This helped me get to my answer. There are two php.ini
files located, in my case, for wamp. One is under the php folder and the other one is in the C:\wamp\bin\apache\Apachex.x.x\bin
folder. When connecting to SQL through sqlsrv_connect
function, we are referring to the php.ini
file in the apache
folder. Add the following (as per your version) to this file:
extension=c:/wamp/bin/php/php5.4.16/ext/php_sqlsrv_53_ts.dll
In case others may find this useful: I found that by adding an initial empty cell to my list of search terms, a zero value will be returned instead of error.
={INDEX(SearchTerms!$A$1:$A$38,MAX(IF(ISERROR(SEARCH(SearchTerms!$A$1:$A$38,SearchCell)),0,1)*((SearchTerms!$B$1:$B$38)+1)))}
NB: Column A has the search terms, B is the row number index.
It's the @Neps' answer but with details.
Note: @Saurabh's answer is more suitable if you don't want to modify your component or don't have access to it.
Components are complicated. One component can be a small fancy button wrapper, and another one can be an entire table with bunch of logic inside. Vue doesn't know what exactly you expect when bind v-model
or use v-on
so all of that should be processed by component's creator.
According to Vue docs, $emit
passes events to parent. Example from docs:
Main file
<blog-post
@enlarge-text="onEnlargeText"
/>
Component
<button @click="$emit('enlarge-text')">
Enlarge text
</button>
(@
is the v-on
shorthand)
Component handles native click
event and emits parent's @enlarge-text="..."
enlarge-text
can be replaced with click
to make it look like we're handling a native click event:
<blog-post
@click="onEnlargeText"
></blog-post>
<button @click="$emit('click')">
Enlarge text
</button>
But that's not all. $emit
allows to pass a specific value with an event. In the case of native click
, the value is MouseEvent (JS event that has nothing to do with Vue).
Vue stores that event in a $event
variable. So, it'd the best to emit $event
with an event to create the impression of native event usage:
<button v-on:click="$emit('click', $event)">
Enlarge text
</button>
Say you have number 1,2,3,4,5,6, in cell A1,A2,A3,A4,A5,A6 respectively. in cell A7 we calculate the sum of A1:Ax. x is specified in cell B1 (in this case, x can be any number from 1 to 6). in cell A7, you can write the following formular:
=SUM(A1:INDIRECT(CONCATENATE("A",B1)))
CONCATENATE will give you the index of the cell Ax(if you put 3 in B1, CONCATENATE("A",B1)) gives A3).
INDIRECT convert "A3" to a index.
see this link Using the value in a cell as a cell reference in a formula?
I use the MAVEN_OPTS option, and find it useful to set suspend to "suspend=y" as my exec:java programs tend to be small generators which are finished before I have manage to attach a debugger.... :) With suspend on it will wait for a debugger to attach before proceding.
An easy short hand way would be to use +x It keeps the sign intact as well as the decimal numbers. The other alternative is to use parseFloat(x). Difference between parseFloat(x) and +x is for a blank string +x returns 0 where as parseFloat(x) returns NaN.
This was how added my headers in my flask application and it worked perfectly
@app.after_request
def add_header(response):
response.headers['X-Content-Type-Options'] = 'nosniff'
return response
If you've already pushed things to a remote server (and you have other developers working off the same remote branch) the important thing to bear in mind is that you don't want to rewrite history
Don't use git reset --hard
You need to revert changes, otherwise any checkout that has the removed commits in its history will add them back to the remote repository the next time they push; and any other checkout will pull them in on the next pull thereafter.
If you have not pushed changes to a remote, you can use
git reset --hard <hash>
If you have pushed changes, but are sure nobody has pulled them you can use
git reset --hard
git push -f
If you have pushed changes, and someone has pulled them into their checkout you can still do it but the other team-member/checkout would need to collaborate:
(you) git reset --hard <hash>
(you) git push -f
(them) git fetch
(them) git reset --hard origin/branch
But generally speaking that's turning into a mess. So, reverting:
The commits to remove are the lastest
This is possibly the most common case, you've done something - you've pushed them out and then realized they shouldn't exist.
First you need to identify the commit to which you want to go back to, you can do that with:
git log
just look for the commit before your changes, and note the commit hash. you can limit the log to the most resent commits using the -n
flag: git log -n 5
Then reset your branch to the state you want your other developers to see:
git revert <hash of first borked commit>..HEAD
The final step is to create your own local branch reapplying your reverted changes:
git branch my-new-branch
git checkout my-new-branch
git revert <hash of each revert commit> .
Continue working in my-new-branch
until you're done, then merge it in to your main development branch.
The commits to remove are intermingled with other commits
If the commits you want to revert are not all together, it's probably easiest to revert them individually. Again using git log
find the commits you want to remove and then:
git revert <hash>
git revert <another hash>
..
Then, again, create your branch for continuing your work:
git branch my-new-branch
git checkout my-new-branch
git revert <hash of each revert commit> .
Then again, hack away and merge in when you're done.
You should end up with a commit history which looks like this on my-new-branch
2012-05-28 10:11 AD7six o [my-new-branch] Revert "Revert "another mistake""
2012-05-28 10:11 AD7six o Revert "Revert "committing a mistake""
2012-05-28 10:09 AD7six o [master] Revert "committing a mistake"
2012-05-28 10:09 AD7six o Revert "another mistake"
2012-05-28 10:08 AD7six o another mistake
2012-05-28 10:08 AD7six o committing a mistake
2012-05-28 10:05 Bob I XYZ nearly works
Better way®
Especially that now that you're aware of the dangers of several developers working in the same branch, consider using feature branches always for your work. All that means is working in a branch until something is finished, and only then merge it to your main branch. Also consider using tools such as git-flow to automate branch creation in a consistent way.
One option would be to use a helper extension method like follows:
public static class MyExtensions
{
public static System.Type Type<T>(this T v)=>typeof(T);
}
var i=0;
console.WriteLine(i.Type().FullName);
That's what solved this problem for me.
I used:
npm install --save @angular/material @angular/cdk
npm install --save @angular/animations
but INSIDE THE APPLICATION'S FOLDER.
Source: https://medium.com/@ismapro/first-steps-with-angular-cli-and-angular-material-5a90406e9a4
It works like this:
h4 {
display:inline;
}
h4:after {
content:"\a";
white-space: pre;
}
Example: http://jsfiddle.net/Bb2d7/
The trick comes from here: https://stackoverflow.com/a/66000/509752 (to have more explanation)
Use the Timer
class.
public static void Main()
{
System.Timers.Timer aTimer = new System.Timers.Timer();
aTimer.Elapsed += new ElapsedEventHandler(OnTimedEvent);
aTimer.Interval = 5000;
aTimer.Enabled = true;
Console.WriteLine("Press \'q\' to quit the sample.");
while(Console.Read() != 'q');
}
// Specify what you want to happen when the Elapsed event is raised.
private static void OnTimedEvent(object source, ElapsedEventArgs e)
{
Console.WriteLine("Hello World!");
}
The Elapsed
event will be raised every X amount of milliseconds, specified by the Interval
property on the Timer object. It will call the Event Handler
method you specify. In the example above, it is OnTimedEvent
.
org.apache.commons.lang3.StringEscapeUtils
from commons-lang3 is marked deprecated now. You can use org.apache.commons.text.StringEscapeUtils#unescapeJava(String)
instead. It requires an additional Maven dependency:
<dependency>
<groupId>org.apache.commons</groupId>
<artifactId>commons-text</artifactId>
<version>1.4</version>
</dependency>
and seems to handle some more special cases, it e.g. unescapes:
\\b
, \\n
, \\t
, \\f
, \\r
The correct fix is to add the property in the type definition as explained in @Nitzan Tomer's answer. If that's not an option though:
You can assign the object to a constant of type any, then call the 'non-existing' property.
const newObj: any = oldObj;
return newObj.someProperty;
You can also cast it as any
:
return (oldObj as any).someProperty;
This fails to provide any type safety though, which is the point of TypeScript.
Another thing you may consider, if you're unable to modify the original type, is extending the type like so:
interface NewType extends OldType {
someProperty: string;
}
Now you can cast your variable as this NewType
instead of any
. Still not ideal but less permissive than any
, giving you more type safety.
return (oldObj as NewType).someProperty;
Instead of using a ServletContextListener, use a HttpSessionListener
.
In the sessionCreated()
method, you can set the session timeout programmatically:
public class MyHttpSessionListener implements HttpSessionListener {
public void sessionCreated(HttpSessionEvent event){
event.getSession().setMaxInactiveInterval(15 * 60); // in seconds
}
public void sessionDestroyed(HttpSessionEvent event) {}
}
And don't forget to define the listener in the deployment descriptor:
<webapp>
...
<listener>
<listener-class>com.example.MyHttpSessionListener</listener-class>
</listener>
</webapp>
(or since Servlet version 3.0 you can use @WebListener
annotation instead).
Still, I would recommend creating different web.xml files for each application and defining the session timeout there:
<webapp>
...
<session-config>
<session-timeout>15</session-timeout> <!-- in minutes -->
</session-config>
</webapp>
Sometimes sorting the whole data ahead is very time consuming. We can groupby first and doing topk for each group:
g = df.groupby(['id']).apply(lambda x: x.nlargest(topk,['value'])).reset_index(drop=True)
You are allow to use php_value to change php setting in .htaccess file. Same like how php.ini did.
Example:
php_value date.timezone Asia/Kuala_Lumpur
For other php setting, please read http://www.php.net/manual/en/ini.list.php
Use IndexOf is easier and high performance.
int index = Value1.IndexOf("abc");
bool found = index >= 0 && index < x;
Change Your Web.Config file as below. It will act like charm.
In node <system.webServer>
add below portion of code
<modules runAllManagedModulesForAllRequests="true">
<remove name="WebDAVModule"/>
</modules>
After adding, your Web.Config will look like below
<system.webServer>
<validation validateIntegratedModeConfiguration="false" />
<modules runAllManagedModulesForAllRequests="true">
<remove name="WebDAVModule"/>
</modules>
<httpProtocol>
<customHeaders>
<add name="Access-Control-Allow-Origin" value="*" />
<add name="Access-Control-Allow-Headers" value="Content-Type" />
<add name="Access-Control-Allow-Methods" value="GET, POST, PUT, DELETE, OPTIONS" />
</customHeaders>
</httpProtocol>
<handlers>
<remove name="ExtensionlessUrlHandler-ISAPI-4.0_32bit" />
<remove name="ExtensionlessUrlHandler-ISAPI-4.0_64bit" />
<remove name="ExtensionlessUrlHandler-Integrated-4.0" />
<add name="ExtensionlessUrlHandler-ISAPI-4.0_32bit" path="*." verb="GET,HEAD,POST,DEBUG,PUT,DELETE,PATCH,OPTIONS" modules="IsapiModule" scriptProcessor="%windir%\Microsoft.NET\Framework\v4.0.30319\aspnet_isapi.dll" preCondition="classicMode,runtimeVersionv4.0,bitness32" responseBufferLimit="0" />
<add name="ExtensionlessUrlHandler-ISAPI-4.0_64bit" path="*." verb="GET,HEAD,POST,DEBUG,PUT,DELETE,PATCH,OPTIONS" modules="IsapiModule" scriptProcessor="%windir%\Microsoft.NET\Framework64\v4.0.30319\aspnet_isapi.dll" preCondition="classicMode,runtimeVersionv4.0,bitness64" responseBufferLimit="0" />
<add name="ExtensionlessUrlHandler-Integrated-4.0" path="*." verb="GET,HEAD,POST,DEBUG,PUT,DELETE,PATCH,OPTIONS" type="System.Web.Handlers.TransferRequestHandler" preCondition="integratedMode,runtimeVersionv4.0" />
</handlers>
</system.webServer>
Install mysql and python via Macports The porters have done all the difficult work.
sudo port install py26-mysql
sudo port install mysql5-server
should install what you need. (see Stack overflow for comments re mysql server)
If you only need to connect to mysql and not run a server then the first line is sufficient.
Macports now (early 2013) will provide binary downloads for common combinations of OS a executable architecture, for others (and if you request it) it will build from source.
In general macports (or fink) help when there are complex libraries etc that need to be installed.
Python only code and if simple C dependencies can be set up via setuptools etc, but it begins to get complex if you mix the two.
Scripts are usually interpreted (by another executable).
A program is usually a standalone compiled executable in its own right (although it might have library dependencies), consisting of machine code or byte codes (for just-in-time compiled programs)
As said above...
I would add that if you have trouble seeing what is going on, if you can't reproduce the issue in the debugger, you can add a trace before re-throwing the new exception (with the good old System.out.println at worse, with a good log system like log4j otherwise).
please check out the IPython configuration system, implemented via traitlets for the type enforcement you are doing manually.
Cut and pasted here to comply with SO guidelines for not just dropping links as the content of links changes over time.
Here are the main requirements we wanted our configuration system to have:
Support for hierarchical configuration information.
Full integration with command line option parsers. Often, you want to read a configuration file, but then override some of the values with command line options. Our configuration system automates this process and allows each command line option to be linked to a particular attribute in the configuration hierarchy that it will override.
Configuration files that are themselves valid Python code. This accomplishes many things. First, it becomes possible to put logic in your configuration files that sets attributes based on your operating system, network setup, Python version, etc. Second, Python has a super simple syntax for accessing hierarchical data structures, namely regular attribute access (Foo.Bar.Bam.name). Third, using Python makes it easy for users to import configuration attributes from one configuration file to another. Fourth, even though Python is dynamically typed, it does have types that can be checked at runtime. Thus, a 1 in a config file is the integer ‘1’, while a '1' is a string.
A fully automated method for getting the configuration information to the classes that need it at runtime. Writing code that walks a configuration hierarchy to extract a particular attribute is painful. When you have complex configuration information with hundreds of attributes, this makes you want to cry.
Type checking and validation that doesn’t require the entire configuration hierarchy to be specified statically before runtime. Python is a very dynamic language and you don’t always know everything that needs to be configured when a program starts.
To acheive this they basically define 3 object classes and their relations to each other:
1) Configuration - basically a ChainMap / basic dict with some enhancements for merging.
2) Configurable - base class to subclass all things you'd wish to configure.
3) Application - object that is instantiated to perform a specific application function, or your main application for single purpose software.
In their words:
Application: Application
An application is a process that does a specific job. The most obvious application is the ipython command line program. Each application reads one or more configuration files and a single set of command line options and then produces a master configuration object for the application. This configuration object is then passed to the configurable objects that the application creates. These configurable objects implement the actual logic of the application and know how to configure themselves given the configuration object.
Applications always have a log attribute that is a configured Logger. This allows centralized logging configuration per-application. Configurable: Configurable
A configurable is a regular Python class that serves as a base class for all main classes in an application. The Configurable base class is lightweight and only does one things.
This Configurable is a subclass of HasTraits that knows how to configure itself. Class level traits with the metadata config=True become values that can be configured from the command line and configuration files.
Developers create Configurable subclasses that implement all of the logic in the application. Each of these subclasses has its own configuration information that controls how instances are created.
I was getting this error:
The type com.ibm.portal.state.exceptions.StateException cannot be resolved. It is indirectly referenced from required .class files
Doing the following fixed it for me:
Properties -> Java build path -> Libraries -> Server Library[wps.base.v61]unbound -> Websphere Portal v6.1 on WAS 7 -> Finish -> OK
Using is_numeric()
for checking if a variable is an integer is a bad idea. This function will return TRUE
for 3.14
for example. It's not the expected behavior.
To do this correctly, you can use one of these options:
Considering this variables array :
$variables = [
"TEST 0" => 0,
"TEST 1" => 42,
"TEST 2" => 4.2,
"TEST 3" => .42,
"TEST 4" => 42.,
"TEST 5" => "42",
"TEST 6" => "a42",
"TEST 7" => "42a",
"TEST 8" => 0x24,
"TEST 9" => 1337e0
];
# Check if your variable is an integer
if ( filter_var($variable, FILTER_VALIDATE_INT) === false ) {
echo "Your variable is not an integer";
}
Output :
TEST 0 : 0 (type:integer) is an integer ?
TEST 1 : 42 (type:integer) is an integer ?
TEST 2 : 4.2 (type:double) is not an integer ?
TEST 3 : 0.42 (type:double) is not an integer ?
TEST 4 : 42 (type:double) is an integer ?
TEST 5 : 42 (type:string) is an integer ?
TEST 6 : a42 (type:string) is not an integer ?
TEST 7 : 42a (type:string) is not an integer ?
TEST 8 : 36 (type:integer) is an integer ?
TEST 9 : 1337 (type:double) is an integer ?
# Check if your variable is an integer
if ( strval($variable) !== strval(intval($variable)) ) {
echo "Your variable is not an integer";
}
Output :
TEST 0 : 0 (type:integer) is an integer ?
TEST 1 : 42 (type:integer) is an integer ?
TEST 2 : 4.2 (type:double) is not an integer ?
TEST 3 : 0.42 (type:double) is not an integer ?
TEST 4 : 42 (type:double) is an integer ?
TEST 5 : 42 (type:string) is an integer ?
TEST 6 : a42 (type:string) is not an integer ?
TEST 7 : 42a (type:string) is not an integer ?
TEST 8 : 36 (type:integer) is an integer ?
TEST 9 : 1337 (type:double) is an integer ?
# Check if your variable is an integer
if ( ! ctype_digit(strval($variable)) ) {
echo "Your variable is not an integer";
}
Output :
TEST 0 : 0 (type:integer) is an integer ?
TEST 1 : 42 (type:integer) is an integer ?
TEST 2 : 4.2 (type:double) is not an integer ?
TEST 3 : 0.42 (type:double) is not an integer ?
TEST 4 : 42 (type:double) is an integer ?
TEST 5 : 42 (type:string) is an integer ?
TEST 6 : a42 (type:string) is not an integer ?
TEST 7 : 42a (type:string) is not an integer ?
TEST 8 : 36 (type:integer) is an integer ?
TEST 9 : 1337 (type:double) is an integer ?
# Check if your variable is an integer
if ( ! preg_match('/^\d+$/', $variable) ) {
echo "Your variable is not an integer";
}
Output :
TEST 0 : 0 (type:integer) is an integer ?
TEST 1 : 42 (type:integer) is an integer ?
TEST 2 : 4.2 (type:double) is not an integer ?
TEST 3 : 0.42 (type:double) is not an integer ?
TEST 4 : 42 (type:double) is an integer ?
TEST 5 : 42 (type:string) is an integer ?
TEST 6 : a42 (type:string) is not an integer ?
TEST 7 : 42a (type:string) is not an integer ?
TEST 8 : 36 (type:integer) is an integer ?
TEST 9 : 1337 (type:double) is an integer ?
for C use in gcc. #include <windows.h>
then use Sleep(); /// Sleep() with capital S. not sleep() with s .
//Sleep(1000) is 1 sec /// maybe.
clang supports sleep(), sleep(1) is for 1 sec time delay/wait.
You should work with padding on the inner container rather than with margin. Try this!
HTML
<div class="row info-panel">
<div class="col-md-4" id="server_1">
<div class="server-action-menu">
Server 1
</div>
</div>
</div>
CSS
.server-action-menu {
background-color: transparent;
background-image: linear-gradient(to bottom, rgba(30, 87, 153, 0.2) 0%, rgba(125, 185, 232, 0) 100%);
background-repeat: repeat;
border-radius:10px;
padding: 5px;
}
In my case, I created a new ChildComponent in Parentcomponent whereas both in the same module but Parent is registered in a shared module so I created ChildComponent using CLI which registered Child in the current module but my parent was registered in the shared module.
So register the ChildComponent in Shared Module manually.
It turns out that OpenSSL is compiled and enabled in php 5.3 of XAMPP 1.7.2 and so no longer requires a separate extension dll.
However, you STILL need to enable it in your PHP.ini file the line extension=php_openssl.dll
You can do it using Powershell through regex and foreach loop, if you store your values in file input.txt:
$initialNum=1; $increment=1; $tmp = Get-Content input.txt | foreach { $n = [regex]::match($_,'id="(\d+)"').groups[1
].value; if ($n) {$_ -replace "$n", ([int32]$initialNum+$increment); $increment=$increment+1;} else {$_}; }
After that you can store $tmp in file using $tmp > result.txt
. This doesn't need data to be in columns.
After Accept Answer
A method that meets these specs: (IMO, the other answers do not meet all)
It is practical/efficient when char
has a wide range. Example: CHAR_BIT
is 16
or 32
, so no use of bool Used[1 << CHAR_BIT];
Works for very long strings (use size_t
rather than int
).
Does not rely on ASCII. ( Use Upper[]
)
Defined behavior when a char
< 0. is...()
functions are defined for EOF
and unsigned char
static const char Upper[] = "ABCDEFGHIJKLMNOPQRSTUVWXYZ";
static const char Lower[] = "abcdefghijklmnopqrstuvwxyz";
void LetterOccurrences(size_t *Count, const char *s) {
memset(Count, 0, sizeof *Count * 26);
while (*s) {
unsigned char ch = *s;
if (isalpha(ch)) {
const char *caseset = Upper;
char *p = strchr(caseset, ch);
if (p == NULL) {
caseset = Lower;
p = strchr(caseset, ch);
}
if (p != NULL) {
Count[p - caseset]++;
}
}
}
}
// sample usage
char *s = foo();
size_t Count[26];
LetterOccurrences(Count, s);
for (int i=0; i<26; i++)
printf("%c : %zu\n", Upper[i], Count[i]);
}
This error was raised for me because of an unhandled exception thrown in the Public Sub New()
(Visual Basic) constructor function of the Web Page in the code behind.
If you implement the constructor function wrap the code in a Try/Catch statement and see if it solves the problem.
Without a view model you could use a simple HTML hidden input.
<input type="hidden" name="FullName" id="FullName" value="@ViewBag.FullName" />
If someone is here as in 2016 for the answer, use .fail()
for error handling as .error()
is deprecated as of jQuery 3.0
$.ajax( "example.php" )
.done(function() {
alert( "success" );
})
.fail(function(jqXHR, textStatus, errorThrown) {
//handle error here
})
I hope it helps
Try something like this:-
table {
width: 50%;
height: 50%;
border-spacing: 0;
position:absolute;
}
td {
border: 1px solid black;
}
#content {
position:absolute;
width:100%;
left:0px;
top:20px;
bottom:20px;
overflow: hidden;
}
See some example in http://www.sitepoint.com/understanding-sql-joins-mysql-database/
You can use 'USING' instead of 'ON' as in the query
SELECT * FROM table1 LEFT JOIN table2 USING (id);
I wrote the following to print a list of results to standard out based on available charsets. Note that it also tells you what line fails from a 0 based line number in case you are troubleshooting what character is causing issues.
public static void testCharset(String fileName) {
SortedMap<String, Charset> charsets = Charset.availableCharsets();
for (String k : charsets.keySet()) {
int line = 0;
boolean success = true;
try (BufferedReader b = Files.newBufferedReader(Paths.get(fileName),charsets.get(k))) {
while (b.ready()) {
b.readLine();
line++;
}
} catch (IOException e) {
success = false;
System.out.println(k+" failed on line "+line);
}
if (success)
System.out.println("************************* Successs "+k);
}
}
This question might still be visited often enough that it's worth offering an addendum to Mr Kassies' answer. The dict
built-in class can be sub-classed so that a default is returned for 'missing' keys. This mechanism works well for pandas. But see below.
In this way it's possible to avoid key errors.
>>> import pandas as pd
>>> data = { 'ID': [ 101, 201, 301, 401 ] }
>>> df = pd.DataFrame(data)
>>> class SurnameMap(dict):
... def __missing__(self, key):
... return ''
...
>>> surnamemap = SurnameMap()
>>> surnamemap[101] = 'Mohanty'
>>> surnamemap[301] = 'Drake'
>>> df['Surname'] = df['ID'].apply(lambda x: surnamemap[x])
>>> df
ID Surname
0 101 Mohanty
1 201
2 301 Drake
3 401
The same thing can be done more simply in the following way. The use of the 'default' argument for the get
method of a dict object makes it unnecessary to subclass a dict.
>>> import pandas as pd
>>> data = { 'ID': [ 101, 201, 301, 401 ] }
>>> df = pd.DataFrame(data)
>>> surnamemap = {}
>>> surnamemap[101] = 'Mohanty'
>>> surnamemap[301] = 'Drake'
>>> df['Surname'] = df['ID'].apply(lambda x: surnamemap.get(x, ''))
>>> df
ID Surname
0 101 Mohanty
1 201
2 301 Drake
3 401
Easy Method is: Just copy the file cmd.exe from c:/windows/system32/ and paste it to C:\xampp\php\ and run it, when the cmd opens type " php -v " without quotes and hit enter... you will get your php version.. thank you
openssl rsa -in privkey.pem -pubout > key.pub
That writes the public key to key.pub
You can add an conditional statement. If your array goes beyond index, then break and print the rest of the file.
This :
$a = array ('zero','one','two', 'three');
foreach ($a as &$v) {
}
foreach ($a as $v) {
echo $v.PHP_EOL;
}
is the same as
$a = array ('zero','one','two', 'three');
$v = &$a[3];
for ($i = 0; $i < 4; $i++) {
$v = $a[$i];
echo $v.PHP_EOL;
}
OR
$a = array ('zero','one','two', 'three');
for ($i = 0; $i < 4; $i++) {
$a[3] = $a[$i];
echo $a[3].PHP_EOL;
}
OR
$a = array ('zero','one','two', 'three');
$a[3] = $a[0];
echo $a[3].PHP_EOL;
$a[3] = $a[1];
echo $a[3].PHP_EOL;
$a[3] = $a[2];
echo $a[3].PHP_EOL;
$a[3] = $a[3];
echo $a[3].PHP_EOL;
Include js files of datepicker and language (locales)
'resource/bower_components/bootstrap-datepicker/dist/js/bootstrap-datepicker.min.js',
'resource/bower_components/bootstrap-datepicker/dist/locales/bootstrap-datepicker.sv.min.js',
In the options of the datepicker, set the language as below:
$('.datepicker').datepicker({'language' : 'sv'});
Sometimes you want to save the output, if it's non-empty, to pass it to another command. If so, you could use something like
list=`grep -l "MY_DESIRED_STRING" *.log `
if [ $? -eq 0 ]
then
/bin/rm $list
fi
This way, the rm
command won't hang if the list is empty.
what is Intent ?
It is a kind of message or information that is passed to the components. It is used to launch an activity, display a web page, send sms, send email etc.
There are two types of intents in android:
Implicit Intent
Explicit Intent
Implicit intent is used to invoke the system components
Example
Intent i = newIntent(android.content.Intent.ACTION_VIEW,Uri.parse(“http://www.amazon.com”));
startActivity(i);
Explicit intent is used to invoke the activity class.
Example
Intent intent = newIntent (this, SecondActivity.class);
startActivity(intent);
you can read more
http://www.vogella.com/tutorials/AndroidIntent/article.html#intents_overview http://developer.android.com/reference/android/content/Intent.html
You need to be at MySQL version 5.6.4 or later to declare columns with fractional-second time datatypes. Not sure you have the right version? Try SELECT NOW(3)
. If you get an error, you don't have the right version.
For example, DATETIME(3)
will give you millisecond resolution in your timestamps, and TIMESTAMP(6)
will give you microsecond resolution on a *nix-style timestamp.
Read this: https://dev.mysql.com/doc/refman/8.0/en/fractional-seconds.html
NOW(3)
will give you the present time from your MySQL server's operating system with millisecond precision.
If you have a number of milliseconds since the Unix epoch, try this to get a DATETIME(3) value
FROM_UNIXTIME(ms * 0.001)
Javascript timestamps, for example, are represented in milliseconds since the Unix epoch.
(Notice that MySQL internal fractional arithmetic, like * 0.001
, is always handled as IEEE754 double precision floating point, so it's unlikely you'll lose precision before the Sun becomes a white dwarf star.)
If you're using an older version of MySQL and you need subsecond time precision, your best path is to upgrade. Anything else will force you into doing messy workarounds.
If, for some reason you can't upgrade, you could consider using BIGINT
or DOUBLE
columns to store Javascript timestamps as if they were numbers. FROM_UNIXTIME(col * 0.001)
will still work OK. If you need the current time to store in such a column, you could use UNIX_TIMESTAMP() * 1000
var file = $('#YOURID > input[type="file"]');
file.value; // filename will be,
In Chrome, it will be something like C:\fakepath\FILE_NAME
or undefined
if no file was selected.
It is a limitation or intention that the browser does not reveal the file structure of the local machine.
Doing it in code is is IMO wrong and even more so if you put it into the onCreate. Do it in the manifest and the "system" knows the orientation from the startup of the app. And this type of meta or top level "guidance" SHOULD be in the manifest. If you want to prove it to yourself set a break in the Activity's onCreate. If you do it in code there it will be called twice : it starts up in Portrait mode then is switched to Landscape. This does not happen if you do it in the manifest.
Depends on whether or not your array is holding a null-terminated string. If so, then
if(text[0] == '\0') {}
should be sufficient.
Edit: Another method would be...
if (strcmp(text, "") == 0)
which is potentially less efficient but clearly expresses your intent.
This may be late but hope this may help.. Try this....
public void writefile()
{
File externalStorageDir = Environment.getExternalStorageDirectory();
File myFile = new File(externalStorageDir , "yourfilename.txt");
if(myFile.exists())
{
try
{
FileOutputStream fostream = new FileOutputStream(myFile);
OutputStreamWriter oswriter = new OutputStreamWriter(fostream);
BufferedWriter bwriter = new BufferedWriter(oswriter);
bwriter.write("Hi welcome ");
bwriter.newLine();
bwriter.close();
oswriter.close();
fostream.close();
}
catch (IOException e)
{
e.printStackTrace();
}
}
else
{
try {
myFile.createNewFile();
}
catch (IOException e)
{
e.printStackTrace();
}
}
here bfwritter.newline
writes your text into the file. And add the permission
<uses-permission android:name = "android.permission.WRITE_EXTERNAL_STORAGE"/>
in your manifest file without fail.
Using ajaxSetup is not correct, as is noted on its doc page. It only sets up defaults, and if some requests override them there will be a mess.
I am way late to the party, but just for future reference if someone is looking for a solution to the same problem, here is my go at it, inspired by and largely identical to the previous answers, but more complete
// Automatically cancel unfinished ajax requests
// when the user navigates elsewhere.
(function($) {
var xhrPool = [];
$(document).ajaxSend(function(e, jqXHR, options){
xhrPool.push(jqXHR);
});
$(document).ajaxComplete(function(e, jqXHR, options) {
xhrPool = $.grep(xhrPool, function(x){return x!=jqXHR});
});
var abort = function() {
$.each(xhrPool, function(idx, jqXHR) {
jqXHR.abort();
});
};
var oldbeforeunload = window.onbeforeunload;
window.onbeforeunload = function() {
var r = oldbeforeunload ? oldbeforeunload() : undefined;
if (r == undefined) {
// only cancel requests if there is no prompt to stay on the page
// if there is a prompt, it will likely give the requests enough time to finish
abort();
}
return r;
}
})(jQuery);
Your data types are mismatched when you are retrieving the field values. Check your code and ensure that for each field that you are retrieving that the java object matches that type. For example, retrieving a date into and int. If you are doing a select * then it is possible a change in the fields of the table has happened causing this error to occur. Your SQL should only select the fields you specifically want in order to avoid this error.
Hope this helps.
Use .. LIMIT :pageSize OFFSET :pageStart
Where :pageStart
is bound to the_page_index (i.e. 0 for the first page) * number_of_items_per_pages (e.g. 4) and :pageSize
is bound to number_of_items_per_pages.
To detect for "has more pages", either use SQL_CALC_FOUND_ROWS or use .. LIMIT :pageSize OFFSET :pageStart + 1
and detect a missing last (pageSize+1) record. Needless to say, for pages with an index > 0, there exists a previous page.
If the page index value is embedded in the URL (e.g. in "prev page" and "next page" links) then it can be obtained via the appropriate $_GET
item.
<!-- change id attribute to name -->
<form method="post" action="yourUrl" name="theForm">
<button onclick="placeOrder()">Place Order</button>
</form>
function placeOrder () {
document.theForm.submit()
}
Just replace and
with ,
and you're done:
try:
with open('a', 'w') as a, open('b', 'w') as b:
do_something()
except IOError as e:
print 'Operation failed: %s' % e.strerror
Just for completeness, changing overflow
to auto
/hidden
should do the trick too.
body {_x000D_
margin: 0px;_x000D_
padding: 0px;_x000D_
}_x000D_
_x000D_
header {_x000D_
margin: 0px;_x000D_
padding: 0px;_x000D_
height: 20em;_x000D_
background-color: #C0C0C0;_x000D_
overflow: auto;_x000D_
}
_x000D_
<header>_x000D_
<h1>OQ Online Judge</h1>_x000D_
_x000D_
<form action="<?php echo base_url();?>/index.php/base/si" method="post">_x000D_
<label for="email1">E-mail :</label>_x000D_
<input type="text" name="email" id="email1">_x000D_
<label for="password1">Password :</label>_x000D_
<input type="password" name="password" id="password1">_x000D_
<input type="submit" name="submit" value="Login">_x000D_
</form>_x000D_
</header>
_x000D_
Maybe this is better:
const withQuery = require('with-query');
fetch(withQuery('https://api.github.com/search/repositories', {
q: 'query',
sort: 'stars',
order: 'asc',
}))
.then(res => res.json())
.then((json) => {
console.info(json);
})
.catch((err) => {
console.error(err);
});
Under Windows dont forget to set
SET HTTPS_PROXY=<proxyHost>:<proxyPort>
what I needed to set for
pip install pep8
Is it possible to do it this way, as opposed to using something like Raphael or jQuery SVG?
Definitely.
If it is possible, what's the technique?
This annotated code snippet works:
<!DOCTYPE html>
<html>
<head>
<title>SVG Illustrator Test</title>
</head>
<body>
<object data="alpha.svg" type="image/svg+xml"
id="alphasvg" width="100%" height="100%"></object>
<script>
var a = document.getElementById("alphasvg");
// It's important to add an load event listener to the object,
// as it will load the svg doc asynchronously
a.addEventListener("load",function(){
// get the inner DOM of alpha.svg
var svgDoc = a.contentDocument;
// get the inner element by id
var delta = svgDoc.getElementById("delta");
// add behaviour
delta.addEventListener("mousedown",function(){
alert('hello world!')
}, false);
}, false);
</script>
</body>
</html>
Note that a limitation of this technique is that it is restricted by the same-origin policy, so alpha.svg
must be hosted on the same domain as the .html
file, otherwise the inner DOM of the object will be inaccessible.
Important thing to run this HTML, you need host HTML file to web server like IIS, Tomcat
$destroy
can refer to 2 things: method and event
.directive("colorTag", function(){
return {
restrict: "A",
scope: {
value: "=colorTag"
},
link: function (scope, element, attrs) {
var colors = new App.Colors();
element.css("background-color", stringToColor(scope.value));
element.css("color", contrastColor(scope.value));
// Destroy scope, because it's no longer needed.
scope.$destroy();
}
};
})
See @SunnyShah's answer.
another way to create a data url from blob url may be using canvas.
var canvas = document.createElement("canvas")
var context = canvas.getContext("2d")
context.drawImage(img, 0, 0) // i assume that img.src is your blob url
var dataurl = canvas.toDataURL("your prefer type", your prefer quality)
as what i saw in mdn, canvas.toDataURL is supported well by browsers. (except ie<9, always ie<9)
Most probably it has to do with caching on the device. Catching the exception and ignoring is not nice but my problem was fixed and it seems to work.
I Think that the problem is about encoding. That's why removing first line(with encoding byte) might solve the problem.
My solution for Data at the root level is invalid. Line 1, position 1.
in XDocument.Parse(xmlString)
was replacing it with XDocument.Load( new MemoryStream( xmlContentInBytes ) );
I've noticed that my xml string looked ok:
<?xml version="1.0" encoding="utf-8"?>
but in different text editor encoding it looked like this:
?<?xml version="1.0" encoding="utf-8"?>
At the end i did not need the xml string but xml byte[]. If you need to use the string you should look for "invisible" bytes in your string and play with encodings to adjust the xml content for parsing or loading.
Hope it will help
Endpoint, in the OpenID authentication lingo, is the URL to which you send (POST) the authentication request.
Excerpts from Google authentication API
To get the Google OpenID endpoint, perform discovery by sending either a GET or HEAD HTTP request to https://www.google.com/accounts/o8/id. When using a GET, we recommend setting the Accept header to "application/xrds+xml". Google returns an XRDS document containing an OpenID provider endpoint URL.The endpoint address is annotated as:
<Service priority="0">
<Type>http://specs.openid.net/auth/2.0/server</Type>
<URI>{Google's login endpoint URI}</URI>
</Service>
Once you've acquired the Google endpoint, you can send authentication requests to it, specifying the appropriate parameters (available at the linked page). You connect to the endpoint by sending a request to the URL or by making an HTTP POST request.
If by saying without destroying it, you mean to a keep a reference to the children, you can do:
var oldChildren = [];
while(element.hasChildNodes()) {
oldChildren.push(element.removeChild(element.firstChild));
}
Regarding the original tagging (html css
) of your question:
You cannot remove content with CSS. You could only hide it. E.g. you can hide all children of a certain node with:
#someID > * {
display: none;
}
This doesn't work in IE6 though (but you could use #someID *
).
New line depends on your OS:
DOS & Windows: \r\n 0D0A (hex), 13,10 (decimal)
Unix & Mac OS X: \n, 0A, 10
Macintosh (OS 9): \r, 0D, 13
More details here: https://ccrma.stanford.edu/~craig/utility/flip/
When in doubt, use any freeware hex viewer/editor to see how a file encodes its new line.
For me, I use following guide to help me remember: 0D0A = \r\n = CR,LF = carriage return, line feed
Hope you don't mind but I cobbled together all the helpful stuff, from above, and came up with a complete class ready for testing...
import java.awt.Desktop;
import java.io.IOException;
import java.net.URI;
import java.net.URISyntaxException;
public class MultiBrowPop {
public static void main(String[] args) {
OUT("\nWelcome to Multi Brow Pop.\nThis aims to popup a browsers in multiple operating systems.\nGood luck!\n");
String url = "http://www.birdfolk.co.uk/cricmob";
OUT("We're going to this page: "+ url);
String myOS = System.getProperty("os.name").toLowerCase();
OUT("(Your operating system is: "+ myOS +")\n");
try {
if(Desktop.isDesktopSupported()) { // Probably Windows
OUT(" -- Going with Desktop.browse ...");
Desktop desktop = Desktop.getDesktop();
desktop.browse(new URI(url));
} else { // Definitely Non-windows
Runtime runtime = Runtime.getRuntime();
if(myOS.contains("mac")) { // Apples
OUT(" -- Going on Apple with 'open'...");
runtime.exec("open " + url);
}
else if(myOS.contains("nix") || myOS.contains("nux")) { // Linux flavours
OUT(" -- Going on Linux with 'xdg-open'...");
runtime.exec("xdg-open " + url);
}
else
OUT("I was unable/unwilling to launch a browser in your OS :( #SadFace");
}
OUT("\nThings have finished.\nI hope you're OK.");
}
catch(IOException | URISyntaxException eek) {
OUT("**Stuff wrongly: "+ eek.getMessage());
}
}
private static void OUT(String str) {
System.out.println(str);
}
}
Here is the code:-
telephonyManager = (TelephonyManager)context.getSystemService(Context.TELEPHONY_SERVICE);
deviceId = telephonyManager.getDeviceId();
Log.d(TAG, "getDeviceId() " + deviceId);
phoneType = telephonyManager.getPhoneType();
Log.d(TAG, "getPhoneType () " + phoneType);
You could do this:
SELECT t.name AS table_name,
SCHEMA_NAME(schema_id) AS schema_name,
c.name AS column_name
FROM sys.tables AS t
INNER JOIN sys.columns c ON t.OBJECT_ID = c.OBJECT_ID
WHERE c.name LIKE '%MyColumn%'
ORDER BY schema_name, table_name;
Reference:
This is how you would drop the constraint
ALTER TABLE <schema_name, sysname, dbo>.<table_name, sysname, table_name>
DROP CONSTRAINT <default_constraint_name, sysname, default_constraint_name>
GO
With a script
-- t-sql scriptlet to drop all constraints on a table
DECLARE @database nvarchar(50)
DECLARE @table nvarchar(50)
set @database = 'dotnetnuke'
set @table = 'tabs'
DECLARE @sql nvarchar(255)
WHILE EXISTS(select * from INFORMATION_SCHEMA.TABLE_CONSTRAINTS where constraint_catalog = @database and table_name = @table)
BEGIN
select @sql = 'ALTER TABLE ' + @table + ' DROP CONSTRAINT ' + CONSTRAINT_NAME
from INFORMATION_SCHEMA.TABLE_CONSTRAINTS
where constraint_catalog = @database and
table_name = @table
exec sp_executesql @sql
END
Credits go to Jon Galloway http://weblogs.asp.net/jgalloway/archive/2006/04/12/442616.aspx
It is there to specify another column as the default id column of the other table, e.g. consider the following
TableA
id int identity
tableb_key varchar
TableB
id int identity
key varchar unique
// in class for TableA
@JoinColumn(name="tableb_key", referencedColumnName="key")
y my case i solved this by named it in the "Identifier" property of Table View Cell:
Don't forgot: to declare in your Class: UITableViewDataSource
let cell = tableView.dequeueReusableCell(withIdentifier: "cell", for: indexPath) as UITableViewCell
String strConnection = Properties.Settings.Default.BooksConnectionString;
SqlConnection con = new SqlConnection(strConnection);
SqlCommand sqlCmd = new SqlCommand();
sqlCmd.Connection = con;
sqlCmd.CommandType = CommandType.Text;
sqlCmd.CommandText = "Select * from titles";
SqlDataAdapter sqlDataAdap = new SqlDataAdapter(sqlCmd);
DataTable dtRecord = new DataTable();
sqlDataAdap.Fill(dtRecord);
dataGridView1.DataSource = dtRecord;
If you have the environment variables in an env.sh
locally and want to set it up when the container starts, you could try
COPY env.sh /env.sh
COPY <filename>.jar /<filename>.jar
ENTRYPOINT ["/bin/bash" , "-c", "source /env.sh && printenv && java -jar /<filename>.jar"]
This command would start the container with a bash shell (I want a bash shell since source
is a bash command), sources the env.sh
file(which sets the environment variables) and executes the jar file.
The env.sh
looks like this,
#!/bin/bash
export FOO="BAR"
export DB_NAME="DATABASE_NAME"
I added the printenv
command only to test that actual source command works. You should probably remove it when you confirm the source command works fine or the environment variables would appear in your docker logs.
@POST
@Path ("Employee")
@Consumes("application/json")
@Produces("application/json")
public JSONObject postEmployee(JSONObject jsonObject)throws Exception{
return jsonObject;
}
This is all you need, in order to run a virtual environment in python / python3
First if virtualenv
not installed, run
pip3 install virtualenv
Now Run:
virtualenv -p python3 <env name>
Sometime the cmd virtualenv
fails, if so use this:
python3 -m virtualenv <env_name> # you can specify full path instead <env_name> to install the file in a different location other than the current location
Now activate the virtual env:
source <env_name>/bin/activate
Or:
source `pwd`/<env_name>/bin/activate
Now run
which python
You should see the full path to your dir and <env_name>/bin/python
suffix
To exit the virtualenv, run:
deactivate
Copyed the *.jar into my WEB-INF/lib folder -> Worked for me. When including over buildpath there was everytime this errormsg.
I'm in the same boat. I wrote a little bash script to manage them. https://github.com/thejeffreystone/setgit
#!/bin/bash
# setgit
#
# Script to manage multiple global gitconfigs
#
# To save your current .gitconfig to .gitconfig-this just run:
# setgit -s this
#
# To load .gitconfig-this to .gitconfig it run:
# setgit -f this
#
#
#
# Author: Jeffrey Stone <[email protected]>
usage(){
echo "$(basename $0) [-h] [-f name]"
echo ""
echo "where:"
echo " -h Show Help Text"
echo " -f Load the .gitconfig file based on option passed"
echo ""
exit 1
}
if [ $# -lt 1 ]
then
usage
exit
fi
while getopts ':hf:' option; do
case "$option" in
h) usage
exit
;;
f) echo "Loading .gitconfig from .gitconfig-$OPTARG"
cat ~/.gitconfig-$OPTARG > ~/.gitconfig
;;
*) printf "illegal option: '%s'\n" "$OPTARG" >&2
echo "$usage" >&2
exit 1
;;
esac
done
Simply Answer you can use like this
public class MainActivity extends AppCompatActivity {
@Override
protected void onCreate(Bundle savedInstanceState) {
super.onCreate(savedInstanceState);
WebView webView = new WebView(this);
setContentView(webView);
webView.setWebViewClient(new WebViewClient());
webView.loadUrl("http://www.google.com");
}
}
Another alternative, even though the OP did not ask for it:
There exist usb-to-serial adapters. Depending on the type of adapter, you may also need a nullmodem cable, too.
They are extremely easy to use under linux, work under windows, too, if you have got working drivers installed.
That way you can work directly with the sensors, and you do not have to try and emulate data. That way you are maybe even save from building an anemic system. (Due to your emulated data inputs not covering all cases, leading you to a brittle system.)
Its often better to work with the real stuff.
You must ensure that you add the location of your .class
file to your classpath. So, if its in the current folder, add .
to your classpath.
Note that the Windows classpath separator is a semi-colon, i.e. a ;
.
On Windows, check out BugTrap. Its not longer at the original link, but its still available on CodeProject.
You can try RuneCountInString
from the utf8 package.
returns the number of runes in p
that, as illustrated in this script: the length of "World" might be 6 (when written in Chinese: "??"), but its rune count is 2:
package main
import "fmt"
import "unicode/utf8"
func main() {
fmt.Println("Hello, ??", len("??"), utf8.RuneCountInString("??"))
}
Phrozen adds in the comments:
Actually you can do len()
over runes by just type casting.
len([]rune("??"))
will print 2
. At leats in Go 1.3.
And with CL 108985 (May 2018, for Go 1.11), len([]rune(string))
is now optimized. (Fixes issue 24923)
The compiler detects len([]rune(string))
pattern automatically, and replaces it with for r := range s call.
Adds a new runtime function to count runes in a string. Modifies the compiler to detect the pattern
len([]rune(string))
and replaces it with the new rune counting runtime function.RuneCount/lenruneslice/ASCII 27.8ns ± 2% 14.5ns ± 3% -47.70% RuneCount/lenruneslice/Japanese 126ns ± 2% 60 ns ± 2% -52.03% RuneCount/lenruneslice/MixedLength 104ns ± 2% 50 ns ± 1% -51.71%
Stefan Steiger points to the blog post "Text normalization in Go"
What is a character?
As was mentioned in the strings blog post, characters can span multiple runes.
For example, an 'e
' and '?´?´' (acute "\u0301") can combine to form 'é' ("e\u0301
" in NFD). Together these two runes are one character.The definition of a character may vary depending on the application.
For normalization we will define it as:
- a sequence of runes that starts with a starter,
- a rune that does not modify or combine backwards with any other rune,
- followed by possibly empty sequence of non-starters, that is, runes that do (typically accents).
The normalization algorithm processes one character at at time.
Using that package and its Iter
type, the actual number of "character" would be:
package main
import "fmt"
import "golang.org/x/text/unicode/norm"
func main() {
var ia norm.Iter
ia.InitString(norm.NFKD, "école")
nc := 0
for !ia.Done() {
nc = nc + 1
ia.Next()
}
fmt.Printf("Number of chars: %d\n", nc)
}
Here, this uses the Unicode Normalization form NFKD "Compatibility Decomposition"
Oliver's answer points to UNICODE TEXT SEGMENTATION as the only way to reliably determining default boundaries between certain significant text elements: user-perceived characters, words, and sentences.
For that, you need an external library like rivo/uniseg, which does Unicode Text Segmentation.
That will actually count "grapheme cluster", where multiple code points may be combined into one user-perceived character.
package uniseg
import (
"fmt"
"github.com/rivo/uniseg"
)
func main() {
gr := uniseg.NewGraphemes("!")
for gr.Next() {
fmt.Printf("%x ", gr.Runes())
}
// Output: [1f44d 1f3fc] [21]
}
Two graphemes, even though there are three runes (Unicode code points).
You can see other examples in "How to manipulate strings in GO to reverse them?"
? alone is one grapheme, but, from unicode to code points converter, 4 runes:
Forget using another plugin:
Here are 3 methods to close a jquery UI dialog when clicking outside popin:
If the dialog is modal/has background overlay: http://jsfiddle.net/jasonday/6FGqN/
jQuery(document).ready(function() {
jQuery("#dialog").dialog({
bgiframe: true,
autoOpen: false,
height: 100,
modal: true,
open: function(){
jQuery('.ui-widget-overlay').bind('click',function(){
jQuery('#dialog').dialog('close');
})
}
});
});
If dialog is non-modal Method 1: method 1: http://jsfiddle.net/jasonday/xpkFf/
// Close Pop-in If the user clicks anywhere else on the page
jQuery('body')
.bind(
'click',
function(e){
if(
jQuery('#dialog').dialog('isOpen')
&& !jQuery(e.target).is('.ui-dialog, a')
&& !jQuery(e.target).closest('.ui-dialog').length
){
jQuery('#dialog').dialog('close');
}
}
);
Non-Modal dialog Method 2: http://jsfiddle.net/jasonday/eccKr/
$(function() {
$( "#dialog" ).dialog({
autoOpen: false,
minHeight: 100,
width: 342,
draggable: true,
resizable: false,
modal: false,
closeText: 'Close',
open: function() {
closedialog = 1;
$(document).bind('click', overlayclickclose);
},
focus: function() {
closedialog = 0;
},
close: function() {
$(document).unbind('click');
}
});
$('#linkID').click(function() {
$('#dialog').dialog('open');
closedialog = 0;
});
var closedialog;
function overlayclickclose() {
if (closedialog) {
$('#dialog').dialog('close');
}
//set to one because click on dialog box sets to zero
closedialog = 1;
}
});
When you work with unsigned types, modular arithmetic (also known as "wrap around" behavior) is taking place. To understand this modular arithmetic, just have a look at these clocks:
9 + 4 = 1 (13 mod 12), so to the other direction it is: 1 - 4 = 9 (-3 mod 12). The same principle is applied while working with unsigned types. If the result type is unsigned
, then modular arithmetic takes place.
Now look at the following operations storing the result as an unsigned int
:
unsigned int five = 5, seven = 7;
unsigned int a = five - seven; // a = (-2 % 2^32) = 4294967294
int one = 1, six = 6;
unsigned int b = one - six; // b = (-5 % 2^32) = 4294967291
When you want to make sure that the result is signed
, then stored it into signed
variable or cast it to signed
. When you want to get the difference between numbers and make sure that the modular arithmetic will not be applied, then you should consider using abs()
function defined in stdlib.h
:
int c = five - seven; // c = -2
int d = abs(five - seven); // d = 2
Be very careful, especially while writing conditions, because:
if (abs(five - seven) < seven) // = if (2 < 7)
// ...
if (five - seven < -1) // = if (-2 < -1)
// ...
if (one - six < 1) // = if (-5 < 1)
// ...
if ((int)(five - seven) < 1) // = if (-2 < 1)
// ...
but
if (five - seven < 1) // = if ((unsigned int)-2 < 1) = if (4294967294 < 1)
// ...
if (one - six < five) // = if ((unsigned int)-5 < 5) = if (4294967291 < 5)
// ...
It's all a perceptual thing. Git is generally rather good at recognising moves, because GIT is a content tracker
All that really depends is how your "stat" displays it. The only difference here is the -M flag.
git log --stat -M
commit 9c034a76d394352134ee2f4ede8a209ebec96288
Author: Kent Fredric
Date: Fri Jan 9 22:13:51 2009 +1300
Category Restructure
lib/Gentoo/Repository.pm | 10 +++++-----
lib/Gentoo/{ => Repository}/Base.pm | 2 +-
lib/Gentoo/{ => Repository}/Category.pm | 12 ++++++------
lib/Gentoo/{ => Repository}/Package.pm | 10 +++++-----
lib/Gentoo/{ => Repository}/Types.pm | 10 +++++-----
5 files changed, 22 insertions(+), 22 deletions(-)
git log --stat
commit 9c034a76d394352134ee2f4ede8a209ebec96288
Author: Kent Fredric
Date: Fri Jan 9 22:13:51 2009 +1300
Category Restructure
lib/Gentoo/Base.pm | 36 ------------------------
lib/Gentoo/Category.pm | 51 ----------------------------------
lib/Gentoo/Package.pm | 41 ---------------------------
lib/Gentoo/Repository.pm | 10 +++---
lib/Gentoo/Repository/Base.pm | 36 ++++++++++++++++++++++++
lib/Gentoo/Repository/Category.pm | 51 ++++++++++++++++++++++++++++++++++
lib/Gentoo/Repository/Package.pm | 41 +++++++++++++++++++++++++++
lib/Gentoo/Repository/Types.pm | 55 +++++++++++++++++++++++++++++++++++++
lib/Gentoo/Types.pm | 55 -------------------------------------
9 files changed, 188 insertions(+), 188 deletions(-)
git help log
-M
Detect renames.
-C
Detect copies as well as renames. See also --find-copies-harder.
Joshua Bloch, the author of LinkedList:
Does anyone actually use LinkedList? I wrote it, and I never use it.
Link: https://twitter.com/joshbloch/status/583813919019573248
I'm sorry for the answer for being not that informative as the other answers, but I thought it would be the most interesting and self-explanatory.
Got this error when using SaveChanges(false) and then later SaveChanges() on the same context, in a unitofwork where multiple rows were being deleted from two tables (in the context)(SaveChanges(False) was in one of the deletes. Then in the calling function SaveChanges() was being called.... The solution was to remove the unnecessary SaveChanges(false).
While the official docs are happy not to provide switch, I have seen a solution using dictionaries.
For example:
# define the function blocks
def zero():
print "You typed zero.\n"
def sqr():
print "n is a perfect square\n"
def even():
print "n is an even number\n"
def prime():
print "n is a prime number\n"
# map the inputs to the function blocks
options = {0 : zero,
1 : sqr,
4 : sqr,
9 : sqr,
2 : even,
3 : prime,
5 : prime,
7 : prime,
}
Then the equivalent switch block is invoked:
options[num]()
This begins to fall apart if you heavily depend on fall through.
you have many HTML and java script mistakes includes:
tag, using non UTF-8 encoding for form submission, no need,...
You must use document.forms.FORMNAME
or document.forms[0]
for first appear form in page
Corrected:
function validate_frm_new_user_request()_x000D_
{_x000D_
alert('test');_x000D_
var valid = true;_x000D_
_x000D_
if ( document.forms.frm_new_user_request.u_userid.value == "" )_x000D_
{_x000D_
alert ( "Please enter your valid ISID Information." );_x000D_
document.forms.frm_new_user_request.u_userid.focus();_x000D_
valid = false;_x000D_
console.log("FALSE::Empty Value ");_x000D_
}_x000D_
return valid;_x000D_
}
_x000D_
<html lang="en" xml:lang="en" xmlns="http://www.w3.org/1999/xhtml">_x000D_
<head>_x000D_
<title></title>_x000D_
<meta content="text/html;charset=UTF-8" http-equiv="content-type" />_x000D_
_x000D_
_x000D_
</head>_x000D_
<body>_x000D_
<form method="post" action="" name="frm_new_user_request" id="frm_new_user_request" onsubmit="return validate_frm_new_user_request();">_x000D_
<center>_x000D_
<table>_x000D_
_x000D_
<tr align="left">_x000D_
<td><Label>ISID<em>*:</Label><input maxlength="15" id="u_userid" name="u_userid" size="20" type="text"/></td>_x000D_
</tr>_x000D_
_x000D_
<tr>_x000D_
<td align="center" colspan="4">_x000D_
<input type="image" src="btn.png" border="0" ALT="Create New Request">_x000D_
_x000D_
</td>_x000D_
</tr>_x000D_
</table>_x000D_
</form>_x000D_
</body>_x000D_
</html>
_x000D_
You can put CSS in the head
of the HTML file, and it will take precedent over a class in an included style sheet.
<style>
.thing{
color: #f00;
}
</style>
#floating-panel {
position: absolute;
top: 10px;
left: 25%;
z-index: 5;
background-color: #fff;
padding: 5px;
border: 1px solid #999;
text-align: center;
font-family: 'Roboto','sans-serif';
line-height: 30px;
padding-left: 10px;
}
Just need to move the map below this box. Work to me.
From Google
I also had entries in:
/Library/Receipts/InstallHistory.plist
that i had to delete.
public static Color hex2Rgb(String colorStr) {
try {
// Create the color
return new Color(
// Using Integer.parseInt() with a radix of 16
// on string elements of 2 characters. Example: "FF 05 E5"
Integer.parseInt(colorStr.substring(0, 2), 16),
Integer.parseInt(colorStr.substring(2, 4), 16),
Integer.parseInt(colorStr.substring(4, 6), 16));
} catch (StringIndexOutOfBoundsException e){
// If a string with a length smaller than 6 is inputted
return new Color(0,0,0);
}
}
public static String rgbToHex(Color color) {
// Integer.toHexString(), built in Java method Use this to add a second 0 if the
// .Get the different RGB values and convert them. output will only be one character.
return Integer.toHexString(color.getRed()).toUpperCase() + (color.getRed() < 16 ? 0 : "") + // Add String
Integer.toHexString(color.getGreen()).toUpperCase() + (color.getGreen() < 16 ? 0 : "") +
Integer.toHexString(color.getBlue()).toUpperCase() + (color.getBlue() < 16 ? 0 : "");
}
I think that this wil work.
You can also just Marshal.Copy the bitmap data. No intermediary memorystream etc. and a fast memory copy. This should work on both 24-bit and 32-bit bitmaps.
public static byte[] BitmapToByteArray(Bitmap bitmap)
{
BitmapData bmpdata = null;
try
{
bmpdata = bitmap.LockBits(new Rectangle(0, 0, bitmap.Width, bitmap.Height), ImageLockMode.ReadOnly, bitmap.PixelFormat);
int numbytes = bmpdata.Stride * bitmap.Height;
byte[] bytedata = new byte[numbytes];
IntPtr ptr = bmpdata.Scan0;
Marshal.Copy(ptr, bytedata, 0, numbytes);
return bytedata;
}
finally
{
if (bmpdata != null)
bitmap.UnlockBits(bmpdata);
}
}
.
I think this will do:
$('#'+div_id+' .widget-head > span').text("new dialog title");
$(document).ready(my_function);
Or
$(document).ready(function () {
// Function code here.
});
Or the shorter but less readable variant:
$(my_function);
All of these will cause my_function to be called after the DOM loads.
See the ready event documentation for more details.
Binds a function to be executed whenever the DOM is ready to be traversed and manipulated.
Edit:
To simulate a click, use the click() method without arguments:
$('#button').click();
From the docs:
Triggers the click event of each matched element. Causes all of the functions that have been bound to that click event to be executed.
To put it all together, the following code simulates a click when the document finishes loading:
$(function () {
$('#button').click();
});
// in foo.h
class Foo {
static const unsigned char* Msg;
};
// in foo.cpp
static const unsigned char Foo_Msg_data[] = {0x00,0x01};
const unsigned char* Foo::Msg = Foo_Msg_data;
try
enum E {
E1, E2, E3
}
public static void main(String[] args) throws Exception {
List<E> list = Arrays.asList(E.values());
System.out.println(list);
}
None of these answers helped me. Then I tried to reinstall Cocoapods:
pod deintegrate
pod install
Problem solved!
The following aims to extract configuration, hook into Date.protoype
and apply configuration.
I've used an Array
to store time chunks and when I push()
this
as a Date
object, it returns me the length to iterate. When I'm done, I can use join
on the return
value.
This seems to work pretty fast: 0.016ms
// Date protoype
Date.prototype.formatTime = function (options) {
var i = 0,
time = [],
len = time.push(this.getHours(), this.getMinutes(), this.getSeconds());
for (; i < len; i += 1) {
var tick = time[i];
time[i] = tick < 10 ? options.pad + tick : tick;
}
return time.join(options.separator);
};
// Setup output
var cfg = {
fieldClock: "#fieldClock",
options: {
pad: "0",
separator: ":",
tick: 1000
}
};
// Define functionality
function startTime() {
var clock = $(cfg.fieldClock),
now = new Date().formatTime(cfg.options);
clock.val(now);
setTimeout(startTime, cfg.options.tick);
}
// Run once
startTime();
Make an /login url, than accept "user" and "password" parameters via GET and don't require basic auth. Here, use php, node, java, whatever and parse your passwd file and match parameters (user/pass) against it. If there is a match then redirect to http://user:[email protected]/ (this will set credential on your browser) if not, send 401 response (without WWW-Authenticate header).
You should use the OpenFileDialog class like this
Dim fd As OpenFileDialog = New OpenFileDialog()
Dim strFileName As String
fd.Title = "Open File Dialog"
fd.InitialDirectory = "C:\"
fd.Filter = "All files (*.*)|*.*|All files (*.*)|*.*"
fd.FilterIndex = 2
fd.RestoreDirectory = True
If fd.ShowDialog() = DialogResult.OK Then
strFileName = fd.FileName
End If
Then you can use the File class.
You can use .map
: http://jsfiddle.net/9ndcL/1/.
// array of text of each td
var texts = $("td").map(function() {
return $(this).text();
});
document.getElementById("#elment").click()
Simply select the element from the DOM. The node has a click function, which you can call.
Use arrays:
{
"number": ["1", "2", "3"],
"alphabet": ["a", "b", "c"]
}
You can the access the different values from their position in the array. Counting starts at left of array at 0. myJsonObject["number"][0] == 1
or myJsonObject["alphabet"][2] == 'c'
On your servlet simply override the service method of your servlet so that you can add headers for all your http methods (POST, GET, DELETE, PUT, etc...).
@Override
protected void service(HttpServletRequest req, HttpServletResponse res) throws ServletException, IOException {
if(("http://www.example.com").equals(req.getHeader("origin"))){
res.setHeader("Access-Control-Allow-Origin", req.getHeader("origin"));
res.setHeader("Access-Control-Allow-Headers", "Authorization");
}
super.service(req, res);
}
I don't think so. But you can create a shape object ( or wordart or something similiar ) hook Click event and place the object to position of the specified cell.
You can use :+
to append element to array and +:
to prepend it:
0 +: array :+ 4
should produce:
res3: Array[Int] = Array(0, 1, 2, 3, 4)
It's the same as with any other implementation of Seq
.
I recommend to replace {}
by type(v)()
in order to propagate object type of any dict subclass stored in u
but absent from d
. For example, this would preserve types such as collections.OrderedDict:
Python 2:
import collections
def update(d, u):
for k, v in u.iteritems():
if isinstance(v, collections.Mapping):
d[k] = update(d.get(k, type(v)()), v)
else:
d[k] = v
return d
Python 3:
import collections.abc
def update(d, u):
for k, v in u.items():
if isinstance(v, collections.abc.Mapping):
d[k] = update(d.get(k, type(v)()), v)
else:
d[k] = v
return d
.compare()
returns an integer, which is a measure of the difference between the two strings.
0
indicates that the two strings compare as equal. operator==
simply returns a boolean, indicating whether the strings are equal or not.
If you don't need the extra detail, you may as well just use ==
.
There are already answers saying use of Bit. I will add more to these answers.
You should use bit for representing Boolean values.
Remarks from MSDN article.
Bit can take a value of 1, 0, or NULL.
The SQL Server Database Engine optimizes storage of bit columns. If there are 8 or less bit columns in a table, the columns are stored as 1 byte. If there are from 9 up to 16 bit columns, the columns are stored as 2 bytes, and so on.
The string values TRUE and FALSE can be converted to bit values: TRUE is converted to 1 and FALSE is converted to 0.
Converting to bit promotes any nonzero value to 1.
NOT NULL
As Bit have values 1, 0 and NULL. See truth table for this. So plan values accordingly. It might add confusion by allowing NULL value for bit data type.
[+*?.] Most special characters have no meaning inside the square brackets. This expression matches any of +, *, ? or the dot.
The lazy-init="default"
setting on a bean only refers to what is set by the default-lazy-init
attribute of the enclosing beans element. The implicit default value of default-lazy-init
is false
.
If there is no lazy-init
attribute specified on a bean, it's always eagerly instantiated.
You need to install the provisioning profile (drag and drop it into iTunes). Then drag and drop the .ipa. Ensure you device is set to sync apps, and try again.
SELECT PersonName, songName, status
FROM table
WHERE name IN ('Holly', 'Ryan')
If you are using parametrized Stored procedure:
INNER JOIN ON t.PersonName = newTable.PersonName
using a table variable which contains passed in namesI noticed that invalid syntax error for no apparent reason can be caused by using space in:
print(f'{something something}')
Python IDLE seems to jump and highlight a part of the first line for some reason (even if the first line happens to be a comment), which is misleading.
I believe this is the Debian package 'bible'.
Well, it's the Debian new maintainer's guide, so a lot of it won't be applicable, but they do cover what goes where.
You can use this regex /^[a-z0-9]+$/i
you might want to look at the online version of xsv
find:
^>([^\n\r]+)[\n\r]([A-Z\n\r]+)
\1 = some_varying_text
\2 = lines of all CAPS
Edit (proof that this works):
text = """> some_Varying_TEXT
DSJFKDAFJKDAFJDSAKFJADSFLKDLAFKDSAF
GATACAACATAGGATACA
GGGGGAAAAAAAATTTTTTTTT
CCCCAAAA
> some_Varying_TEXT2
DJASDFHKJFHKSDHF
HHASGDFTERYTERE
GAGAGAGAGAG
PPPPPAAAAAAAAAAAAAAAP
"""
import re
regex = re.compile(r'^>([^\n\r]+)[\n\r]([A-Z\n\r]+)', re.MULTILINE)
matches = [m.groups() for m in regex.finditer(text)]
for m in matches:
print 'Name: %s\nSequence:%s' % (m[0], m[1])
actually you don't need to replace this all....
there are 2 ways to do this. One is to use autoclose property, the other (alternativ) way is to use the on change property thats fired by the input when selecting a Date.
HTML
<div class="container">
<div class="hero-unit">
<input type="text" placeholder="Sample 1: Click to show datepicker" id="example1">
</div>
<div class="hero-unit">
<input type="text" placeholder="Sample 2: Click to show datepicker" id="example2">
</div>
</div>
jQuery
$(document).ready(function () {
$('#example1').datepicker({
format: "dd/mm/yyyy",
autoclose: true
});
//Alternativ way
$('#example2').datepicker({
format: "dd/mm/yyyy"
}).on('change', function(){
$('.datepicker').hide();
});
});
this is all you have to do :)
HERE IS A FIDDLE to see whats happening.
Fiddleupdate on 13 of July 2016: CDN wasnt present anymore
According to your EDIT:
$('#example1').datepicker().on('changeDate', function (ev) {
$('#example1').Close();
});
Here you take the Input (that has no Close-Function) and create a Datepicker-Element. If the element changes you want to close it but you still try to close the Input (That has no close-function).
Binding a mouseup event to the document state may not be the best idea because you will fire all containing scripts on each click!
Thats it :)
EDIT: August 2017 (Added a StackOverFlowFiddle aka Snippet. Same as in Top of Post)
$(document).ready(function () {_x000D_
$('#example1').datepicker({_x000D_
format: "dd/mm/yyyy",_x000D_
autoclose: true_x000D_
});_x000D_
_x000D_
//Alternativ way_x000D_
$('#example2').datepicker({_x000D_
format: "dd/mm/yyyy"_x000D_
}).on('change', function(){_x000D_
$('.datepicker').hide();_x000D_
});_x000D_
});
_x000D_
.hero-unit{_x000D_
float: left;_x000D_
width: 210px;_x000D_
margin-right: 25px;_x000D_
}_x000D_
.hero-unit input{_x000D_
width: 100%;_x000D_
}
_x000D_
<script src="https://ajax.googleapis.com/ajax/libs/jquery/2.1.1/jquery.min.js"></script>_x000D_
<script src="https://ajax.googleapis.com/ajax/libs/jqueryui/1.12.1/jquery-ui.min.js"></script>_x000D_
<div class="container">_x000D_
<div class="hero-unit">_x000D_
<input type="text" placeholder="Sample 1: Click to show datepicker" id="example1">_x000D_
</div>_x000D_
<div class="hero-unit">_x000D_
<input type="text" placeholder="Sample 2: Click to show datepicker" id="example2">_x000D_
</div>_x000D_
</div>
_x000D_
EDIT: December 2018 Obviously Bootstrap-Datepicker doesnt work with jQuery 3.x see this to fix
I will just give my opinion why I use singular names.
For example, I need to get all the fields from an user:
-- Select every fields from 'user' table
SELECT * FROM user
I need the name of the user that is 21 years old:
-- Select every fields from 'user' table which have 21 years old
SELECT * FROM user WHERE age = '21'
Of course the plural way can be used by the same means, but for my brain to read, I really think that's the right way to go.
in rare cases when you can't use strncat
, strcat
or strcpy
. And you don't have access to <string.h>
so you can't use strlen
. Also you maybe don't even know the size of the char arrays and you still want to concatenate because you got only pointers. Well, you can do old school malloc and count characters yourself like..
char *combineStrings(char* inputA, char* inputB) {
size_t len = 0, lenB = 0;
while(inputA[len] != '\0') len++;
while(inputB[lenB] != '\0') lenB++;
char* output = malloc(len+lenB);
sprintf((char*)output,"%s%s",inputA,inputB);
return output;
}
It just needs #include <stdio.h>
which you will have most likely included already
Use the IP instead:
DROP USER 'root'@'127.0.0.1'; GRANT ALL PRIVILEGES ON . TO 'root'@'%';
For more possibilities, see this link.
To create the root user, seeing as MySQL is local & all, execute the following from the command line (Start > Run > "cmd" without quotes):
mysqladmin -u root password 'mynewpassword'
Simple INNER JOIN VIEW code....
CREATE VIEW room_view
AS SELECT a.*,b.*
FROM j4_booking a INNER JOIN j4_scheduling b
on a.room_id = b.room_id;
Preflight is a web security feature implemented by the browser. For Chrome you can disable all web security by adding the --disable-web-security flag.
For example: "C:\Program Files\Google\Chrome\Application\chrome.exe" --disable-web-security --user-data-dir="C:\newChromeSettingsWithoutSecurity" . You can first create a new shortcut of chrome, go to its properties and change the target as above. This should help!
using outline:none; we can remove that border in chrome
<style>
input[type="button"]
{
width:120px;
height:60px;
margin-left:35px;
display:block;
background-color:gray;
color:white;
border: none;
outline:none;
}
</style>
I think this is the problem
A little background
Traceview is a graphical viewer for execution logs that you create by using the Debug class to log tracing information in your code. Traceview can help you debug your application and profile its performance. Enabling it creates a .trace
file in the sdcard root folder which can then be extracted by ADB and processed by traceview bat file for processing. It also can get added by the DDMS.
It is a system used internally by the logger. In general unless you are using traceview to extract the trace file this error shouldnt bother you. You should look at error/logs directly related to your application
How do I enable it:
There are two ways to generate trace logs:
Include the Debug class in your code and call its methods such as
startMethodTracing()
andstopMethodTracing()
, to start and stop logging of trace information to disk. This option is very precise because you can specify exactly where to start and stop logging trace data in your code.Use the method profiling feature of DDMS to generate trace logs. This option is less precise because you do not modify code, but rather specify when to start and stop logging with DDMS. Although you have less control on exactly where logging starts and stops, this option is useful if you don't have access to the application's code, or if you do not need precise log timing.
But the following restrictions exist for the above
If you are using the Debug class, your application must have permission to write to external storage (
WRITE_EXTERNAL_STORAGE
).If you are using DDMS: Android 2.1 and earlier devices must have an SD card present and your application must have permission to write to the SD card. Android 2.2 and later devices do not need an SD card. The trace log files are streamed directly to your development machine.
So in essence the traceFile access requires two things
1.) Permission to write a trace log file i.e.
WRITE_EXTERNAL_STORAGE
andREAD_EXTERNAL_STORAGE
for good measure2.) An emulator with an SDCard attached with sufficient space. The doc doesnt say if this is only for DDMS but also for debug, so I am assuming this is also true for debugging via the application.
What do I do with this error:
Now the error is essentially a fall out of either not having the sdcard path to create a tracefile or not having permission to access it. This is an old thread, but the dev behind the bounty, check if are meeting the two prerequisites. You can then go search for the .trace
file in the sdcard folder in your emulator. If it exists it shouldn't be giving you this problem, if it doesnt try creating it by adding the startMethodTracing
to your app.
I'm not sure why it automatically looks for this file when the logger kicks in. I think when an error/log event occurs , the logger internally tries to write to trace file and does not find it, in which case it throws the error.Having scoured through the docs, I don't find too many references to why this is automatically on.
But in general this doesn't affect you directly, you should check direct application logs/errors.
Also as an aside Android 2.2 and later devices do not need an SD card for DDMS trace logging. The trace log files are streamed directly to your development machine.
Additional information on Traceview:
Copying Trace Files to a Host Machine
After your application has run and the system has created your trace files .trace on a device or emulator, you must copy those files to your development computer. You can use adb pull to copy the files. Here's an example that shows how to copy an example file, calc.trace, from the default location on the emulator to the /tmp directory on the emulator host machine:
adb pull /sdcard/calc.trace /tmp Viewing Trace Files in Traceview To run Traceview and view the trace files, enter traceview . For example, to run Traceview on the example files copied in the previous section, use:
traceview /tmp/calc Note: If you are trying to view the trace logs of an application that is built with ProGuard enabled (release mode build), some method and member names might be obfuscated. You can use the Proguard mapping.txt file to figure out the original unobfuscated names. For more information on this file, see the Proguard documentation.
I think any other answer regarding positioning of oncreate
statements or removing uses-sdk
are not related, but this is Android and I could be wrong. Would be useful to redirect this question to an android engineer or post it as a bug
More in the docs
Fast-forward merging makes sense for short-lived branches, but in a more complex history, non-fast-forward merging may make the history easier to understand, and make it easier to revert a group of commits.
Warning: Non-fast-forwarding has potential side effects as well. Please review https://sandofsky.com/blog/git-workflow.html, avoid the 'no-ff' with its "checkpoint commits" that break bisect or blame, and carefully consider whether it should be your default approach for master
.
(From nvie.com, Vincent Driessen, post "A successful Git branching model")
Incorporating a finished feature on develop
Finished features may be merged into the develop branch to add them to the upcoming release:
$ git checkout develop
Switched to branch 'develop'
$ git merge --no-ff myfeature
Updating ea1b82a..05e9557
(Summary of changes)
$ git branch -d myfeature
Deleted branch myfeature (was 05e9557).
$ git push origin develop
The
--no-ff
flag causes the merge to always create a new commit object, even if the merge could be performed with a fast-forward. This avoids losing information about the historical existence of a feature branch and groups together all commits that together added the feature.
Jakub Narebski also mentions the config merge.ff
:
By default, Git does not create an extra merge commit when merging a commit that is a descendant of the current commit. Instead, the tip of the current branch is fast-forwarded.
When set tofalse
, this variable tells Git to create an extra merge commit in such a case (equivalent to giving the--no-ff
option from the command line).
When set to 'only
', only such fast-forward merges are allowed (equivalent to giving the--ff-only
option from the command line).
The fast-forward is the default because:
But if you anticipate an iterative workflow on one topic/feature branch (i.e., I merge, then I go back to this feature branch and add some more commits), then it is useful to include only the merge in the main branch, rather than all the intermediate commits of the feature branch.
In this case, you can end up setting this kind of config file:
[branch "master"]
# This is the list of cmdline options that should be added to git-merge
# when I merge commits into the master branch.
# The option --no-commit instructs git not to commit the merge
# by default. This allows me to do some final adjustment to the commit log
# message before it gets commited. I often use this to add extra info to
# the merge message or rewrite my local branch names in the commit message
# to branch names that are more understandable to the casual reader of the git log.
# Option --no-ff instructs git to always record a merge commit, even if
# the branch being merged into can be fast-forwarded. This is often the
# case when you create a short-lived topic branch which tracks master, do
# some changes on the topic branch and then merge the changes into the
# master which remained unchanged while you were doing your work on the
# topic branch. In this case the master branch can be fast-forwarded (that
# is the tip of the master branch can be updated to point to the tip of
# the topic branch) and this is what git does by default. With --no-ff
# option set, git creates a real merge commit which records the fact that
# another branch was merged. I find this easier to understand and read in
# the log.
mergeoptions = --no-commit --no-ff
The OP adds in the comments:
I see some sense in fast-forward for [short-lived] branches, but making it the default action means that git assumes you... often have [short-lived] branches. Reasonable?
Jefromi answers:
I think the lifetime of branches varies greatly from user to user. Among experienced users, though, there's probably a tendency to have far more short-lived branches.
To me, a short-lived branch is one that I create in order to make a certain operation easier (rebasing, likely, or quick patching and testing), and then immediately delete once I'm done.
That means it likely should be absorbed into the topic branch it forked from, and the topic branch will be merged as one branch. No one needs to know what I did internally in order to create the series of commits implementing that given feature.
More generally, I add:
it really depends on your development workflow:
- if it is linear, one branch makes sense.
- If you need to isolate features and work on them for a long period of time and repeatedly merge them, several branches make sense.
See "When should you branch?"
Actually, when you consider the Mercurial branch model, it is at its core one branch per repository (even though you can create anonymous heads, bookmarks and even named branches)
See "Git and Mercurial - Compare and Contrast".
Mercurial, by default, uses anonymous lightweight codelines, which in its terminology are called "heads".
Git uses lightweight named branches, with injective mapping to map names of branches in remote repository to names of remote-tracking branches.
Git "forces" you to name branches (well, with the exception of a single unnamed branch, which is a situation called a "detached HEAD"), but I think this works better with branch-heavy workflows such as topic branch workflow, meaning multiple branches in a single repository paradigm.
$("#editable").on('keydown keyup mousedown mouseup',function(e){_x000D_
_x000D_
if($(window.getSelection().anchorNode).is($(this))){_x000D_
$('#position').html('0')_x000D_
}else{_x000D_
$('#position').html(window.getSelection().anchorOffset);_x000D_
}_x000D_
});
_x000D_
body{_x000D_
padding:40px;_x000D_
}_x000D_
#editable{_x000D_
height:50px;_x000D_
width:400px;_x000D_
border:1px solid #000;_x000D_
}_x000D_
#editable p{_x000D_
margin:0;_x000D_
padding:0;_x000D_
}
_x000D_
<script src="https://ajax.googleapis.com/ajax/libs/jquery/2.0.1/jquery.min.js"></script>_x000D_
<div contenteditable="true" id="editable">move the cursor to see position</div>_x000D_
<div>_x000D_
position : <span id="position"></span>_x000D_
</div>
_x000D_
here is how to give permission for one user not public,
Direct Query:
Use MyDatabase
Grant execute on [dbo].[My-procedures-name] to [IIS APPPOOL\my-iis-pool]
Go
If you are using Go 1.5 above, you can try to use vendoring feature. It allows you to put your local package under vendor folder and import it with shorter path. In your case, you can put your common and routers folder inside vendor folder so it would be like
myapp/
--vendor/
----common/
----routers/
------middleware/
--main.go
and import it like this
import (
"common"
"routers"
"routers/middleware"
)
This will work because Go will try to lookup your package starting at your project’s vendor directory (if it has at least one .go file) instead of $GOPATH/src.
FYI: You can do more with vendor, because this feature allows you to put "all your dependency’s code" for a package inside your own project's directory so it will be able to always get the same dependencies versions for all builds. It's like npm or pip in python, but you need to manually copy your dependencies to you project, or if you want to make it easy, try to look govendor by Daniel Theophanes
For more learning about this feature, try to look up here
Understanding and Using Vendor Folder by Daniel Theophanes
Understanding Go Dependency Management by Lucas Fernandes da Costa
I hope you or someone else find it helpfully
On Windows timer returns hundredths of a second... Most people just use seconds because on the Macintosh platform timer returns whole numbers.
You can also try this to determine the current global sql_mode
value:
SELECT @@GLOBAL.sql_mode;
or session sql_mode
value:
SELECT @@SESSION.sql_mode;
I also had the feeling that the SQL mode was indeed empty.
I saw this post when I was looking for mysql statement to drop all WordPress tables based on @Xenph Yan here is what I did eventually:
SELECT CONCAT( 'DROP TABLE `', TABLE_NAME, '`;' ) AS query
FROM INFORMATION_SCHEMA.TABLES
WHERE TABLE_NAME LIKE 'wp_%'
this will give you the set of drop queries for all tables begins with wp_
What you have on your hands is an IPython Notebook file. (Now renamed to Jupyter Notebook
you can open it using the command ipython notebook filename.ipynb
from the directory it is downloaded on to.
If you are on a newer machine, open the file as jupyter notebook filename.ipynb
.
do not forget to remove the .txt extension.
the file has a series of python code/statements and markdown text that you can run/inspect/save/share. read more about ipython notebook from the website.
if you do not have IPython installed, you can do
pip install ipython
or check out installation instructions at the ipython website
An accessed dictionary value (a list in this case) is the original value, separate from the dictionary which is used to access it. You would increment the values in the list the same way whether it's in a dictionary or not:
l = dictionary.get('C1')
for i in range(len(l)):
l[i] += 10
The solution that work for is were add the next dependency to my pom.xml file.
<dependency>
<groupId>javax.servlet</groupId>
<artifactId>javax.servlet-api</artifactId>
<version>3.0.1</version>
<scope>provided</scope>
</dependency>
Just make sure that same JDK versions(i.e. 1.8 in this case) are accessible from PATH
environment variable and JAVA_HOME
. Example:
If
JAVA_HOME=C:\Program Files\Java\jdk1.8.0_152
then
PATH
variable should also contain above path and importantly before any (if there are any) other path of if JDK/JRE already mentioned in the PATH
variable. You may choose to uninstall other versions if no other application is using different version of java.
The spec files are unit tests for your source files. The convention for Angular applications is to have a .spec.ts file for each .ts file. They are run using the Jasmine javascript test framework through the Karma test runner (https://karma-runner.github.io/) when you use the ng test
command.
You can use this for some further reading:
Your classes should look like this
[XmlRoot("StepList")]
public class StepList
{
[XmlElement("Step")]
public List<Step> Steps { get; set; }
}
public class Step
{
[XmlElement("Name")]
public string Name { get; set; }
[XmlElement("Desc")]
public string Desc { get; set; }
}
Here is my testcode.
string testData = @"<StepList>
<Step>
<Name>Name1</Name>
<Desc>Desc1</Desc>
</Step>
<Step>
<Name>Name2</Name>
<Desc>Desc2</Desc>
</Step>
</StepList>";
XmlSerializer serializer = new XmlSerializer(typeof(StepList));
using (TextReader reader = new StringReader(testData))
{
StepList result = (StepList) serializer.Deserialize(reader);
}
If you want to read a text file you should load the file into a FileStream and deserialize this.
using (FileStream fileStream = new FileStream("<PathToYourFile>", FileMode.Open))
{
StepList result = (StepList) serializer.Deserialize(fileStream);
}
Yet another possibility if you're getting the error on a checkbox input. If your checkboxes use custom CSS which hides the default and replaces it with some other styling, this will also trigger the not focusable error in Chrome on validation error.
I found this in my stylesheet:
input[type="checkbox"] {
visibility: hidden;
}
Simple fix was to replace it with this:
input[type="checkbox"] {
opacity: 0;
}
i've got the following function in my "standard library"
/// Convert argument to an array.
function a($a = null) {
if(is_null($a))
return array();
if(is_array($a))
return $a;
if(is_object($a))
return (array) $a;
return $_ = func_get_args();
}
Basically, this does nothing with arrays/objects and convert other types to arrays. This is extremely handy to use with foreach statements and array functions
foreach(a($whatever) as $item)....
$foo = array_map(a($array_or_string)....
etc
JAVA_HOME = C:\Program Files\Java\jdk(JDK version number)
Example: C:\Program Files\Java\jdk-10
And then restart you command prompt it works.
If you want to check by a block, you could try any?
or all?
.
%w{ant bear cat}.any? {|word| word.length >= 3} #=> true
%w{ant bear cat}.any? {|word| word.length >= 4} #=> true
[ nil, true, 99 ].any? #=> true
See Enumerable for more information.
My inspiration came from "evaluate if array has any items in ruby"
You can specify the constraints and defaults in a CREATE TABLE AS SELECT, but the syntax is as follows
create table t1 (id number default 1 not null);
insert into t1 (id) values (2);
create table t2 (id default 1 not null)
as select * from t1;
That is, it won't inherit the constraints from the source table/select. Only the data type (length/precision/scale) is determined by the select.
locale
to get what locale is used. Such as:LANG=en_US.UTF-8
LANGUAGE=en_US:en
LC_CTYPE=zh_CN.UTF-8
LC_NUMERIC="en_US.UTF-8"
LC_TIME="en_US.UTF-8"
LC_COLLATE="en_US.UTF-8"
LC_MONETARY="en_US.UTF-8"
LC_MESSAGES="en_US.UTF-8"
LC_PAPER="en_US.UTF-8"
LC_NAME="en_US.UTF-8"
LC_ADDRESS="en_US.UTF-8"
LC_TELEPHONE="en_US.UTF-8"
LC_MEASUREMENT="en_US.UTF-8"
LC_IDENTIFICATION="en_US.UTF-8"
LC_ALL=
/etc/locale-gen
file. Uncomment to used oneslocale-gen
to generate newly added localesIn case you get a cross-domain error:
If you have control over the content of the iframe - that is, if it is merely loaded in a cross-origin setup such as on Amazon Mechanical Turk - you can circumvent this problem with the <body onload='my_func(my_arg)'>
attribute for the inner html.
For example, for the inner html, use the this
html parameter (yes - this
is defined and it refers to the parent window of the inner body element):
<body onload='changeForm(this)'>
In the inner html :
function changeForm(window) {
console.log('inner window loaded: do whatever you want with the inner html');
window.document.getElementById('mturk_form').style.display = 'none';
</script>
Why not write your own?
I see from your profile you have at least some C#/.NET experience. I'd create a Windows console application and use a free Excel reader to read in your Excel file(s). I've used Excel Data Reader available from CodePlex without any problem (one nice thing: this reader doesn't require Excel to be installed). You can call your console application from the command line.
If you find yourself stuck post here and I'm sure you'll get help.
Functions are not exported by default to be made available in subshells. I'd recommend you do:
source ~/anaconda3/etc/profile.d/conda.sh
conda activate my_env
In the commands above, replace ~/anaconda3/ with the path to your miniconda / anaconda installation.
I got the same problem. I downloaded the jar and added it to the build path, but I didn't notice that the extension was .jar.zip. I again converted it to .jar and added to the build path.
It solved my problem. It's a very silly mistake but I wrote it here in case it could help someone.
OK, first of all I'm not sure how it works when you create a div using (document.createElement('div'))
, so I might be wrong now, but wouldn't it be possible to use the :target pseudo class selector for this?
If you look at the code below, you can se I've used a link to target the div, but in your case it might be possible to target #new from the script instead and that way make the div fade in without user interaction, or am I thinking wrong?
Here's the code for my example:
HTML
<a href="#new">Click</a>
<div id="new">
Fade in ...
</div>
CSS
#new {
width: 100px;
height: 100px;
border: 1px solid #000000;
opacity: 0;
}
#new:target {
-webkit-transition: opacity 2.0s ease-in;
-moz-transition: opacity 2.0s ease-in;
-o-transition: opacity 2.0s ease-in;
opacity: 1;
}
... and here's a jsFiddle
Yes, you can use Application.OnTime
for this and then put it in a loop. It's sort of like an alarm clock where you keep hittig the snooze button for when you want it to ring again. The following updates Cell A1 every three seconds with the time.
Dim TimerActive As Boolean
Sub StartTimer()
Start_Timer
End Sub
Private Sub Start_Timer()
TimerActive = True
Application.OnTime Now() + TimeValue("00:00:03"), "Timer"
End Sub
Private Sub Stop_Timer()
TimerActive = False
End Sub
Private Sub Timer()
If TimerActive Then
ActiveSheet.Cells(1, 1).Value = Time
Application.OnTime Now() + TimeValue("00:00:03"), "Timer"
End If
End Sub
You can put the StartTimer
procedure in your Auto_Open
event and change what is done in the Timer
proceedure (right now it is just updating the time in A1 with ActiveSheet.Cells(1, 1).Value = Time
).
Note: you'll want the code (besides StartTimer
) in a module, not a worksheet module. If you have it in a worksheet module, the code requires slight modification.
$emit
It dispatches an event name upwards through the scope hierarchy and notify to the registered $rootScope.Scope
listeners. The event life cycle starts at the scope on which $emit
was called. The event traverses upwards toward the root scope and calls all registered listeners along the way. The event will stop propagating if one of the listeners cancels it.
$broadcast
It dispatches an event name downwards to all child scopes (and their children) and notify to the registered $rootScope.Scope
listeners. The event life cycle starts at the scope on which $broadcast
was called. All listeners for the event on this scope get notified. Afterwards, the event traverses downwards toward the child scopes and calls all registered listeners along the way. The event cannot be canceled.
$on
It listen on events of a given type. It can catch the event dispatched by $broadcast
and $emit
.
Visual demo:
Demo working code, visually showing scope tree (parent/child relationship):
http://plnkr.co/edit/am6IDw?p=preview
Demonstrates the method calls:
$scope.$on('eventEmitedName', function(event, data) ...
$scope.broadcastEvent
$scope.emitEvent
For everyone here seeking a crazy solution, just simply try
title="your-tooltip-here"
in any tag. I've tested into td
's and a
's and it pretty works.
For me the error message goes away if I unmount the old mount before mounting it again:
fusermount -u /mnt/point
If it's not already mounted you get a non-critical error:
$ fusermount -u /mnt/point
fusermount: entry for /mnt/point not found in /etc/mtab
So in my script I just put unmount it before mounting it.
Almost everything in EC2 is multi-tenant. What the network performance indicates is what priority you will have compared with other instances sharing the same infrastructure.
If you need a guaranteed level of bandwidth, then EC2 will likely not work well for you.
//Recursive solution
class SLL
{
int data;
SLL next;
}
SLL reverse(SLL head)
{
//base case - 0 or 1 elements
if(head == null || head.next == null) return head;
SLL temp = reverse(head.next);
head.next.next = head;
head.next = null;
return temp;
}
If some of you, like me, encounter orientation problems I have combined the solutions here with a exif orientation fix
https://gist.github.com/SagiMedina/f00a57de4e211456225d3114fd10b0d0
You can override the IIS default document setting using the web.config
<system.webServer>
<defaultDocument>
<files>
<clear />
<add value="DefaultPageToBeSet.aspx" />
</files>
</defaultDocument>
</system.webServer>
Or using the IIS, refer the link for reference http://www.iis.net/configreference/system.webserver/defaultdocument
try this within your if statements:
Application.DisplayAlerts = False
Worksheets(“Sheetname”).Delete
Application.DisplayAlerts = True
Alternatively to hasProperty
you can try hamcrest-more-matchers where
matcher with extracting function. In your case it will look like:
import static com.github.seregamorph.hamcrest.MoreMatchers.where;
assertThat(myClass.getMyItems(), contains(
where(MyItem::getName, is("foo")),
where(MyItem::getName, is("bar"))
));
The advantages of this approach are:
Expected: iterable containing [Object that matches is "foo" after call
MyItem.getName, Object that matches is "bar" after call MyItem.getName]
but: item 0: was "wrong-name"
Windows uses carriage return
+ line feed
for newline:
\r\n
Unix only uses Line feed
for newline:
\n
In conclusion, simply replace every occurence of \n
by \r\n
.
Both unix2dos
and dos2unix
are not by default available on Mac OSX.
Fortunately, you can simply use Perl
or sed
to do the job:
sed -e 's/$/\r/' inputfile > outputfile # UNIX to DOS (adding CRs)
sed -e 's/\r$//' inputfile > outputfile # DOS to UNIX (removing CRs)
perl -pe 's/\r\n|\n|\r/\r\n/g' inputfile > outputfile # Convert to DOS
perl -pe 's/\r\n|\n|\r/\n/g' inputfile > outputfile # Convert to UNIX
perl -pe 's/\r\n|\n|\r/\r/g' inputfile > outputfile # Convert to old Mac
Code snippet from:
http://en.wikipedia.org/wiki/Newline#Conversion_utilities
One important advantage of BFS would be that it can be used to find the shortest path between any two nodes in an unweighted graph. Whereas, we cannot use DFS for the same.
Express makes this kind of stuff really intuitive. The syntax looks like below :
var app = require('express').createServer();
app.get("/string", function(req, res) {
var strings = ["rad", "bla", "ska"]
var n = Math.floor(Math.random() * strings.length)
res.send(strings[n])
})
app.listen(8001)
If you're using jQuery on the client side you can do something like this:
$.get("/string", function(string) {
alert(string)
})
Since the beginning, Swift has provided some facilities for making ObjC and C more Swifty, adding more with each version. Now, in Swift 3, the new "import as member" feature lets frameworks with certain styles of C API -- where you have a data type that works sort of like a class, and a bunch of global functions to work with it -- act more like Swift-native APIs. The data types import as Swift classes, their related global functions import as methods and properties on those classes, and some related things like sets of constants can become subtypes where appropriate.
In Xcode 8 / Swift 3 beta, Apple has applied this feature (along with a few others) to make the Dispatch framework much more Swifty. (And Core Graphics, too.) If you've been following the Swift open-source efforts, this isn't news, but now is the first time it's part of Xcode.
Your first step on moving any project to Swift 3 should be to open it in Xcode 8 and choose Edit > Convert > To Current Swift Syntax... in the menu. This will apply (with your review and approval) all of the changes at once needed for all the renamed APIs and other changes. (Often, a line of code is affected by more than one of these changes at once, so responding to error fix-its individually might not handle everything right.)
The result is that the common pattern for bouncing work to the background and back now looks like this:
// Move to a background thread to do some long running work
DispatchQueue.global(qos: .userInitiated).async {
let image = self.loadOrGenerateAnImage()
// Bounce back to the main thread to update the UI
DispatchQueue.main.async {
self.imageView.image = image
}
}
Note we're using .userInitiated
instead of one of the old DISPATCH_QUEUE_PRIORITY
constants. Quality of Service (QoS) specifiers were introduced in OS X 10.10 / iOS 8.0, providing a clearer way for the system to prioritize work and deprecating the old priority specifiers. See Apple's docs on background work and energy efficiency for details.
By the way, if you're keeping your own queues to organize work, the way to get one now looks like this (notice that DispatchQueueAttributes
is an OptionSet
, so you use collection-style literals to combine options):
class Foo {
let queue = DispatchQueue(label: "com.example.my-serial-queue",
attributes: [.serial, .qosUtility])
func doStuff() {
queue.async {
print("Hello World")
}
}
}
Using dispatch_after
to do work later? That's a method on queues, too, and it takes a DispatchTime
, which has operators for various numeric types so you can just add whole or fractional seconds:
DispatchQueue.main.asyncAfter(deadline: .now() + 0.5) { // in half a second...
print("Are we there yet?")
}
You can find your way around the new Dispatch API by opening its interface in Xcode 8 -- use Open Quickly to find the Dispatch module, or put a symbol (like DispatchQueue
) in your Swift project/playground and command-click it, then brouse around the module from there. (You can find the Swift Dispatch API in Apple's spiffy new API Reference website and in-Xcode doc viewer, but it looks like the doc content from the C version hasn't moved into it just yet.)
See the Migration Guide for more tips.
md5=$(md5sum < $file | tr -d ' -')
From a Windows Server OS execute the following command for a dump of the entire Active Director:
csvde -f test.csv
This command is very broad and will give you more than necessary information. To constrain the records to only user records, you would instead want:
csvde -f test.csv -r objectClass=user
You can further restrict the command to give you only the fields you need relevant to the search requested such as:
csvde -f test.csv -r objectClass=user -l DN, sAMAccountName, department, memberOf
If you have an Exchange server and each user associated with a live person has a mailbox (as opposed to generic accounts for kiosk / lab workstations) you can use mailNickname in place of sAMAccountName.
Regarding apply
vs map
:
pool.apply(f, args)
: f
is only executed in ONE of the workers of the pool. So ONE of the processes in the pool will run f(args)
.
pool.map(f, iterable)
: This method chops the iterable into a number of chunks which it submits to the process pool as separate tasks. So you take advantage of all the processes in the pool.
There's a difference.
var x = 1
declares variable x
in current scope (aka execution context). If the declaration appears in a function - a local variable is declared; if it's in global scope - a global variable is declared.
x = 1
, on the other hand, is merely a property assignment. It first tries to resolve x
against scope chain. If it finds it anywhere in that scope chain, it performs assignment; if it doesn't find x
, only then does it creates x
property on a global object (which is a top level object in a scope chain).
Now, notice that it doesn't declare a global variable, it creates a global property.
The difference between the two is subtle and might be confusing unless you understand that variable declarations also create properties (only on a Variable Object) and that every property in Javascript (well, ECMAScript) have certain flags that describe their properties - ReadOnly, DontEnum and DontDelete.
Since variable declaration creates property with the DontDelete flag, the difference between var x = 1
and x = 1
(when executed in global scope) is that the former one - variable declaration - creates the DontDelete'able property, and latter one doesn't. As a consequence, the property created via this implicit assignment can then be deleted from the global object, and the former one - the one created via variable declaration - cannot be deleted.
But this is just theory of course, and in practice there are even more differences between the two, due to various bugs in implementations (such as those from IE).
Hope it all makes sense : )
[Update 2010/12/16]
In ES5 (ECMAScript 5; recently standardized, 5th edition of the language) there's a so-called "strict mode" — an opt-in language mode, which slightly changes the behavior of undeclared assignments. In strict mode, assignment to an undeclared identifier is a ReferenceError. The rationale for this was to catch accidental assignments, preventing creation of undesired global properties. Some of the newer browsers have already started rolling support for strict mode. See, for example, my compat table.
I think there a better alternative to the answers as of 2019. We can use the global-tunnel-ng
package to initialize proxy and not pollute the http
or https
based code everywhere. So first install global-tunnel-ng
package:
npm install global-tunnel-ng
Then change your implementations to initialize proxy if needed as:
const globalTunnel = require('global-tunnel-ng');
globalTunnel.initialize({
host: 'proxy.host.name.or.ip',
port: 8080
});
Easiest way I find is to:
Right click project
Debug as -> Maven build ...
In the goals field put -Dmaven.surefire.debug test
In the parameters put a new parameter called forkCount with a value of 0 (previously was forkMode=never but it is deprecated and doesn't work anymore)
Set your breakpoints down and run this configuration and it should hit the breakpoint.
Use herDatabase
GO ;
Code says to execute the instructions above the GO
marker.
My default database is myDatabase, so instead of using myDatabase GO
and makes current query to use herDatabase
Here is another possible solution, using the resolve
attribute of the $stateProvider
or the $routeProvider
. Example with $stateProvider
:
.config(["$stateProvider", function ($stateProvider) {
$stateProvider
.state("forbidden", {
/* ... */
})
.state("signIn", {
/* ... */
resolve: {
access: ["Access", function (Access) { return Access.isAnonymous(); }],
}
})
.state("home", {
/* ... */
resolve: {
access: ["Access", function (Access) { return Access.isAuthenticated(); }],
}
})
.state("admin", {
/* ... */
resolve: {
access: ["Access", function (Access) { return Access.hasRole("ROLE_ADMIN"); }],
}
});
}])
Access
resolves or rejects a promise depending on the current user rights:
.factory("Access", ["$q", "UserProfile", function ($q, UserProfile) {
var Access = {
OK: 200,
// "we don't know who you are, so we can't say if you're authorized to access
// this resource or not yet, please sign in first"
UNAUTHORIZED: 401,
// "we know who you are, and your profile does not allow you to access this resource"
FORBIDDEN: 403,
hasRole: function (role) {
return UserProfile.then(function (userProfile) {
if (userProfile.$hasRole(role)) {
return Access.OK;
} else if (userProfile.$isAnonymous()) {
return $q.reject(Access.UNAUTHORIZED);
} else {
return $q.reject(Access.FORBIDDEN);
}
});
},
hasAnyRole: function (roles) {
return UserProfile.then(function (userProfile) {
if (userProfile.$hasAnyRole(roles)) {
return Access.OK;
} else if (userProfile.$isAnonymous()) {
return $q.reject(Access.UNAUTHORIZED);
} else {
return $q.reject(Access.FORBIDDEN);
}
});
},
isAnonymous: function () {
return UserProfile.then(function (userProfile) {
if (userProfile.$isAnonymous()) {
return Access.OK;
} else {
return $q.reject(Access.FORBIDDEN);
}
});
},
isAuthenticated: function () {
return UserProfile.then(function (userProfile) {
if (userProfile.$isAuthenticated()) {
return Access.OK;
} else {
return $q.reject(Access.UNAUTHORIZED);
}
});
}
};
return Access;
}])
UserProfile
copies the current user properties, and implement the $hasRole
, $hasAnyRole
, $isAnonymous
and $isAuthenticated
methods logic (plus a $refresh
method, explained later):
.factory("UserProfile", ["Auth", function (Auth) {
var userProfile = {};
var clearUserProfile = function () {
for (var prop in userProfile) {
if (userProfile.hasOwnProperty(prop)) {
delete userProfile[prop];
}
}
};
var fetchUserProfile = function () {
return Auth.getProfile().then(function (response) {
clearUserProfile();
return angular.extend(userProfile, response.data, {
$refresh: fetchUserProfile,
$hasRole: function (role) {
return userProfile.roles.indexOf(role) >= 0;
},
$hasAnyRole: function (roles) {
return !!userProfile.roles.filter(function (role) {
return roles.indexOf(role) >= 0;
}).length;
},
$isAnonymous: function () {
return userProfile.anonymous;
},
$isAuthenticated: function () {
return !userProfile.anonymous;
}
});
});
};
return fetchUserProfile();
}])
Auth
is in charge of requesting the server, to know the user profile (linked to an access token attached to the request for example):
.service("Auth", ["$http", function ($http) {
this.getProfile = function () {
return $http.get("api/auth");
};
}])
The server is expected to return such a JSON object when requesting GET api/auth
:
{
"name": "John Doe", // plus any other user information
"roles": ["ROLE_ADMIN", "ROLE_USER"], // or any other role (or no role at all, i.e. an empty array)
"anonymous": false // or true
}
Finally, when Access
rejects a promise, if using ui.router
, the $stateChangeError
event will be fired:
.run(["$rootScope", "Access", "$state", "$log", function ($rootScope, Access, $state, $log) {
$rootScope.$on("$stateChangeError", function (event, toState, toParams, fromState, fromParams, error) {
switch (error) {
case Access.UNAUTHORIZED:
$state.go("signIn");
break;
case Access.FORBIDDEN:
$state.go("forbidden");
break;
default:
$log.warn("$stateChangeError event catched");
break;
}
});
}])
If using ngRoute
, the $routeChangeError
event will be fired:
.run(["$rootScope", "Access", "$location", "$log", function ($rootScope, Access, $location, $log) {
$rootScope.$on("$routeChangeError", function (event, current, previous, rejection) {
switch (rejection) {
case Access.UNAUTHORIZED:
$location.path("/signin");
break;
case Access.FORBIDDEN:
$location.path("/forbidden");
break;
default:
$log.warn("$stateChangeError event catched");
break;
}
});
}])
The user profile can also be accessed in the controllers:
.state("home", {
/* ... */
controller: "HomeController",
resolve: {
userProfile: "UserProfile"
}
})
UserProfile
then contains the properties returned by the server when requesting GET api/auth
:
.controller("HomeController", ["$scope", "userProfile", function ($scope, userProfile) {
$scope.title = "Hello " + userProfile.name; // "Hello John Doe" in the example
}])
UserProfile
needs to be refreshed when a user signs in or out, so that Access
can handle the routes with the new user profile. You can either reload the whole page, or call UserProfile.$refresh()
. Example when signing in:
.service("Auth", ["$http", function ($http) {
/* ... */
this.signIn = function (credentials) {
return $http.post("api/auth", credentials).then(function (response) {
// authentication succeeded, store the response access token somewhere (if any)
});
};
}])
.state("signIn", {
/* ... */
controller: "SignInController",
resolve: {
/* ... */
userProfile: "UserProfile"
}
})
.controller("SignInController", ["$scope", "$state", "Auth", "userProfile", function ($scope, $state, Auth, userProfile) {
$scope.signIn = function () {
Auth.signIn($scope.credentials).then(function () {
// user successfully authenticated, refresh UserProfile
return userProfile.$refresh();
}).then(function () {
// UserProfile is refreshed, redirect user somewhere
$state.go("home");
});
};
}])
Since the SERVICE_USER table is not a pure join table, but has additional functional fields (blocked), you must map it as an entity, and decompose the many to many association between User and Service into two OneToMany associations : One User has many UserServices, and one Service has many UserServices.
You haven't shown us the most important part : the mapping and initialization of the relationships between your entities (i.e. the part you have problems with). So I'll show you how it should look like.
If you make the relationships bidirectional, you should thus have
class User {
@OneToMany(mappedBy = "user")
private Set<UserService> userServices = new HashSet<UserService>();
}
class UserService {
@ManyToOne
@JoinColumn(name = "user_id")
private User user;
@ManyToOne
@JoinColumn(name = "service_code")
private Service service;
@Column(name = "blocked")
private boolean blocked;
}
class Service {
@OneToMany(mappedBy = "service")
private Set<UserService> userServices = new HashSet<UserService>();
}
If you don't put any cascade on your relationships, then you must persist/save all the entities. Although only the owning side of the relationship (here, the UserService side) must be initialized, it's also a good practice to make sure both sides are in coherence.
User user = new User();
Service service = new Service();
UserService userService = new UserService();
user.addUserService(userService);
userService.setUser(user);
service.addUserService(userService);
userService.setService(service);
session.save(user);
session.save(service);
session.save(userService);
Yea, this was a pain for me as well.
So what i did was find the "Start Wampserver", just hit the start button and type it in.
Then right click on it , select properties. I set it to run in XP servive pack 3 on the capatability tab. I also checked the box "Run this program as an administrator".
Then I right clicked the WAMPSERVER on the System Tray, and re-started all services. This worked perfect for me, hope this will help you as well.
Rob
Review any .htaccess. Maybe, a .htaccess rule is interfering with the right output. Try browsing your CSS resource directly in your address bar, it must be presented in text format.
<div>
with some proportions
div {
position: relative;
width: 100%;
height: 100%;
}
<img>
's with their own proportions
img {
position: absolute;
top: 0;
left: 0;
bottom: 0;
right: 0;
width: auto; /* to keep proportions */
height: auto; /* to keep proportions */
max-width: 100%; /* not to stand out from div */
max-height: 100%; /* not to stand out from div */
margin: auto auto 0; /* position to bottom and center */
}
To fix center position, I use:
open : function() {
var t = $(this).parent(), w = window;
t.offset({
top: (w.height() / 2) - (t.height() / 2),
left: (w.width() / 2) - (t.width() / 2)
});
}
It is also very important to distinguish a SENDING multicast socket from a RECEIVING multicast socket.
I agree with all the answers above regarding RECEIVING multicast sockets. The OP noted that binding a RECEIVING socket to an interface did not help. However, it is necessary to bind a multicast SENDING socket to an interface.
For a SENDING multicast socket on a multi-homed server, it is very important to create a separate socket for each interface you want to send to. A bound SENDING socket should be created for each interface.
// This is a fix for that bug that causes Servers to pop offline/online.
// Servers will intermittently pop offline/online for 10 seconds or so.
// The bug only happens if the machine had a DHCP gateway, and the gateway is no longer accessible.
// After several minutes, the route to the DHCP gateway may timeout, at which
// point the pingponging stops.
// You need 3 machines, Client machine, server A, and server B
// Client has both ethernets connected, and both ethernets receiving CITP pings (machine A pinging to en0, machine B pinging to en1)
// Now turn off the ping from machine B (en1), but leave the network connected.
// You will notice that the machine transmitting on the interface with
// the DHCP gateway will fail sendto() with errno 'No route to host'
if ( theErr == 0 )
{
// inspired by 'ping -b' option in man page:
// -b boundif
// Bind the socket to interface boundif for sending.
struct sockaddr_in bindInterfaceAddr;
bzero(&bindInterfaceAddr, sizeof(bindInterfaceAddr));
bindInterfaceAddr.sin_len = sizeof(bindInterfaceAddr);
bindInterfaceAddr.sin_family = AF_INET;
bindInterfaceAddr.sin_addr.s_addr = htonl(interfaceipaddr);
bindInterfaceAddr.sin_port = 0; // Allow the kernel to choose a random port number by passing in 0 for the port.
theErr = bind(mSendSocketID, (struct sockaddr *)&bindInterfaceAddr, sizeof(bindInterfaceAddr));
struct sockaddr_in serverAddress;
int namelen = sizeof(serverAddress);
if (getsockname(mSendSocketID, (struct sockaddr *)&serverAddress, (socklen_t *)&namelen) < 0) {
DLogErr(@"ERROR Publishing service... getsockname err");
}
else
{
DLog( @"socket %d bind, %@ port %d", mSendSocketID, [NSString stringFromIPAddress:htonl(serverAddress.sin_addr.s_addr)], htons(serverAddress.sin_port) );
}
Without this fix, multicast sending will intermittently get sendto() errno 'No route to host'. If anyone can shed light on why unplugging a DHCP gateway causes Mac OS X multicast SENDING sockets to get confused, I would love to hear it.
If you don't want to go to bin
folder of MySQL then another option is to put a shortcut of mysql.exe
to your default path of command prompt (C:\Users\"your user name">
) with the contents of:
mysql -u(username) -p(password)
You can use regular expressions for extracting the number from string. Lets check it. Suppose this is the string mixing text and numbers 'stack12345overflow569'. This one should work:
select regexp_replace('stack12345overflow569', '[[:alpha:]]|_') as numbers from dual;
which will return "12345569".
also you can use this one:
select regexp_replace('stack12345overflow569', '[^0-9]', '') as numbers,
regexp_replace('Stack12345OverFlow569', '[^a-z and ^A-Z]', '') as characters
from dual
which will return "12345569" for numbers and "StackOverFlow" for characters.
I experienced that NodeJS is hashing the UTF-8 representation of the string. Other languages (like Python, PHP or PERL...) are hashing the byte string.
We can add binary argument to use the byte string.
const crypto = require("crypto");
function sha1(data) {
return crypto.createHash("sha1").update(data, "binary").digest("hex");
}
sha1("Your text ;)");
You can try with : "\xac", "\xd1", "\xb9", "\xe2", "\xbb", "\x93", etc...
sha1("\xac") //39527c59247a39d18ad48b9947ea738396a3bc47
sha1 = crypto.createHash("sha1").update("\xac", "binary").digest("hex") //39527c59247a39d18ad48b9947ea738396a3bc47
//without:
sha1 = crypto.createHash("sha1").update("\xac").digest("hex") //f50eb35d94f1d75480496e54f4b4a472a9148752
Not possible, per MSDN:
You can have the same code execute for multiple trigger types, but the syntax does not allow for multiple code blocks in one trigger:
Trigger on an INSERT, UPDATE, or DELETE statement to a table or view (DML Trigger)
CREATE TRIGGER [ schema_name . ]trigger_name ON { table | view } [ WITH <dml_trigger_option> [ ,...n ] ] { FOR | AFTER | INSTEAD OF } { [ INSERT ] [ , ] [ UPDATE ] [ , ] [ DELETE ] } [ NOT FOR REPLICATION ] AS { sql_statement [ ; ] [ ,...n ] | EXTERNAL NAME <method specifier [ ; ] > }
An alternative approach may be to embed images in the email using the cid
method. (Basically including the image as an attachment, and then embedding it). In my experience, this approach seems to be well supported these days.
Source: https://www.campaignmonitor.com/blog/how-to/2008/08/embedding-images-revisited/
As others have mentioned, there is no official Go construct for this. The closest I can imagine would be a function that returns a slice. In this way, you can guarantee that no one will manipulate the elements of the original slice (as it is "hard-coded" into the array).
I have shortened your slice to make it...shorter...:
func GetLetterGoodness() []float32 {
return []float32 { .0817,.0149,.0278,.0425,.1270,.0223 }
}
another option is to add a method like this
def select_option(css_selector, value)
find(:css, css_selector).find(:option, value).select_option
end
Create custom error pages through .htaccess file
1. 404 - page not found
RewriteEngine On
ErrorDocument 404 /404.html
2. 500 - Internal Server Error
RewriteEngine On
ErrorDocument 500 /500.html
3. 403 - Forbidden
RewriteEngine On
ErrorDocument 403 /403.html
4. 400 - Bad request
RewriteEngine On
ErrorDocument 400 /400.html
5. 401 - Authorization Required
RewriteEngine On
ErrorDocument 401 /401.html
You can also redirect all error to single page. like
RewriteEngine On
ErrorDocument 404 /404.html
ErrorDocument 500 /404.html
ErrorDocument 403 /404.html
ErrorDocument 400 /404.html
ErrorDocument 401 /401.html
try using
import mainLogo from'./logoWhite.png';
//then in the render function of Jsx insert the mainLogo variable
class NavBar extends Component {
render() {
return (
<nav className="nav" style={nbStyle}>
<div className="container">
//right below here
<img src={mainLogo} style={nbStyle.logo} alt="fireSpot"/>
</div>
</nav>
);
}
}
The commands module is a reasonably high-level way to do this:
import commands
status, output = commands.getstatusoutput("cat /etc/services")
status is 0, output is the contents of /etc/services.
In JQuery you can call
$("form:first").trigger("submit")
Don't know if that is much better. I think form.submit(); is pretty universal.
Remember that:
FacesContext context = FacesContext.getCurrentInstance();
context.addMessage( null, new FacesMessage( "The message to display in client" ));
is also valid, because when null is specified as first parameter, it is applied to the whole form.
More info: coreservlets.com //Outdated
When you write
from file2 import *
it actually copies the names defined in file2
into the namespace of file1
. So if you reassign those names in file1
, by writing
foo = "bar"
for example, it will only make that change in file1
, not file2
. Note that if you were to change an attribute of foo
, say by doing
foo.blah = "bar"
then that change would be reflected in file2
, because you are modifying the existing object referred to by the name foo
, not replacing it with a new object.
You can get the effect you want by doing this in file1.py
:
import file2
file2.foo = "bar"
test = SomeClass()
(note that you should delete from foo import *
) although I would suggest thinking carefully about whether you really need to do this. It's not very common that changing one module's variables from within another module is really justified.
To do this you pass a callback as a property down to the child from the parent.
For example:
var Parent = React.createClass({
getInitialState: function() {
return {
value: 'foo'
}
},
changeHandler: function(value) {
this.setState({
value: value
});
},
render: function() {
return (
<div>
<Child value={this.state.value} onChange={this.changeHandler} />
<span>{this.state.value}</span>
</div>
);
}
});
var Child = React.createClass({
propTypes: {
value: React.PropTypes.string,
onChange: React.PropTypes.func
},
getDefaultProps: function() {
return {
value: ''
};
},
changeHandler: function(e) {
if (typeof this.props.onChange === 'function') {
this.props.onChange(e.target.value);
}
},
render: function() {
return (
<input type="text" value={this.props.value} onChange={this.changeHandler} />
);
}
});
In the above example, Parent
calls Child
with a property of value
and onChange
. The Child
in return binds an onChange
handler to a standard <input />
element and passes the value up to the Parent
's callback if it's defined.
As a result the Parent
's changeHandler
method is called with the first argument being the string value from the <input />
field in the Child
. The result is that the Parent
's state can be updated with that value, causing the parent's <span />
element to update with the new value as you type it in the Child
's input field.
In general, it is desirable to avoid arbitrary string comparisons throughout your code. It is better to update the strings in one place and hide the magic string from your app. I provide a category on UIDevice
for that purpose.
For my specific needs I need to know which device I am using without the need to know specifics about networking capability that can be easily retrieved in other ways. So you will find a coarser grained enum
than the ever growing list of devices.
Updating is a matter of adding the device to the enum and the lookup table.
typedef NS_ENUM(NSUInteger, NTNUDeviceType) {
DeviceAppleUnknown,
DeviceAppleSimulator,
DeviceAppleiPhone,
DeviceAppleiPhone3G,
DeviceAppleiPhone3GS,
DeviceAppleiPhone4,
DeviceAppleiPhone4S,
DeviceAppleiPhone5,
DeviceAppleiPhone5C,
DeviceAppleiPhone5S,
DeviceAppleiPhone6,
DeviceAppleiPhone6_Plus,
DeviceAppleiPhone6S,
DeviceAppleiPhone6S_Plus,
DeviceAppleiPhoneSE,
DeviceAppleiPhone7,
DeviceAppleiPhone7_Plus,
DeviceAppleiPodTouch,
DeviceAppleiPodTouch2G,
DeviceAppleiPodTouch3G,
DeviceAppleiPodTouch4G,
DeviceAppleiPad,
DeviceAppleiPad2,
DeviceAppleiPad3G,
DeviceAppleiPad4G,
DeviceAppleiPad5G_Air,
DeviceAppleiPadMini,
DeviceAppleiPadMini2G,
DeviceAppleiPadPro12,
DeviceAppleiPadPro9
};
@interface UIDevice (NTNUExtensions)
- (NSString *)ntnu_deviceDescription;
- (NTNUDeviceType)ntnu_deviceType;
@end
#import <sys/utsname.h>
#import "UIDevice+NTNUExtensions.h"
@implementation UIDevice (NTNUExtensions)
- (NSString *)ntnu_deviceDescription
{
struct utsname systemInfo;
uname(&systemInfo);
return [NSString stringWithCString:systemInfo.machine encoding:NSUTF8StringEncoding];
}
- (NTNUDeviceType)ntnu_deviceType
{
NSNumber *deviceType = [[self ntnu_deviceTypeLookupTable] objectForKey:[self ntnu_deviceDescription]];
return [deviceType unsignedIntegerValue];
}
- (NSDictionary *)ntnu_deviceTypeLookupTable
{
return @{
@"i386": @(DeviceAppleSimulator),
@"x86_64": @(DeviceAppleSimulator),
@"iPod1,1": @(DeviceAppleiPodTouch),
@"iPod2,1": @(DeviceAppleiPodTouch2G),
@"iPod3,1": @(DeviceAppleiPodTouch3G),
@"iPod4,1": @(DeviceAppleiPodTouch4G),
@"iPhone1,1": @(DeviceAppleiPhone),
@"iPhone1,2": @(DeviceAppleiPhone3G),
@"iPhone2,1": @(DeviceAppleiPhone3GS),
@"iPhone3,1": @(DeviceAppleiPhone4),
@"iPhone3,3": @(DeviceAppleiPhone4),
@"iPhone4,1": @(DeviceAppleiPhone4S),
@"iPhone5,1": @(DeviceAppleiPhone5),
@"iPhone5,2": @(DeviceAppleiPhone5),
@"iPhone5,3": @(DeviceAppleiPhone5C),
@"iPhone5,4": @(DeviceAppleiPhone5C),
@"iPhone6,1": @(DeviceAppleiPhone5S),
@"iPhone6,2": @(DeviceAppleiPhone5S),
@"iPhone7,1": @(DeviceAppleiPhone6_Plus),
@"iPhone7,2": @(DeviceAppleiPhone6),
@"iPhone8,1" :@(DeviceAppleiPhone6S),
@"iPhone8,2" :@(DeviceAppleiPhone6S_Plus),
@"iPhone8,4" :@(DeviceAppleiPhoneSE),
@"iPhone9,1" :@(DeviceAppleiPhone7),
@"iPhone9,3" :@(DeviceAppleiPhone7),
@"iPhone9,2" :@(DeviceAppleiPhone7_Plus),
@"iPhone9,4" :@(DeviceAppleiPhone7_Plus),
@"iPad1,1": @(DeviceAppleiPad),
@"iPad2,1": @(DeviceAppleiPad2),
@"iPad3,1": @(DeviceAppleiPad3G),
@"iPad3,4": @(DeviceAppleiPad4G),
@"iPad2,5": @(DeviceAppleiPadMini),
@"iPad4,1": @(DeviceAppleiPad5G_Air),
@"iPad4,2": @(DeviceAppleiPad5G_Air),
@"iPad4,4": @(DeviceAppleiPadMini2G),
@"iPad4,5": @(DeviceAppleiPadMini2G),
@"iPad4,7":@(DeviceAppleiPadMini),
@"iPad6,7":@(DeviceAppleiPadPro12),
@"iPad6,8":@(DeviceAppleiPadPro12),
@"iPad6,3":@(DeviceAppleiPadPro9),
@"iPad6,4":@(DeviceAppleiPadPro9)
};
}
@end
The maven dependency plugin can potentially solve your problem.
If you have a pom
with all your project dependencies specified, all you would need to do is run
mvn dependency:copy-dependencies
and you will find the target/dependencies
folder filled with all the dependencies, including transitive.
Adding Gustavo's answer from below: To download the dependency sources, you can use
mvn dependency:copy-dependencies -Dclassifier=sources