">    
         <option value="Text for Item 1" selected="selected"> Item 1 </option>
         <option value="Text for Item 2"> Item 2 </option>
         <option value="Text for Item 3"> Item 3 </option>
         <option value="Text for Item 4"> Item 4 </option>
      </select>

      <button onserverclick="Button_Click" runat="server" Text="Submit"/>

      <asp:Label id="Label1" runat="server"/>    
   </form>
</body>
</html>

Source from Microsoft. Hope this is helpful!

if ($done)
{
    header("Location: /url/to/the/other/page");
    exit;
}

To check whether a process/command returned 0 or not, use the operators && == 0 or not == 0 ||:

Just add operator to your script:

execute_command && (

       echo\Return 0, with no execution error
) || (
        echo\Return non 0, something went wrong
     )

command && echo\Return 0 || echo\Return non 0

• For details on Operators' behavior see: Conditional Execution || && ...

Use this syntax:

obj[name]

Note that obj.x is the same as obj["x"] for all valid JS identifiers, but the latter form accepts all string as keys (not just valid identifiers).

obj["Hey, this is ... neat?"] = 42

The standard way to do this is with jQuery UI's CSS Scopes:

<div class="myCssScope">
   <!-- dialog goes here -->
</div>

Unfortunately, the jQuery UI dialog moves the dialog DOM elements to the end of the document, to fix potential z-index issues. This means the scoping won't work (it will no longer have a ".myCssScope" ancestor).

Christoph Herold designed a workaround which I've implemented as a jQuery plugin, maybe that will help.

I would say, in your layout file give a

<div id="background"></div>

and then in your css do

#background {
 position: fixed;
  top: 50%;
  left: 50%;
  min-width: 100%;
  min-height: 100%;
  width: auto;
  height: auto;
  z-index: -100;
  -webkit-transform: translateX(-50%) translateY(-50%);
  transform: translateX(-50%) translateY(-50%);
  background: image-url('background.png') no-repeat;
  background-size: cover;
}

And be sure to have the background image in your app/assets/images and also change the

background: image-url('background.png') no-repeat;

'background.png' to your own background pic.

As of powershell 5.0, you can now use the -Depth parameter in Get-ChildItem!

You combine it with -Recurse to limit the recursion.

Get-ChildItem -Recurse -Depth 2

Hi I got the solution by using this :

You have to execute this command from terminal. I got the result,

adb logcat | grep `adb shell ps | grep com.package | cut -c10-15`

Thanks Alex your second point helped me fix this.

It appears that unless you run visual studio as an administrator in Windows 7 it stores your temp files locally rather than C:\Windows\Microsoft.NET\Framework\v2.0.50727\Temporary ASP.NET Files.

See following blog post: http://www.dotnetscraps.com/dotnetscraps/post/Location-of-Temporary-ASPNET-files-in-Vista-or-Windows-7.aspx

Yet an other way:

s.insert(-1, ' world')

Another possible fix (solved my problem)

You might have configured the environment properly but for some reason it broke along the way. In this case go to:

file > project settings > modules

Deploy the list of SDKs and look for a red line with [invalid] at the end. If you find one, you have to recreate a python sdk.

It is likely that your previously working SDK is there too, but not red. Delete it.

Now you can click on the new button and add your favorite python virtualenv. And it should work now.

It is possible and it is really simple if you look at it when finishing the implementation, which is again - very simple, since the only items you need are two boolean variables: internet reachability and host reachability (you often need more than one of these). Once you assemble your helper class that can determine the connections status, you really don't care again of the implementation needed for knowing these procedures.

Example:

#import <Foundation/Foundation.h>

@class Reachability;

@interface ConnectionManager : NSObject {
    Reachability *internetReachable;
    Reachability *hostReachable;
}

@property BOOL internetActive;
@property BOOL hostActive;

- (void) checkNetworkStatus:(NSNotification *)notice;

@end

And the .m file:

#import "ConnectionManager.h"
#import "Reachability.h"

@implementation ConnectionManager
@synthesize internetActive, hostActive;

-(id)init {
    self = [super init];
    if(self) {

    }
    [[NSNotificationCenter defaultCenter] addObserver:self selector:@selector(checkNetworkStatus:) name:kReachabilityChangedNotification object:nil];

    internetReachable = [[Reachability reachabilityForInternetConnection] retain];
    [internetReachable startNotifier];

    hostReachable = [[Reachability reachabilityWithHostName:@"www.apple.com"] retain];
    [hostReachable startNotifier];

    return self;
}

- (void) checkNetworkStatus:(NSNotification *)notice {
    NetworkStatus internetStatus = [internetReachable currentReachabilityStatus];
    switch (internetStatus)

    {
        case NotReachable:
        {
            NSLog(@"The internet is down.");
            self.internetActive = NO;

            break;

        }
        case ReachableViaWiFi:
        {
            NSLog(@"The internet is working via WIFI.");
            self.internetActive = YES;

            break;

        }
        case ReachableViaWWAN:
        {
            NSLog(@"The internet is working via WWAN.");
            self.internetActive = YES;

            break;

        }
    }

    NetworkStatus hostStatus = [hostReachable currentReachabilityStatus];
    switch (hostStatus)

    {
        case NotReachable:
        {
            NSLog(@"A gateway to the host server is down.");
            self.hostActive = NO;

            break;

        }
        case ReachableViaWiFi:
        {
            NSLog(@"A gateway to the host server is working via WIFI.");
            self.hostActive = YES;

            break;

        }
        case ReachableViaWWAN:
        {
            NSLog(@"A gateway to the host server is working via WWAN.");
            self.hostActive = YES;

            break;

        }
    }

}

// If lower than SDK 5 : Otherwise, remove the observer as pleased.

- (void)dealloc {
    [[NSNotificationCenter defaultCenter] removeObserver:self];
    [super dealloc];
}

@end

Use JavaScript's hasOwnProperty() function:

if (json_object.hasOwnProperty('name')) {
    //do struff
}

This works across year and month changes.

Date.prototype.GetFirstDayOfWeek = function() {
    return (new Date(this.setDate(this.getDate() - this.getDay())));
}

Date.prototype.GetLastDayOfWeek = function() {
    return (new Date(this.setDate(this.getDate() - this.getDay() +6)));
}

var today = new Date();

alert(today.GetFirstDayOfWeek());

alert(today.GetLastDayOfWeek());

for those having problems after adding active and focus give a class or id name to your button and add this to css

for example

//html code

<button id="aboutus">ABOUT US</button>

//css code

#aboutus{background-color: white;border:none;outline-style: none;}

Change the cell type to Markdown in the menu bar, from Code to Markdown. Currently in Notebook 4.x, the keyboard shortcut for such an action is: Esc (for command mode), then m (for markdown).

I am surprised not to see the following pattern here, which actually looks very simple.

// shout.ts
class ShoutSingleton {
  helloWorld() { return 'hi'; }
}

export let Shout = new ShoutSingleton();

Usage

import { Shout } from './shout';
Shout.helloWorld();

Even though the <head> and <body> tags aren't required, the elements are still there - it's just that the browser can work out where the tags would have been from the rest of the document.

The other elements you're using still have to be inside the <body>

In bootstrap-3.3.7.js you will see the following code.

if (this.options.remote) {
  this.$element
    .find('.modal-content')
    .load(this.options.remote, $.proxy(function () {
      this.$element.trigger('loaded.bs.modal')
    }, this))
}

So the bootstrap is going to replace the remote content into <div class="modal-content"> element. This is the default behavior by framework. So the problem is in your remote content itself, it should contain <div class="modal-header">, <div class="modal-body">, <div class="modal-footer"> by design.

Object doesn't support this property or method.

Think of it like if anything after the dot is called on an object. It's like a chain.

An object is a class instance. A class instance supports some properties defined in that class type definition. It exposes whatever intelli-sense in VBE tells you (there are some hidden members but it's not related to this). So after each dot . you get intelli-sense (that white dropdown) trying to help you pick the correct action.

(you can start either way - front to back or back to front, once you understand how this works you'll be able to identify where the problem occurs)

Type this much anywhere in your code area

Dim a As Worksheets
a.

you get help from VBE, it's a little dropdown called Intelli-sense

It lists all available actions that particular object exposes to any user. You can't see the .Selection member of the Worksheets() class. That's what the error tells you exactly.

Object doesn't support this property or method.

If you look at the example on MSDN

Worksheets("GRA").Activate
iAreaCount = Selection.Areas.Count

It activates the sheet first then calls the Selection... it's not connected together because Selection is not a member of Worksheets() class. Simply, you can't prefix the Selection

What about

Sub DisplayColumnCount()
    Dim iAreaCount As Integer
    Dim i As Integer

    Worksheets("GRA").Activate
    iAreaCount = Selection.Areas.Count

    If iAreaCount <= 1 Then
        MsgBox "The selection contains " & Selection.Columns.Count & " columns."
    Else
        For i = 1 To iAreaCount
        MsgBox "Area " & i & " of the selection contains " & _
        Selection.Areas(i).Columns.Count & " columns."
        Next i
    End If
End Sub

from HERE

block elements expand to fill their parent.

inline elements contract to be just big enough to hold their children.

There are a number of ways to create arrays.

The traditional way of declaring and initializing an array looks like this:

var a = new Array(5); // declare an array "a", of size 5
a = [0, 0, 0, 0, 0];  // initialize each of the array's elements to 0

Or...

// declare and initialize an array in a single statement
var a = new Array(0, 0, 0, 0, 0); 

When I want access some value from GridView before GridView was appears.

1. I have a BoundField and bind DataField nomally.
2. In RowDataBound event, I do some process in that event.

3. Before GridView was appears I write this:

   protected void GridviewLecturer_PreRender(object sender, EventArgs e) 
   {
       GridviewLecturer.Columns[0].Visible = false;
   }
   

You're throwing away a result row when you do $sth->fetchColumn(). That's not how you check if there's any results. you do

if ($sth->rowCount() > 0) {
  ... got results ...
} else {
   echo 'nothing';
}

relevant docs here: http://php.net/manual/en/pdostatement.rowcount.php

You can use pydash:

import pydash as _

_.get(example_dict, 'key1.key2', default='Default')

https://pydash.readthedocs.io/en/latest/api.html

I had set everything correctly (cardinalities and dependent properties) but could not figure out why I keep receiving error. Finally figured out that, EF generated a column in dependent table on its own (table_tablecolumn) and it does not have any relation to the table, so no mapping was specified. I had to delete the column in EDMX file and rebuild the solution which fixed the issue. I am using DB approach.

@forelse ($users as $user)
    <li>{{ $user->name }}</li>
@empty
    <p>No users</p>
@endforelse

If the table has an index which you can iterate over I would put update top(10000) statement in a while loop moving over the data. That would keep the transaction log slim and won't have such a huge impact on the disk system. Also, I would recommend to play with maxdop option (setting it closer to 1).

In HTML, the <br/> tag breaks the line. So, there's no sense to use an ASCII character for it.

In CSS we can use \A for line break:

.selector::after{
   content: '\A';
}

But if you want to display <br> in the HTML as text then you can use:

&lt;br&gt; // &lt denotes to < sign and &gt denotes to > sign

LivingRoom.objects.create() calls LivingRoom.__init__() - as you might have noticed if you had read the traceback - passing it the same arguments. To make a long story short, a Django models.Model subclass's initializer is best left alone, or should accept *args and **kwargs matching the model's meta fields. The correct way to provide default values for fields is in the field constructor using the default keyword as explained in the FineManual.

If you have multiple Menus with Submenus, then you can go with the below solution.

HTML

          <ul class="sidebar-menu" id="nav-accordion">
             <li class="sub-menu">
                  <a href="" ng-click="hasSubMenu('dashboard')">
                      <i class="fa fa-book"></i>
                      <span>Dashboard</span>
                      <i class="fa fa-angle-right pull-right"></i>
                  </a>
                  <ul class="sub" ng-show="showDash">
                      <li><a ng-class="{ active: isActive('/dashboard/loan')}" href="#/dashboard/loan">Loan</a></li>
                      <li><a ng-class="{ active: isActive('/dashboard/recovery')}" href="#/dashboard/recovery">Recovery</a></li>
                  </ul>
              </li>
              <li class="sub-menu">
                  <a href="" ng-click="hasSubMenu('customerCare')">
                      <i class="fa fa-book"></i>
                      <span>Customer Care</span>
                      <i class="fa fa-angle-right pull-right"></i>
                  </a>
                  <ul class="sub" ng-show="showCC">
                      <li><a ng-class="{ active: isActive('/customerCare/eligibility')}" href="#/CC/eligibility">Eligibility</a></li>
                      <li><a ng-class="{ active: isActive('/customerCare/transaction')}" href="#/CC/transaction">Transaction</a></li>
                  </ul>
              </li>
          </ul>

There are two functions i have called first is ng-click = hasSubMenu('dashboard'). This function will be used to toggle the menu and it is explained in the code below. The ng-class="{ active: isActive('/customerCare/transaction')} it will add a class active to the current menu item.

Now i have defined some functions in my app:

First, add a dependency $rootScope which is used to declare variables and functions. To learn more about $roootScope refer to the link : https://docs.angularjs.org/api/ng/service/$rootScope

Here is my app file:

 $rootScope.isActive = function (viewLocation) { 
                return viewLocation === $location.path();
        };

The above function is used to add active class to the current menu item.

        $rootScope.showDash = false;
        $rootScope.showCC = false;

        var location = $location.url().split('/');

        if(location[1] == 'customerCare'){
            $rootScope.showCC = true;
        }
        else if(location[1]=='dashboard'){
            $rootScope.showDash = true;
        }

        $rootScope.hasSubMenu = function(menuType){
            if(menuType=='dashboard'){
                $rootScope.showCC = false;
                $rootScope.showDash = $rootScope.showDash === false ? true: false;
            }
            else if(menuType=='customerCare'){
                $rootScope.showDash = false;
                $rootScope.showCC = $rootScope.showCC === false ? true: false;
            }
        }

By default $rootScope.showDash and $rootScope.showCC are set to false. It will set the menus to closed when page is initially loaded. If you have more than two submenus add accordingly.

hasSubMenu() function will work for toggling between the menus. I have added a small condition

if(location[1] == 'customerCare'){
                $rootScope.showCC = true;
            }
            else if(location[1]=='dashboard'){
                $rootScope.showDash = true;
            }

it will remain the submenu open after reloading the page according to selected menu item.

I have defined my pages like:

$routeProvider
        .when('/dasboard/loan', {
            controller: 'LoanController',
            templateUrl: './views/loan/view.html',
            controllerAs: 'vm'
        })

You can use isActive() function only if you have a single menu without submenu. You can modify the code according to your requirement. Hope this will help. Have a great day :)

I use these two commands and I can see the files to change.

1. First executing git fetch, it gives output like this (part of output):

   ...
   72f8433..c8af041  develop -> origin/develop
   ...

This operation gives us two commit IDs, first is the old one, and second will be the new.

2. Then compare these two commits using git diff

   git diff 72f8433..c8af041 | grep "diff --git"

This command will list the files that will be updated:

diff --git a/app/controller/xxxx.php b/app/controller/xxxx.php
diff --git a/app/view/yyyy.php b/app/view/yyyy.php

For example app/controller/xxxx.php and app/view/yyyy.php will be updated.

Comparing two commits using git diff prints all updated files with changed lines, but with grep it searches and gets only the lines contains diff --git from output.

No need to divert stdout. Here is better way to do it:

import logging
class MyLogHandler(logging.Handler):
    def emit(self, record):
        pass

logging.getLogger().addHandler(MyLogHandler())

An even simpler way is:

logging.getLogger().setLevel(100)

As others mentioned, you can do this with ConfigurationManager.AppSettings.Settings. But: Using Settings[key] = value will not work if the key doesn't exist.
Using Settings.Add(key, value), if the key already exists, it will join the new value to its value(s) separated by a comma, something like <add key="myKey" value="value1, value2, value3" />

To avoid these unexpected results, you have to handle two scenario's

• If entry with the given key exists? then update its value
• if entry with the given key doesn't exist? then create new entry(key,value)

Code

public static void Set(string key, string value)
{
    var config = ConfigurationManager.OpenExeConfiguration(ConfigurationUserLevel.None);

    var entry = config.AppSettings.Settings[key];
    if (entry == null)
        config.AppSettings.Settings.Add(key, value);
    else
        config.AppSettings.Settings[key].Value = value;

    config.Save(ConfigurationSaveMode.Modified);
}

For more info about the check entry == null, check this post.
Hope this will help someone.

Deletion of a topic has been supported since 0.8.2.x version. You have to enable topic deletion (setting delete.topic.enable to true) on all brokers first.

Note: Ever since 1.0.x, the functionality being stable, delete.topic.enable is by default true.

Follow this step by step process for manual deletion of topics

1. Stop Kafka server
2. Delete the topic directory, on each broker (as defined in the logs.dirs and log.dir properties) with rm -rf command
3. Connect to Zookeeper instance: zookeeper-shell.sh host:port
4. From within the Zookeeper instance:
   1. List the topics using: ls /brokers/topics
   2. Remove the topic folder from ZooKeeper using: rmr /brokers/topics/yourtopic
   3. Exit the Zookeeper instance (Ctrl+C)
5. Restart Kafka server
6. Confirm if it was deleted or not by using this command kafka-topics.sh --list --zookeeper host:port

Here is the answer: Download the "Windows Mobile Device Center" for your machine type, likely 64bit.
http://www.microsoft.com/download/en/details.aspx?displaylang=en&id=3182

Before you run the install, change the compatibility settings to 'Windows 7'. Then install it... Then run it: You'll find it under 'WMDC'.. Your device should now recognize, when plugged in, mine did!

Try switching to Integrated mode. See the following thread:

IIS 7, HttpHandler and HTTP Error 500.21

Keep in mind that any class defined as public will automatically show up in the intellisense when someone looks at your project namespace. From an API perspective, it is important to only show users of your project the classes that they can use. Use the internal keyword to hide things they shouldn't see.

If your Big_Important_Class for Project A is intended for use outside your project, then you should not mark it internal.

However, in many projects, you'll often have classes that are really only intended for use inside a project. For example, you may have a class that holds the arguments to a parameterized thread invocation. In these cases, you should mark them as internal if for no other reason than to protect yourself from an unintended API change down the road.

Xml declaration is optional so your xml is well-formed without it. But it is recommended to use it so that wrong assumptions are not made by the parsers, specifically about the encoding used.

I've also created a utility called goat that you can use for easier navigation.

You can view the source code on GitHub.

As of v2.3.1 the usage overview looks like this:

# Create a link (h4xdir) to a directory:
goat h4xdir ~/Documents/dev

# Follow a link to change a directory:
cd h4xdir

# Follow a link (and don't stop there!):
cd h4xdir/awesome-project

# Go up the filesystem tree with '...' (same as `cd ../../`):
cd ...

# List all your links:
goat list

# Delete a link (or more):
goat delete h4xdir lojban

# Delete all the links which point to directories with the given prefix:
goat deleteprefix $HOME/Documents

# Delete all saved links:
goat nuke

# Delete broken links:
goat fix

In view there is not any direct or physical relation with the database. And Modification through a view (e.g. insert, update, delete) is not permitted.Its just a logical set of tables

The character set is part of the locale, which is determined by the value of NLS_LANG. As the documentation makes clear this is an operating system variable:

NLS_LANG is set as an environment variable on UNIX platforms. NLS_LANG is set in the registry on Windows platforms.

Now we can use ALTER SESSION to change the values for a couple of locale elements, NLS_LANGUAGE and NLS_TERRITORY. But not, alas, the character set. The reason for this discrepancy is - I think - that the language and territory simply effect how Oracle interprets the stored data, e.g. whether to display a comma or a period when displaying a large number. Wheareas the character set is concerned with how the client application renders the displayed data. This information is picked up by the client application at startup time, and cannot be changed from within.

PHP is likely the easiest.

Just make a file script.php that contains <?php shell_exec("yourscript.sh"); ?> and send anybody who clicks the button to that destination. You can return the user to the original page with header:

<?php
shell_exec("yourscript.sh");
header('Location: http://www.website.com/page?success=true');
?>

Reference: http://php.net/manual/en/function.shell-exec.php

if you want only the background-image to be affected, you can use a linear gradient to do that, just like this:

  background: linear-gradient(rgba(0, 0, 0, .5), rgba(0, 0, 0, .5)), url(IMAGE_URL);

If you want it darker, make the alpha value higher, else you want it lighter, make alpha lower

Running in Debug Mode

When you're developing and debugging an application, you will typically run with the debug attribute in the web.config file set to true and your DLLs compiled in debug mode. However, before you deploy your application to test or to production, you should compile your components in release mode and set the debug attribute to false.

ASP.NET works differently on many levels when running in debug mode. In fact, when you are running in debug mode, the GC will allow your objects to remain alive longer (until the end of the scope) so you will always see higher memory usage when running in debug mode.

Another often unrealized side-effect of running in debug mode is that client scripts served via the webresource.axd and scriptresource.axd handlers will not be cached. That means that each client request will have to download any scripts (such as ASP.NET AJAX scripts) instead of taking advantage of client-side caching. This can lead to a substantial performance hit.

Source: http://blogs.iis.net/webtopics/archive/2009/05/22/troubleshooting-system-outofmemoryexceptions-in-asp-net.aspx

This is a mix of HTML and code but it's pretty basic, easy to understand and should be fairly simple to decouple to suit your needs I think.

try {

    // Find out how many items are in the table
    $total = $dbh->query('
        SELECT
            COUNT(*)
        FROM
            table
    ')->fetchColumn();

    // How many items to list per page
    $limit = 20;

    // How many pages will there be
    $pages = ceil($total / $limit);

    // What page are we currently on?
    $page = min($pages, filter_input(INPUT_GET, 'page', FILTER_VALIDATE_INT, array(
        'options' => array(
            'default'   => 1,
            'min_range' => 1,
        ),
    )));

    // Calculate the offset for the query
    $offset = ($page - 1)  * $limit;

    // Some information to display to the user
    $start = $offset + 1;
    $end = min(($offset + $limit), $total);

    // The "back" link
    $prevlink = ($page > 1) ? '<a href="?page=1" title="First page">&laquo;</a> <a href="?page=' . ($page - 1) . '" title="Previous page">&lsaquo;</a>' : '<span class="disabled">&laquo;</span> <span class="disabled">&lsaquo;</span>';

    // The "forward" link
    $nextlink = ($page < $pages) ? '<a href="?page=' . ($page + 1) . '" title="Next page">&rsaquo;</a> <a href="?page=' . $pages . '" title="Last page">&raquo;</a>' : '<span class="disabled">&rsaquo;</span> <span class="disabled">&raquo;</span>';

    // Display the paging information
    echo '<div id="paging"><p>', $prevlink, ' Page ', $page, ' of ', $pages, ' pages, displaying ', $start, '-', $end, ' of ', $total, ' results ', $nextlink, ' </p></div>';

    // Prepare the paged query
    $stmt = $dbh->prepare('
        SELECT
            *
        FROM
            table
        ORDER BY
            name
        LIMIT
            :limit
        OFFSET
            :offset
    ');

    // Bind the query params
    $stmt->bindParam(':limit', $limit, PDO::PARAM_INT);
    $stmt->bindParam(':offset', $offset, PDO::PARAM_INT);
    $stmt->execute();

    // Do we have any results?
    if ($stmt->rowCount() > 0) {
        // Define how we want to fetch the results
        $stmt->setFetchMode(PDO::FETCH_ASSOC);
        $iterator = new IteratorIterator($stmt);

        // Display the results
        foreach ($iterator as $row) {
            echo '<p>', $row['name'], '</p>';
        }

    } else {
        echo '<p>No results could be displayed.</p>';
    }

} catch (Exception $e) {
    echo '<p>', $e->getMessage(), '</p>';
}

Late to answer but might help someone else, here is how to do it without removing the 'multiple' attribute.

$('.myDropdown').chosen({
    //Here you can change the value of the maximum allowed options
    max_selected_options: 1
});

WebViewClient.shouldOverrideUrlLoading might be helpful. We are having a similar requirement in one of our app. Not tried yet.

This should work:

const getRandomNum = (min, max) => Math.floor(Math.random() * (max - min + 1)) + min

Use the following:

new Date().toLocaleDateString();

Then as per your requirement just change locale for your application:

import { registerLocaleData } from '@angular/common';
import localeFr from '@angular/common/locales/fr';
registerLocaleData(localeFr);

//Provide the locale in any Module or Component by the LOCALE_ID token.
providers: [
 {provide: LOCALE_ID, useValue: 'fr'}
]

You might be after something that the scrollTo plugin from Ariel Flesler does really well.

http://demos.flesler.com/jquery/scrollTo/

The problem is that the DIV that should center your tables has no width defined. By default, DIVs are block elements and take up the entire width of their parent - in this case the entire document (propagating through the #outer DIV), so the automatic margin style has no effect.

For this technique to work, you simply have to set the width of the div that has margin:auto to anything but "auto" or "inherit" (either a fixed pixel value or a percentage).

Just do the following change

echo off
cls

echo Would you like to do a backup?

pause

copy "\\My_Servers_IP\Shared Drive\FolderName\*" C:\TEST_BACKUP_FOLDER

pause

The answers provided are not the solution. The .NET 6# stuff is pretty different from what we used to. A lot has changed, from having to deal with portable libraries to Visual Studio 2015 installing an old compiler (it cost me four hours cracking my head).

The long story short: Stack Overflow question How do I use C# 6 with a Web Site project type?

You need to install the C# .NET compiler (now runs as a service bla bla bla). and you need to run updates on NuGet to get the latest everything (before trying anything else).

The compiler must be installed on the project your solution runs from (so your website or your main project your application starts from (if you have multiple projects)).

Once you install that then sort out your web.config referencing any portable libraries, and delete both the bin and obj folder (to avoid works on my computer nightmare), It should just run. But be patient; what happens on your machine may vary as much as the answers above. Most of the answers above hide other problems. It may work for a while, then boom: compiler error. I had a few pages working, then some pages started failing because of some packages that have started using portable libraries.

Use query selectors, examples:

document.querySelectorAll(' input[name], [id|=view], [class~=button] ')

input[name] Inputs elements with name property.

[id|=view] Elements with id that start with view-.

[class~=button] Elements with the button class.

Another way is to stick it into the command section of the Deployment:

...
command: [ "echo", "
  option = value\n
  other_option = value\n
" ]
...

Alternatively, to make it more ConfigMap-like, use an additional Deployment that will just host that config in the command section and execute kubectl create on it while adding an unique 'version' to its name (like calculating a hash of the content) and modifying all the deployments that use that config:

...
command: [ "/usr/sbin/kubectl-apply-config.sh", "
  option = value\n
  other_option = value\n
" ]
...

I'll probably post kubectl-apply-config.sh if it ends up working.

(don't do that; it looks too bad)

Use animation-fill-mode: forwards;

animation-fill-mode: forwards;

The element will retain the style values that is set by the last keyframe (depends on animation-direction and animation-iteration-count).

Note: The @keyframes rule is not supported in Internet Explorer 9 and earlier versions.

Working example

div {_x000D_
  width: 100px;_x000D_
  height: 100px;_x000D_
  background: red;_x000D_
  position :relative;_x000D_
  -webkit-animation: mymove 3ss forwards; /* Safari 4.0 - 8.0 */_x000D_
  animation: bubble 3s forwards;_x000D_
  /* animation-name: bubble; _x000D_
  animation-duration: 3s;_x000D_
  animation-fill-mode: forwards; */_x000D_
}_x000D_
_x000D_
/* Safari */_x000D_
@-webkit-keyframes bubble  {_x000D_
  0%   { transform:scale(0.5); opacity:0.0; left:0}_x000D_
    50%  { transform:scale(1.2); opacity:0.5; left:100px}_x000D_
    100% { transform:scale(1.0); opacity:1.0; left:200px}_x000D_
}_x000D_
_x000D_
/* Standard syntax */_x000D_
@keyframes bubble  {_x000D_
   0%   { transform:scale(0.5); opacity:0.0; left:0}_x000D_
    50%  { transform:scale(1.2); opacity:0.5; left:100px}_x000D_
    100% { transform:scale(1.0); opacity:1.0; left:200px}_x000D_
}

<h1>The keyframes </h1>_x000D_
<div></div>

There is a better way!

To make the VStack fill the width of it's parent you can use a GeometryReader and set the frame. (.relativeWidth(1.0) should work but apparently doesn't right now)

struct ContentView : View {
    var body: some View {
        GeometryReader { geometry in
            VStack {
                Text("test")
            }
                .frame(width: geometry.size.width,
                       height: nil,
                       alignment: .topLeading)
        }
    }
}

To make the VStack the width of the actual screen you can use UIScreen.main.bounds.width when setting the frame instead of using a GeometryReader, but I imagine you likely wanted the width of the parent view.

Also, this way has the added benefit of not adding spacing in your VStack which might happen (if you have spacing) if you added an HStack with a Spacer() as it's content to the VStack.

UPDATE - THERE IS NOT A BETTER WAY!

After checking out the accepted answer, I realized that the accepted answer doesn't actually work! It appears to work at first glance, but if you update the VStack to have a green background you'll notice the VStack is still the same width.

struct ContentView : View {
    var body: some View {
        NavigationView {
            VStack(alignment: .leading) {
                Text("Hello World")
                    .font(.title)
                Text("Another")
                    .font(.body)
                Spacer()
                }
                .background(Color.green)
                .frame(minWidth: 0, maxWidth: .infinity, minHeight: 0, maxHeight: .infinity, alignment: .topLeading)
                .background(Color.red)
        }
    }
}

This is because .frame(...) is actually adding another view to the view hierarchy and that view ends up filling the screen. However, the VStack still does not.

This issue also seems to be the same in my answer as well and can be checked using the same approach as above (putting different background colors before and after the .frame(...). The only way that appears to actually widen the VStack is to use spacers:

struct ContentView : View {
    var body: some View {
        VStack(alignment: .leading) {
            HStack{
                Text("Title")
                    .font(.title)
                Spacer()
            }
            Text("Content")
                .lineLimit(nil)
                .font(.body)
            Spacer()
        }
            .background(Color.green)
    }
}

run the following and you'll see what's going on:

public class RS {

    public static String reverse(String str) {
        System.out.println("--- reverse --- " + str);
        if ((null == str) || (str.length() <= 1)) {
            return str;
        }
        return add(reverse(str.substring(1)), charAt(str));
    }

    public static char charAt(String s) {
        System.out.println("--- charAt --- " + s);
        return s.charAt(0);
    }

    public static String add(String s, char c) {
        System.out.println("--- add --- " + s + " - " + c);
        return s + c;
    }

    public static void main(String[] args) {
        System.out.println("start");
        System.out.println("result: " + reverse("hello"));
        System.out.println("end");
    }

}

select *
from (select
  staff_id, site_id, pay_level, date, 
  rank() over (partition by staff_id order by date desc) r
  from owner.table
  where end_enrollment_date is null
)
where r = 1

You can set timeout like this,

con.setConnectTimeout(connectTimeout);
con.setReadTimeout(socketTimeout);

You can only call instance method like do() (which is an illegal method name, incidentally) against an instance of the class:

public static void main(String[] args){
  new Foo().doSomething();
}

public void doSomething(){}

Alternatively, make doSomething() static as well, if that works for your design.

There are several parts of hibernate logging you can control based on the logger hierarchy of the hibernate package (more on logger hierarchy here).

    <!-- Log everything in hibernate -->
    <Logger name="org.hibernate" level="info" additivity="false">
      <AppenderRef ref="Console" />
    </Logger>

    <!-- Log SQL statements -->
    <Logger name="org.hibernate.SQL" level="debug" additivity="false">
      <AppenderRef ref="Console" />
      <AppenderRef ref="File" />
    </Logger>

    <!-- Log JDBC bind parameters -->
    <Logger name="org.hibernate.type.descriptor.sql" level="trace" additivity="false">
      <AppenderRef ref="Console" />
      <AppenderRef ref="File" />
    </Logger>

The above was taken from here.

Additionally you could have the property show-sql:true in your configuration file since that supersedes the logging framework settings. More on that here.

select advanced options when Write a message, and choose sound activated

this is My solution

The noob way to do this:

SELECT field1, field2 FROM table WHERE field1 = TRUE OR field2 = TRUE

You can manage this information properly at the programming language only doing an if-else.

Example in ASP/JavaScript

// Code to retrieve the ADODB.Recordset
if (rs("field1")) {
   do_the_stuff_a();
}
if (rs("field2")) {
   do_the_stuff_b();
}
rs.MoveNext();

You can use Array.push() for appending elements to an array.

For deleting, it is best to use this.$delete(array, index) for reactive objects.

Vue.delete( target, key ): Delete a property on an object. If the object is reactive, ensure the deletion triggers view updates. This is primarily used to get around the limitation that Vue cannot detect property deletions, but you should rarely need to use it.

https://vuejs.org/v2/api/#Vue-delete

Programming habits could help too; e.g. add static to functions that are not accessed outside a specific file; use shorter names for symbols (can help a bit, likely not too much); use const char x[] where possible; ... this paper, though it talks about dynamic shared objects, can contain suggestions that, if followed, can help to make your final binary output size smaller (if your target is ELF).

If you are looking for a solution to your particular case, it would be:

Date date = new SimpleDateFormat("yyyy-MM-dd'T'HH:mm:ss.SSS'Z'").parse("2012-05-20T09:00:00.000Z");
String formattedDate = new SimpleDateFormat("dd/MM/yyyy, Ka").format(date);

CREATE VIEW AS
SELECT e1.emp_Id EmployeeId, e1.emp_name EmployeeName, 
       e1.emp_mgr_id ManagerId, e2.emp_name AS ManagerName
FROM   tblEmployeeDetails e1
       JOIN tblEmployeeDetails e2
       ON e1.emp_mgr_id = e2.emp_id

EDIT: Left Join will work if emp_mgr_id is null.

CREATE VIEW AS 
SELECT e1.emp_Id EmployeeId, e1.emp_name EmployeeName,  
       e1.emp_mgr_id ManagerId, e2.emp_name AS ManagerName 
FROM   tblEmployeeDetails e1 
       LEFT JOIN tblEmployeeDetails e2 
       ON e1.emp_mgr_id = e2.emp_id

@ECHO OFF
SETLOCAL ENABLEDELAYEDEXPANSION
SET /a pid=1600
FOR /f "skip=3delims=" %%a IN ('tasklist') DO (
 SET "found=%%a"
 SET /a foundpid=!found:~26,8!
 IF %pid%==!foundpid! echo found %pid%=!found:~0,24%!
)

GOTO :EOF

...set PID to suit your circumstance.

You may find this query useful:

SELECT * 
FROM sys.dm_exec_requests
WHERE DB_NAME(database_id) = 'YourDBName' 
AND blocking_session_id <> 0

The correct syntax is described in the manual. Try this:

INSERT INTO this_table_archive (col1, col2, ..., coln)
SELECT col1, col2, ..., coln
FROM this_table
WHERE entry_date < '2011-01-01 00:00:00';

If the id columns is an auto-increment column and you already have some data in both tables then in some cases you may want to omit the id from the column list and generate new ids instead to avoid insert an id that already exists in the original table. If your target table is empty then this won't be an issue.

NullPointerExceptions are among the easier exceptions to diagnose, frequently. Whenever you get an exception in Java and you see the stack trace ( that's what your second quote-block is called, by the way ), you read from top to bottom. Often, you will see exceptions that start in Java library code or in native implementations methods, for diagnosis you can just skip past those until you see a code file that you wrote.

Then you like at the line indicated and look at each of the objects ( instantiated classes ) on that line -- one of them was not created and you tried to use it. You can start by looking up in your code to see if you called the constructor on that object. If you didn't, then that's your problem, you need to instantiate that object by calling new Classname( arguments ). Another frequent cause of NullPointerExceptions is accidentally declaring an object with local scope when there is an instance variable with the same name.

In your case, the exception occurred in your constructor for Workshop on line 75. <init> means the constructor for a class. If you look on that line in your code, you'll see the line

denimjeansButton.addItemListener(this);

There are fairly clearly two objects on this line: denimjeansButton and this. this is synonymous with the class instance you are currently in and you're in the constructor, so it can't be this. denimjeansButton is your culprit. You never instantiated that object. Either remove the reference to the instance variable denimjeansButton or instantiate it.

In search of this same solution, I found what I needed under a different question in stackoverflow: Powershell-log-off-remote-session. The below one line will return a list of logged on users.

query user /server:$SERVER

No it's not a bug. Have a look at the Loose comparisons with == table (second table), which shows the result of comparing each value in the first column with the values in the other columns:

    TRUE    FALSE   1       0       -1      "1"     "0"     "-1"    NULL    array() "php"   ""

    [...]    

""  FALSE   TRUE    FALSE   TRUE    FALSE   FALSE   FALSE   FALSE   TRUE    FALSE   FALSE   TRUE

There you can see that an empty string "" compared with false, 0, NULL or "" will yield true.

You might want to use is_null ^[docs] instead, or strict comparison (third table).

My solution is to use a custom attribute that provides default value property initialization by constant or using property type initializer.

[AttributeUsage(AttributeTargets.Property, AllowMultiple = false, Inherited = true)]
public class InstanceAttribute : Attribute
{
    public bool IsConstructorCall { get; private set; }
    public object[] Values { get; private set; }
    public InstanceAttribute() : this(true) { }
    public InstanceAttribute(object value) : this(false, value) { }
    public InstanceAttribute(bool isConstructorCall, params object[] values)
    {
        IsConstructorCall = isConstructorCall;
        Values = values ?? new object[0];
    }
}

To use this attribute it's necessary to inherit a class from special base class-initializer or use a static helper method:

public abstract class DefaultValueInitializer
{
    protected DefaultValueInitializer()
    {
        InitializeDefaultValues(this);
    }

    public static void InitializeDefaultValues(object obj)
    {
        var props = from prop in obj.GetType().GetProperties()
                    let attrs = prop.GetCustomAttributes(typeof(InstanceAttribute), false)
                    where attrs.Any()
                    select new { Property = prop, Attr = ((InstanceAttribute)attrs.First()) };
        foreach (var pair in props)
        {
            object value = !pair.Attr.IsConstructorCall && pair.Attr.Values.Length > 0
                            ? pair.Attr.Values[0]
                            : Activator.CreateInstance(pair.Property.PropertyType, pair.Attr.Values);
            pair.Property.SetValue(obj, value, null);
        }
    }
}

Usage example:

public class Simple : DefaultValueInitializer
{
    [Instance("StringValue")]
    public string StringValue { get; set; }
    [Instance]
    public List<string> Items { get; set; }
    [Instance(true, 3,4)]
    public Point Point { get; set; }
}

public static void Main(string[] args)
{
    var obj = new Simple
        {
            Items = {"Item1"}
        };
    Console.WriteLine(obj.Items[0]);
    Console.WriteLine(obj.Point);
    Console.WriteLine(obj.StringValue);
}

Output:

Item1
(X=3,Y=4)
StringValue

This work for me. In the android\app\build.gradle file you need to specify the following

compileSdkVersion 26
buildToolsVersion "26.0.1"

and then find this

compile "com.android.support:appcompat-v7"

and make sure it says

compile "com.android.support:appcompat-v7:26.0.1"

You need to create a object from your list like:

List<CartProduct> lst = new List<CartProduct>();

CartProduct obj = lst.Find(x => (x.Name == "product name"));

That object get the looked value searching by their properties: x.name

Then you can use List methods like Contains or Remove

if (lst.Contains(obj))
{
   lst.Remove(obj);
}

There are a variety of ways to get the URL .m3u8 either by viewing the source of a page, looking at the Network tab in the Developer Tools in Chrome, or using a plugin such as HDL/HLS Video Downloader.

With the .m3u8 URL in hand you can then use ffmpeg to download the video to a file like so:

$ ffmpeg -i 'https://url/to/some/file.m3u8' -bsf:a aac_adtstoasc \
    -vcodec copy -c copy -crf 50 file.mp4

Right-click the database to clone, click Tasks, click Copy Database.... Follow the wizard and you're done.

Wherever there is errors or exceptions in static blocks, this exception will be thrown. To get the cause of this exception simply use Throwable.getCause() to know what is wrong.

If you are using reactive forms and want to disable some input associated with a form control, you should place this disabled logic into you code and call yourFormControl.disable() or yourFormControl.enable()

You could use the same mechanism the XAML reading system uses: Type converters

var converter = new System.Windows.Media.BrushConverter();
var brush = (Brush)converter.ConvertFromString("#FFFFFF90");
Fill = brush;

Yes, it's safe to delete these, although it may force a dynamic recompilation of any .NET applications you run on the server.

For background, see the Understanding ASP.NET dynamic compilation article on MSDN.

Because there are two print statements. First is inside function and second is outside function. When function not return any thing that time it return None value.

Use return statement at end of function to return value.

e.g.:

Return None value.

>>> def test1():
...    print "In function."
... 
>>> a = test1()
In function.
>>> print a
None
>>> 
>>> print test1()
In function.
None
>>>
>>> test1()
In function.
>>> 

Use return statement

>>> def test():
...   return "ACV"
... 
>>> print test()
ACV
>>> 
>>> a = test()
>>> print a
ACV
>>> 

simply: document.cookie="name=value;path=/";

There is a negative point to it

Now, the cookie will be available to all directories on the domain it is set from. If the website is just one of many at that domain, it’s best not to do this because everyone else will also have access to your cookie information.

I'm not sure I understand your question. I assume you are doing something along the lines of:

import base64

with open("yourfile.ext", "rb") as image_file:
    encoded_string = base64.b64encode(image_file.read())

You have to open the file first of course, and read its contents - you cannot simply pass the path to the encode function.

Edit: Ok, here is an update after you have edited your original question.

First of all, remember to use raw strings (prefix the string with 'r') when using path delimiters on Windows, to prevent accidentally hitting an escape character. Second, PIL's Image.open either accepts a filename, or a file-like (that is, the object has to provide read, seek and tell methods).

That being said, you can use cStringIO to create such an object from a memory buffer:

import cStringIO
import PIL.Image

# assume data contains your decoded image
file_like = cStringIO.StringIO(data)

img = PIL.Image.open(file_like)
img.show()

In javascript there are no block-level scopes only function-level scopes:

Read this article about javaScript Scoping and Hoisting.

See how I debugged your code:

var deferred = $q.defer();
deferred.count = i;

console.log(deferred.count); // 0,1,2,3,4,5 --< all deferred objects

// some code

.success(function(data){
   console.log(deferred.count); // 5,5,5,5,5,5 --< only the last deferred object
   deferred.resolve(data);
})

• When you write var deferred= $q.defer(); inside a for loop it's hoisted to the top of the function, it means that javascript declares this variable on the function scope outside of the for loop.
• With each loop, the last deferred is overriding the previous one, there is no block-level scope to save a reference to that object.
• When asynchronous callbacks (success / error) are invoked, they reference only the last deferred object and only it gets resolved, so $q.all is never resolved because it still waits for other deferred objects.
• What you need is to create an anonymous function for each item you iterate.
• Since functions do have scopes, the reference to the deferred objects are preserved in a closure scope even after functions are executed.
• As #dfsq commented: There is no need to manually construct a new deferred object since $http itself returns a promise.

  ---

Solution with angular.forEach:

Here is a demo plunker: http://plnkr.co/edit/NGMp4ycmaCqVOmgohN53?p=preview

UploadService.uploadQuestion = function(questions){

    var promises = [];

    angular.forEach(questions , function(question) {

        var promise = $http({
            url   : 'upload/question',
            method: 'POST',
            data  : question
        });

        promises.push(promise);

    });

    return $q.all(promises);
}

My favorite way is to use Array#map:

Here is a demo plunker: http://plnkr.co/edit/KYeTWUyxJR4mlU77svw9?p=preview

UploadService.uploadQuestion = function(questions){

    var promises = questions.map(function(question) {

        return $http({
            url   : 'upload/question',
            method: 'POST',
            data  : question
        });

    });

    return $q.all(promises);
}

You can do it in pgadmin3. Drop the schema(s) that your dump contains. Then right-click on the database and choose Restore. Then you can browse for the dump file.

In case of Excel 2007 You can change datasource in Options menu /Change Data Source

UTF-8 is a variable-length encoding. In the case of UTF-8, this means that storing one code point requires one to four bytes. However, MySQL's encoding called "utf8" (alias of "utf8mb3") only stores a maximum of three bytes per code point.

So the character set "utf8"/"utf8mb3" cannot store all Unicode code points: it only supports the range 0x000 to 0xFFFF, which is called the "Basic Multilingual Plane". See also Comparison of Unicode encodings.

This is what (a previous version of the same page at) the MySQL documentation has to say about it:

The character set named utf8[/utf8mb3] uses a maximum of three bytes per character and contains only BMP characters. As of MySQL 5.5.3, the utf8mb4 character set uses a maximum of four bytes per character supports supplemental characters:

• For a BMP character, utf8[/utf8mb3] and utf8mb4 have identical storage characteristics: same code values, same encoding, same length.

• For a supplementary character, utf8[/utf8mb3] cannot store the character at all, while utf8mb4 requires four bytes to store it. Since utf8[/utf8mb3] cannot store the character at all, you do not have any supplementary characters in utf8[/utf8mb3] columns and you need not worry about converting characters or losing data when upgrading utf8[/utf8mb3] data from older versions of MySQL.

So if you want your column to support storing characters lying outside the BMP (and you usually want to), such as emoji, use "utf8mb4". See also What are the most common non-BMP Unicode characters in actual use?.

I think not, and the reason is that default values are evaluated to constants and values passed by reference must be able to change, unless you also declare it to be constant reference.

This works too...

FooBar=baz

echo ${FooBar^^${FooBar:0:1}}

=> Baz

FooBar=baz

echo ${FooBar^^${FooBar:1:1}}

=> bAz

FooBar=baz

echo ${FooBar^^${FooBar:2:2}}

=> baZ

And so on.

Sources:

• Bash Manual: Shell Parameter Expansion
• Full Bash Guide: Parameters
• Bash Hacker's Wiki Parameter Expansion

Inroductions/Tutorials:

• Cyberciti.biz: 8. Convert to upper to lower case or vice versa
• Opensource.com: An introduction to parameter expansion in Bash

Performances (using iPython) for some solutions found here:

>>> # small array
>>> a = [12,3,65,33,12,3,123,888000]
>>> 
>>> import collections
>>> collections.Counter(a).most_common()[0][0]
3
>>> %timeit collections.Counter(a).most_common()[0][0]
100000 loops, best of 3: 11.3 µs per loop
>>> 
>>> import numpy
>>> numpy.bincount(a).argmax()
3
>>> %timeit numpy.bincount(a).argmax()
100 loops, best of 3: 2.84 ms per loop
>>> 
>>> import scipy.stats
>>> scipy.stats.mode(a)[0][0]
3.0
>>> %timeit scipy.stats.mode(a)[0][0]
10000 loops, best of 3: 172 µs per loop
>>> 
>>> from collections import defaultdict
>>> def jjc(l):
...     d = defaultdict(int)
...     for i in a:
...         d[i] += 1
...     return sorted(d.iteritems(), key=lambda x: x[1], reverse=True)[0]
... 
>>> jjc(a)[0]
3
>>> %timeit jjc(a)[0]
100000 loops, best of 3: 5.58 µs per loop
>>> 
>>> max(map(lambda val: (a.count(val), val), set(a)))[1]
12
>>> %timeit max(map(lambda val: (a.count(val), val), set(a)))[1]
100000 loops, best of 3: 4.11 µs per loop
>>> 

Best is 'max' with 'set' for small arrays like the problem.

According to @David Sanders, if you increase the array size to something like 100,000 elements, the "max w/set" algorithm ends up being the worst by far whereas the "numpy bincount" method is the best.

System.out.println(isLeapYear);

should work just fine.

Incidentally, in

else if ((year % 4 == 0) && (year % 100 == 0))
    isLeapYear = false;

else if ((year % 4 == 0) && (year % 100 == 0) && (year % 400 == 0))
    isLeapYear = true;

the year % 400 part will never be reached because if (year % 4 == 0) && (year % 100 == 0) && (year % 400 == 0) is true, then (year % 4 == 0) && (year % 100 == 0) must have succeeded.

Maybe swap those two conditions or refactor them:

else if ((year % 4 == 0) && (year % 100 == 0))
    isLeapYear = (year % 400 == 0);

This code will help a lot

function isObject(data){
    var tb = document.createElement("table");

    if(data !=null) {
        var keyOfobj = Object.keys(data);
        var ValOfObj = Object.values(data);

        for (var i = 0; i < keyOfobj.length; i++) {
            var tr = document.createElement('tr');
            var td = document.createElement('td');
            var key = document.createTextNode(keyOfobj[i]);

            td.appendChild(key);
            tr.appendChild(td);
            tb.appendChild(tr);

            if(typeof(ValOfObj[i]) == "object") {

                if(ValOfObj[i] !=null) {
                    tr.setAttribute("style","font-weight: bold");   
                    isObject(ValOfObj[i]);
                } else {
                    var td = document.createElement('td');
                    var value = document.createTextNode(ValOfObj[i]);

                    td.appendChild(value);
                    tr.appendChild(td);
                    tb.appendChild(tr);
                }
            } else {
                var td = document.createElement('td');
                var value = document.createTextNode(ValOfObj[i]);

                td.appendChild(value);
                tr.appendChild(td);
                tb.appendChild(tr);
            }
        }
    }
}

Can't post comments yet, but @Cristi S's answer works a treat for me.

In my scenario, I needed to keep only the most recent 3 records in Lowest_Offers for all product_ids.

Need to rework his SQL to delete - thought that this would be ok, but syntax is wrong.

DELETE from (
SELECT product_id, id, date_checked,
  ROW_NUMBER() OVER (PARTITION BY product_id ORDER BY date_checked DESC) rn
FROM lowest_offers
) tmp WHERE > 3;

jQuery's .html() can be used for setting and getting the contents of matched non empty elements (innerHTML).

var contents = $(element).html();
$(element).html("insert content into element");

We had the same error even though the user was properly mapped to the login.

After trying to delete the user it was discovered that a few SPs contained "with execute as" that user.

The issue was solved by dropping those SPs, dropping the user, recreating the user linked to login, and recreating the SPs.

Possibly it got in this state from restoring from backup (during a time when the related login didn't exist) or bulk schema syncing (if its possible to create an SP with execute as even though the user doesn't exist. Could also have been related to this answer.

You can use the .delay() function.
This is what you're after:

.addClass("load").delay(2000).addClass("done");

as mentioned above: its not possible to call a css pseudo-class / -element inline. what i now did, is: give your element a unique identifier, f.ex. an id or a unique class. and write a fitting <style> element

<style>#id29:before { content: "*";}</style>
<article id="id29">
  <!-- something -->
</article>

fugly, but what inline css isnt..?

It's impossible to say without seeing your actual code. Likely the reason is a code path through your function that doesn't execute a return statement. When the code goes down that path, the function ends with no value returned, and so returns None.

Updated: It sounds like your code looks like this:

def b(self, p, data): 
    current = p 
    if current.data == data: 
        return True 
    elif current.data == 1:
        return False 
    else: 
        self.b(current.next, data)

That else clause is your None path. You need to return the value that the recursive call returns:

    else:
        return self.b(current.next, data)

BTW: using recursion for iterative programs like this is not a good idea in Python. Use iteration instead. Also, you have no clear termination condition.

This is method I created to handle async scenarios with ForEach.

• If one of tasks fails then other tasks will continue their execution.
• You have ability to add function that will be executed on every exception.
• Exceptions are being collected as aggregateException at the end and are available for you.
• Can handle CancellationToken

 public static class ParallelExecutor
    {
        /// <summary>
        /// Executes asynchronously given function on all elements of given enumerable with task count restriction.
        /// Executor will continue starting new tasks even if one of the tasks throws. If at least one of the tasks throwed exception then <see cref="AggregateException"/> is throwed at the end of the method run.
        /// </summary>
        /// <typeparam name="T">Type of elements in enumerable</typeparam>
        /// <param name="maxTaskCount">The maximum task count.</param>
        /// <param name="enumerable">The enumerable.</param>
        /// <param name="asyncFunc">asynchronous function that will be executed on every element of the enumerable. MUST be thread safe.</param>
        /// <param name="onException">Acton that will be executed on every exception that would be thrown by asyncFunc. CAN be thread unsafe.</param>
        /// <param name="cancellationToken">The cancellation token.</param>
        public static async Task ForEachAsync<T>(int maxTaskCount, IEnumerable<T> enumerable, Func<T, Task> asyncFunc, Action<Exception> onException = null, CancellationToken cancellationToken = default)
        {
            using var semaphore = new SemaphoreSlim(initialCount: maxTaskCount, maxCount: maxTaskCount);

            // This `lockObject` is used only in `catch { }` block.
            object lockObject = new object();
            var exceptions = new List<Exception>();
            var tasks = new Task[enumerable.Count()];
            int i = 0;

            try
            {
                foreach (var t in enumerable)
                {
                    await semaphore.WaitAsync(cancellationToken);
                    tasks[i++] = Task.Run(
                        async () =>
                        {
                            try
                            {
                                await asyncFunc(t);
                            }
                            catch (Exception e)
                            {
                                if (onException != null)
                                {
                                    lock (lockObject)
                                    {
                                        onException.Invoke(e);
                                    }
                                }

                                // This exception will be swallowed here but it will be collected at the end of ForEachAsync method in order to generate AggregateException.
                                throw;
                            }
                            finally
                            {
                                semaphore.Release();
                            }
                        }, cancellationToken);

                    if (cancellationToken.IsCancellationRequested)
                    {
                        break;
                    }
                }
            }
            catch (OperationCanceledException e)
            {
                exceptions.Add(e);
            }

            foreach (var t in tasks)
            {
                if (cancellationToken.IsCancellationRequested)
                {
                    break;
                }

                // Exception handling in this case is actually pretty fast.
                // https://gist.github.com/shoter/d943500eda37c7d99461ce3dace42141
                try
                {
                    await t;
                }
#pragma warning disable CA1031 // Do not catch general exception types - we want to throw that exception later as aggregate exception. Nothing wrong here.
                catch (Exception e)
#pragma warning restore CA1031 // Do not catch general exception types
                {
                    exceptions.Add(e);
                }
            }

            if (exceptions.Any())
            {
                throw new AggregateException(exceptions);
            }
        }
    }

Solution in python can be as below:

class Word:
    def __init__(self, data, index):
        self.data = data
        self.index = index

def printAnagrams(arr):
    dupArray = []
    size = len(arr)

    for i in range(size):
        dupArray.append(Word(arr[i], i))

    for i in range(size):
        dupArray[i].data = ''.join(sorted(dupArray[i].data))

    dupArray = sorted(dupArray, key=lambda x: x.data)

    for i in range(size):
        print arr[dupArray[i].index]

def main():
    arr = ["dog", "act", "cat", "god", "tac"]

    printAnagrams(arr)

if __name__== '__main__':
    main()

1. First create a duplicate list of same words with indexes representing their position indexes.
2. Then sort the individual strings of the duplicate list
3. Then sort the duplicate list itself based on strings.
4. Finally print the original list with indexes used from duplicate array.

The time complexity of above is O(NMLogN + NMLogM) = O(NMlogN)

If your code doesn't require the file to be truncated first, you can use the FileMode.OpenOrCreate to open the filestream, which will create the file if it doesn't exist or open it if it does. You can use the stream to point at the front and start overwriting the existing file?

I'm assuming your using a streams here, there are other ways to write a file.

To print the text my text you can use either of the following Locator Strategies:

• Using class_name and get_attribute("textContent"):

  print(driver.find_element(By.CLASS_NAME, "current-stage").get_attribute("textContent"))
  

• Using css_selector and get_attribute("innerHTML"):

  print(driver.find_element(By.CSS_SELECTOR, "span.current-stage").get_attribute("innerHTML"))
  

• Using xpath and text attribute:

  print(driver.find_element(By.XPATH, "//span[@class='current-stage']").text)
  

Ideally you need to induce WebDriverWait for the visibility_of_element_located() and you can use either of the following Locator Strategies:

• Using CLASS_NAME and get_attribute("textContent"):

  print(WebDriverWait(driver, 20).until(EC.visibility_of_element_located((By.CLASS_NAME, "current-stage"))).get_attribute("textContent"))
  

• Using CSS_SELECTOR and text attribute:

  print(WebDriverWait(driver, 20).until(EC.visibility_of_element_located((By.CSS_SELECTOR, "span.current-stage"))).text)
  

• Using XPATH and get_attribute("innerHTML"):

  print(WebDriverWait(driver, 20).until(EC.visibility_of_element_located((By.XPATH, "//span[@class='current-stage']"))).get_attribute("innerHTML"))
  

• Note : You have to add the following imports :

  from selenium.webdriver.support.ui import WebDriverWait
  from selenium.webdriver.common.by import By
  from selenium.webdriver.support import expected_conditions as EC
  

You can find a relevant discussion in How to retrieve the text of a WebElement using Selenium - Python

References

Link to useful documentation:

• get_attribute() method Gets the given attribute or property of the element.
• text attribute returns The text of the element.
• Difference between text and innerHTML using Selenium

Please use these two methods for store data in ArrayList in kotlin

fun setDataInArrayList(list: ArrayList<ShopReisterRequest>, key: String, context: Context) {
    val prefs = PreferenceManager.getDefaultSharedPreferences(context)
    val editor = prefs.edit()
    val gson = Gson()
    val json = gson.toJson(list)
    editor.putString(key, json)
    editor.apply()   
}

fun getDataInArrayList(key: String, context: Context): ArrayList<ShopReisterRequest> {
    val prefs = PreferenceManager.getDefaultSharedPreferences(context)
    val gson = Gson()
    val json = prefs.getString(key, null)
    val type = object : TypeToken<ArrayList<ShopReisterRequest>>() {

    }.type
    return gson.fromJson<ArrayList<ShopReisterRequest>>(json, type)
}  

Crazy amount of complicated answers here. If you don't intend to process nodeJS files/database but just want to serve static html/css/js/images as your question suggest then simply install the pushstate-server module or similar;

Here's a "one liner" that will create and launch a mini site. Simply paste that entire block in your terminal in the appropriate directory.

mkdir mysite; \
cd mysite; \
npm install pushstate-server --save; \
mkdir app; \
touch app/index.html; \
echo '<h1>Hello World</h1>' > app/index.html; \
touch server.js; \
echo "var server = require('pushstate-server');server.start({ port: 3000, directory: './app' });" > server.js; \
node server.js

Open browser and go to http://localhost:3000. Done.

The server will use the app dir as the root to serve files from. To add additional assets just place them inside that directory.

In your readLine function, you return a pointer to the line array (Strictly speaking, a pointer to its first character, but the difference is irrelevant here). Since it's an automatic variable (i.e., it's “on the stack”), the memory is reclaimed when the function returns. You see gibberish because printf has put its own stuff on the stack.

You need to return a dynamically allocated buffer from the function. You already have one, it's lineBuffer; all you have to do is truncate it to the desired length.

    lineBuffer[count] = '\0';
    realloc(lineBuffer, count + 1);
    return lineBuffer;
}

ADDED (response to follow-up question in comment): readLine returns a pointer to the characters that make up the line. This pointer is what you need to work with the contents of the line. It's also what you must pass to free when you've finished using the memory taken by these characters. Here's how you might use the readLine function:

char *line = readLine(file);
printf("LOG: read a line: %s\n", line);
if (strchr(line, 'a')) { puts("The line contains an a"); }
/* etc. */
free(line);
/* After this point, the memory allocated for the line has been reclaimed.
   You can't use the value of `line` again (though you can assign a new value
   to the `line` variable if you want). */

Make sure "App Domain" and Facebook Login => Valid OAuth redirect URIs. There you must check www or without www. Its better if you use with www or without for all URLs in php,html,css files and Fb app settings.

Other thing is if you're using "/" end of the URLs you must add that URL to app settings of Valid OAuth redirect URIs. Example:- https://www.example.com/index.php/ if this url if youre using in the redirect url you must set that to app settings.

Hope this would be help.

I believe that your problem is that you're checking for an empty string using double quotes instead of single quotes. Try just changing to:

DELETE FROM table WHERE edit_user=''

If you don't care about the order of the array, then you may want to get the difference between arr1 and arr2 by id using differenceBy() and then simply use concat() to append all the updated objects.

var result = _(arr1).differenceBy(arr2, 'id').concat(arr2).value();

var arr1 = [{_x000D_
  id: '124',_x000D_
  name: 'qqq'_x000D_
}, {_x000D_
  id: '589',_x000D_
  name: 'www'_x000D_
}, {_x000D_
  id: '45',_x000D_
  name: 'eee'_x000D_
}, {_x000D_
  id: '567',_x000D_
  name: 'rrr'_x000D_
}]_x000D_
_x000D_
var arr2 = [{_x000D_
  id: '124',_x000D_
  name: 'ttt'_x000D_
}, {_x000D_
  id: '45',_x000D_
  name: 'yyy'_x000D_
}];_x000D_
_x000D_
var result = _(arr1).differenceBy(arr2, 'id').concat(arr2).value();_x000D_
_x000D_
console.log(result);

<script src="https://cdnjs.cloudflare.com/ajax/libs/lodash.js/4.13.1/lodash.js"></script>

setattr()

We use setattr to add an attribute to our class instance. We pass the class instance, the attribute name, and the value.

getattr()

With getattr we retrive these values

For example

Employee = type("Employee", (object,), dict())

employee = Employee()

# Set salary to 1000
setattr(employee,"salary", 1000 )

# Get the Salary
value = getattr(employee, "salary")

print(value)

:set tabstop=4
:set shiftwidth=4
:set expandtab

This will insert four spaces instead of a tab character. Spaces are a bit more “stable”, meaning that text indented with spaces will show up the same in the browser and any other application.

OK realized a mistake .. it has to be /:id/:id2

Anyway didn't find this in any tutorial or other StackOverflow question.

@RouteConfig([{path: '/component/:id/:id2',name: 'MyCompB', component:MyCompB}])
export class MyCompA {
    onClick(){
        this._router.navigate( ['MyCompB', {id: "someId", id2: "another ID"}]);
    }
}

If you are using numpy, the closest, I can think of is using a mask

>>> import numpy as np
>>> arr = np.arange(1,10)
>>> mask = np.ones(arr.shape,dtype=bool)
>>> mask[5]=0
>>> arr[mask]
array([1, 2, 3, 4, 5, 7, 8, 9])

Something similar can be achieved using itertools without numpy

>>> from itertools import compress
>>> arr = range(1,10)
>>> mask = [1]*len(arr)
>>> mask[5]=0
>>> list(compress(arr,mask))
[1, 2, 3, 4, 5, 7, 8, 9]

Here's a typical simple example in the Unity milieu

using UnityEngine;

public class Launch : MonoBehaviour
{
    void Start()
    {
        Debug.Log("today " + System.DateTime.Now.ToString("MM/dd/yyyy"));

        // don't allow the app to be run after June 10th
        System.DateTime lastDay = new System.DateTime(2020, 6, 10);
        System.DateTime today = System.DateTime.Now;

        if (lastDay < today) {
            Debug.Log("quit the app");
            Application.Quit();
        }
        UnityEngine.SceneManagement.SceneManager.LoadScene("Welcome");
    }
}

With ES8 you could also use padStart or padEnd for this. eg.

var str = 'cat';
var num = 23;
var size = str.length * num;
"".padStart(size, str) // outputs: 'catcatcatcatcatcatcatcatcatcatcatcatcatcatcatcatcatcatcatcatcatcatcat'

I'd use a decent HTML parser like Jsoup. It's then as easy as:

String html = Jsoup.connect("http://stackoverflow.com").get().html();

It handles GZIP and chunked responses and character encoding fully transparently. It offers more advantages as well, like HTML traversing and manipulation by CSS selectors like as jQuery can do. You only have to grab it as Document, not as a String.

Document document = Jsoup.connect("http://google.com").get();

You really don't want to run basic String methods or even regex on HTML to process it.

See also:

• What are the pros and cons of leading HTML parsers in Java?

In Angular p-checkbox,

Use all attributes of p-checkbox

<p-checkbox name="checkbox" value="isAC" 
    label="All Colors" [(ngModel)]="selectedAllColors" 
    [ngModelOptions]="{standalone: true}" id="al" 
    binary="true">
</p-checkbox>

And more importantly, don't forget to include [ngModelOptions]="{standalone: true} as well as it SAVED MY DAY.

Without having selected a language type for your file there are no styles defined. Comment and block comment are language specific style preferences. If that's a PITA...

To select for multi-line editing you can use

shift + alt + down arrow

listView.setOnItemClickListener(new OnItemClickListener() {

    public void onItemClick(AdapterView<?> parent, View view, int position, long id) {
        Object o = prestListView.getItemAtPosition(position);
        prestationEco str = (prestationEco)o; //As you are using Default String Adapter
        Toast.makeText(getBaseContext(),str.getTitle(),Toast.LENGTH_SHORT).show();
    }
});

Use the equals method. Why are you so worried that it's expensive?

By this method also you can compare two dates

NSDate * dateOne = [NSDate date];
NSDate * dateTwo = [NSDate date];

if([dateOne compare:dateTwo] == NSOrderedAscending)
{

}

The short answer is that history.pushState (not History.pushState, which would throw an exception, the window part is optional) will never do what you suggest.

If pages are refreshing, then it is caused by other things that you are doing (for example, you might have code running that goes to a new location in the case of the address bar changing).

history.pushState({urlPath:'/page2.php'},"",'/page2.php') works exactly like it is supposed to in the latest versions of Chrome, IE and Firefox for me and my colleagues.

In fact you can put whatever you like into the function: history.pushState({}, '', 'So long and thanks for all the fish.not a real file').

If you post some more code (with special attention for code nearby the history.pushState and anywhere document.location is used), then we'll be more than happy to help you figure out where exactly this issue is coming from.

If you post more code, I'll update this answer (I have your question favourited) :).

The git diff command typically expects one or more commit hashes to generate your diff. You seem to be supplying the name of a remote.

If you had a branch named origin, the commit hash at tip of the branch would have been used if you supplied origin to the diff command, but currently (with no corresponding branch) the command will produce the error you're seeing. It may be the case that you were previously working with a branch named origin.

An alternative, if you're trying to view the difference between your local branch, and a branch on a remote would be something along the lines of:

git diff origin/<branchname>

git diff <branchname> origin/<branchname>

Or other documented variants.

Edit: Having read further, I realise I'm slightly wrong, git diff origin is shorthand for diffing against the head of the specified remote, so git diff origin = git diff origin/HEAD (compare local git branch with remote branch?, Why is "origin/HEAD" shown when running "git branch -r"?)

It sounds like your origin does not have a HEAD, in my case this is because my remote is a bare repository that has never had a HEAD set.

Running git branch -r will show you if origin/HEAD is set, and if so, which branch it points at (e.g. origin/HEAD -> origin/<branchname>).

For sentOs, it's works for me At first stop service by sudo service jenkins stop

Than remove by sudo yum remove jenkins

To expound slightly on GlennG's very helpful answer (translating the syntax from C# to VB.Net is not always "obvious") you can also decorate individual class properties to manage how null values are handled. If you do this don't use the global JsonSerializerSettings from GlennG's suggestion, otherwise it will override the individual decorations. This comes in handy if you want a null item to appear in the JSON so the consumer doesn't have to do any special handling. If, for example, the consumer needs to know an array of optional items is normally available, but is currently empty... The decoration in the property declaration looks like this:

<JsonPropertyAttribute("MyProperty", DefaultValueHandling:=NullValueHandling.Include)> Public Property MyProperty As New List(of String)

For those properties you don't want to have appear at all in the JSON change :=NullValueHandling.Include to :=NullValueHandling.Ignore. By the way - I've found that you can decorate a property for both XML and JSON serialization just fine (just put them right next to each other). This gives me the option to call the XML serializer in dotnet or the NewtonSoft serializer at will - both work side-by-side and my customers have the option to work with XML or JSON. This is slick as snot on a doorknob since I have customers that require both!

With dotnetcore3.0 you can package entire solution into a single-file executable using PublishSingleFile property

-p:PublishSingleFile=True

Source Single-file executables

An example of Self Contained, Release OSX executable:

dotnet publish -c Release -r osx-x64 -p:PublishSingleFile=True --self-contained True

An example of Self Contained, Debug Linux 64bit executable:

dotnet publish -c Debug -r linux-x64 -p:PublishSingleFile=True --self-contained True

Linux build is independed of distribution and I have found them working on Ubuntu 18.10, CentOS 7.7, and Amazon Linux 2.

A Self Contained executable includes Dotnet Runtime and Runtime does not require to be installed on a target machine. The published executables are saved under:

<ProjectDir>/bin/<Release or Debug>/netcoreapp3.0/<target-os>/publish/ on Linux, OSX and

<ProjectDir>\bin\<Release or Debug>\netcoreapp3.0\<target-os>\publish\ on Windows.

Saving large files

Long data URIs can give performance problems in browsers. Another option to save client-side generated files, is to put their contents in a Blob (or File) object and create a download link using URL.createObjectURL(blob). This returns an URL that can be used to retrieve the contents of the blob. The blob is stored inside the browser until either URL.revokeObjectURL() is called on the URL or the document that created it is closed. Most web browsers have support for object URLs, Opera Mini is the only one that does not support them.

Forcing a download

If the data is text or an image, the browser can open the file, instead of saving it to disk. To cause the file to be downloaded upon clicking the link, you can use the the download attribute. However, not all web browsers have support for the download attribute. Another option is to use application/octet-stream as the file's mime-type, but this causes the file to be presented as a binary blob which is especially user-unfriendly if you don't or can't specify a filename. See also 'Force to open "Save As..." popup open at text link click for pdf in HTML'.

Specifying a filename

If the blob is created with the File constructor, you can also set a filename, but only a few web browsers (including Chrome & Firefox) have support for the File constructor. The filename can also be specified as the argument to the download attribute, but this is subject to a ton of security considerations. Internet Explorer 10 and 11 provides its own method, msSaveBlob, to specify a filename.

Example code

var file;_x000D_
var data = [];_x000D_
data.push("This is a test\n");_x000D_
data.push("Of creating a file\n");_x000D_
data.push("In a browser\n");_x000D_
var properties = {type: 'text/plain'}; // Specify the file's mime-type._x000D_
try {_x000D_
  // Specify the filename using the File constructor, but ..._x000D_
  file = new File(data, "file.txt", properties);_x000D_
} catch (e) {_x000D_
  // ... fall back to the Blob constructor if that isn't supported._x000D_
  file = new Blob(data, properties);_x000D_
}_x000D_
var url = URL.createObjectURL(file);_x000D_
document.getElementById('link').href = url;

<a id="link" target="_blank" download="file.txt">Download</a>

find . -name "*.pyc"|xargs rm -rf

Not sure if this is really beneficial or why I prefer this style but what I do (in vanilla js) is:

document.querySelector('#selector').toggleAttribute('data-something');

This will add the attribute in all lowercase without a value or remove it if it already exists on the element.

https://developer.mozilla.org/en-US/docs/Web/API/Element/toggleAttribute

Since .NET 4.5 you can use combination of async and await with Progress for sending updates to UI thread:

private void Calculate(int i)
{
    double pow = Math.Pow(i, i);
}

public void DoWork(IProgress<int> progress)
{
    // This method is executed in the context of
    // another thread (different than the main UI thread),
    // so use only thread-safe code
    for (int j = 0; j < 100000; j++)
    {
        Calculate(j);

        // Use progress to notify UI thread that progress has
        // changed
        if (progress != null)
            progress.Report((j + 1) * 100 / 100000);
    }
}

private async void button1_Click(object sender, EventArgs e)
{
    progressBar1.Maximum = 100;
    progressBar1.Step = 1;

    var progress = new Progress<int>(v =>
    {
        // This lambda is executed in context of UI thread,
        // so it can safely update form controls
        progressBar1.Value = v;
    });

    // Run operation in another thread
    await Task.Run(() => DoWork(progress));

    // TODO: Do something after all calculations
}

Tasks are currently the preferred way to implement what BackgroundWorker does.

Tasks and Progress are explained in more detail here:

• Async in 4.5: Enabling Progress and Cancellation in Async APIs
• Reporting Progress from Async Tasks by Stephen Cleary
• Task parallel library replacement for BackgroundWorker?

The problem is with slashes: your variable contains them and the final command will be something like sed "s/string/path/to/something/g", containing way too many slashes.

Since sed can take any char as delimiter (without having to declare the new delimiter), you can try using another one that doesn't appear in your replacement string:

replacement="/my/path"
sed --expression "s@pattern@$replacement@"

Note that this is not bullet proof: if the replacement string later contains @ it will break for the same reason, and any backslash sequences like \1 will still be interpreted according to sed rules. Using | as a delimiter is also a nice option as it is similar in readability to /.

Maybe you wrongly set permission on python3. For instance if for the file permission is set like

`os.chmod('spam.txt', 0777)` --> This will lead to SyntaxError 

This syntax was used in Python2. Now if you change like: os.chmod('spam.txt', 777) --> This is still worst!! Your permission will be set wrongly since are not on "octal" but on decimal.

Afterwards you will get permission Error if you try for instance to remove the file: PermissionError: [WinError 5] Access is denied:

Solution for python3 is quite easy: os.chmod('spam.txt', 0o777) --> The syntax is now ZERO and o "0o"

public class BOX
{
    double height, length, breadth;

    public static bool operator == (BOX b1, BOX b2)
    {
        if (b1 is null)
            return b2 is null;

        return b1.Equals(b2);
    }

    public static bool operator != (BOX b1, BOX b2)
    {
        return !(b1 == b2);
    }

    public override bool Equals(object obj)
    {
        if (obj == null)
            return false;

        return obj is BOX b2? (length == b2.length && 
                               breadth == b2.breadth && 
                               height == b2.height): false;

    }

    public override int GetHashCode()
    {
        return (height,length,breadth).GetHashCode();
    }
}

'Simple HTML DOM Parser' is a good option for PHP, if your familiar with jQuery or JavaScript selectors then you will find yourself at home.

Find it here

There is also a blog post about it here.

This is the best option. As said Michal Gasek (first answer), since the pull request was merged (https://github.com/ansible/ansible/pull/8651), we are able to set permanent environment variables easily by play level.

- hosts: all
  roles:
     - php
     - nginx
  environment:
    MY_ENV_VARIABLE: whatever_value

Just to complete the example with a full implementation of ClientHttpRequestInterceptor to trace request and response:

import java.io.BufferedReader;
import java.io.IOException;
import java.io.InputStreamReader;

import org.slf4j.Logger;
import org.slf4j.LoggerFactory;
import org.springframework.http.HttpRequest;
import org.springframework.http.client.ClientHttpRequestExecution;
import org.springframework.http.client.ClientHttpRequestInterceptor;
import org.springframework.http.client.ClientHttpResponse;

public class LoggingRequestInterceptor implements ClientHttpRequestInterceptor {

    final static Logger log = LoggerFactory.getLogger(LoggingRequestInterceptor.class);

    @Override
    public ClientHttpResponse intercept(HttpRequest request, byte[] body, ClientHttpRequestExecution execution) throws IOException {
        traceRequest(request, body);
        ClientHttpResponse response = execution.execute(request, body);
        traceResponse(response);
        return response;
    }

    private void traceRequest(HttpRequest request, byte[] body) throws IOException {
        log.info("===========================request begin================================================");
        log.debug("URI         : {}", request.getURI());
        log.debug("Method      : {}", request.getMethod());
        log.debug("Headers     : {}", request.getHeaders() );
        log.debug("Request body: {}", new String(body, "UTF-8"));
        log.info("==========================request end================================================");
    }

    private void traceResponse(ClientHttpResponse response) throws IOException {
        StringBuilder inputStringBuilder = new StringBuilder();
        BufferedReader bufferedReader = new BufferedReader(new InputStreamReader(response.getBody(), "UTF-8"));
        String line = bufferedReader.readLine();
        while (line != null) {
            inputStringBuilder.append(line);
            inputStringBuilder.append('\n');
            line = bufferedReader.readLine();
        }
        log.info("============================response begin==========================================");
        log.debug("Status code  : {}", response.getStatusCode());
        log.debug("Status text  : {}", response.getStatusText());
        log.debug("Headers      : {}", response.getHeaders());
        log.debug("Response body: {}", inputStringBuilder.toString());
        log.info("=======================response end=================================================");
    }

}

Then instantiate RestTemplate using a BufferingClientHttpRequestFactory and the LoggingRequestInterceptor:

RestTemplate restTemplate = new RestTemplate(new BufferingClientHttpRequestFactory(new SimpleClientHttpRequestFactory()));
List<ClientHttpRequestInterceptor> interceptors = new ArrayList<>();
interceptors.add(new LoggingRequestInterceptor());
restTemplate.setInterceptors(interceptors);

The BufferingClientHttpRequestFactory is required as we want to use the response body both in the interceptor and for the initial calling code. The default implementation allows to read the response body only once.

String test = DateTime.Now.ToShortDateString();

git log --reflog

saved me! I lost mine while merging HEAD and could not find my lates commit! Not showing in source tree but git log --reflog show all my local commits before

Here's my modification of the implementation that was originally written by René Nyffenegger. And why have I modified it? Well, because it didn't seem appropriate to me that I should work with binary data stored within std::string object ;)

base64.h:

#ifndef _BASE64_H_
#define _BASE64_H_

#include <vector>
#include <string>
typedef unsigned char BYTE;

std::string base64_encode(BYTE const* buf, unsigned int bufLen);
std::vector<BYTE> base64_decode(std::string const&);

#endif

base64.cpp:

#include "base64.h"
#include <iostream>

static const std::string base64_chars =
             "ABCDEFGHIJKLMNOPQRSTUVWXYZ"
             "abcdefghijklmnopqrstuvwxyz"
             "0123456789+/";


static inline bool is_base64(BYTE c) {
  return (isalnum(c) || (c == '+') || (c == '/'));
}

std::string base64_encode(BYTE const* buf, unsigned int bufLen) {
  std::string ret;
  int i = 0;
  int j = 0;
  BYTE char_array_3[3];
  BYTE char_array_4[4];

  while (bufLen--) {
    char_array_3[i++] = *(buf++);
    if (i == 3) {
      char_array_4[0] = (char_array_3[0] & 0xfc) >> 2;
      char_array_4[1] = ((char_array_3[0] & 0x03) << 4) + ((char_array_3[1] & 0xf0) >> 4);
      char_array_4[2] = ((char_array_3[1] & 0x0f) << 2) + ((char_array_3[2] & 0xc0) >> 6);
      char_array_4[3] = char_array_3[2] & 0x3f;

      for(i = 0; (i <4) ; i++)
        ret += base64_chars[char_array_4[i]];
      i = 0;
    }
  }

  if (i)
  {
    for(j = i; j < 3; j++)
      char_array_3[j] = '\0';

    char_array_4[0] = (char_array_3[0] & 0xfc) >> 2;
    char_array_4[1] = ((char_array_3[0] & 0x03) << 4) + ((char_array_3[1] & 0xf0) >> 4);
    char_array_4[2] = ((char_array_3[1] & 0x0f) << 2) + ((char_array_3[2] & 0xc0) >> 6);
    char_array_4[3] = char_array_3[2] & 0x3f;

    for (j = 0; (j < i + 1); j++)
      ret += base64_chars[char_array_4[j]];

    while((i++ < 3))
      ret += '=';
  }

  return ret;
}

std::vector<BYTE> base64_decode(std::string const& encoded_string) {
  int in_len = encoded_string.size();
  int i = 0;
  int j = 0;
  int in_ = 0;
  BYTE char_array_4[4], char_array_3[3];
  std::vector<BYTE> ret;

  while (in_len-- && ( encoded_string[in_] != '=') && is_base64(encoded_string[in_])) {
    char_array_4[i++] = encoded_string[in_]; in_++;
    if (i ==4) {
      for (i = 0; i <4; i++)
        char_array_4[i] = base64_chars.find(char_array_4[i]);

      char_array_3[0] = (char_array_4[0] << 2) + ((char_array_4[1] & 0x30) >> 4);
      char_array_3[1] = ((char_array_4[1] & 0xf) << 4) + ((char_array_4[2] & 0x3c) >> 2);
      char_array_3[2] = ((char_array_4[2] & 0x3) << 6) + char_array_4[3];

      for (i = 0; (i < 3); i++)
          ret.push_back(char_array_3[i]);
      i = 0;
    }
  }

  if (i) {
    for (j = i; j <4; j++)
      char_array_4[j] = 0;

    for (j = 0; j <4; j++)
      char_array_4[j] = base64_chars.find(char_array_4[j]);

    char_array_3[0] = (char_array_4[0] << 2) + ((char_array_4[1] & 0x30) >> 4);
    char_array_3[1] = ((char_array_4[1] & 0xf) << 4) + ((char_array_4[2] & 0x3c) >> 2);
    char_array_3[2] = ((char_array_4[2] & 0x3) << 6) + char_array_4[3];

    for (j = 0; (j < i - 1); j++) ret.push_back(char_array_3[j]);
  }

  return ret;
}

Here's the usage:

std::vector<BYTE> myData;
...
std::string encodedData = base64_encode(&myData[0], myData.size());
std::vector<BYTE> decodedData = base64_decode(encodedData);

How about this?

WAITFOR DELAY '00:00:02';

If you have "00:02" it's interpreting that as Hours:Minutes.

Yes it is valid according to xhtml1-strict.dtd. The following XHTML passes the validation:

<?xml version="1.0"?>
<!DOCTYPE html PUBLIC "-//W3C//DTD XHTML 1.0 Strict//EN"
    "http://www.w3.org/TR/xhtml1/DTD/xhtml1-strict.dtd">
<html xmlns="http://www.w3.org/1999/xhtml" xml:lang="en" lang="en">
<head>
    <meta http-equiv="Content-Type" content="text/html; charset=utf-8" />
    <title>Test</title>
</head>
<body>
<ul>
  <li><div>test</div></li>
</ul>
</body>
</html>

Perhaps a better way of handling errors in MVC is to apply the HandleError attribute to your controller or action and update the Shared/Error.aspx file to do what you want. The Model object on that page includes an Exception property as well as ControllerName and ActionName.

Explore the folder where your website is store and see you will get one extra folder "aspnet_client" delete that folder and it will work for you.

I tried this my problem is solved.

If it works for you please make it as answer so that some body else will also get solution.

Hope this helps: http://nrecursions.blogspot.in/2014/02/how-to-trigger-jenkins-build-on-git.html

It's just a matter of using curl to trigger a Jenkins job using the git hooks provided by git.
The command

curl http://localhost:8080/job/someJob/build?delay=0sec

can run a Jenkins job, where someJob is the name of the Jenkins job.

Search for the hooks folder in your hidden .git folder. Rename the post-commit.sample file to post-commit. Open it with Notepad, remove the : Nothing line and paste the above command into it.

That's it. Whenever you do a commit, Git will trigger the post-commit commands defined in the file.

OMG I Got A Quick File Move Command form CMD

1)Command will move All Files and Sub Folders into another location in 1 second .

check command

C:\user>move "your source path " "your destination path" 

Hint : For move all Files and Sub folders

C:\user>move "f:\wamp\www" "f:\wapm_3.2\www\old Projects"

check image

you can see that it's before i try some other code that was not working due to more than 1 files and folder was there. when i try to execute code that is under line by red color then all folder move in 1 second.

now check this image. here Total 6.7GB data moved in 1 second... you can check date of post and move as well as Folder name.

i will soon make a windows app that will do same..

Run these two commands from the terminal to set User email and Name

 git config --global user.email "[email protected]" 

 git config --global user.name "your name" 

With small custom synchronization context, sync function can wait for completion of async function, without creating deadlock. Here is small example for WinForms app.

Imports System.Threading
Imports System.Runtime.CompilerServices

Public Class Form1

    Private Sub Form1_Load(sender As Object, e As EventArgs) Handles MyBase.Load
        SyncMethod()
    End Sub

    ' waiting inside Sync method for finishing async method
    Public Sub SyncMethod()
        Dim sc As New SC
        sc.WaitForTask(AsyncMethod())
        sc.Release()
    End Sub

    Public Async Function AsyncMethod() As Task(Of Boolean)
        Await Task.Delay(1000)
        Return True
    End Function

End Class

Public Class SC
    Inherits SynchronizationContext

    Dim OldContext As SynchronizationContext
    Dim ContextThread As Thread

    Sub New()
        OldContext = SynchronizationContext.Current
        ContextThread = Thread.CurrentThread
        SynchronizationContext.SetSynchronizationContext(Me)
    End Sub

    Dim DataAcquired As New Object
    Dim WorkWaitingCount As Long = 0
    Dim ExtProc As SendOrPostCallback
    Dim ExtProcArg As Object

    <MethodImpl(MethodImplOptions.Synchronized)>
    Public Overrides Sub Post(d As SendOrPostCallback, state As Object)
        Interlocked.Increment(WorkWaitingCount)
        Monitor.Enter(DataAcquired)
        ExtProc = d
        ExtProcArg = state
        AwakeThread()
        Monitor.Wait(DataAcquired)
        Monitor.Exit(DataAcquired)
    End Sub

    Dim ThreadSleep As Long = 0

    Private Sub AwakeThread()
        If Interlocked.Read(ThreadSleep) > 0 Then ContextThread.Resume()
    End Sub

    Public Sub WaitForTask(Tsk As Task)
        Dim aw = Tsk.GetAwaiter

        If aw.IsCompleted Then Exit Sub

        While Interlocked.Read(WorkWaitingCount) > 0 Or aw.IsCompleted = False
            If Interlocked.Read(WorkWaitingCount) = 0 Then
                Interlocked.Increment(ThreadSleep)
                ContextThread.Suspend()
                Interlocked.Decrement(ThreadSleep)
            Else
                Interlocked.Decrement(WorkWaitingCount)
                Monitor.Enter(DataAcquired)
                Dim Proc = ExtProc
                Dim ProcArg = ExtProcArg
                Monitor.Pulse(DataAcquired)
                Monitor.Exit(DataAcquired)
                Proc(ProcArg)
            End If
        End While

    End Sub

     Public Sub Release()
         SynchronizationContext.SetSynchronizationContext(OldContext)
     End Sub

End Class

querystring can help.

So, you can

const querystring = require('querystring')

url += '?' + querystring.stringify(parameters)

If you absolutely do not want to use code-behind, you can try conditional operator for this:

<%# ((int)Eval("Percentage") < 50) ? "0 %" : Eval("Percentage") %>

That is assuming field Percentage contains integer.

Update: Version for VB.NET, just in case, provided by tomasofen:

<%# If(Eval("Status") < 50, "0 %", Eval("Percentage")) %>

What if you compile it using another machine? A fresh installed one would be lovely. I hope your machine is not jealous.

This error can occur especially when you are updating large libraries or libraries with a lot of dependencies. Composer can be quite memory hungry.

Be sure that your composer itself is updated to the latest version:

php composer.phar --self-update

You can increase the memory limit for composer temporarily by adding the composer memory limit environment variable:

COMPOSER_MEMORY_LIMIT=128MB php composer.phar update

Use the format “128M” for megabyte or “2G” for gigabyte. You can use the value “-1” to ignore the memory limit completely.

Another way would be to increase the PHP memory limit:

php -d memory_limit=512M composer.phar update ...

The spec can be read as "ISO-8859-1" or "undefined". Your choice. It's known that many servers use ISO-8859-1 (like it or not) and will fail when you send something else.

For more information and a proposal to fix the situation, see http://greenbytes.de/tech/webdav/draft-reschke-basicauth-enc-latest.html

Another way could be using observers with a fake model class through the activity and the service itself, implementing an MVC pattern variation. I don't know if it's the best way to accomplish this, but it's the way that worked for me. If you need some example ask for it and i'll post something.

jhat is one of the best i have used so far.To take a core dump,I think you better use jmap and jps instead of gcore(i haven't used it).Check the link to see how to use jhat. http://www.lshift.net/blog/2006/03/08/java-memory-profiling-with-jmap-and-jhat

The curl installed by default in Debian supports HTTPS since a great while back. (a long time ago there were two separate packages, one with and one without SSL but that's not the case anymore)

OPTIONS /path

You can send an OPTIONS request with curl like this:

curl -i -X OPTIONS http://example.org/path

You may also use -v instead of -i to see more output.

OPTIONS *

To send a plain * (instead of the path, see RFC 7231) with the OPTIONS method, you need curl 7.55.0 or later as then you can run a command line like:

curl -i --request-target "*" -X OPTIONS http://example.org

stored value in DB is: 5XXXXXX [where x can be any digit]

You don't mention data types - if numeric, you'll likely have to use CAST/CONVERT to change the data type to [n]varchar.

Use:

WHERE CHARINDEX(column, '5') = 1
  AND CHARINDEX(column, '.') = 0 --to stop decimals if needed
  AND ISNUMERIC(column) = 1

References:

• CHARINDEX
• ISNUMERIC

i have also different cases like XXXX7XX for example, so it has to be generic.

Use:

WHERE PATINDEX('%7%', column) = 5
  AND CHARINDEX(column, '.') = 0 --to stop decimals if needed
  AND ISNUMERIC(column) = 1

References:

• PATINDEX

Regex Support

SQL Server 2000+ supports regex, but the catch is you have to create the UDF function in CLR before you have the ability. There are numerous articles providing example code if you google them. Once you have that in place, you can use:

• 5\d{6} for your first example
• \d{4}7\d{2} for your second example

For more info on regular expressions, I highly recommend this website.

If these worksheets reside in the same workbook, a simple solution would be to name the range, and have the formula refer to the named range. To name a range, select it, right click, and provide it with a meaningful name with Workbook scope.

For example =Sheet1!$A$1:$F$1 could be named: theNamedRange. Then your formula on Sheet2! could refer to it in your formula like this: =SUM(theNamedRange).

Incidentally, it is not clear from your question how you meant to use the range. If you put what you had in a formula (e.g., =SUM(Sheet1!A1:F1)) it will work, you simply need to insert that range argument in a formula. Excel does not resolve the range reference without a related formula because it does not know what you want to do with it.

Of the two methods, I find the named range convention is easier to work with.