If you have missed to add unique to DB column, just add this validation in model to check if the field is unique:

class Person < ActiveRecord::Base
  validates_uniqueness_of :user_name
end

refer here Above is for testing purpose only, please add index by changing DB column as suggested by @Nate

please refer this with index for more information

In Sql Server 2012 - Management Studio:

Solution 1:

Execute the query

Right click the Results Window

Select Save Results As from the menu

Select CSV

Solution 2:

Right click on database

Select Tasks, Export Data

Select Source DB

Select Destination: Flat File Destination

Pick a file name

Select Format - Delimited

Choose a table or write a query

Pick a Column delimiter

Note: You can pick a Text qualifier that will delimit your text fields, such as quotes.

If you have a field with commas, don't use you use comma as a delimiter, because it does not escape commas. You can pick a column delimiter such as Vertical Bar: | instead of comma, or a tab character. Otherwise, write a query that escapes your commas or delimits your varchar field.

The escape character or text qualifier you need to use depends on your requirements.

Demo

See below for an explanation.

$(document).ready(function() {_x000D_
_x000D_
  function exportTableToCSV($table, filename) {_x000D_
_x000D_
    var $rows = $table.find('tr:has(td)'),_x000D_
_x000D_
      // Temporary delimiter characters unlikely to be typed by keyboard_x000D_
      // This is to avoid accidentally splitting the actual contents_x000D_
      tmpColDelim = String.fromCharCode(11), // vertical tab character_x000D_
      tmpRowDelim = String.fromCharCode(0), // null character_x000D_
_x000D_
      // actual delimiter characters for CSV format_x000D_
      colDelim = '","',_x000D_
      rowDelim = '"\r\n"',_x000D_
_x000D_
      // Grab text from table into CSV formatted string_x000D_
      csv = '"' + $rows.map(function(i, row) {_x000D_
        var $row = $(row),_x000D_
          $cols = $row.find('td');_x000D_
_x000D_
        return $cols.map(function(j, col) {_x000D_
          var $col = $(col),_x000D_
            text = $col.text();_x000D_
_x000D_
          return text.replace(/"/g, '""'); // escape double quotes_x000D_
_x000D_
        }).get().join(tmpColDelim);_x000D_
_x000D_
      }).get().join(tmpRowDelim)_x000D_
      .split(tmpRowDelim).join(rowDelim)_x000D_
      .split(tmpColDelim).join(colDelim) + '"';_x000D_
_x000D_
    // Deliberate 'false', see comment below_x000D_
    if (false && window.navigator.msSaveBlob) {_x000D_
_x000D_
      var blob = new Blob([decodeURIComponent(csv)], {_x000D_
        type: 'text/csv;charset=utf8'_x000D_
      });_x000D_
_x000D_
      // Crashes in IE 10, IE 11 and Microsoft Edge_x000D_
      // See MS Edge Issue #10396033_x000D_
      // Hence, the deliberate 'false'_x000D_
      // This is here just for completeness_x000D_
      // Remove the 'false' at your own risk_x000D_
      window.navigator.msSaveBlob(blob, filename);_x000D_
_x000D_
    } else if (window.Blob && window.URL) {_x000D_
      // HTML5 Blob        _x000D_
      var blob = new Blob([csv], {_x000D_
        type: 'text/csv;charset=utf-8'_x000D_
      });_x000D_
      var csvUrl = URL.createObjectURL(blob);_x000D_
_x000D_
      $(this)_x000D_
        .attr({_x000D_
          'download': filename,_x000D_
          'href': csvUrl_x000D_
        });_x000D_
    } else {_x000D_
      // Data URI_x000D_
      var csvData = 'data:application/csv;charset=utf-8,' + encodeURIComponent(csv);_x000D_
_x000D_
      $(this)_x000D_
        .attr({_x000D_
          'download': filename,_x000D_
          'href': csvData,_x000D_
          'target': '_blank'_x000D_
        });_x000D_
    }_x000D_
  }_x000D_
_x000D_
  // This must be a hyperlink_x000D_
  $(".export").on('click', function(event) {_x000D_
    // CSV_x000D_
    var args = [$('#dvData>table'), 'export.csv'];_x000D_
_x000D_
    exportTableToCSV.apply(this, args);_x000D_
_x000D_
    // If CSV, don't do event.preventDefault() or return false_x000D_
    // We actually need this to be a typical hyperlink_x000D_
  });_x000D_
});

a.export,_x000D_
a.export:visited {_x000D_
  display: inline-block;_x000D_
  text-decoration: none;_x000D_
  color: #000;_x000D_
  background-color: #ddd;_x000D_
  border: 1px solid #ccc;_x000D_
  padding: 8px;_x000D_
}

<script src="https://ajax.googleapis.com/ajax/libs/jquery/2.1.1/jquery.min.js"></script>_x000D_
<a href="#" class="export">Export Table data into Excel</a>_x000D_
<div id="dvData">_x000D_
  <table>_x000D_
    <tr>_x000D_
      <th>Column One</th>_x000D_
      <th>Column Two</th>_x000D_
      <th>Column Three</th>_x000D_
    </tr>_x000D_
    <tr>_x000D_
      <td>row1 Col1</td>_x000D_
      <td>row1 Col2</td>_x000D_
      <td>row1 Col3</td>_x000D_
    </tr>_x000D_
    <tr>_x000D_
      <td>row2 Col1</td>_x000D_
      <td>row2 Col2</td>_x000D_
      <td>row2 Col3</td>_x000D_
    </tr>_x000D_
    <tr>_x000D_
      <td>row3 Col1</td>_x000D_
      <td>row3 Col2</td>_x000D_
      <td>row3 Col3</td>_x000D_
    </tr>_x000D_
    <tr>_x000D_
      <td>row4 'Col1'</td>_x000D_
      <td>row4 'Col2'</td>_x000D_
      <td>row4 'Col3'</td>_x000D_
    </tr>_x000D_
    <tr>_x000D_
      <td>row5 &quot;Col1&quot;</td>_x000D_
      <td>row5 &quot;Col2&quot;</td>_x000D_
      <td>row5 &quot;Col3&quot;</td>_x000D_
    </tr>_x000D_
    <tr>_x000D_
      <td>row6 "Col1"</td>_x000D_
      <td>row6 "Col2"</td>_x000D_
      <td>row6 "Col3"</td>_x000D_
    </tr>_x000D_
  </table>_x000D_
</div>

As of 2017

Now uses HTML5 Blob and URL as the preferred method with Data URI as a fallback.

On Internet Explorer

Other answers suggest window.navigator.msSaveBlob; however, it is known to crash IE10/Window 7 and IE11/Windows 10. Whether it works using Microsoft Edge is dubious (see Microsoft Edge issue ticket #10396033).

Merely calling this in Microsoft's own Developer Tools / Console causes the browser to crash:

navigator.msSaveBlob(new Blob(["hello"], {type: "text/plain"}), "test.txt");

?Four years after my first answer, new IE versions include IE10, IE11, and Edge. They all crash on a function that Microsoft invented (slow clap).

Add navigator.msSaveBlob support at your own risk.

As of 2013

Typically this would be performed using a server-side solution, but this is my attempt at a client-side solution. Simply dumping HTML as a Data URI will not work, but is a helpful step. So:

1. Convert the table contents into a valid CSV formatted string. (This is the easy part.)
2. Force the browser to download it. The window.open approach would not work in Firefox, so I used <a href="{Data URI here}">.
3. Assign a default file name using the <a> tag's download attribute, which only works in Firefox and Google Chrome. Since it is just an attribute, it degrades gracefully.

Notes

• You can style your link to look like a button. I'll leave this effort to you
• IE has Data URI restrictions. See: Data URI scheme and Internet Explorer 9 Errors

• About the "download" attribute, see these:

  • Downloading resources in HTML5: a[download]
  • Bug 676619 - Implement proposed download attribute
  • How to detect support for the HTML5 “download” attribute

Compatibility

Browsers testing includes:

• Firefox 20+, Win/Mac (works)
• Google Chrome 26+, Win/Mac (works)
• Safari 6, Mac (works, but filename is ignored)
• IE 9+ (fails)

Content Encoding

The CSV is exported correctly, but when imported into Excel, the character ü is printed out as ä. Excel interprets the value incorrectly.

Introduce var csv = '\ufeff'; and then Excel 2013+ interprets the values correctly.

If you need compatibility with Excel 2007, add UTF-8 prefixes at each data value. See also:

• Is it possible to force Excel recognize UTF-8 CSV files automatically?
• Microsoft Excel mangles Diacritics in .csv files?
• Adding UTF-8 BOM to string/Blob

Problem solved!

Final .htaccess:

<IfModule mod_rewrite.c>
RewriteEngine On
RewriteBase /

RewriteCond %{ENV:HTTPS} !=on
RewriteRule ^.*$ https://%{SERVER_NAME}%{REQUEST_URI} [R,L]

# BEGIN WordPress
RewriteRule ^index\.php$ - [L]
RewriteCond %{REQUEST_FILENAME} !-f
RewriteCond %{REQUEST_FILENAME} !-d
RewriteRule . /index.php [L]
</IfModule>

Try this code:-

var input string
func main() {
      fmt.Print("Enter Your Name=")
      fmt.Scanf("%s",&input)
      fmt.Println("Hello "+input)
      }

It doesn't "fail"; it just stops reading. It sees a lexical token as a "string".

Use std::getline:

int main()
{
   std::string name, title;

   std::cout << "Enter your name: ";
   std::getline(std::cin, name);

   std::cout << "Enter your favourite movie: ";
   std::getline(std::cin, title);

   std::cout << name << "'s favourite movie is " << title;
}

Note that this is not the same as std::istream::getline, which works with C-style char buffers rather than std::strings.

Update

Your edited question bears little resemblance to the original.

You were trying to getline into an int, not a string or character buffer. The formatting operations of streams only work with operator<< and operator>>. Either use one of them (and tweak accordingly for multi-word input), or use getline and lexically convert to int after-the-fact.

IDisposable is good for unsubscribing from events.

I use this with good results:

border-style:hidden;

It also works for:

border-right-style:hidden; /*if you want to hide just a border on a cell*/

Example:

<style type="text/css">_x000D_
      table, th, td {_x000D_
       border: 2px solid green;_x000D_
      }_x000D_
      tr.hide_right > td, td.hide_right{_x000D_
        border-right-style:hidden;_x000D_
      }_x000D_
      tr.hide_all > td, td.hide_all{_x000D_
        border-style:hidden;_x000D_
      }_x000D_
  }_x000D_
</style>_x000D_
<table>_x000D_
  <tr>_x000D_
    <td class="hide_right">11</td>_x000D_
    <td>12</td>_x000D_
    <td class="hide_all">13</td>_x000D_
  </tr>_x000D_
  <tr class="hide_right">_x000D_
    <td>21</td>_x000D_
    <td>22</td>_x000D_
    <td>23</td>_x000D_
  </tr>_x000D_
  <tr class="hide_all">_x000D_
    <td>31</td>_x000D_
    <td>32</td>_x000D_
    <td>33</td>_x000D_
  </tr>_x000D_
</table>

Here is the result:

I had the same problem and wrote a class that seems to work for me. Basically, I used a static layout to draw the text in a separate canvas and remeasure until I find a font size that fits. You can see the class posted in the topic below. I hope it helps.

Auto Scale TextView Text to Fit within Bounds

You can also try using runuser (as root) to run a command as a different user

*/1 * * * * runuser php5 \
            --command="/var/www/web/includes/crontab/queue_process.php \
                       >> /var/www/web/includes/crontab/queue.log 2>&1"

See also: man runuser

Replace

rake assets:precompile RAILS_ENV=production

with

rake assets:precompile (RAILS_ENV=production bundle exec rake assets:precompile is the exact rake task)

Since precompilation is done in production mode only, no need to explicitly specify the environment.

Update:

Try adding the below line to your Gemfile:

group :assets do
  gem 'therubyracer'
  gem 'sass-rails', "  ~> 3.1.0"
  gem 'coffee-rails', "~> 3.1.0"
  gem 'uglifier'
end

Then run bundle install.

Hope it will work :)

Extending other answers:

I found @GEverding's answer most flexible. It also works with aggregation:

test_db.js

print("name,email");

db.users.aggregate([
    { $match: {} }
]).forEach(function(user) {
        print(user.name+","+user.email);
    }
});

Execute the following command to export results:

mongo test_db < ./test_db.js >> ./test_db.csv

Unfortunately, it adds additional text to the CSV file which requires processing the file before we can use it:

MongoDB shell version: 3.2.10 
connecting to: test_db

But we can make mongo shell stop spitting out those comments and only print what we have asked for by passing the --quiet flag

mongo --quiet test_db < ./test_db.js >> ./test_db.csv

If you use a "text variable" tk.StringVar(), you can just set() that.

No need to use the Entry delete and insert. Moreover, those functions don't work when the Entry is disabled or readonly! The text variable method, however, does work under those conditions as well.

import Tkinter as tk

...

entryText = tk.StringVar()
entry = tk.Entry( master, textvariable=entryText )
entryText.set( "Hello World" )

If you want to throw the latest four commits away, use:

git reset --hard HEAD^^^^

Alternatively, you can specify the hash of a commit you want to reset to:

git reset --hard 6e559cb

If you want a lower level API:

import http.client

conn = http.client.HTTPSConnection('example.com')
conn.request('GET', '/')

resp = conn.getresponse()
content = resp.read()

conn.close()

text = content.decode('utf-8')

print(text)

find:

^>([^\n\r]+)[\n\r]([A-Z\n\r]+)

\1 = some_varying_text

\2 = lines of all CAPS

Edit (proof that this works):

text = """> some_Varying_TEXT

DSJFKDAFJKDAFJDSAKFJADSFLKDLAFKDSAF
GATACAACATAGGATACA
GGGGGAAAAAAAATTTTTTTTT
CCCCAAAA

> some_Varying_TEXT2

DJASDFHKJFHKSDHF
HHASGDFTERYTERE
GAGAGAGAGAG
PPPPPAAAAAAAAAAAAAAAP
"""

import re

regex = re.compile(r'^>([^\n\r]+)[\n\r]([A-Z\n\r]+)', re.MULTILINE)
matches = [m.groups() for m in regex.finditer(text)]

for m in matches:
    print 'Name: %s\nSequence:%s' % (m[0], m[1])

in my case, datas is an objects of Array for more information please Click Here

<% for(let [index,data] of datas.entries() || []){  %>
 Index : <%=index%>
 Data : <%=data%>
<%} %>

Just press windows button and type %APPDATA% and type enter.

Above is the location where you can find \npm\node_modules folder. This is where global modules sit in your system.

You should use the ISO-8601 format for string representations of dates - anything else is dependent on the SQL Server language and dateformat settings.

The ISO-8601 format for a DATETIME when using only the date is: YYYYMMDD (no dashes or antyhing!)

For a DATETIME with the time portion, it's YYYY-MM-DDTHH:MM:SS (with dashes, and a T in the middle to separate date and time portions).

If you want to convert a string to a DATE for SQL Server 2008 or newer, you can use YYYY-MM-DD (with the dashes) to achieve the same result. And don't ask me why this is so inconsistent and confusing - it just is, and you'll have to work with that for now.

So in your case, you should try:

declare @a datetime
declare @b datetime 

set @a = '2012-04-06T12:23:45'   -- 6th of April, 2012
set @b = '2012-08-06T21:10:12'   -- 6th of August, 2012

exec LogProcedure 'AccountLog', N'test', @a, @b

Furthermore - your stored proc has problem, since you're concatenating together datetime and string into a string, but you're not converting the datetime to string first, and also, you're forgetting the close quotes in your statement after both dates.

So change this line here to this:

IF @DateFirst <> '' and @DateLast <> ''
   SET @FinalSQL  = @FinalSQL + '  OR CONVERT(Date, DateLog) >= ''' + 
                    CONVERT(VARCHAR(50), @DateFirst, 126) +   -- convert @DateFirst to string for concatenation!
                    ''' AND CONVERT(Date, DateLog) <=''' +  -- you need closing quotes after @DateFirst!
                    CONVERT(VARCHAR(50), @DateLast, 126) + ''''      -- convert @DateLast to string and also: closing tags after that missing!

With these settings, and once you've fixed your stored procedure which contains problems right now, it will work.

Hopefully someone else is saved by reading this.

We encountered an issue with webkit based browsers doing:

window.open("webpage.htm", "_self");

The browser would lockup and die if we had too many DOM nodes. When we switched our code to following the accepted answer of:

location.href = "webpage.html";

all was good. It took us awhile to figure out what was causing the issue, since it wasn't obvious what made our page periodically fail to load.

Short Answer:

I did it. I wrote a function for dynamic usage for all the little people out there...

Working example which displays on the page

Working example logging to the console

Long Answer:

...Still did it.

It took me awhile to do it, since a psuedo element is not really on the page. While some of the answers above work in SOME scenarios, they ALL fail to be both dynamic and work in a scenario in which an element is both unexpected in size and position(such as absolute positioned elements overlaying a portion of the parent element). Mine does not.

Usage:

//some element selector and a click event...plain js works here too
$("div").click(function() {
    //returns an object {before: true/false, after: true/false}
    psuedoClick(this);

    //returns true/false
    psuedoClick(this).before;

    //returns true/false
    psuedoClick(this).after;

});

How it works:

It grabs the height, width, top, and left positions(based on the position away from the edge of the window) of the parent element and grabs the height, width, top, and left positions(based on the edge of the parent container) and compares those values to determine where the psuedo element is on the screen.

It then compares where the mouse is. As long as the mouse is in the newly created variable range then it returns true.

Note:

It is wise to make the parent element RELATIVE positioned. If you have an absolute positioned psuedo element, this function will only work if it is positioned based on the parent's dimensions(so the parent has to be relative...maybe sticky or fixed would work too....I dont know).

Code:

function psuedoClick(parentElem) {

    var beforeClicked,
      afterClicked;

  var parentLeft = parseInt(parentElem.getBoundingClientRect().left, 10),
      parentTop = parseInt(parentElem.getBoundingClientRect().top, 10);

  var parentWidth = parseInt(window.getComputedStyle(parentElem).width, 10),
      parentHeight = parseInt(window.getComputedStyle(parentElem).height, 10);

  var before = window.getComputedStyle(parentElem, ':before');

  var beforeStart = parentLeft + (parseInt(before.getPropertyValue("left"), 10)),
      beforeEnd = beforeStart + parseInt(before.width, 10);

  var beforeYStart = parentTop + (parseInt(before.getPropertyValue("top"), 10)),
      beforeYEnd = beforeYStart + parseInt(before.height, 10);

  var after = window.getComputedStyle(parentElem, ':after');

  var afterStart = parentLeft + (parseInt(after.getPropertyValue("left"), 10)),
      afterEnd = afterStart + parseInt(after.width, 10);

  var afterYStart = parentTop + (parseInt(after.getPropertyValue("top"), 10)),
      afterYEnd = afterYStart + parseInt(after.height, 10);

  var mouseX = event.clientX,
      mouseY = event.clientY;

  beforeClicked = (mouseX >= beforeStart && mouseX <= beforeEnd && mouseY >= beforeYStart && mouseY <= beforeYEnd ? true : false);

  afterClicked = (mouseX >= afterStart && mouseX <= afterEnd && mouseY >= afterYStart && mouseY <= afterYEnd ? true : false);

  return {
    "before" : beforeClicked,
    "after"  : afterClicked

  };      

}

Support:

I dont know....it looks like ie is dumb and likes to return auto as a computed value sometimes. IT SEEMS TO WORK WELL IN ALL BROWSERS IF DIMENSIONS ARE SET IN CSS. So...set your height and width on your psuedo elements and only move them with top and left. I recommend using it on things that you are okay with it not working on. Like an animation or something. Chrome works...as usual.

Just another bit. in some case i found no result on all_tab_privs! i found it indeed on dba_tab_privs. I think so that this last table is better to check for any grant available on an object (in case of impact analysis). The statement becomes:

    select * from dba_tab_privs where table_name = 'sequence_name';

I used Fiddler as a proxy. Fiddler redirects localhost calls to a external server.

I configured Firefox to use manual proxy (127.0.0.1 port 8888). Fiddler capture the calls and redirect them to another server, by using URL filters.

Right(A1, Len(A1)-Find("(asterisk)",Substitute(A1, "(space)","(asterisk)",Len(A1)-Len(Substitute(A1,"(space)", "(no space)")))))

Try this. Hope it works.

Don't use scanf() to read strings without specifying a field width. You should also check the return values for errors:

#include <stdio.h>

#define NAME_MAX    80
#define NAME_MAX_S "80"

int main(void)
{
    static char name[NAME_MAX + 1]; // + 1 because of null
    if(scanf("%" NAME_MAX_S "[^\n]", name) != 1)
    {
        fputs("io error or premature end of line\n", stderr);
        return 1;
    }

    printf("Hello %s. Nice to meet you.\n", name);
}

Alternatively, use fgets():

#include <stdio.h>

#define NAME_MAX 80

int main(void)
{
    static char name[NAME_MAX + 2]; // + 2 because of newline and null
    if(!fgets(name, sizeof(name), stdin))
    {
        fputs("io error\n", stderr);
        return 1;
    }

    // don't print newline
    printf("Hello %.*s. Nice to meet you.\n", strlen(name) - 1, name);
}

It is a clever means of encoding negative integers in such a way that approximately half of the combination of bits of a data type are reserved for negative integers, and the addition of most of the negative integers with their corresponding positive integers results in a carry overflow that leaves the result to be binary zero.

So, in 2's complement if one is 0x0001 then -1 is 0x1111, because that will result in a combined sum of 0x0000 (with an overflow of 1).

A command-line process such cmd.exe or mysql.exe will usually read (and execute) whatever you (the user) type in (at the keyboard).

To mimic that, I think you want to use the RedirectStandardInput property: http://msdn.microsoft.com/en-us/library/system.diagnostics.processstartinfo.redirectstandardinput.aspx

some comments says that it works and some say it doesn't It works only for your form background not any other controls behind

Here is a simple shell script with no dependencies that will convert one or more SVN repositories to git and push them to GitHub.

https://gist.github.com/NathanSweet/7327535

In about 30 lines of script it: clones using git SVN, creates a .gitignore file from SVN::ignore properties, pushes into a bare git repository, renames SVN trunk to master, converts SVN tags to git tags, and pushes it to GitHub while preserving the tags.

I went thru a lot of pain to move a dozen SVN repositories from Google Code to GitHub. It didn't help that I used Windows. Ruby was all kinds of broken on my old Debian box and getting it working on Windows was a joke. Other solutions failed to work with Cygwin paths. Even once I got something working, I couldn't figure out how to get the tags to show up on GitHub (the secret is --follow-tags).

In the end I cobbled together two short and simple scripts, linked above, and it works great. The solution does not need to be any more complicated than that!

Yes, use the commercial but inexpensive SSMS Tools Pack addin which has a nifty "Generate Insert statements from resultsets, tables or database" feature

In Entity Framework 6.1+ you can use this attribute on your model:

[Index(IsUnique=true)]

You can find it in this namespace:

using System.ComponentModel.DataAnnotations.Schema;

If your model field is a string, make sure it is not set to nvarchar(MAX) in SQL Server or you will see this error with Entity Framework Code First:

Column 'x' in table 'dbo.y' is of a type that is invalid for use as a key column in an index.

The reason is because of this:

SQL Server retains the 900-byte limit for the maximum total size of all index key columns."

(from: http://msdn.microsoft.com/en-us/library/ms191241.aspx )

You can solve this by setting a maximum string length on your model:

[StringLength(450)]

Your model will look like this now in EF CF 6.1+:

public class User
{
   public int UserId{get;set;}
   [StringLength(450)]
   [Index(IsUnique=true)]
   public string UserName{get;set;}
}

Update:

if you use Fluent:

  public class UserMap : EntityTypeConfiguration<User>
  {
    public UserMap()
    {
      // ....
      Property(x => x.Name).IsRequired().HasMaxLength(450).HasColumnAnnotation("Index", new IndexAnnotation(new[] { new IndexAttribute("Index") { IsUnique = true } }));
    }
  }

and use in your modelBuilder:

protected override void OnModelCreating(DbModelBuilder modelBuilder)
{
  // ...
  modelBuilder.Configurations.Add(new UserMap());
  // ...
}

Update 2

for EntityFrameworkCore see also this topic: https://github.com/aspnet/EntityFrameworkCore/issues/1698

Update 3

for EF6.2 see: https://github.com/aspnet/EntityFramework6/issues/274

Update 4

ASP.NET Core Mvc 2.2 with EF Core:

[DatabaseGenerated(DatabaseGeneratedOption.Identity)]
public Guid Unique { get; set; }

Note: You may also want to run

git clean -fd

as

git reset --hard

will not remove untracked files, where as git-clean will remove any files from the tracked root directory that are not under git tracking. WARNING - BE CAREFUL WITH THIS! It is helpful to run a dry-run with git-clean first, to see what it will delete.

This is also especially useful when you get the error message

~"performing this command will cause an un-tracked file to be overwritten"

Which can occur when doing several things, one being updating a working copy when you and your friend have both added a new file of the same name, but he's committed it into source control first, and you don't care about deleting your untracked copy.

In this situation, doing a dry run will also help show you a list of files that would be overwritten.

Remove the : before last-child and the :after and used

 ul li:not(last-child){
 content:' |';
}

Hopefully,it should work

Perl was likely the first language to use it. Groovy is another language that supports it. Basically instead of returning 1 (true) or 0 (false) depending on whether the arguments are equal or unequal, the spaceship operator will return 1, 0, or -1 depending on the value of the left argument relative to the right argument.

a <=> b :=
  if a < b then return -1
  if a = b then return  0
  if a > b then return  1
  if a and b are not comparable then return nil

It's useful for sorting an array.

In PowerShell v5.1 this is slightly different compared to v5. According to MS documentation, it has to have a -Path parameter to specify the archive file path.

Expand-Archive -Path Draft.Zip -DestinationPath C:\Reference

Or else, this can be an actual path:

Expand-Archive -Path c:\Download\Draft.Zip -DestinationPath C:\Reference

Expand-Archive Doc

You shoud follow the Angular docs and use $sce - $sce is a service that provides Strict Contextual Escaping services to AngularJS. Here is a docs: http://docs-angularjs-org-dev.appspot.com/api/ng.directive:ngBindHtmlUnsafe

Let's take an example with asynchroniously loading Eventbrite login button

In your controller:

someAppControllers.controller('SomeCtrl', ['$scope', '$sce', 'eventbriteLogin', 
  function($scope, $sce, eventbriteLogin) {

    eventbriteLogin.fetchButton(function(data){
      $scope.buttonLogin = $sce.trustAsHtml(data);
    });
  }]);

In your view just add:

<span ng-bind-html="buttonLogin"></span>

In your services:

someAppServices.factory('eventbriteLogin', function($resource){
   return {
        fetchButton: function(callback){
            Eventbrite.prototype.widget.login({'app_key': 'YOUR_API_KEY'}, function(widget_html){
                callback(widget_html);
            })
      }
    }
});

I use the term program to include applications (apps), utilities and even operating systems like windows, linux and mac OS. We kinda need an overall term for all the different terms available. It might be wrong but works for me. :)

TL;DR

Consider i and n to be the left and right operands respectively of a shift operator; the type of i, after integer promotion, be T. Assuming n to be in [0, sizeof(i) * CHAR_BIT) — undefined otherwise — we've these cases:

| Direction  |   Type   | Value (i) | Result                   |
| ---------- | -------- | --------- | ------------------------ |
| Right (>>) | unsigned |    = 0    | -8 ? (i ÷ 2n)            |
| Right      | signed   |    = 0    | -8 ? (i ÷ 2n)            |
| Right      | signed   |    < 0    | Implementation-defined†  |
| Left  (<<) | unsigned |    = 0    | (i * 2n) % (T_MAX + 1)   |
| Left       | signed   |    = 0    | (i * 2n) ‡               |
| Left       | signed   |    < 0    | Undefined                |

^{† most compilers implement this as arithmetic shift
‡ undefined if value overflows the result type T; promoted type of i}

Shifting

First is the difference between logical and arithmetic shifts from a mathematical viewpoint, without worrying about data type size. Logical shifts always fills discarded bits with zeros while arithmetic shift fills it with zeros only for left shift, but for right shift it copies the MSB thereby preserving the sign of the operand (assuming a two's complement encoding for negative values).

In other words, logical shift looks at the shifted operand as just a stream of bits and move them, without bothering about the sign of the resulting value. Arithmetic shift looks at it as a (signed) number and preserves the sign as shifts are made.

A left arithmetic shift of a number X by n is equivalent to multiplying X by 2ⁿ and is thus equivalent to logical left shift; a logical shift would also give the same result since MSB anyway falls off the end and there's nothing to preserve.

A right arithmetic shift of a number X by n is equivalent to integer division of X by 2ⁿ ONLY if X is non-negative! Integer division is nothing but mathematical division and round towards 0 (trunc).

For negative numbers, represented by two's complement encoding, shifting right by n bits has the effect of mathematically dividing it by 2ⁿ and rounding towards -8 (floor); thus right shifting is different for non-negative and negative values.

for X = 0, X >> n = X / 2ⁿ = trunc(X ÷ 2ⁿ)

for X < 0, X >> n = floor(X ÷ 2ⁿ)

where ÷ is mathematical division, / is integer division. Let's look at an example:

37)₁₀ = 100101)₂

37 ÷ 2 = 18.5

37 / 2 = 18 (rounding 18.5 towards 0) = 10010)₂ [result of arithmetic right shift]

-37)₁₀ = 11011011)₂ (considering a two's complement, 8-bit representation)

-37 ÷ 2 = -18.5

-37 / 2 = -18 (rounding 18.5 towards 0) = 11101110)₂ [NOT the result of arithmetic right shift]

-37 >> 1 = -19 (rounding 18.5 towards -8) = 11101101)₂ [result of arithmetic right shift]

As Guy Steele pointed out, this discrepancy has led to bugs in more than one compiler. Here non-negative (math) can be mapped to unsigned and signed non-negative values (C); both are treated the same and right-shifting them is done by integer division.

So logical and arithmetic are equivalent in left-shifting and for non-negative values in right shifting; it's in right shifting of negative values that they differ.

Operand and Result Types

Standard C99 §6.5.7:

Each of the operands shall have integer types.

The integer promotions are performed on each of the operands. The type of the result is that of the promoted left operand. If the value of the right operand is negative or is greater than or equal to the width of the promoted left operand, the behaviour is undefined.

short E1 = 1, E2 = 3;
int R = E1 << E2;

In the above snippet, both operands become int (due to integer promotion); if E2 was negative or E2 = sizeof(int) * CHAR_BIT then the operation is undefined. This is because shifting more than the available bits is surely going to overflow. Had R been declared as short, the int result of the shift operation would be implicitly converted to short; a narrowing conversion, which may lead to implementation-defined behaviour if the value is not representable in the destination type.

Left Shift

The result of E1 << E2 is E1 left-shifted E2 bit positions; vacated bits are filled with zeros. If E1 has an unsigned type, the value of the result is E1×2^E2, reduced modulo one more than the maximum value representable in the result type. If E1 has a signed type and non-negative value, and E1×2^E2 is representable in the result type, then that is the resulting value; otherwise, the behaviour is undefined.

As left shifts are the same for both, the vacated bits are simply filled with zeros. It then states that for both unsigned and signed types it's an arithmetic shift. I'm interpreting it as arithmetic shift since logical shifts don't bother about the value represented by the bits, it just looks at it as a stream of bits; but the standard talks not in terms of bits, but by defining it in terms of the value obtained by the product of E1 with 2^E2.

The caveat here is that for signed types the value should be non-negative and the resulting value should be representable in the result type. Otherwise the operation is undefined. The result type would be the type of the E1 after applying integral promotion and not the destination (the variable which is going to hold the result) type. The resulting value is implicitly converted to the destination type; if it is not representable in that type, then the conversion is implementation-defined (C99 §6.3.1.3/3).

If E1 is a signed type with a negative value then the behaviour of left shifting is undefined. This is an easy route to undefined behaviour which may easily get overlooked.

Right Shift

The result of E1 >> E2 is E1 right-shifted E2 bit positions. If E1 has an unsigned type or if E1 has a signed type and a non-negative value, the value of the result is the integral part of the quotient of E1/2^E2. If E1 has a signed type and a negative value, the resulting value is implementation-defined.

Right shift for unsigned and signed non-negative values are pretty straight forward; the vacant bits are filled with zeros. For signed negative values the result of right shifting is implementation-defined. That said, most implementations like GCC and Visual C++ implement right-shifting as arithmetic shifting by preserving the sign bit.

Conclusion

Unlike Java, which has a special operator >>> for logical shifting apart from the usual >> and <<, C and C++ have only arithmetic shifting with some areas left undefined and implementation-defined. The reason I deem them as arithmetic is due to the standard wording the operation mathematically rather than treating the shifted operand as a stream of bits; this is perhaps the reason why it leaves those areas un/implementation-defined instead of just defining all cases as logical shifts.

The right way for Select2 3.x is:

$('select').select2("enable", false)

This works fine.

I think I use the simplest method to get the full profile picture. You can get full profile picture or you can set the profile picture dimension yourself:

$facebook->api(me?fields=picture.width(800).height(800))

You can set width and height as per your need. Though Facebook doesn't return the exact size asked for, It returns the closest dimension picture available with them.

I use this script on my windows machine ( insall all apks in current folder to all available devices )

Write-Host "Listing APKs..."

$List_Apks = New-Object System.Collections.ArrayList

Get-ChildItem -Path .\ -Filter *.apk -File -Name| ForEach-Object {
    $apk_filename = [System.IO.Path]::GetFileName($_)
    $List_Apks+=$apk_filename
    $apk_filename
}

Write-Host "Found apks "$List_Apks.Length
Write-Host ""

$raw_list = adb devices
$array_lines = $raw_list.Split("\n")

Write-Host "Listing devices "

$List_Device_Ids = New-Object System.Collections.ArrayList

1..($array_lines.Length-2) | foreach {
  $device_id = $array_lines[$_].Split([char]0x9)[0]
  $List_Device_Ids+=$device_id
  $device_id
}

Write-Host "Found devices "$List_Device_Ids.Length

0..($List_Device_Ids.Length-1) | foreach {
    $device_id = $List_Device_Ids[$_]

    0..($List_Apks.Length-1) | foreach {
        $apk_file_name = $List_Apks[$_]

        Write-Host "Installing " $apk_file_name "->" $device_id

        adb -s $device_id install -r $apk_file_name
    }
}


Write-Host "Endo"

Save this as install-apks.ps1

Then from the powershell :

powershell -executionpolicy bypass -File .\install-apks.ps1

1. Open up App Store

   

2. Look in the top right for the updates section (may also be in lefthand column "Updates"..)

   

3. Find Xcode & click Update

Collections.sort( new ArrayList( coll ) );

Well you can hide the close button by changing the FormBorderStyle from the properties section or programmatically in the constructor using:

public Form1()
{
InitializeComponent();
this.FormBorderStyle = FormBorderStyle.None;
}

then you create a menu strip item to exit the application.

cheers

I found that I have ticked "Run whether user is logged on or not" and it returns a silent failure.

When I changed tick "Run only when user is logged on" instead it works for me.

you can use the below code to bring focus to a div, in this example the page scrolls to the <div id="navigation">

$('html, body').animate({ scrollTop: $('#navigation').offset().top }, 'slow');

Best results you'll get with Shared Memory solution.

Named pipes are only 16% better than TCP sockets.

Results are get with IPC benchmarking:

• System: Linux (Linux ubuntu 4.4.0 x86_64 i7-6700K 4.00GHz)
• Message: 128 bytes
• Messages count: 1000000

Pipe benchmark:

Message size:       128
Message count:      1000000
Total duration:     27367.454 ms
Average duration:   27.319 us
Minimum duration:   5.888 us
Maximum duration:   15763.712 us
Standard deviation: 26.664 us
Message rate:       36539 msg/s

FIFOs (named pipes) benchmark:

Message size:       128
Message count:      1000000
Total duration:     38100.093 ms
Average duration:   38.025 us
Minimum duration:   6.656 us
Maximum duration:   27415.040 us
Standard deviation: 91.614 us
Message rate:       26246 msg/s

Message Queue benchmark:

Message size:       128
Message count:      1000000
Total duration:     14723.159 ms
Average duration:   14.675 us
Minimum duration:   3.840 us
Maximum duration:   17437.184 us
Standard deviation: 53.615 us
Message rate:       67920 msg/s

Shared Memory benchmark:

Message size:       128
Message count:      1000000
Total duration:     261.650 ms
Average duration:   0.238 us
Minimum duration:   0.000 us
Maximum duration:   10092.032 us
Standard deviation: 22.095 us
Message rate:       3821893 msg/s

TCP sockets benchmark:

Message size:       128
Message count:      1000000
Total duration:     44477.257 ms
Average duration:   44.391 us
Minimum duration:   11.520 us
Maximum duration:   15863.296 us
Standard deviation: 44.905 us
Message rate:       22483 msg/s

Unix domain sockets benchmark:

Message size:       128
Message count:      1000000
Total duration:     24579.846 ms
Average duration:   24.531 us
Minimum duration:   2.560 us
Maximum duration:   15932.928 us
Standard deviation: 37.854 us
Message rate:       40683 msg/s

ZeroMQ benchmark:

Message size:       128
Message count:      1000000
Total duration:     64872.327 ms
Average duration:   64.808 us
Minimum duration:   23.552 us
Maximum duration:   16443.392 us
Standard deviation: 133.483 us
Message rate:       15414 msg/s

This can also happen due to the bad unzipping process of SDK.It Happend to me. Dont use inbuilt windows unzip process. use WINRAR software for unzipping sdk

Depending on how big your arrays are you might consider an efficient algorithm O(n log n)

def equal_a(a1, a2)
  a1sorted = a1.sort
  a2sorted = a2.sort
  return false if a1.length != a2.length
  0.upto(a1.length - 1) do 
    |i| return false if a1sorted[i] != a2sorted[i]
  end
end

Sorting costs O(n log n) and checking each pair costs O(n) thus this algorithm is O(n log n). The other algorithms cannot be faster (asymptotically) using unsorted arrays.

Try SASS http://sass-lang.com/ or LESS http://lesscss.org/

I love SASS and use it for all my projects.

Do you like my 3-lines way using only String class's methods?

static String join(String glue, String[] array) {
    String line = "";
    for (String s : array) line += s + glue;
    return (array.length == 0) ? line : line.substring(0, line.length() - glue.length());
}

You can try:

textBox1.Enable = false;

The book HTML5 Guidelines for Web Developers: Structure and Semantics for Documents suggested this way (option 1):

<aside id="sidebar">
    <section id="widget_1"></section>
    <section id="widget_2"></section>
    <section id="widget_3"></section>
</aside>

It also points out that you can use sections in the footer. So section can be used outside of the actual page content.

A rephrasal

Another way to phrase the question is "What is the nearest commit that resides on a branch other than the current branch, and which branch is that?"

A solution

You can find it with a little bit of command line magic

git show-branch \
| sed "s/].*//" \
| grep "\*" \
| grep -v "$(git rev-parse --abbrev-ref HEAD)" \
| head -n1 \
| sed "s/^.*\[//" 

With awk:

git show-branch -a \
| grep '\*' \
| grep -v `git rev-parse --abbrev-ref HEAD` \
| head -n1 \
| sed 's/[^\[]*//' \
| awk 'match($0, /\[[a-zA-Z0-9\/-]+\]/) { print substr( $0, RSTART+1, RLENGTH-2 )}'

Here's how it works:

1. Display a textual history of all commits, including remote branches.
2. Ancestors of the current commit are indicated by a star. Filter out everything else.
3. Ignore all the commits in the current branch.
4. The first result will be the nearest ancestor branch. Ignore the other results.
5. Branch names are displayed [in brackets]. Ignore everything outside the brackets, and the brackets.
6. Sometimes the branch name will include a ~# or ^# to indicate how many commits are between the referenced commit and the branch tip. We don't care. Ignore them.

And the Result

Running the above code on

 A---B---D <-master
      \
       \
        C---E---I <-develop
             \
              \
               F---G---H <-topic

Will give you develop if you run it from H and master if you run it from I.

The code is available as a gist

The recommended way is to let str.format handle the casting (docs). Methods with %s substitution may be deprecated eventually (see PEP3101).

>>> answer = True
>>> myvar = "the answer is {}".format(answer)
>>> print(myvar)
the answer is True

In Python 3.6+ you may use literal string interpolation:

 >>> print(f"the answer is {answer}")
the answer is True

You can't, as there are no variables in Python but only names.

For example:

> a = [1,2,3]
> b = a
> a is b
True

Which of those two is now the correct variable? There's no difference between a and b.

There's been a similar question before.

Not sure why the accepted answer doesn't work in my environment, finally I run below command to get what I need

git log --pretty=format:"%h - %an, %ar : %s"|grep "STRING"

Since iOS 6, UIKit supports drawing attributed strings, so no extension or replacement is needed.

From UILabel:

@property(nonatomic, copy) NSAttributedString *attributedText;

You just need to build up your NSAttributedString. There are basically two ways:

1. Append chunks of text with the same attributes - for each part create one NSAttributedString instance and append them to one NSMutableAttributedString

2. Create attributed text from plain string and then add attributed for given ranges – find the range of your number (or whatever) and apply different color attribute on that.

Although not exactly answering the question as formulated, but if you need or can take the end result as string you can also use

string s = Char.ConvertFromUtf32(56);

which will give you surrogate UTF-16 pairs if needed, protecting you if you are out side of the BMP.

I think you don't have to use sub query in this scenario.You can directly left outer join the DEPRMNT table .

While using Left Outer Join ,don't use columns in the RHS table of the join in the where condition, you ll get wrong output

How about:

import pandas as pd
#List with all words
words=[]

#Code for adding words
words.append('test')


#When Input equals blank:
pd.Series(words).nunique()

It returns how many unique values are in a list

I got an error with the same error message - two years later. It's a different problem this time though, related to .NET Core dnx things.

I couldn't find an answer on Stack Overflow, but there's a GitHub issue that contains a workaround: https://github.com/aspnet/Home/issues/1455

Below is the most important part of the workaround:

• Delete the entire C:\Program Files (x86)\Microsoft Visual Studio 14.0\Common7\IDE\Extensions\Microsoft\Web Tools\DNX directory. (As far as I understand, it belongs to the old version of ASP.NET Core RC1, which for some reason is still shipped even with Visual Studio 2015 Update-3).
• Delete the C:\Users\<user>\AppData\Local\Microsoft\VisualStudio\14.0\devenv.exe.config file.
• Run the Developer Command Prompt for Visual Studio 2015 as Administrator, and execute the devenv /setup command. The new devenv.exe.config file is generated. This time there are many assemblies that refer to the C:\Program Files (x86)\Microsoft Visual Studio 14.0\Common7\IDE\Extensions\Microsoft\DotNet directory.
• Run the Visual Studio 2015 and check that it shows the Microsoft .NET Core Tools (Preview 2) 14.1.20624.0 in the Help => About Microsoft Visual Studio menu.

Thanks to olegburov's post on GitHub for figuring this out.

To change color of UINavigationBar title the correct way use this code:

[self.navigationController.navigationBar setTitleTextAttributes:[NSDictionary dictionaryWithObject:[UIColor whiteColor] forKey:UITextAttributeTextColor]];

UITextAttributeTextColor is deprecated in lastest ios 7 version. Use NSForegroundColorAttributeName instead.

You can pass --force-recreate to docker compose up, which should use fresh containers.

I think the reasoning behind reusing containers is to preserve any changes during development. Note that Compose does something similar with volumes, which will also persist between container recreation (a recreated container will attach to its predecessor's volumes). This can be helpful, for example, if you have a Redis container used as a cache and you don't want to lose the cache each time you make a small change. At other times it's just confusing.

I don't believe there is any way you can force this from the Compose file.

Arguably it does clash with immutable infrastructure principles. The counter-argument is probably that you don't use Compose in production (yet). Also, I'm not sure I agree that immutable infra is the basic idea of Docker, although it's certainly a good use case/selling point.

To expand on Peter's answer - you could make Search a first-class resource:

POST    /searches          # create a new search
GET     /searches          # list all searches (admin)
GET     /searches/{id}     # show the results of a previously-run search
DELETE  /searches/{id}     # delete a search (admin)

The Search resource would have fields for color, make model, garaged status, etc and could be specified in XML, JSON, or any other format. Like the Car and Garage resource, you could restrict access to Searches based on authentication. Users who frequently run the same Searches can store them in their profiles so that they don't need to be re-created. The URLs will be short enough that in many cases they can be easily traded via email. These stored Searches can be the basis of custom RSS feeds, and so on.

There are many possibilities for using Searches when you think of them as resources.

The idea is explained in more detail in this Railscast.

After Xcode 7, the bitcode option will be enabled by default. If your library was compiled without bitcode, but the bitcode option is enabled in your project settings, you can:

1. Update your library with bit code,
2. Say NO to Enable Bitcode in your target Build Settings

And the Library Build Settings to remove the warnings.

For more information, go to documentation of bitcode in developer library.

And WWDC 2015 Session 102: "Platforms State of the Union"

this will also work, if you like

 xcopy  C:\Test\Log "c:\Test\Backup-%date:~4,2%-%date:~7,2%-%date:~10,4%_%time:~0,2%%time:~3,2%" /s /i
 del C:\Test\Log

In the CSS all you have to do is put url(logical path to the image file)

set intersection and dict comprehension can be used here

# the dictionary
d = {1:2, 3:4, 5:6, 7:8}

# the subset of keys I'm interested in
l = (1,5)

>>>{key:d[key] for key in set(l) & set(d)}
{1: 2, 5: 6}

Needed to do a reverse on $.each so i used Vinay idea:

//jQuery.each(collection, callback) =>
$.each($(collection).get().reverse(), callback func() {});

worked nicely, thanks

You can simply use jQuery UI Dialog

Example:

$(function() {_x000D_
  $("#dialog").dialog();_x000D_
});

<script src="https://ajax.googleapis.com/ajax/libs/jquery/2.1.1/jquery.min.js"></script>_x000D_
<html lang="en">_x000D_
_x000D_
<head>_x000D_
  <meta charset="utf-8" />_x000D_
  <title>jQuery UI Dialog - Default functionality</title>_x000D_
  <link rel="stylesheet" href="http://code.jquery.com/ui/1.10.3/themes/smoothness/jquery-ui.css" />_x000D_
  <script src="http://code.jquery.com/ui/1.10.3/jquery-ui.js"></script>_x000D_
  <link rel="stylesheet" href="/resources/demos/style.css" />_x000D_
</head>_x000D_
_x000D_
<body>_x000D_
  <div id="dialog" title="Basic dialog">_x000D_
    <p>This is the default dialog which is useful for displaying information. The dialog window can be moved, resized and closed with the 'x' icon.</p>_x000D_
  </div>_x000D_
</body>_x000D_
</html>

Softwares run on the OS on a very simple premise - they require memory. The device OS provides it in the form of RAM. The amount of memory required may vary - some softwares need huge memory, some require paltry memory. Most (if not all) users run multiple applications on the OS simultaneously, and given that memory is expensive (and device size is finite), the amount of memory available is always limited. So given that all softwares require a certain amount of RAM, and all of them can be made to run at the same time, OS has to take care of two things:

1. That the software always runs until user aborts it, i.e. it should not auto-abort because OS has run out of memory.
2. The above activity, while maintaining a respectable performance for the softwares running.

Now the main question boils down to how the memory is being managed. What exactly governs where in the memory will the data belonging to a given software reside?

Possible solution 1: Let individual softwares specify explicitly the memory address they will use in the device. Suppose Photoshop declares that it will always use memory addresses ranging from 0 to 1023 (imagine the memory as a linear array of bytes, so first byte is at location 0, 1024th byte is at location 1023) - i.e. occupying 1 GB memory. Similarly, VLC declares that it will occupy memory range 1244 to 1876, etc.

Advantages:

1. Every application is pre-assigned a memory slot, so when it is installed and executed, it just stores its data in that memory area, and everything works fine.

Disadvantages:

1. This does not scale. Theoretically, an app may require a huge amount of memory when it is doing something really heavy-duty. So to ensure that it never runs out of memory, the memory area allocated to it must always be more than or equal to that amount of memory. What if a software, whose maximal theoretical memory usage is 2 GB (hence requiring 2 GB memory allocation from RAM), is installed in a machine with only 1 GB memory? Should the software just abort on startup, saying that the available RAM is less than 2 GB? Or should it continue, and the moment the memory required exceeds 2 GB, just abort and bail out with the message that not enough memory is available?

2. It is not possible to prevent memory mangling. There are millions of softwares out there, even if each of them was allotted just 1 kB memory, the total memory required would exceed 16 GB, which is more than most devices offer. How can, then, different softwares be allotted memory slots that do not encroach upon each other's areas? Firstly, there is no centralized software market which can regulate that when a new software is being released, it must assign itself this much memory from this yet unoccupied area, and secondly, even if there were, it is not possible to do it because the no. of softwares is practically infinite (thus requiring infinite memory to accommodate all of them), and the total RAM available on any device is not sufficient to accommodate even a fraction of what is required, thus making inevitable the encroaching of the memory bounds of one software upon that of another. So what happens when Photoshop is assigned memory locations 1 to 1023 and VLC is assigned 1000 to 1676? What if Photoshop stores some data at location 1008, then VLC overwrites that with its own data, and later Photoshop accesses it thinking that it is the same data is had stored there previously? As you can imagine, bad things will happen.

So clearly, as you can see, this idea is rather naive.

Possible solution 2: Let's try another scheme - where OS will do majority of the memory management. Softwares, whenever they require any memory, will just request the OS, and the OS will accommodate accordingly. Say OS ensures that whenever a new process is requesting for memory, it will allocate the memory from the lowest byte address possible (as said earlier, RAM can be imagined as a linear array of bytes, so for a 4 GB RAM, the addresses range for a byte from 0 to 2^32-1) if the process is starting, else if it is a running process requesting the memory, it will allocate from the last memory location where that process still resides. Since the softwares will be emitting addresses without considering what the actual memory address is going to be where that data is stored, OS will have to maintain a mapping, per software, of the address emitted by the software to the actual physical address (Note: that is one of the two reasons we call this concept Virtual Memory. Softwares are not caring about the real memory address where their data are getting stored, they just spit out addresses on the fly, and the OS finds the right place to fit it and find it later if required).

Say the device has just been turned on, OS has just launched, right now there is no other process running (ignoring the OS, which is also a process!), and you decide to launch VLC. So VLC is allocated a part of the RAM from the lowest byte addresses. Good. Now while the video is running, you need to start your browser to view some webpage. Then you need to launch Notepad to scribble some text. And then Eclipse to do some coding.. Pretty soon your memory of 4 GB is all used up, and the RAM looks like this:

Problem 1: Now you cannot start any other process, for all RAM is used up. Thus programs have to be written keeping the maximum memory available in mind (practically even less will be available, as other softwares will be running parallelly as well!). In other words, you cannot run a high-memory consuming app in your ramshackle 1 GB PC.

Okay, so now you decide that you no longer need to keep Eclipse and Chrome open, you close them to free up some memory. The space occupied in RAM by those processes is reclaimed by OS, and it looks like this now:

Suppose that closing these two frees up 700 MB space - (400 + 300) MB. Now you need to launch Opera, which will take up 450 MB space. Well, you do have more than 450 MB space available in total, but...it is not contiguous, it is divided into individual chunks, none of which is big enough to fit 450 MB. So you hit upon a brilliant idea, let's move all the processes below to as much above as possible, which will leave the 700 MB empty space in one chunk at the bottom. This is called compaction. Great, except that...all the processes which are there are running. Moving them will mean moving the address of all their contents (remember, OS maintains a mapping of the memory spat out by the software to the actual memory address. Imagine software had spat out an address of 45 with data 123, and OS had stored it in location 2012 and created an entry in the map, mapping 45 to 2012. If the software is now moved in memory, what used to be at location 2012 will no longer be at 2012, but in a new location, and OS has to update the map accordingly to map 45 to the new address, so that the software can get the expected data (123) when it queries for memory location 45. As far as the software is concerned, all it knows is that address 45 contains the data 123!)! Imagine a process that is referencing a local variable i. By the time it is accessed again, its address has changed, and it won't be able to find it any more. The same will hold for all functions, objects, variables, basically everything has an address, and moving a process will mean changing the address of all of them. Which leads us to:

Problem 2: You cannot move a process. The values of all variables, functions and objects within that process have hardcoded values as spat out by the compiler during compilation, the process depends on them being at the same location during its lifetime, and changing them is expensive. As a result, processes leave behind big "holes" when they exit. This is called External Fragmentation.

Fine. Suppose somehow, by some miraculous manner, you do manage to move the processes up. Now there is 700 MB of free space at the bottom:

Opera smoothly fits in at the bottom. Now your RAM looks like this:

Good. Everything is looking fine. However, there is not much space left, and now you need to launch Chrome again, a known memory-hog! It needs lots of memory to start, and you have hardly any left...Except.. you now notice that some of the processes, which were initially occupying large space, now is not needing much space. May be you have stopped your video in VLC, hence it is still occupying some space, but not as much as it required while running a high resolution video. Similarly for Notepad and Photos. Your RAM now looks like this:

Holes, once again! Back to square one! Except, previously, the holes occurred due to processes terminating, now it is due to processes requiring less space than before! And you again have the same problem, the holes combined yield more space than required, but they are scattered around, not much of use in isolation. So you have to move those processes again, an expensive operation, and a very frequent one at that, since processes will frequently reduce in size over their lifetime.

Problem 3: Processes, over their lifetime, may reduce in size, leaving behind unused space, which if needed to be used, will require the expensive operation of moving many processes. This is called Internal Fragmentation.

Fine, so now, your OS does the required thing, moves processes around and start Chrome and after some time, your RAM looks like this:

Cool. Now suppose you again resume watching Avatar in VLC. Its memory requirement will shoot up! But...there is no space left for it to grow, as Notepad is snuggled at its bottom. So, again, all processes has to move below until VLC has found sufficient space!

Problem 4: If processes needs to grow, it will be a very expensive operation

Fine. Now suppose, Photos is being used to load some photos from an external hard disk. Accessing hard-disk takes you from the realm of caches and RAM to that of disk, which is slower by orders of magnitudes. Painfully, irrevocably, transcendentally slower. It is an I/O operation, which means it is not CPU bound (it is rather the exact opposite), which means it does not need to occupy RAM right now. However, it still occupies RAM stubbornly. If you want to launch Firefox in the meantime, you can't, because there is not much memory available, whereas if Photos was taken out of memory for the duration of its I/O bound activity, it would have freed lot of memory, followed by (expensive) compaction, followed by Firefox fitting in.

Problem 5: I/O bound jobs keep on occupying RAM, leading to under-utilization of RAM, which could have been used by CPU bound jobs in the meantime.

So, as we can see, we have so many problems even with the approach of virtual memory.

There are two approaches to tackle these problems - paging and segmentation. Let us discuss paging. In this approach, the virtual address space of a process is mapped to the physical memory in chunks - called pages. A typical page size is 4 kB. The mapping is maintained by something called a page table, given a virtual address, all now we have to do is find out which page the address belong to, then from the page table, find the corresponding location for that page in actual physical memory (known as frame), and given that the offset of the virtual address within the page is same for the page as well as the frame, find out the actual address by adding that offset to the address returned by the page table. For example:

On the left is the virtual address space of a process. Say the virtual address space requires 40 units of memory. If the physical address space (on the right) had 40 units of memory as well, it would have been possible to map all location from the left to a location on the right, and we would have been so happy. But as ill luck would have it, not only does the physical memory have less (24 here) memory units available, it has to be shared between multiple processes as well! Fine, let's see how we make do with it.

When the process starts, say a memory access request for location 35 is made. Here the page size is 8 (each page contains 8 locations, the entire virtual address space of 40 locations thus contains 5 pages). So this location belongs to page no. 4 (35/8). Within this page, this location has an offset of 3 (35%8). So this location can be specified by the tuple (pageIndex, offset) = (4,3). This is just the starting, so no part of the process is stored in the actual physical memory yet. So the page table, which maintains a mapping of the pages on the left to the actual pages on the right (where they are called frames) is currently empty. So OS relinquishes the CPU, lets a device driver access the disk and fetch the page no. 4 for this process (basically a memory chunk from the program on the disk whose addresses range from 32 to 39). When it arrives, OS allocates the page somewhere in the RAM, say first frame itself, and the page table for this process takes note that page 4 maps to frame 0 in the RAM. Now the data is finally there in the physical memory. OS again queries the page table for the tuple (4,3), and this time, page table says that page 4 is already mapped to frame 0 in the RAM. So OS simply goes to the 0th frame in RAM, accesses the data at offset 3 in that frame (Take a moment to understand this. The entire page, which was fetched from disk, is moved to frame. So whatever the offset of an individual memory location in a page was, it will be the same in the frame as well, since within the page/frame, the memory unit still resides at the same place relatively!), and returns the data! Because the data was not found in memory at first query itself, but rather had to be fetched from disk to be loaded into memory, it constitutes a miss.

Fine. Now suppose, a memory access for location 28 is made. It boils down to (3,4). Page table right now has only one entry, mapping page 4 to frame 0. So this is again a miss, the process relinquishes the CPU, device driver fetches the page from disk, process regains control of CPU again, and its page table is updated. Say now the page 3 is mapped to frame 1 in the RAM. So (3,4) becomes (1,4), and the data at that location in RAM is returned. Good. In this way, suppose the next memory access is for location 8, which translates to (1,0). Page 1 is not in memory yet, the same procedure is repeated, and the page is allocated at frame 2 in RAM. Now the RAM-process mapping looks like the picture above. At this point in time, the RAM, which had only 24 units of memory available, is filled up. Suppose the next memory access request for this process is from address 30. It maps to (3,6), and page table says that page 3 is in RAM, and it maps to frame 1. Yay! So the data is fetched from RAM location (1,6), and returned. This constitutes a hit, as data required can be obtained directly from RAM, thus being very fast. Similarly, the next few access requests, say for locations 11, 32, 26, 27 all are hits, i.e. data requested by the process is found directly in the RAM without needing to look elsewhere.

Now suppose a memory access request for location 3 comes. It translates to (0,3), and page table for this process, which currently has 3 entries, for pages 1, 3 and 4 says that this page is not in memory. Like previous cases, it is fetched from disk, however, unlike previous cases, RAM is filled up! So what to do now? Here lies the beauty of virtual memory, a frame from the RAM is evicted! (Various factors govern which frame is to be evicted. It may be LRU based, where the frame which was least recently accessed for a process is to be evicted. It may be first-come-first-evicted basis, where the frame which allocated longest time ago, is evicted, etc.) So some frame is evicted. Say frame 1 (just randomly choosing it). However, that frame is mapped to some page! (Currently, it is mapped by the page table to page 3 of our one and only one process). So that process has to be told this tragic news, that one frame, which unfortunate belongs to you, is to be evicted from RAM to make room for another pages. The process has to ensure that it updates its page table with this information, that is, removing the entry for that page-frame duo, so that the next time a request is made for that page, it right tells the process that this page is no longer in memory, and has to be fetched from disk. Good. So frame 1 is evicted, page 0 is brought in and placed there in the RAM, and the entry for page 3 is removed, and replaced by page 0 mapping to the same frame 1. So now our mapping looks like this (note the colour change in the second frame on the right side):

Saw what just happened? The process had to grow, it needed more space than the available RAM, but unlike our earlier scenario where every process in the RAM had to move to accommodate a growing process, here it happened by just one page replacement! This was made possible by the fact that the memory for a process no longer needs to be contiguous, it can reside at different places in chunks, OS maintains the information as to where they are, and when required, they are appropriately queried. Note: you might be thinking, huh, what if most of the times it is a miss, and the data has to be constantly loaded from disk into memory? Yes, theoretically, it is possible, but most compilers are designed in such a manner that follows locality of reference, i.e. if data from some memory location is used, the next data needed will be located somewhere very close, perhaps from the same page, the page which was just loaded into memory. As a result, the next miss will happen after quite some time, most of the upcoming memory requirements will be met by the page just brought in, or the pages already in memory which were recently used. The exact same principle allows us to evict the least recently used page as well, with the logic that what has not been used in a while, is not likely to be used in a while as well. However, it is not always so, and in exceptional cases, yes, performance may suffer. More about it later.

Solution to Problem 4: Processes can now grow easily, if space problem is faced, all it requires is to do a simple page replacement, without moving any other process.

Solution to Problem 1: A process can access unlimited memory. When more memory than available is needed, the disk is used as backup, the new data required is loaded into memory from the disk, and the least recently used data frame (or page) is moved to disk. This can go on infinitely, and since disk space is cheap and virtually unlimited, it gives an illusion of unlimited memory. Another reason for the name Virtual Memory, it gives you illusion of memory which is not really available!

Cool. Earlier we were facing a problem where even though a process reduces in size, the empty space is difficult to be reclaimed by other processes (because it would require costly compaction). Now it is easy, when a process becomes smaller in size, many of its pages are no longer used, so when other processes need more memory, a simple LRU based eviction automatically evicts those less-used pages from RAM, and replaces them with the new pages from the other processes (and of course updating the page tables of all those processes as well as the original process which now requires less space), all these without any costly compaction operation!

Solution to Problem 3: Whenever processes reduce in size, its frames in RAM will be less used, so a simple LRU based eviction can evict those pages out and replace them with pages required by new processes, thus avoiding Internal Fragmentation without need for compaction.

As for problem 2, take a moment to understand this, the scenario itself is completely removed! There is no need to move a process to accommodate a new process, because now the entire process never needs to fit at once, only certain pages of it need to fit ad hoc, that happens by evicting frames from RAM. Everything happens in units of pages, thus there is no concept of hole now, and hence no question of anything moving! May be 10 pages had to be moved because of this new requirement, there are thousands of pages which are left untouched. Whereas, earlier, all processes (every bit of them) had to be moved!

Solution to Problem 2: To accommodate a new process, data from only less recently used parts of other processes have to be evicted as required, and this happens in fixed size units called pages. Thus there is no possibility of hole or External Fragmentation with this system.

Now when the process needs to do some I/O operation, it can relinquish CPU easily! OS simply evicts all its pages from the RAM (perhaps store it in some cache) while new processes occupy the RAM in the meantime. When the I/O operation is done, OS simply restores those pages to the RAM (of course by replacing the pages from some other processes, may be from the ones which replaced the original process, or may be from some which themselves need to do I/O now, and hence can relinquish the memory!)

Solution to Problem 5: When a process is doing I/O operations, it can easily give up RAM usage, which can be utilized by other processes. This leads to proper utilization of RAM.

And of course, now no process is accessing the RAM directly. Each process is accessing a virtual memory location, which is mapped to a physical RAM address and maintained by the page-table of that process. The mapping is OS-backed, OS lets the process know which frame is empty so that a new page for a process can be fitted there. Since this memory allocation is overseen by the OS itself, it can easily ensure that no process encroaches upon the contents of another process by allocating only empty frames from RAM, or upon encroaching upon the contents of another process in the RAM, communicate to the process to update it page-table.

Solution to Original Problem: There is no possibility of a process accessing the contents of another process, since the entire allocation is managed by the OS itself, and every process runs in its own sandboxed virtual address space.

So paging (among other techniques), in conjunction with virtual memory, is what powers today's softwares running on OS-es! This frees the software developer from worrying about how much memory is available on the user's device, where to store the data, how to prevent other processes from corrupting their software's data, etc. However, it is of course, not full-proof. There are flaws:

1. Paging is, ultimately, giving user the illusion of infinite memory by using disk as secondary backup. Retrieving data from secondary storage to fit into memory (called page swap, and the event of not finding the desired page in RAM is called page fault) is expensive as it is an IO operation. This slows down the process. Several such page swaps happen in succession, and the process becomes painfully slow. Ever seen your software running fine and dandy, and suddenly it becomes so slow that it nearly hangs, or leaves you with no option that to restart it? Possibly too many page swaps were happening, making it slow (called thrashing).

So coming back to OP,

Why do we need the virtual memory for executing a process? - As the answer explains at length, to give softwares the illusion of the device/OS having infinite memory, so that any software, big or small, can be run, without worrying about memory allocation, or other processes corrupting its data, even when running in parallel. It is a concept, implemented in practice through various techniques, one of which, as described here, is Paging. It may also be Segmentation.

Where does this virtual memory stand when the process (program) from the external hard drive is brought to the main memory (physical memory) for the execution? - Virtual memory doesn't stand anywhere per se, it is an abstraction, always present, when the software/process/program is booted, a new page table is created for it, and it contains the mapping from the addresses spat out by that process to the actual physical address in RAM. Since the addresses spat out by the process are not real addresses, in one sense, they are, actually, what you can say, the virtual memory.

Who takes care of the virtual memory and what is the size of the virtual memory? - It is taken care of by, in tandem, the OS and the software. Imagine a function in your code (which eventually compiled and made into the executable that spawned the process) which contains a local variable - an int i. When the code executes, i gets a memory address within the stack of the function. That function is itself stored as an object somewhere else. These addresses are compiler generated (the compiler which compiled your code into the executable) - virtual addresses. When executed, i has to reside somewhere in actual physical address for duration of that function at least (unless it is a static variable!), so OS maps the compiler generated virtual address of i into an actual physical address, so that whenever, within that function, some code requires the value of i, that process can query the OS for that virtual address, and OS in turn can query the physical a

For your current structure, you could also try the following:

select cash.Country, cash.Value, cheque.Value, cash.Value + cheque.Value as [Total]
from Cash
join Cheque
on cash.Country = cheque.Country

I think I prefer a union between the two tables, and a group by on the country name as mentioned above.

But I would also recommend normalising your tables. Ideally you'd have a country table, with Id and Name, and a payments table with: CountryId (FK to countries), Total, Type (cash/cheque)

NOTE: pd.convert_objects has now been deprecated. You should use pd.Series.astype(float) or pd.to_numeric as described in other answers.

This is available in 0.11. Forces conversion (or set's to nan) This will work even when astype will fail; its also series by series so it won't convert say a complete string column

In [10]: df = DataFrame(dict(A = Series(['1.0','1']), B = Series(['1.0','foo'])))

In [11]: df
Out[11]: 
     A    B
0  1.0  1.0
1    1  foo

In [12]: df.dtypes
Out[12]: 
A    object
B    object
dtype: object

In [13]: df.convert_objects(convert_numeric=True)
Out[13]: 
   A   B
0  1   1
1  1 NaN

In [14]: df.convert_objects(convert_numeric=True).dtypes
Out[14]: 
A    float64
B    float64
dtype: object

My solution applies Array.prototype.some() and Array.prototype.includes() array helpers which do their job pretty efficient as well

ES6

const originalFruits = ["apple","banana","orange"];_x000D_
_x000D_
const fruits1 = ["apple","banana","pineapple"];_x000D_
_x000D_
const fruits2 = ["grape", "pineapple"];_x000D_
_x000D_
const commonFruits = (myFruitsArr, otherFruitsArr) => {_x000D_
  return myFruitsArr.some(fruit => otherFruitsArr.includes(fruit))_x000D_
}_x000D_
console.log(commonFruits(originalFruits, fruits1)) //returns true;_x000D_
console.log(commonFruits(originalFruits, fruits2)) //returns false;

I did the following to get my Mac to see the devices again:

• Run android update adb
• Run adb kill-server
• Run adb start-server

At this point, calling adb devices started returning devices again. Now run or debug your project to test it on your device.

To check git remote connection:

git remote -v

Now, set the local repository to remote git:

git remote set-url origin https://NewRepoLink.git

Now to make it upstream or push use following code:

git push --set-upstream origin master -f

By transforming your int array into an Integer one and then using public static <T> void Arrays.sort(T[] a, Comparator<? super T> c) (the first step is only needed as I fear autoboxing may bot work on arrays).

Refresh would probably also make for much more readable code, depending on context.

One of my friends is writing a graphics app using NVIDIA CUDA. Application fits in very nicely with OOP paradigm and the problem can be decomposed into modules neatly. However, to use CUDA you need to use C, which doesn't support inheritance. Therefore, you need to be clever.

a) You devise a clever system which will emulate inheritance to a certain extent. It can be done!

i) You can use a hook system, which expects every child C of parent P to have a certain override for function F. You can make children register their overrides, which will be stored and called when required.

ii) You can use struct memory alignment feature to cast children into parents.

This can be neat but it's not easy to come up with future-proof, reliable solution. You will spend lots of time designing the system and there is no guarantee that you won't run into problems half-way through the project. Implementing multiple inheritance is even harder, if not almost impossible.

b) You can use consistent naming policy and use divide and conquer approach to create a program. It won't have any inheritance but because your functions are small, easy-to-understand and consistently formatted you don't need it. The amount of code you need to write goes up, it's very hard to stay focused and not succumb to easy solutions (hacks). However, this ninja way of coding is the C way of coding. Staying in balance between low-level freedom and writing good code. Good way to achieve this is to write prototypes using a functional language. For example, Haskell is extremely good for prototyping algorithms.

I tend towards approach b. I wrote a possible solution using approach a, and I will be honest, it felt very unnatural using that code.

You can load HTML page partial, in your case is everything inside div#mytable.

setTimeout(function(){
   $( "#mytable" ).load( "your-current-page.html #mytable" );
}, 2000); //refresh every 2 seconds

more information read this http://api.jquery.com/load/

Update Code (if you don't want it auto-refresh)

<button id="refresh-btn">Refresh Table</button>

<script>
$(document).ready(function() {

   function RefreshTable() {
       $( "#mytable" ).load( "your-current-page.html #mytable" );
   }

   $("#refresh-btn").on("click", RefreshTable);

   // OR CAN THIS WAY
   //
   // $("#refresh-btn").on("click", function() {
   //    $( "#mytable" ).load( "your-current-page.html #mytable" );
   // });


});
</script>

See the scipy.interpolate documentation for some examples.

The following example demonstrates its use, for linear and cubic spline interpolation:

>>> from scipy.interpolate import interp1d

>>> x = np.linspace(0, 10, num=11, endpoint=True)
>>> y = np.cos(-x**2/9.0)
>>> f = interp1d(x, y)
>>> f2 = interp1d(x, y, kind='cubic')

>>> xnew = np.linspace(0, 10, num=41, endpoint=True)
>>> import matplotlib.pyplot as plt
>>> plt.plot(x, y, 'o', xnew, f(xnew), '-', xnew, f2(xnew), '--')
>>> plt.legend(['data', 'linear', 'cubic'], loc='best')
>>> plt.show()

I had the same problem - also make sure you add name="" in the input button. Well, that fix worked for me.

if($_SERVER['REQUEST_METHOD'] == 'POST' && !empty($_POST['add'])){
    echo "stuff is happening now";
}

<input type="submit" name="add" value="Submit">

You may have inadvertently used a private key for a public key.

I noticed creation of 'appcompat' library while creating new android project with ADT 22.6.2 version, even when the minSDK was set to 11 and targetSDK was set 19

This was happening because, in the new project template android is using some attributes that are from the support library. For instance if a new project was created with actionbar then in the menu's main.xml one could find app:showAsAction="never" which is from support library.

• If the app is targeted at android version 11 and above then one can change this attribute to android:showAsAction in menu's main.xml

• Also the default theme set could be "Theme.AppCompat.Light.DarkActionBar" as shown below (styles.xml)

  <style name="AppBaseTheme" parent="Theme.AppCompat.Light.DarkActionBar">
         <!-- API 14 theme customizations can go here. -->
     </style> 
  

  In this case the parent theme in style.xml has to be changed to "android:style/Theme.Holo.Light.DarkActionBar"

• In addition to this if reference to Fragment,Fragments Manager from support library was made in the code of MainActivity.java, these have to appropriately changed to Fragment, FragmentManager of the SDK.

window.onload = function() {
    var el = document.documentElement,
        rfs = el.requestFullScreen
        || el.webkitRequestFullScreen
        || el.mozRequestFullScreen;
    rfs.call(el);
};

Before using v-html, you have to make sure that the element which you escape is sanitized in case you allow user input, otherwise you expose your app to xss vulnerabilities.

More info here: https://vuejs.org/v2/guide/security.html

I highly encourage you that instead of using v-html to use this npm package

If you prefer a GUI, DB Browser for SQLite will do this with a few clicks.

1. "File" - "Open Database"
2. In the "Database Structure" tab, click on the table content (not table name), then "Edit" menu, "Modify table", and now you can change the data type of any column with a drop down menu. I changed a 'text' field to 'numeric' in order to retrieve data in a number range.

DB Browser for SQLite is open source and free. For Linux it is available from the repository.

ASPX:

<asp:TextBox ID="TextBox1" clientidmode="Static" runat="server" onkeypress="return EnterEvent(event)"></asp:TextBox>    
<asp:Button ID="Button1" runat="server" style="display:none" Text="Button" />

JS:

function EnterEvent(e) {
        if (e.keyCode == 13) {
            __doPostBack('<%=Button1.UniqueID%>', "");
        }
    }

CS:

protected void Button1_Click1(object sender, EventArgs e)
    {

    }

grep -e apple your_site_root/**/*.* -s -l | xargs sed -i "" "s|apple|orage|"

You can get rid of the first line. You don't need import java.lang.*;

Just change your 5th line to:

public static void main(String [] args) throws Exception

The new keyword allocates memory on the Java heap. The heap is the main pool of memory, accessible to the whole of the application. If there is not enough memory available to allocate for that object, the JVM attempts to reclaim some memory from the heap with a garbage collection. If it still cannot obtain enough memory, an OutOfMemoryError is thrown, and the JVM exits.

The heap is split into several different sections, called generations. As objects survive more garbage collections, they are promoted into different generations. The older generations are not garbage collected as often. Because these objects have already proven to be longer lived, they are less likely to be garbage collected.

When objects are first constructed, they are allocated in the Eden Space. If they survive a garbage collection, they are promoted to Survivor Space, and should they live long enough there, they are allocated to the Tenured Generation. This generation is garbage collected much less frequently.

There is also a fourth generation, called the Permanent Generation, or PermGen. The objects that reside here are not eligible to be garbage collected, and usually contain an immutable state necessary for the JVM to run, such as class definitions and the String constant pool. Note that the PermGen space is planned to be removed from Java 8, and will be replaced with a new space called Metaspace, which will be held in native memory. reference:http://www.programcreek.com/2013/04/jvm-run-time-data-areas/

You can try this will return true if network connected

function isInternetConnected(){return navigator.onLine;}

You shouldn't be using .findall() at all - .search() is what you want. It finds the leftmost match, which is what you want (or returns None if no match exists).

m = re.search(pattern, text)
result = m.group(0) if m else ""

Whether you want to put that in a function is up to you. It's unusual to want to return an empty string if no match is found, which is why nothing like that is built in. It's impossible to get confused about whether .search() on its own finds a match (it returns None if it didn't, or an SRE_Match object if it did).

Here is a solution that builds upon the accepted answer. It corrects for: column widths, matching table style, and when the table is scrolled in a container div.

Usage

Ensure your table has a <thead> tag because only thead content will be fixed.

$("#header-fixed").fixHeader();

JavaSript

//Custom JQuery Plugin
(function ($) {
    $.fn.fixHeader = function () {
        return this.each(function () {
            var $table = $(this);
            var $sp = $table.scrollParent();
            var tableOffset = $table.position().top;
            var $tableFixed = $("<table />")
                .prop('class', $table.prop('class'))
                .css({ position: "fixed", "table-layout": "fixed", display: "none", "margin-top": "0px" });
            $table.before($tableFixed);
            $tableFixed.append($table.find("thead").clone());

            $sp.bind("scroll", function () {
                var offset = $(this).scrollTop();

                if (offset > tableOffset && $tableFixed.is(":hidden")) {
                    $tableFixed.show();
                    var p = $table.position();
                    var offset = $sp.offset();

                    //Set the left and width to match the source table and the top to match the scroll parent
                    $tableFixed.css({ left: p.left + "px", top: (offset ? offset.top : 0) + "px", }).width($table.width());

                    //Set the width of each column to match the source table
                    $.each($table.find('th, td'), function (i, th) {
                        $($tableFixed.find('th, td')[i]).width($(th).width());
                    });

                }
                else if (offset <= tableOffset && !$tableFixed.is(":hidden")) {
                    $tableFixed.hide();
                }
            });
        });
    };
})(jQuery);

I have read or heard that Mac OS X is written mostly in Objective-C with some of the lower level parts, such as the kernel, and hardware device drivers written in C. I believe that Apple "eat(s) its own dog food", meaning that they write Mac OS X using their own Xcode Developer Tools. The GCC(GNU Compiler Collection) compiler-linker is the unix command line tool that xCode used for most of its compiling and/or linking of executables. Among other possible languages, I know GCC compiles source code from the C, Objective-C, C++ and Objective-C++ languages.

Just return any kind of list. ArrayList will be fine, its not static.

    ArrayList<yourClass> list = new ArrayList<yourClass>();
for (yourClass item : yourArray) 
{
   list.add(item); 
}

Update: Latest ActionBar (Title) pattern:

FYI, ActionBar was introduced in API Level 11. ActionBar is a window feature at the top of the Activity that may display the activity title, navigation modes, and other interactive items like search.

I exactly remember about customizing title bar and making it consistent through the application. So I can make a comparison with the earlier days and can list some of the advantages of using ActionBar:

1. It offers your users a familiar interface across applications that the system gracefully adapts for different screen configurations.
2. Developers don't need to write much code for displaying the Activity Title, icons and navigation modes because ActionBar is already ready with top level abstraction.

For example:

=> Normal way,

getActionBar().setTitle("Hello world App");   
getSupportActionBar().setTitle("Hello world App");  // provide compatibility to all the versions

=> Customizing Action Bar,

For example:

@Override
public void setActionBar(String heading) {
    // TODO Auto-generated method stub

    com.actionbarsherlock.app.ActionBar actionBar = getSupportActionBar();
    actionBar.setHomeButtonEnabled(true);
    actionBar.setDisplayHomeAsUpEnabled(false);
    actionBar.setDisplayShowHomeEnabled(false);
    actionBar.setBackgroundDrawable(new ColorDrawable(getResources().getColor(R.color.title_bar_gray)));
    actionBar.setTitle(heading);
    actionBar.show();

}

Styling the Action Bar:

The ActionBar provides you with basic and familiar looks, navigation modes and other quick actions to perform. But that doesn't mean it looks the same in every app. You can customize it as per your UI and design requirements. You just have to define and write styles and themes.

Read more at: Styling the Action Bar

And if you want to generate styles for ActionBar then this Style Generator tool can help you out.

=================================================================================

Old: Earlier days:

=> Normal way,

you can Change the Title of each screen (i.e. Activity) by setting their Android:label

   <activity android:name=".Hello_World"
                  android:label="This is the Hello World Application">
   </activity>

=> Custom - Title - bar

But if you want to Customize title-bar in your own way, i.e. Want to put Image icon and custom-text, then the following code works for me:

main.xml

<?xml version="1.0" encoding="utf-8"?>
<LinearLayout xmlns:android="http://schemas.android.com/apk/res/android"
    android:orientation="vertical"
    android:layout_width="fill_parent"
    android:layout_height="fill_parent"/>

titlebar.xml

<?xml version="1.0" encoding="utf-8"?>
<LinearLayout xmlns:android="http://schemas.android.com/apk/res/android"
 android:layout_width="400dp" 
  android:layout_height="fill_parent"
  android:orientation="horizontal">

<ImageView android:id="@+id/ImageView01" 
            android:layout_width="57dp" 
            android:layout_height="wrap_content"
            android:background="@drawable/icon1"/>

<TextView 

  android:id="@+id/myTitle" 
  android:text="This is my new title" 
  android:layout_width="fill_parent" 
  android:layout_height="fill_parent" 
  android:textColor="@color/titletextcolor"
   />
</LinearLayout>

TitleBar.java

public class TitleBar extends Activity {

    @Override
    public void onCreate(Bundle savedInstanceState) {
        super.onCreate(savedInstanceState);
        final boolean customTitleSupported = 
                requestWindowFeature(Window.FEATURE_CUSTOM_TITLE);
        setContentView(R.layout.main);
        if (customTitleSupported) {
            getWindow().setFeatureInt(Window.FEATURE_CUSTOM_TITLE,
                R.layout.titlebar);
        }
        final TextView myTitleText = (TextView) findViewById(R.id.myTitle);
        if (myTitleText != null) {
            myTitleText.setText("NEW TITLE");
            // user can also set color using "Color" and then
            // "Color value constant"
            // myTitleText.setBackgroundColor(Color.GREEN);
        }
    }
}

strings.xml

The strings.xml file is defined under the values folder.

<?xml version="1.0" encoding="utf-8"?>
<resources>
    <string name="hello">Hello World, Set_Text_TitleBar!</string>
    <string name="app_name">Set_Text_TitleBar</string>
    <color name="titlebackgroundcolor">#3232CD</color>
    <color name="titletextcolor">#FFFF00</color>
</resources>

On SourceTree (GUI for GitHub), you may right-click the commit and do a 'Reverse Commit'. This should undo your changes.

On the terminal:

You may alternatively use:

git revert

Or:

git reset --soft HEAD^ # Use --soft if you want to keep your changes.
git reset --hard HEAD^ # Use --hard if you don't care about keeping your changes.

I can't comment on @Ian Ippolito answer (because I would have if I had the rep) but according to the document his comment linked, I'm fairly certain you can find the Chrome version for IOS. https://developer.chrome.com/multidevice/user-agent?hl=ja lists the UA as: Mozilla/5.0 (iPhone; CPU iPhone OS 10_3 like Mac OS X) AppleWebKit/602.1.50 (KHTML, like Gecko) CriOS/56.0.2924.75 Mobile/14E5239e Safari/602.1

So this should work:

if ((verOffset = nAgt.indexOf('CriOS')) != -1) {
                //Chrome on iPad spoofing Safari...correct it.
                browser = 'Chrome';
                version = nAgt.substring(verOffset + 6);//should get the criOS ver.
            }

Haven't been able to test (otherwise I would have improved his answer) it to make sure since my iPad is at home and I'm at work, but I thought I'd put it out there.

See with the help of the following example if you can use literals and '$' sign in your case.

    function doHomework(subject) {
    
      alert(\`Starting my ${subject} homework.\`);
    
    }

doHomework('maths');

 color: transparent; 

make the tricks for me

#videos-part:before{
    font-size: 35px;
    line-height: 33px;
    width: 16px;
    color: transparent;
    content: 'AS YOU LIKE';
    background-image: url('data:image/svg+xml;base64,PD94bWwgdmVyc2lvbj0iMS4wIiA/PjwhRE9DVFlQRSBzdmcgIFBVQkxJQyAnLS8vVzNDLy9EVEQgU1ZHIDEuMS8vRU4nICAnaHR0cDovL3d3dy53My5vcmcvR3JhcGhpY3MvU1ZHLzEuMS9EVEQvc3ZnMTEuZHRkJz48c3ZnIGVuYWJsZS1iYWNrZ3JvdW5kPSJuZXcgMCAwIDUwIDUwIiBoZWlnaHQ9IjUwcHgiIGlkPSJMYXllcl8xIiB2ZXJzaW9uPSIxLjEiIHZpZXdCb3g9IjAgMCA1MCA1MCIgd2lkdGg9IjUwcHgiIHhtbDpzcGFjZT0icHJlc2VydmUiIHhtbG5zPSJodHRwOi8vd3d3LnczLm9yZy8yMDAwL3N2ZyIgeG1sbnM6eGxpbms9Imh0dHA6Ly93d3cudzMub3JnLzE5OTkveGxpbmsiPjxwYXRoIGQ9Ik04LDE0TDQsNDloNDJsLTQtMzVIOHoiIGZpbGw9Im5vbmUiIHN0cm9rZT0iIzAwMDAwMCIgc3Ryb2tlLWxpbmVjYXA9InJvdW5kIiBzdHJva2UtbWl0ZXJsaW1pdD0iMTAiIHN0cm9rZS13aWR0aD0iMiIvPjxyZWN0IGZpbGw9Im5vbmUiIGhlaWdodD0iNTAiIHdpZHRoPSI1MCIvPjxwYXRoIGQ9Ik0zNCwxOWMwLTEuMjQxLDAtNi43NTksMC04ICBjMC00Ljk3MS00LjAyOS05LTktOXMtOSw0LjAyOS05LDljMCwxLjI0MSwwLDYuNzU5LDAsOCIgZmlsbD0ibm9uZSIgc3Ryb2tlPSIjMDAwMDAwIiBzdHJva2UtbGluZWNhcD0icm91bmQiIHN0cm9rZS1taXRlcmxpbWl0PSIxMCIgc3Ryb2tlLXdpZHRoPSIyIi8+PGNpcmNsZSBjeD0iMzQiIGN5PSIxOSIgcj0iMiIvPjxjaXJjbGUgY3g9IjE2IiBjeT0iMTkiIHI9IjIiLz48L3N2Zz4=');
    background-size: 25px;
    background-repeat: no-repeat;
    }

I know the accepted answer is great but for anyone who is looking for a hover like feel you can use setTimeout on mouseover and save the handle in a map (of let's say list ids to setTimeout Handle). On mouseover clear the handle from setTimeout and delete it from the map

onMouseOver={() => this.onMouseOver(someId)}
onMouseOut={() => this.onMouseOut(someId)

And implement the map as follows:

onMouseOver(listId: string) {
  this.setState({
    ... // whatever
  });

  const handle = setTimeout(() => {
    scrollPreviewToComponentId(listId);
  }, 1000); // Replace 1000ms with any time you feel is good enough for your hover action
  this.hoverHandleMap[listId] = handle;
}

onMouseOut(listId: string) {
  this.setState({
    ... // whatever
  });

  const handle = this.hoverHandleMap[listId];
  clearTimeout(handle);
  delete this.hoverHandleMap[listId];
}

And the map is like so,

hoverHandleMap: { [listId: string]: NodeJS.Timeout } = {};

I prefer onMouseOver and onMouseOut because it also applies to all the children in the HTMLElement. If this is not required you may use onMouseEnter and onMouseLeave respectively.

Referring to the first thread / another possibility VS cant open or find pdb file of the process is when you have your executable running in the background. I was working with mpiexec and ran into this issue. Always check your task manager and kill any exec process that your gonna build in your project. Once I did that, it debugged or built fine.

Also, if you try to continue with the warning , the breakpoints would not be hit and it would not have the current executable

This XML file does not appear to have any style information associated with it. The document tree is shown below.

You will get this error in the client side when the client (the webbrowser) for some reason interprets the HTTP response content as text/xml instead of text/html and the parsed XML tree doesn't have any XML-stylesheet. In other words, the webbrowser incorrectly parsed the retrieved HTTP response content as XML instead of as HTML due to the wrong or missing HTTP response content type.

In case of JSF/Facelets files which have the default extension of .xhtml, that can in turn happen if the HTTP request hasn't invoked the FacesServlet and thus it wasn't able to parse the Facelets file and generate the desired HTML output based on the XHTML source code. Firefox is then merely guessing the HTTP response content type based on the .xhtml file extension which is in your Firefox configuration apparently by default interpreted as text/xml.

You need to make sure that the HTTP request URL, as you see in browser's address bar, matches the <url-pattern> of the FacesServlet as registered in webapp's web.xml, so that it will be invoked and be able to generate the desired HTML output based on the XHTML source code. If it's for example *.jsf, then you need to open the page by /some.jsf instead of /some.xhtml. Alternatively, you can also just change the <url-pattern> to *.xhtml. This way you never need to fiddle with virtual URLs.

See also:

• JSF Facelets: Sometimes I see the URL is .jsf and sometimes .xhtml. Why?

Note thus that you don't actually need a XML stylesheet. This all was just misinterpretation by the webbrowser while trying to do its best to make something presentable out of the retrieved HTTP response content. It should actually have retrieved the properly generated HTML output, Firefox surely knows precisely how to deal with HTML content.

Assignment, at its heart, is two steps: tearing down the object's old state and building its new state as a copy of some other object's state.

Basically, that's what the destructor and the copy constructor do, so the first idea would be to delegate the work to them. However, since destruction mustn't fail, while construction might, we actually want to do it the other way around: first perform the constructive part and, if that succeeded, then do the destructive part. The copy-and-swap idiom is a way to do just that: It first calls a class' copy constructor to create a temporary object, then swaps its data with the temporary's, and then lets the temporary's destructor destroy the old state.
Since swap() is supposed to never fail, the only part which might fail is the copy-construction. That is performed first, and if it fails, nothing will be changed in the targeted object.

In its refined form, copy-and-swap is implemented by having the copy performed by initializing the (non-reference) parameter of the assignment operator:

T& operator=(T tmp)
{
    this->swap(tmp);
    return *this;
}

The initiale code must have borderBottomLeftRadius: 0px

$('#user_button').toggle().css('borderBottomLeftRadius','+5px');

there are two ways of doing it either you can use XML or Java for it. If it's static and requires no changes then you can initialize in XML.

  android:drawableLeft="@drawable/cloud_up"
    android:drawablePadding="5sp"

Now if you need to change the icons dynamically then you can do it by calling the icons based on the events

       textViewContext.setText("File Uploaded");
textViewContext.setCompoundDrawablesWithIntrinsicBounds(R.drawable.uploaded, 0, 0, 0);

Mavroprovato's answer reports more than only the listening ports. Listening ports are sockets without a peer. The following Perl program reports only the listening ports. It works for me on SunOS 5.10.

#! /usr/bin/env perl
##
## Search the processes which are listening on the given port.
##
## For SunOS 5.10.
##

use strict;
use warnings;

die "Port missing" unless $#ARGV >= 0;
my $port = int($ARGV[0]);
die "Invalid port" unless $port > 0;

my @pids;
map { push @pids, $_ if $_ > 0; } map { int($_) } `ls /proc`;

foreach my $pid (@pids) {
    open (PF, "pfiles $pid 2>/dev/null |") 
        || warn "Can not read pfiles $pid";
    $_ = <PF>;
    my $fd;
    my $type;
    my $sockname;
    my $peername;
    my $report = sub {
        if (defined $fd) {
            if (defined $sockname && ! defined $peername) {
                print "$pid $type $sockname\n"; } } };
    while (<PF>) {
        if (/^\s*(\d+):.*$/) {
            &$report();
            $fd = int ($1);
            undef $type;
            undef $sockname;
            undef $peername; }
        elsif (/(SOCK_DGRAM|SOCK_STREAM)/) { $type = $1; }
        elsif (/sockname: AF_INET[6]? (.*)  port: $port/) {
            $sockname = $1; }
        elsif (/peername: AF_INET/) { $peername = 1; } }
    &$report();
    close (PF); }

It's often clearer to separate the two actions git pull does. The first thing it does is update the local tracking branc that corresponds to the remote branch. This can be done with git fetch. The second is that it then merges in changes, which can of course be done with git merge, though other options such as git rebase are occasionally useful.

try this

for example

DecimalFormat df = new DecimalFormat("#.##");
df.format(55.544545);

output:

55.54

JRE 7 is probably installed in Program Files\Java and NOT Program Files(x86)\Java.

Both System.Timers.Timer and System.Threading.Timer will work for services.

The timers you want to avoid are System.Web.UI.Timer and System.Windows.Forms.Timer, which are respectively for ASP applications and WinForms. Using those will cause the service to load an additional assembly which is not really needed for the type of application you are building.

Use System.Timers.Timer like the following example (also, make sure that you use a class level variable to prevent garbage collection, as stated in Tim Robinson's answer):

using System;
using System.Timers;

public class Timer1
{
    private static System.Timers.Timer aTimer;

    public static void Main()
    {
        // Normally, the timer is declared at the class level,
        // so that it stays in scope as long as it is needed.
        // If the timer is declared in a long-running method,  
        // KeepAlive must be used to prevent the JIT compiler 
        // from allowing aggressive garbage collection to occur 
        // before the method ends. (See end of method.)
        //System.Timers.Timer aTimer;

        // Create a timer with a ten second interval.
        aTimer = new System.Timers.Timer(10000);

        // Hook up the Elapsed event for the timer.
        aTimer.Elapsed += new ElapsedEventHandler(OnTimedEvent);

        // Set the Interval to 2 seconds (2000 milliseconds).
        aTimer.Interval = 2000;
        aTimer.Enabled = true;

        Console.WriteLine("Press the Enter key to exit the program.");
        Console.ReadLine();

        // If the timer is declared in a long-running method, use
        // KeepAlive to prevent garbage collection from occurring
        // before the method ends.
        //GC.KeepAlive(aTimer);
    }

    // Specify what you want to happen when the Elapsed event is 
    // raised.
    private static void OnTimedEvent(object source, ElapsedEventArgs e)
    {
        Console.WriteLine("The Elapsed event was raised at {0}", e.SignalTime);
    }
}

/* This code example produces output similar to the following:

Press the Enter key to exit the program.
The Elapsed event was raised at 5/20/2007 8:42:27 PM
The Elapsed event was raised at 5/20/2007 8:42:29 PM
The Elapsed event was raised at 5/20/2007 8:42:31 PM
...
 */

If you choose System.Threading.Timer, you can use as follows:

using System;
using System.Threading;

class TimerExample
{
    static void Main()
    {
        AutoResetEvent autoEvent     = new AutoResetEvent(false);
        StatusChecker  statusChecker = new StatusChecker(10);

        // Create the delegate that invokes methods for the timer.
        TimerCallback timerDelegate = 
            new TimerCallback(statusChecker.CheckStatus);

        // Create a timer that signals the delegate to invoke 
        // CheckStatus after one second, and every 1/4 second 
        // thereafter.
        Console.WriteLine("{0} Creating timer.\n", 
            DateTime.Now.ToString("h:mm:ss.fff"));
        Timer stateTimer = 
                new Timer(timerDelegate, autoEvent, 1000, 250);

        // When autoEvent signals, change the period to every 
        // 1/2 second.
        autoEvent.WaitOne(5000, false);
        stateTimer.Change(0, 500);
        Console.WriteLine("\nChanging period.\n");

        // When autoEvent signals the second time, dispose of 
        // the timer.
        autoEvent.WaitOne(5000, false);
        stateTimer.Dispose();
        Console.WriteLine("\nDestroying timer.");
    }
}

class StatusChecker
{
    int invokeCount, maxCount;

    public StatusChecker(int count)
    {
        invokeCount  = 0;
        maxCount = count;
    }

    // This method is called by the timer delegate.
    public void CheckStatus(Object stateInfo)
    {
        AutoResetEvent autoEvent = (AutoResetEvent)stateInfo;
        Console.WriteLine("{0} Checking status {1,2}.", 
            DateTime.Now.ToString("h:mm:ss.fff"), 
            (++invokeCount).ToString());

        if(invokeCount == maxCount)
        {
            // Reset the counter and signal Main.
            invokeCount  = 0;
            autoEvent.Set();
        }
    }
}

Both examples comes from the MSDN pages.

Majority of the solutions above have a high run time complexity.

Here is the solution that uses reduce and can do the job in O(n) time.

Array.prototype.unique = Array.prototype.unique || function() {_x000D_
        var arr = [];_x000D_
 this.reduce(function (hash, num) {_x000D_
  if(typeof hash[num] === 'undefined') {_x000D_
   hash[num] = 1; _x000D_
   arr.push(num);_x000D_
  }_x000D_
  return hash;_x000D_
 }, {});_x000D_
 return arr;_x000D_
}_x000D_
    _x000D_
var myArr = [3,1,2,3,3,3];_x000D_
console.log(myArr.unique()); //[3,1,2];

Note:

This solution is not dependent on reduce. The idea is to create an object map and push unique ones into the array.

If you want all the bars to get the same color (fill), you can easily add it inside geom_bar.

ggplot(data=df, aes(x=c1+c2/2, y=c3)) + 
geom_bar(stat="identity", width=c2, fill = "#FF6666")

Add fill = the_name_of_your_var inside aes to change the colors depending of the variable :

c4 = c("A", "B", "C")
df = cbind(df, c4)
ggplot(data=df, aes(x=c1+c2/2, y=c3, fill = c4)) + 
geom_bar(stat="identity", width=c2)

Use scale_fill_manual() if you want to manually the change of colors.

ggplot(data=df, aes(x=c1+c2/2, y=c3, fill = c4)) + 
geom_bar(stat="identity", width=c2) + 
scale_fill_manual("legend", values = c("A" = "black", "B" = "orange", "C" = "blue"))

Before getting a session id you need to start a session and that is done by using: session_start() function.

Now that you have started a session you can get a session id by using: session_id().

/* A small piece of code for setting, displaying and destroying session in PHP */

<?php
session_start();
$r=session_id();

/* SOME PIECE OF CODE TO AUTHENTICATE THE USER, MOSTLY SQL QUERY... */

/* now registering a session for an authenticated user */
$_SESSION['username']=$username;

/* now displaying the session id..... */
echo "the session id id: ".$r;
echo " and the session has been registered for: ".$_SESSION['username'];


/* now destroying the session id */

if(isset($_SESSION['username']))
{
    $_SESSION=array();
    unset($_SESSION);
    session_destroy();
    echo "session destroyed...";
}
?>

make sure your folder permissions are set so that a directory listing is allowed then just point your anchor to that folder using chmod 701 (that might be risky though) for example

<a href="./downloads/folder_i_want_to_display/" >Go to downloads page</a>

make sure that you have no index.html any index file on that directory

On Mac Lion :

I just had to go to /path/to/android-sdk/tools and run android adb update for the devices to be detected.

You can use bcp utility.

To copy the result set from a Transact-SQL statement to a data file, use the queryout option. The following example copies the result of a query into the Contacts.txt data file. The example assumes that you are using Windows Authentication and have a trusted connection to the server instance on which you are running the bcp command. At the Windows command prompt, enter:

bcp "<your query here>" queryout Contacts.txt -c -T

You can use BCP by directly calling as operating sytstem command in SQL Agent job.

You don't want git revert. That undoes a previous commit. You want git checkout to get git's version of the file from master.

git checkout -- filename.txt

In general, when you want to perform a git operation on a single file, use -- filename.

• git-checkout Documentation
• git-revert Documentation

2020 Update

Git introduced a new command git restore in version 2.23.0. Therefore, if you have git version 2.23.0+, you can simply git restore filename.txt - which does the same thing as git checkout -- filename.txt. The docs for this command do note that it is currently experimental.

• git-restore Documentation

Specify foreign key for the details tables which references to the primary key of master and set Delete rule = Cascade .

Now when u delete a record from the master table all other details table record based on the deleting rows primary key value, will be deleted automatically.

So in that case a single delete query of master table can delete master tables data as well as child tables data.

I Use this query:

select floor(RAND() * (SELECT MAX(key) FROM table)) from table limit 10

query time:0.016s

on Mac OS X (BSD find): Same as accepted answer, the .*/ prefix is needed to match a complete path:

$ find -E . -regex ".*/[a-f0-9\-]{36}.jpg"

man find says -E uses extended regex support

There's no need to mess with your PYTHONPATH or sys.path here.

To properly use absolute imports in a package you should include the "root" packagename as well, e.g.:

from dirFoo.dirFoo1.foo1 import Foo1
from dirFoo.dirFoo2.foo2 import Foo2

Or you can use relative imports:

from .dirfoo1.foo1 import Foo1
from .dirfoo2.foo2 import Foo2

There are errors here :

var formTag = document.getElementsByTagName("form"), // form tag is an array
selectListItem = $('select'),
makeSelect = document.createElement('select'),
makeSelect.setAttribute("id", "groups");

The code must change to:

var formTag = document.getElementsByTagName("form");
var selectListItem = $('select');
var makeSelect = document.createElement('select');
makeSelect.setAttribute("id", "groups");

By the way, there is another error at line 129 :

var createLi.appendChild(createSubList);

Replace it with:

createLi.appendChild(createSubList);

Maybe it's too late for answering but, there's a working code:

sqlplus -s "/ as sysdba" << EOF
    SET HEADING OFF
    SET FEEDBACK OFF
    SET LINESIZE 3800
    SET TRIMSPOOL ON
    SET TERMOUT OFF
    SET SPACE 0
    SET PAGESIZE 0
    select (select instance_name from v\$instance) as DB_NAME,
           file_name
      from dba_data_files
     order by 2;

I know this one is already too late. But we can fetch root URL by two methods

1st method

var path = require('path');
path.dirname(require.main.filename);

2nd method

var path = require('path');
path.dirname(process.mainModule.filename);

Reference Link:- https://gist.github.com/geekiam/e2e3e0325abd9023d3a3

echo "LOAD_SETTLED    LOAD_INIT       2011-01-13 03:50:01" | awk -v var="test" 'BEGIN { FS = "[ \t]+" } ; { print $1 "\t" var "\t" $3 }'

The third template parameter for priority_queue is the comparator. Set it to use greater.

e.g.

std::priority_queue<int, std::vector<int>, std::greater<int> > max_queue;

You'll need #include <functional> for std::greater.

CTRL + M + O will collapse all.

CTRL + M + L will expand all. (in VS 2013 - Toggle All outlining)

CTRL + M + P will expand all and disable outlining.

CTRL + M + M will collapse/expand the current section.

CTRL + M + A will collapse all even in Html files.

These controls are also in the context menu under Outlining.

Right click in editor -> Outlining to find these controls. (After disabling outlining, use same steps to enable outlining.)

For outlining options: Go to Tools -> Options -> Text Editor -> C# -> Advanced -> Outlining for outlining options.

string(byteslice) will convert byte slice to string, just know that it's not only simply type conversion, but also memory copy.

The /g modifier is used to perform a global match (find all matches rather than stopping after the first)

You can use \d for digit, as it is shorter than [0-9].

JavaScript:

var s = "04.07.2012"; 
echo(s.replace(/\d/g, "X"));

Output:

XX.XX.XXXX

You could design a simple nine-patch png image and use it as the background of spinner. Using GIMP you can put both border and right triangle in image.

At the present time, Intel graphics chips do not support CUDA. It is possible that, in the nearest future, these chips will support OpenCL (which is a standard that is very similar to CUDA), but this is not guaranteed and their current drivers do not support OpenCL either. (There is an Intel OpenCL SDK available, but, at the present time, it does not give you access to the GPU.)

Newest Intel processors (Sandy Bridge) have a GPU integrated into the CPU core. Your processor may be a previous-generation version, in which case "Intel(HD) graphics" is an independent chip.

Similar like before-mentioned solutions, but most compact:

db.row_factory = lambda C, R: { c[0]: R[i] for i, c in enumerate(C.description) }

i've read the answers and i have done this:

cd repos
mv .git repos.git
cd repos.git
git config --bool core.bare true # from another answer
cd ../
mv repos.git ../
cd ../
rm -rf repos/ # or delete using a file manager if you like

this will leave the contents of repos/.git as the bare repos.git

The dplyr select function selects specific columns from a data frame. To return unique values in a particular column of data, you can use the group_by function. For example:

library(dplyr)

# Fake data
set.seed(5)
dat = data.frame(x=sample(1:10,100, replace=TRUE))

# Return the distinct values of x
dat %>%
  group_by(x) %>%
  summarise() 

    x
1   1
2   2
3   3
4   4
5   5
6   6
7   7
8   8
9   9
10 10

If you want to change the column name you can add the following:

dat %>%
  group_by(x) %>%
  summarise() %>%
  select(unique.x=x)

This both selects column x from among all the columns in the data frame that dplyr returns (and of course there's only one column in this case) and changes its name to unique.x.

You can also get the unique values directly in base R with unique(dat$x).

If you have multiple variables and want all unique combinations that appear in the data, you can generalize the above code as follows:

set.seed(5)
dat = data.frame(x=sample(1:10,100, replace=TRUE), 
                 y=sample(letters[1:5], 100, replace=TRUE))

dat %>% 
  group_by(x,y) %>%
  summarise() %>%
  select(unique.x=x, unique.y=y)

Bootstrap Modal Events:

1. hide.bs.modal => Occurs when the modal is about to be hidden.
2. hidden.bs.modal => Occurs when the modal is fully hidden (after CSS transitions have completed).

<script type="text/javascript">
    $("#salesitems_modal").on('hide.bs.modal', function () {
        //actions you want to perform after modal is closed.
    });
</script>

I hope this will Help.

Only ASCII or are other characters allowed too?

^\w*$

restricts (in Java) to ASCII letters/digits und underscore,

^[\pL\pN\p{Pc}]*$

also allows international characters/digits and "connecting punctuation".

if you are looking for a boolean, the quickest way would be

var values = [_x000D_
    { name: 'someName1' },_x000D_
    { name: 'someName2' },_x000D_
    { name: 'someName1' },_x000D_
    { name: 'someName1' }_x000D_
]_x000D_
_x000D_
// solution_x000D_
var hasDuplicate = false;_x000D_
values.map(v => v.name).sort().sort((a, b) => {_x000D_
  if (a === b) hasDuplicate = true_x000D_
})_x000D_
console.log('hasDuplicate', hasDuplicate)

I hope this will meet your requirement

import PyPDF4
import io

pdfFile = open(r'test.pdf', 'rb')
pdfReader = PyPDF4.PdfFileReader(pdfFile)
pageObj = pdfReader.getPage(1)
pagetext = pageObj.extractText()

for line in io.StringIO(pagetext):
    print(line)

If its working when you are using a browser and then passing on your username and password for the first time - then this means that once authentication is done Request header of your browser is set with required authentication values, which is then passed on each time a request is made to hosting server.

So start with inspecting Request Header (this could be done using Web Developers tools), Once you established whats required in header then you could pass this within your HttpWebRequest Header.

Example with Digest Authentication:

using System;
using System.Collections.Generic;
using System.Linq;
using System.Text;
using System.Security.Cryptography;
using System.Text.RegularExpressions;
using System.Net;
using System.IO;

namespace NUI
{
    public class DigestAuthFixer
    {
        private static string _host;
        private static string _user;
        private static string _password;
        private static string _realm;
        private static string _nonce;
        private static string _qop;
        private static string _cnonce;
        private static DateTime _cnonceDate;
        private static int _nc;

public DigestAuthFixer(string host, string user, string password)
{
    // TODO: Complete member initialization
    _host = host;
    _user = user;
    _password = password;
}

private string CalculateMd5Hash(
    string input)
{
    var inputBytes = Encoding.ASCII.GetBytes(input);
    var hash = MD5.Create().ComputeHash(inputBytes);
    var sb = new StringBuilder();
    foreach (var b in hash)
        sb.Append(b.ToString("x2"));
    return sb.ToString();
}

private string GrabHeaderVar(
    string varName,
    string header)
{
    var regHeader = new Regex(string.Format(@"{0}=""([^""]*)""", varName));
    var matchHeader = regHeader.Match(header);
    if (matchHeader.Success)
        return matchHeader.Groups[1].Value;
    throw new ApplicationException(string.Format("Header {0} not found", varName));
}

private string GetDigestHeader(
    string dir)
{
    _nc = _nc + 1;

    var ha1 = CalculateMd5Hash(string.Format("{0}:{1}:{2}", _user, _realm, _password));
    var ha2 = CalculateMd5Hash(string.Format("{0}:{1}", "GET", dir));
    var digestResponse =
        CalculateMd5Hash(string.Format("{0}:{1}:{2:00000000}:{3}:{4}:{5}", ha1, _nonce, _nc, _cnonce, _qop, ha2));

    return string.Format("Digest username=\"{0}\", realm=\"{1}\", nonce=\"{2}\", uri=\"{3}\", " +
        "algorithm=MD5, response=\"{4}\", qop={5}, nc={6:00000000}, cnonce=\"{7}\"",
        _user, _realm, _nonce, dir, digestResponse, _qop, _nc, _cnonce);
}

public string GrabResponse(
    string dir)
{
    var url = _host + dir;
    var uri = new Uri(url);

    var request = (HttpWebRequest)WebRequest.Create(uri);

    // If we've got a recent Auth header, re-use it!
    if (!string.IsNullOrEmpty(_cnonce) &&
        DateTime.Now.Subtract(_cnonceDate).TotalHours < 1.0)
    {
        request.Headers.Add("Authorization", GetDigestHeader(dir));
    }

    HttpWebResponse response;
    try
    {
        response = (HttpWebResponse)request.GetResponse();
    }
    catch (WebException ex)
    {
        // Try to fix a 401 exception by adding a Authorization header
        if (ex.Response == null || ((HttpWebResponse)ex.Response).StatusCode != HttpStatusCode.Unauthorized)
            throw;

        var wwwAuthenticateHeader = ex.Response.Headers["WWW-Authenticate"];
        _realm = GrabHeaderVar("realm", wwwAuthenticateHeader);
        _nonce = GrabHeaderVar("nonce", wwwAuthenticateHeader);
        _qop = GrabHeaderVar("qop", wwwAuthenticateHeader);

        _nc = 0;
        _cnonce = new Random().Next(123400, 9999999).ToString();
        _cnonceDate = DateTime.Now;

        var request2 = (HttpWebRequest)WebRequest.Create(uri);
        request2.Headers.Add("Authorization", GetDigestHeader(dir));
        response = (HttpWebResponse)request2.GetResponse();
    }
    var reader = new StreamReader(response.GetResponseStream());
    return reader.ReadToEnd();
}

}

Then you could call it:

DigestAuthFixer digest = new DigestAuthFixer(domain, username, password);
string strReturn = digest.GrabResponse(dir);

if Url is: http://xyz.rss.com/folder/rss then domain: http://xyz.rss.com (domain part) dir: /folder/rss (rest of the url)

you could also return it as stream and use XmlDocument Load() method.

I recently needed to launch a Bootstrap 5 modal without jQuery and not with a button click (eg, on page load) using Django messages. This is how I did it:

Template/HTML

<div class="modal" id="notification">
  <div class="modal-dialog modal-dialog-centered">
    <div class="modal-content">
      <div class="modal-header">
        <h5 class="modal-title">Notification!</h5>
        <button type="button" class="btn-close"
                data-bs-dismiss="modal" aria-label="Close"></button>
      </div>
      <div class="modal-body">
        {% for m in messages %}
          {{ m }}
        {% endfor %}
      </div>
      <div class="modal-footer justify-content-between">
        <a class="float-none btn btn-secondary" href="{% url 'some_view' %}"
           type="button">
          Link/Button A
        </a>
        <button type="button" class="btn btn-primary"
                data-bs-dismiss="modal">
          Link/Button B
        </button>
      </div>
    </div>
  </div>
</div>

JS in a file or in the template

{% block javascript %}
  {{ block.super }}
  <script>
    var test_modal = new bootstrap.Modal(
      document.getElementById('notification')
    )
    test_modal.show()
  </script>
{% endblock javascript %}

This method will work without the Django template; just use the HTML and put the JS in a file or script elements that loads after the Bootstrap JS before the end of the body element.

Currently, I am using Ubuntu 16.04 LTS. Me too was facing same problem while Fetching the Postgress Database values using Php so i resolved it by using the below commands.

Mine PHP version is 7.0, so i tried the below command.

apt-get install php-pgsql

Remember to restart Apache.

/etc/init.d/apache2 restart

class Foo(object):    
    bar = 1

    def bah(object_reference):
        object_reference.var = Foo.bar
        return object_reference.var


f = Foo() 
print 'var=', f.bah()

This blog post helped me efficiently detect size changes to DOM elements.

http://www.backalleycoder.com/2013/03/18/cross-browser-event-based-element-resize-detection/

How to use this code...

AppConfig.addResizeListener(document.getElementById('id'), function () {
  //Your code to execute on resize.
});

Packaged code used by the example...

var AppConfig = AppConfig || {};
AppConfig.ResizeListener = (function () {
    var attachEvent = document.attachEvent;
    var isIE = navigator.userAgent.match(/Trident/);
    var requestFrame = (function () {
        var raf = window.requestAnimationFrame || window.mozRequestAnimationFrame || window.webkitRequestAnimationFrame ||
            function (fn) { return window.setTimeout(fn, 20); };
        return function (fn) { return raf(fn); };
    })();

    var cancelFrame = (function () {
        var cancel = window.cancelAnimationFrame || window.mozCancelAnimationFrame || window.webkitCancelAnimationFrame ||
               window.clearTimeout;
        return function (id) { return cancel(id); };
    })();

    function resizeListener(e) {
        var win = e.target || e.srcElement;
        if (win.__resizeRAF__) cancelFrame(win.__resizeRAF__);
        win.__resizeRAF__ = requestFrame(function () {
            var trigger = win.__resizeTrigger__;
            trigger.__resizeListeners__.forEach(function (fn) {
                fn.call(trigger, e);
            });
        });
    }

    function objectLoad(e) {
        this.contentDocument.defaultView.__resizeTrigger__ = this.__resizeElement__;
        this.contentDocument.defaultView.addEventListener('resize', resizeListener);
    }

    AppConfig.addResizeListener = function (element, fn) {
        if (!element.__resizeListeners__) {
            element.__resizeListeners__ = [];
            if (attachEvent) {
                element.__resizeTrigger__ = element;
                element.attachEvent('onresize', resizeListener);
            } else {
                if (getComputedStyle(element).position === 'static') element.style.position = 'relative';
                var obj = element.__resizeTrigger__ = document.createElement('object');
                obj.setAttribute('style', 'display: block; position: absolute; top: 0; left: 0; height: 100%; width: 100%; overflow: hidden; pointer-events: none; z-index: -1;');
                obj.__resizeElement__ = element;
                obj.onload = objectLoad;
                obj.type = 'text/html';
                if (isIE) element.appendChild(obj);
                obj.data = 'about:blank';
                if (!isIE) element.appendChild(obj);
            }
        }
        element.__resizeListeners__.push(fn);
    };

    AppConfig.removeResizeListener = function (element, fn) {
        element.__resizeListeners__.splice(element.__resizeListeners__.indexOf(fn), 1);
        if (!element.__resizeListeners__.length) {
            if (attachEvent) element.detachEvent('onresize', resizeListener);
            else {
                element.__resizeTrigger__.contentDocument.defaultView.removeEventListener('resize', resizeListener);
                element.__resizeTrigger__ = !element.removeChild(element.__resizeTrigger__);
            }
        }
    }
})();

Note: AppConfig is a namespace/object I use for organizing reusable functions. Feel free to search and replace the name with anything you would like.

Couldn't get bootstrap datepicker to work until I wrap the textbox with position relative element as shown here:

<span style="position: relative">
 <input  type="text" placeholder="click to show datepicker"  id="pickyDate"/>
</span>

i have an error like this, but after

1/

 mvn eclipse:clean
    mvn eclipse:eclipse -Dwtpversion=2.0

2/ run eclipse, and open the project

3/

mvn package

it's work

In some circumstances, it's sufficient to just set all values of state to null.

If you're state is updated in such a way, that you don't know what might be in there, you might want to use

this.setState(Object.assign(...Object.keys(this.state).map(k => ({[k]: null}))))

Which will change the state as follows

{foo: 1, bar: 2, spam: "whatever"} > {foo: null, bar: null, spam: null}

Not a solution in all cases, but works well for me.

I strongly recommend Perlbrew. It lets you run multiple versions of Perl, install packages, hack Perl internals if you want to, all regular user permissions.

In ASP.NET web api 2 , CORS support has been added . Please check the link [ http://www.asp.net/web-api/overview/security/enabling-cross-origin-requests-in-web-api ]

I updated my android SDK to the latest version (API 19). When I tried to run the emulator with phonegap 3, the build was successful but it ran the same issue.

In the AVD manager there was an existent device, nevertheless, its parameters were all unknown. Surely this occurs because I uninstalled the old sdk version (API 17) that returns a second error while attempting to remove the device. With the message: "device is already running"

To solve the issue, I went to the AVD's location in ~/.android/avd/ and removed manually the device directory.avd and device.ini file. Finally, in the the device manager I created a new AVD provided by the newest API.

This allowed phonegap to build and run the emulator succesfully

I hope this helps

Good day

Below is the exact code you need to make your sheet look exactly as it is in the attached PDF:

try
        {
            Excel.Application application;
            Excel.Workbook workBook;
            Excel.Worksheet workSheet;
            object misValue = System.Reflection.Missing.Value;

            application = new Excel.ApplicationClass();
            workBook = application.Workbooks.Add(misValue);
            workSheet = (Excel.Worksheet)workBook.Worksheets.get_Item(1);

            int i = 1;
            workSheet.Cells[i, 2] = "MSS Close Sheet"; 
            WorkSheet.Cells[i, 2].Style.Font.Bold = true;               
            i++;
            workSheet.Cells[i, 2] = "MSS - " + dpsNoTextBox.Text;
            WorkSheet.Cells[i, 2].Style.Font.Bold = true;
            i++;
            workSheet.Cells[i, 2] = customerNameTextBox.Text;
            i++;                
            workSheet.Cells[i, 2] = "Opening Date : ";
            workSheet.Cells[i, 3] = openingDateTextBox.Value.ToShortDateString();
            i++;
            workSheet.Cells[i, 2] = "Closing Date : ";
            workSheet.Cells[i, 3] = closingDateTextBox.Value.ToShortDateString();
            i++;
            i++;
            i++;

            workSheet.Cells[i, 1] = "SL. No";
            workSheet.Cells[i, 2] = "Month";
            workSheet.Cells[i, 3] = "Amount Deposited";
            workSheet.Cells[i, 4] = "Fine";
            workSheet.Cells[i, 5] = "Cumulative Total";
            workSheet.Cells[i, 6] = "Profit + Cumulative Total";
            workSheet.Cells[i, 7] = "Profit @ " + profitRateComboBox.Text;
            WorkSheet.Cells[i, 1].EntireRow.Font.Bold = true;
            i++;



            /////////////////////////////////////////////////////////
            foreach (RecurringDeposit rd in RecurringDepositList)
            {
                workSheet.Cells[i, 1] = rd.SN.ToString();
                workSheet.Cells[i, 2] = rd.MonthYear;
                workSheet.Cells[i, 3] = rd.InstallmentSize.ToString();
                workSheet.Cells[i, 4] = "";
                workSheet.Cells[i, 5] = rd.CumulativeTotal.ToString();
                workSheet.Cells[i, 6] = rd.ProfitCumulative.ToString();
                workSheet.Cells[i, 7] = rd.Profit.ToString();
                i++;
            }
            //////////////////////////////////////////////////////


            ////////////////////////////////////////////////////////
            workSheet.Cells[i, 2] = "Total (" + RecurringDepositList.Count + " months installment)";
            WorkSheet.Cells[i, 2].Style.Font.Bold = true;
            workSheet.Cells[i, 3] = totalAmountDepositedTextBox.Value.ToString("0.00");
            i++;

            workSheet.Cells[i, 2] = "a) Total Amount Deposited";
            workSheet.Cells[i, 3] = totalAmountDepositedTextBox.Value.ToString("0.00");
            i++;

            workSheet.Cells[i, 2] = "b) Fine";
            workSheet.Cells[i, 3] = "";
            i++;

            workSheet.Cells[i, 2] = "c) Total Pft Paid";
            workSheet.Cells[i, 3] = totalProfitPaidTextBox.Value.ToString("0.00");
            i++;

            workSheet.Cells[i, 2] = "Sub Total";
            WorkSheet.Cells[i, 2].Style.Font.Bold = true;
            workSheet.Cells[i, 3] = (totalAmountDepositedTextBox.Value + totalProfitPaidTextBox.Value).ToString("0.00");
            i++;

            workSheet.Cells[i, 2] = "Deduction";
            WorkSheet.Cells[i, 2].Style.Font.Bold = true;
            i++;

            workSheet.Cells[i, 2] = "a) Excise Duty";
            workSheet.Cells[i, 3] = "0";
            i++;

            workSheet.Cells[i, 2] = "b) Income Tax on Pft. @ " + incomeTaxPercentageTextBox.Text;
            workSheet.Cells[i, 3] = "0";
            i++;

            workSheet.Cells[i, 2] = "c) Account Closing Charge ";
            workSheet.Cells[i, 3] = closingChargeCommaNumberTextBox.Value.ToString("0.00");
            i++;

            workSheet.Cells[i, 2] = "d) Outstanding on BAIM(FO) ";
            workSheet.Cells[i, 3] = baimFOLowerTextBox.Value.ToString("0.00");
            i++;

            workSheet.Cells[i, 2] = "Total Deduction ";
            WorkSheet.Cells[i, 2].Style.Font.Bold = true;
            workSheet.Cells[i, 3] = (incomeTaxDeductionTextBox.Value + closingChargeCommaNumberTextBox.Value + baimFOTextBox.Value).ToString("0.00");
            i++;

            workSheet.Cells[i, 2] = "Client Paid ";
            WorkSheet.Cells[i, 2].Style.Font.Bold = true;
            workSheet.Cells[i, 3] = customerPayableNumberTextBox.Value.ToString("0.00");
            i++;

            workSheet.Cells[i, 2] = "e) Current Balance ";
            workSheet.Cells[i, 3] = currentBalanceCommaNumberTextBox.Value.ToString("0.00");
            workSheet.Cells[i, 5] = "Exp. Pft paid on MSS A/C(PL67054)";
            workSheet.Cells[i, 6] = plTextBox.Value.ToString("0.00");
            i++;

            workSheet.Cells[i, 2] = "e) Total Paid ";
            workSheet.Cells[i, 3] = customerPayableNumberTextBox.Value.ToString("0.00");
            workSheet.Cells[i, 5] = "IT on Pft (BDT16216)";
            workSheet.Cells[i, 6] = incomeTaxDeductionTextBox.Value.ToString("0.00");
            i++;

            workSheet.Cells[i, 2] = "Difference";
            WorkSheet.Cells[i, 2].Style.Font.Bold = true;
            workSheet.Cells[i, 3] = (currentBalanceCommaNumberTextBox.Value - customerPayableNumberTextBox.Value).ToString("0.00");
            workSheet.Cells[i, 5] = "Account Closing Charge";
            workSheet.Cells[i, 6] = closingChargeCommaNumberTextBox.Value;
            i++;

            ///////////////////////////////////////////////////////////////

            workBook.SaveAs("D:\\" + dpsNoTextBox.Text.Trim() + "-" + customerNameTextBox.Text.Trim() + ".xls", Excel.XlFileFormat.xlWorkbookNormal, misValue, misValue, misValue, misValue, Excel.XlSaveAsAccessMode.xlExclusive, misValue, misValue, misValue, misValue, misValue);
            workBook.Close(true, misValue, misValue);
            application.Quit();

            releaseObject(workSheet);
            releaseObject(workBook);
            releaseObject(application);

To be even more pedantic, the most python doc consistent answer would be:

mypath = os.path.join('c:', os.sep, 'sourcedir')

Since you also need os.sep for the posix root path:

mypath = os.path.join(os.sep, 'usr', 'lib')

I found this method by Jeff Clayton. It is working for me with Firefox 56 and Chrome (on Windows and Android).

Did not try all possibilities. On my side, I open a window with a target name in my A links, for example, target="mywindowname", so all my links open inside the same window name: mywindowname.

To open a new window:

<a href="example-link.html" target="mywindowname">New Window</a>

And then in the new window (inside example-link.html):

<a href="#" onclick="return quitBox('quit');"></a>

Javascript:

function quitBox(cmd) {   
    if (cmd=='quit') {
        open(location, '_self').close();
    }   
    return false;   
}

Hope this can help anyone else that is looking for a method to close a window. I tried a lot of other methods and this one is the best I found.

I found this is really helpful:

// Make the DIV element draggable:_x000D_
dragElement(document.getElementById("mydiv"));_x000D_
_x000D_
function dragElement(elmnt) {_x000D_
  var pos1 = 0, pos2 = 0, pos3 = 0, pos4 = 0;_x000D_
  if (document.getElementById(elmnt.id + "header")) {_x000D_
    // if present, the header is where you move the DIV from:_x000D_
    document.getElementById(elmnt.id + "header").onmousedown = dragMouseDown;_x000D_
  } else {_x000D_
    // otherwise, move the DIV from anywhere inside the DIV:_x000D_
    elmnt.onmousedown = dragMouseDown;_x000D_
  }_x000D_
_x000D_
  function dragMouseDown(e) {_x000D_
    e = e || window.event;_x000D_
    e.preventDefault();_x000D_
    // get the mouse cursor position at startup:_x000D_
    pos3 = e.clientX;_x000D_
    pos4 = e.clientY;_x000D_
    document.onmouseup = closeDragElement;_x000D_
    // call a function whenever the cursor moves:_x000D_
    document.onmousemove = elementDrag;_x000D_
  }_x000D_
_x000D_
  function elementDrag(e) {_x000D_
    e = e || window.event;_x000D_
    e.preventDefault();_x000D_
    // calculate the new cursor position:_x000D_
    pos1 = pos3 - e.clientX;_x000D_
    pos2 = pos4 - e.clientY;_x000D_
    pos3 = e.clientX;_x000D_
    pos4 = e.clientY;_x000D_
    // set the element's new position:_x000D_
    elmnt.style.top = (elmnt.offsetTop - pos2) + "px";_x000D_
    elmnt.style.left = (elmnt.offsetLeft - pos1) + "px";_x000D_
  }_x000D_
_x000D_
  function closeDragElement() {_x000D_
    // stop moving when mouse button is released:_x000D_
    document.onmouseup = null;_x000D_
    document.onmousemove = null;_x000D_
  }_x000D_
}

#mydiv {_x000D_
  position: absolute;_x000D_
  z-index: 9;_x000D_
  background-color: #f1f1f1;_x000D_
  border: 1px solid #d3d3d3;_x000D_
  text-align: center;_x000D_
}_x000D_
_x000D_
#mydivheader {_x000D_
  padding: 10px;_x000D_
  cursor: move;_x000D_
  z-index: 10;_x000D_
  background-color: #2196F3;_x000D_
  color: #fff;_x000D_
}

 <!-- Draggable DIV -->_x000D_
<div id="mydiv">_x000D_
  <!-- Include a header DIV with the same name as the draggable DIV, followed by "header" -->_x000D_
  <div id="mydivheader">Click here to move</div>_x000D_
  <p>Move</p>_x000D_
  <p>this</p>_x000D_
  <p>DIV</p>_x000D_
</div> 

I hope you can use it to!

If you want to move the repository and keep history, you'll probably need filesystem access on both hosts. The simplest solution, if your backend is FSFS (the default on recent versions), is to make a filesystem copy of the entire repository folder.

If you have a Berkley DB backend, if you're not sure of what your backend is, or if you're changing SVN version numbers, you're going to want to use svnadmin to dump your old repository and load it into your new repository. Using svnadmin dump will give you a single file backup that you can copy to the new system. Then you can create the new (empty) repository and use svnadmin load, which will essentially replay all the commits along with its metadata (author, timestamp, etc).

You can read more about the dump/load process here:

http://svnbook.red-bean.com/en/1.8/svn.reposadmin.maint.html#svn.reposadmin.maint.migrate

Also, if you do svnadmin load, make sure you use the --force-uuid option, or otherwise people are going to have problems switching to the new repository. Subversion uses a UUID to identify the repository internally, and it won't let you switch a working copy to a different repository.

If you don't have filesystem access, there may be other third party options out there (or you can write something) to help you migrate: essentially you'd have to use the svn log to replay each revision on the new repository, and then fix up the metadata afterwards. You'll need the pre-revprop-change and post-revprop-change hook scripts in place to do this, which sort of assumes filesystem access, so YMMV. Or, if you don't want to keep the history, you can use your working copy to import into the new repository. But hopefully this isn't the case.

Just to clarify on OP's comment that the use on ref and out is a "reference to a value type or struct declared outside the method", which has already been established in incorrect.

Consider the use of ref on a StringBuilder, which is a reference type:

private void Nullify(StringBuilder sb, string message)
{
    sb.Append(message);
    sb = null;
}

// -- snip --

StringBuilder sb = new StringBuilder();
string message = "Hi Guy";
Nullify(sb, message);
System.Console.WriteLine(sb.ToString());

// Output
// Hi Guy

As apposed to this:

private void Nullify(ref StringBuilder sb, string message)
{
    sb.Append(message);
    sb = null;
}

// -- snip --

StringBuilder sb = new StringBuilder();
string message = "Hi Guy";
Nullify(ref sb, message);
System.Console.WriteLine(sb.ToString());

// Output
// NullReferenceException

I've found that these problems are often best solved at the server layer. Do you have access to an .htaccess file where you could place a redirect rule? If so:

RedirectPermanent /path/to/page http://uri.com

This redirect will also serve a "301 Moved Permanently" response to indicate that the Flickr page (for example) is the permanent URI for the old page.

If this is not possible, you can create a custom page template for each page in question, and add the following PHP code to the top of the page template (actually, this is all you need in the template:

header('Location: http://uri.com, true, 301');

More information about PHP headers.

Situation:

We have certificate.key certificate.crt inside /user/ssl/

We want to rename anything that starts with certificate to certificate_OLD

We are now located inside /user

First, you do a dry run with -n:

rename -n "s/certificate/certificate_old/" ./ssl/*

Which returns:

rename(./ssl/certificate.crt, ./ssl/certificate_OLD.crt) rename(./ssl/certificate.key, ./ssl/certificate_OLD.key)

Your files will be unchanged this is just a test run.

Solution:

When your happy with the result of the test run it for real:

rename "s/certificate/certificate_OLD/" ./ssl/*

What it means:

`rename "s/ SOMETHING / SOMETING_ELSE " PATH/FILES

Tip:

If you are already on the path run it like this:

rename "s/certificate/certificate_OLD/" *

Or if you want to do this in any sub-directory starting with ss do:

rename -n "s/certificat/certificate_old/" ./ss*/*

You can also do:

rename -n "s/certi*/certificate_old/" ./ss*/*

Which renames anything starting with certi in any sub-directory starting with ss.

The sky is the limit.

Play around with regex and ALWAYS test this BEFORE with -n.

WATCH OUT THIS WILL EVEN RENAME FOLDER NAMES THAT MATCH. Better cd into the directory and do it there. USE AT OWN RISK.

In order to rename a table in a different schema, try:

ALTER TABLE owner.mytable RENAME TO othertable;

The rename command (as in "rename mytable to othertable") only supports renaming a table in the same schema.

Use expression(delta) where 'delta' for lowercase d and 'Delta' to get capital ?.

Here's full list of Greek characters:

? a alpha
? ß beta
G ? gamma
? d delta
? e epsilon
? ? zeta
? ? eta
T ? theta
? ? iota
? ? kappa
? ? lambda
? µ mu
? ? nu
? ? xi
? ? omicron
? p pi
? ? rho
S s sigma
? t tau
? ? upsilon
F f phi
? ? chi
? ? psi
O ? omega

EDIT: Copied from comments, when using in conjunction with other words use like: expression(Delta*"price")

Solution for Swift 4:

yourLabel.layer.borderColor = UIColor.green.cgColor

This is a known problem with Android 2.x. I was struggling with this problem for a week until I came across the following question, which not only gives a good background of the problem but also provides a working and effective solution devoid of any security holes.

'No peer certificate' error in Android 2.3 but NOT in 4

grep find the lines and output the line numbers, but does not let you "program" other things. If you want to include arbitrary text and do other "programming", you can use awk,

$ awk '/null/{c++;print $0," - Line number: "NR}END{print "Total null count: "c}' file
example two null,  - Line number: 2
example four null,  - Line number: 4
Total null count: 2

Or only using the shell(bash/ksh)

c=0
while read -r line
do
  case "$line" in
   *null* )  (
    ((c++))
    echo "$line - Line number $c"
    ;;
  esac
done < "file"
echo "total count: $c"

• process.cwd() returns directory where command has been executed (not directory of the node package) if it's has not been changed by 'process.chdir' inside of application.
• __filename returns absolute path to file where it is placed.
• __dirname returns absolute path to directory of __filename.

If you need to load files from your module directory you need to use relative paths.

require('../lib/test');

instead of

var lib  = path.join(path.dirname(fs.realpathSync(__filename)), '../lib');

require(lib + '/test');

It's always relative to file where it called from and don't depend on current work dir.

To answer the question that is asked in the beginning:

Why can't the container component call the async API, and then dispatch the actions?

Keep in mind that those docs are for Redux, not Redux plus React. Redux stores hooked up to React components can do exactly what you say, but a Plain Jane Redux store with no middleware doesn't accept arguments to dispatch except plain ol' objects.

Without middleware you could of course still do

const store = createStore(reducer);
MyAPI.doThing().then(resp => store.dispatch(...));

But it's a similar case where the asynchrony is wrapped around Redux rather than handled by Redux. So, middleware allows for asynchrony by modifying what can be passed directly to dispatch.

That said, the spirit of your suggestion is, I think, valid. There are certainly other ways you could handle asynchrony in a Redux + React application.

One benefit of using middleware is that you can continue to use action creators as normal without worrying about exactly how they're hooked up. For example, using redux-thunk, the code you wrote would look a lot like

function updateThing() {
  return dispatch => {
    dispatch({
      type: ActionTypes.STARTED_UPDATING
    });
    AsyncApi.getFieldValue()
      .then(result => dispatch({
        type: ActionTypes.UPDATED,
        payload: result
      }));
  }
}

const ConnectedApp = connect(
  (state) => { ...state },
  { update: updateThing }
)(App);

which doesn't look all that different from the original — it's just shuffled a bit — and connect doesn't know that updateThing is (or needs to be) asynchronous.

If you also wanted to support promises, observables, sagas, or crazy custom and highly declarative action creators, then Redux can do it just by changing what you pass to dispatch (aka, what you return from action creators). No mucking with the React components (or connect calls) necessary.

With HTML5, the easiest way is simply to do height: 100vh. Where 'vh' stands for viewport height of the browser window. Responsive to resizing of browser and mobile devices.

If it's a string that you trust meaning that you have checked it before hand then the following would also work.

$date = new DateTime('2015-03-27');

Yes if you have no idea that how many arguments are possible at the time of function declaration then you can declare the function with no parameters and can access all variables by arguments array which are passed at the time of function calling.

I ended up using JavaScript before each postback to check for the characters you didn't want, such as:

<asp:Button runat="server" ID="saveButton" Text="Save" CssClass="saveButton" OnClientClick="return checkFields()" />

function checkFields() {
    var tbs = new Array();
    tbs = document.getElementsByTagName("input");
    var isValid = true;
    for (i=0; i<tbs.length; i++) {
        if (tbs(i).type == 'text') {
            if (tbs(i).value.indexOf('<') != -1 || tbs(i).value.indexOf('>') != -1) {
                alert('<> symbols not allowed.');
                isValid = false;
            }
        }
    }
    return isValid;
}

Granted my page is mostly data entry, and there are very few elements that do postbacks, but at least their data is retained.

Use the quotemeta function:

$text_to_search = "example text with [foo] and more";
$search_string = quotemeta "[foo]";

print "wee" if ($text_to_search =~ /$search_string/);

It seems like a bug in Safari's cache handling policies.

Workaround in apache:

Header unset ETag
Header unset Last-Modified

Since Docker merges stdout and stderr for us, we can treat the log output like any other shell stream. To redirect the current logs to a file, use a redirection operator

$ docker logs test_container > output.log
docker logs -f test_container > output.log

Instead of sending output to stderr and stdout, redirect your application’s output to a file and map the file to permanent storage outside of the container.

$ docker logs test_container> /tmp/output.log

Docker will not accept relative paths on the command line, so if you want to use a different directory, you’ll need to use the complete path.

Some Improvements in Sudheesh B Nair's answer, i have noticed it will wait for handler even while pressing back twice immediately, so cancel handler as shown below. I have cancled toast also to prevent it to display after app exit.

 boolean doubleBackToExitPressedOnce = false;
        Handler myHandler;
        Runnable myRunnable;
        Toast myToast;

    @Override
        public void onBackPressed() {
            if (doubleBackToExitPressedOnce) {
                myHandler.removeCallbacks(myRunnable);
                myToast.cancel();
                super.onBackPressed();
                return;
            }

            this.doubleBackToExitPressedOnce = true;
            myToast = Toast.makeText(this, "Please click BACK again to exit", Toast.LENGTH_SHORT);
            myToast.show();

            myHandler = new Handler();

            myRunnable = new Runnable() {

                @Override
                public void run() {
                    doubleBackToExitPressedOnce = false;
                }
            };
            myHandler.postDelayed(myRunnable, 2000);
        }

Since PHP is dynamically weakly typed, you can pass any variable to the function and the function will try to do its best with it.

Therefore, you can indeed pass arrays as parameters.

The thing you really want to do is wrap all child elements. In this case you should use an items control and not resort to horrible attached properties which you will end up having a million of for every property you wish to style.

<ItemsControl>

    <!-- target the wrapper parent of the child with a style -->
    <ItemsControl.ItemContainerStyle>
        <Style TargetType="Control">
            <Setter Property="Margin" Value="0 0 5 0"></Setter>
        </Style>
    </ItemsControl.ItemContainerStyle>

    <!-- use a stack panel as the main container -->
    <ItemsControl.ItemsPanel>
        <ItemsPanelTemplate>
            <StackPanel Orientation="Horizontal"/>
        </ItemsPanelTemplate>
    </ItemsControl.ItemsPanel>

    <!-- put in your children -->
    <ItemsControl.Items>
        <Label>Auto Zoom Reset?</Label>
        <CheckBox x:Name="AutoResetZoom"/>
        <Button x:Name="ProceedButton" Click="ProceedButton_OnClick">Next</Button>
        <ComboBox SelectedItem="{Binding LogLevel }" ItemsSource="{Binding LogLevels}" />
    </ItemsControl.Items>
</ItemsControl>

The problem is that the package that used to connect PHP to MySQL is deprecated (php5-mysql). If you install the new package,

sudo apt-get install php-mysql

this will automatically update Apache and PHP 7.

I had the same kind of error, right after a warning like the following:

java: You aren't using a compiler supported by lombok, so lombok will not work and has been disabled.
  Your processor is: com.sun.proxy.$Proxy27
  Lombok supports: OpenJDK javac, ECJ

In my case, it was an unfortunate combination of lombok < 1.18.16 and IDEA 2020.3.

I would suggest using String.format() if you need the value as a String in your code.

For example, you can use String.format() in the following way:

float myFloat = 2.001f;

String formattedString = String.format("%.02f", myFloat);

it's a problem with the scipy package, just pip uninstall scipy and reinstall it

I don't have much experience working with php but from a logic standpoint this is what I would do.

1. Loop through your result set from MySQL
2. In Excel you should already know what A,B,C should be because those are the columns and you know how many columns you are returning.
3. The row number can just be incremented with each time through the loop.

Below is some pseudocode illustrating this technique:

    for (int i = 0; i < MySQLResults.count; i++){
         $objPHPExcel->getActiveSheet()->setCellValue('A' . (string)(i + 1), MySQLResults[i].name); 
        // Add 1 to i because Excel Rows start at 1, not 0, so row will always be one off
         $objPHPExcel->getActiveSheet()->setCellValue('B' . (string)(i + 1), MySQLResults[i].number);
         $objPHPExcel->getActiveSheet()->setCellValue('C' . (string)(i + 1), MySQLResults[i].email);
    }

First of all, the easiest way to run things at startup is to add them to the file /etc/rc.local.

Another simple way is to use @reboot in your crontab. Read the cron manpage for details.

However, if you want to do things properly, in addition to adding a script to /etc/init.d you need to tell ubuntu when the script should be run and with what parameters. This is done with the command update-rc.d which creates a symlink from some of the /etc/rc* directories to your script. So, you'd need to do something like:

update-rc.d yourscriptname start 2

However, real init scripts should be able to handle a variety of command line options and otherwise integrate to the startup process. The file /etc/init.d/README has some details and further pointers.

There are 3 ways to achieve this as shown below

Method 1:

var uName="abc";
var passwrd="pqr";

$.ajax({
    type: '{GET/POST}',
    url: '{urlpath}',
    headers: {
        "Authorization": "Basic " + btoa(uName+":"+passwrd);
    },
    success : function(data) {
      //Success block  
    },
   error: function (xhr,ajaxOptions,throwError){
    //Error block 
  },
});

Method 2:

var uName="abc";
var passwrd="pqr";

$.ajax({
    type: '{GET/POST}',
    url: '{urlpath}',
     beforeSend: function (xhr){ 
        xhr.setRequestHeader('Authorization', "Basic " + btoa(uName+":"+passwrd)); 
    },
    success : function(data) {
      //Success block 
   },
   error: function (xhr,ajaxOptions,throwError){
    //Error block 
  },
});

Method 3:

var uName="abc";
var passwrd="pqr";

$.ajax({
    type: '{GET/POST}',
    url: '{urlpath}',
    username:uName,
    password:passwrd, 
    success : function(data) {
    //Success block  
   },
    error: function (xhr,ajaxOptions,throwError){
    //Error block 
  },
});

select column1, coulumn2, case when colum1=column2 then 'true' else 'false' end from table;

HTH

For comprehensive SFTP support in .NET try edtFTPnet/PRO. It's been around a long time with support for many different SFTP servers.

We also sell an SFTP server for Windows, CompleteFTP, which is an inexpensive way to get support for SFTP on your Windows machine. Also has FTP and FTPS.

Check with netstat -nptl all processes

Active Internet connections (only servers)
Proto Recv-Q Send-Q Local Address           Foreign Address         State       PID/Program name
tcp        0      0 127.0.0.1:27017         0.0.0.0:*               LISTEN      1736/mongod     
tcp        0      0 0.0.0.0:22              0.0.0.0:*               LISTEN      1594/sshd       
tcp6       0      0 :::3977                 :::*                    LISTEN      6231/nodejs     
tcp6       0      0 :::22                   :::*                    LISTEN      1594/sshd       
tcp6       0      0 :::3200                 :::*                    LISTEN      5535/nodejs 

And it simply kills the process by the PID reference.... In my case I want to stop the 6231/nodejs so I execute the following command:

kill -9 6231

You can use the built-in filter function to filter dictionaries, lists, etc. based on specific conditions.

filtered_dict = dict(filter(lambda item: filter_str in item[0], d.items()))

The advantage is that you can use it for different data structures.

You can provide a new testContext.xml in which the @Autowired bean you define is of the type you need for your test.

Swift 3: Chage ViewController withOut Segue and send AnyObject Use: Identity MainPageViewController on target ViewController

let mainPage = self.storyboard?.instantiateViewController(withIdentifier: "MainPageViewController") as! MainPageViewController

var mainPageNav = UINavigationController(rootViewController: mainPage)

self.present(mainPageNav, animated: true, completion: nil)

or if you want to Change View Controller and send Data

let mainPage = self.storyboard?.instantiateViewController(withIdentifier: "MainPageViewController") as! MainPageViewController

let dataToSend = "**Any String**" or  var ObjectToSend:**AnyObject** 

mainPage.getData = dataToSend 

var mainPageNav = UINavigationController(rootViewController: mainPage)

self.present(mainPageNav, animated: true, completion: nil)  

library(lubridate) if your date format is like this '04/24/2017 05:35:00'then change it like below prods.all$Date2<-gsub("/","-",prods.all$Date2) then change the date format parse_date_time(prods.all$Date2, orders="mdy hms")

Try FrameLayout, it gives you the possibility to put views one above another. You can create two LinearLayouts: one with the background views, and one with foreground views, and combine them using the FrameLayout. Hope this helps.

The following code is looking for '\0', and under the assumptions of the question the array can be considered sorted since all non-'\0' precede all '\0'. This assumption won't hold if the array can contain '\0' within the data.

Find the location of the first zero-byte using a binary search, then slice.

You can find the zero-byte like this:

package main

import "fmt"

func FirstZero(b []byte) int {
    min, max := 0, len(b)
    for {
        if min + 1 == max { return max }
        mid := (min + max) / 2
        if b[mid] == '\000' {
            max = mid
        } else {
            min = mid
        }
    }
    return len(b)
}
func main() {
    b := []byte{1, 2, 3, 0, 0, 0}
    fmt.Println(FirstZero(b))
}

It may be faster just to naively scan the byte array looking for the zero-byte, especially if most of your strings are short.

jQuery Scroll Plugin

since this is a question tagged with jquery i have to say, that this library has a very nice plugin for smooth scrolling, you can find it here: http://plugins.jquery.com/scrollTo/

Excerpts from Documentation:

$('div.pane').scrollTo(...);//all divs w/class pane

or

$.scrollTo(...);//the plugin will take care of this

Custom jQuery function for scrolling

you can use a very lightweight approach by defining your custom scroll jquery function

$.fn.scrollView = function () {
    return this.each(function () {
        $('html, body').animate({
            scrollTop: $(this).offset().top
        }, 1000);
    });
}

and use it like:

$('#your-div').scrollView();

Scroll to a page coordinates

Animate html and body elements with scrollTop or scrollLeft attributes

$('html, body').animate({
    scrollTop: 0,
    scrollLeft: 300
}, 1000);

Plain javascript

scrolling with window.scroll

window.scroll(horizontalOffset, verticalOffset);

only to sum up, use the window.location.hash to jump to element with ID

window.location.hash = '#your-page-element';

Directly in HTML (accesibility enhancements)

<a href="#your-page-element">Jump to ID</a>

<div id="your-page-element">
    will jump here
</div>

Give it a try to the jQuery Audit extension (https://chrome.google.com/webstore/detail/jquery-audit/dhhnpbajdcgdmbbcoakfhmfgmemlncjg), after installing follow these steps:

1. Inspect the element
2. On the new 'jQuery Audit' tab expand the Events property
3. Choose for the Event you need
4. From the handler property, right click over function and select 'Show function definition'
5. You will now see the Event binding code
6. Click on the 'Pretty print' button for a more readable view of the code

select distinct(t1.sal) 
from emp t1 
where &n=(select count(distinct(t2.sal)) from emp t2 where t1.sal<=t2.sal);

Output: Enter value for n: if you want 2nd highest ,enter 2; if you want 5,enter n=3

Solved:
Just add
org.gradle.jvmargs=-Xmx1024m
in
gradle.properties
and if it does not exist, create it.

I find that the best solution for centering text is as follows:

textPaint.setTextAlign(Paint.Align.CENTER);
//textPaint is the Paint object being used to draw the text (it must be initialized beforehand)
float textY=center.y;
float textX=center.x; 
// in this case, center.x and center.y represent the coordinates of the center of the rectangle in which the text is being placed
canvas.drawText(text,textX,textY,textPaint);    `