If your 13 digit "number" is really text, that is you don't intend to do any math on it, you can precede it with an apostrophe

Sheet3.Range("c" & k).Value = "'" & Sheet2.Range("c" & i).Value

But I don't see how a 13 digit number would ever get past the If statement because it would always be greater than 1000. Here's an alternate version

Sub CommandClick()

    Dim rCell As Range
    Dim rNext As Range

    For Each rCell In Sheet2.Range("C1:C30000").Cells
        If rCell.Value >= 100 And rCell.Value < 1000 Then
            Set rNext = Sheet3.Cells(Sheet3.Rows.Count, 1).End(xlUp).Offset(1, 0)
            rNext.Resize(1, 3).Value = rCell.Offset(0, -2).Resize(1, 3).Value
        End If
    Next rCell

End Sub

Old thread, still for future reference...:) even following works

git show-ref --head

by default HEAD is filtered out. Be careful about following though ; plural "heads" with a 's' at the end. The following command shows branches under "refs/heads"

 git show-ref --heads

Use css:

<style>
input[name=btnsubmit]:active {
color: green;
}
</style>

Using command line:

python -c "import scipy; print(scipy.__version__)"

You need to get hold of the axes themselves. Probably the cleanest way is to change your last row:

lm = sns.lmplot('X','Y',df,col='Z',sharex=False,sharey=False)

Then you can get hold of the axes objects (an array of axes):

axes = lm.axes

After that you can tweak the axes properties

axes[0,0].set_ylim(0,)
axes[0,1].set_ylim(0,)

creates:

That's compiled code, you'll need to use a decompiler like JAD: http://www.kpdus.com/jad.html

object-fit property does the magic. On JsFiddle.

CSS

.image {
  width: 160px;
  height: 160px;
}

.object-fit_fill {
  object-fit: fill
}

.object-fit_contain {
  object-fit: contain
}

.object-fit_cover {
  object-fit: cover
}

.object-fit_none {
  object-fit: none
}

.object-fit_scale-down {
  object-fit: scale-down
}

HTML

<div class="original-image">
  <p>original image</p>
  <img src="http://lorempixel.com/500/200">
</div>

<div class="image">
  <p>object-fit: fill</p>
  <img class="object-fit_fill" src="http://lorempixel.com/500/200">
</div>

<div class="image">
  <p>object-fit: contain</p>
  <img class="object-fit_contain" src="http://lorempixel.com/500/200">
</div>

<div class="image">
  <p>object-fit: cover</p>
  <img class="object-fit_cover" src="http://lorempixel.com/500/200">
</div>

<div class="image">
  <p>object-fit: none</p>
  <img class="object-fit_none" src="http://lorempixel.com/500/200">
</div>

<div class="image">
  <p>object-fit: scale-down</p>
  <img class="object-fit_scale-down" src="http://lorempixel.com/500/200">
</div>

Result

From wikipedia

In Java, all non-static methods are by default "virtual functions." Only methods marked with the keyword final, which cannot be overridden, along with private methods, which are not inherited, are non-virtual.

Perfect Picker with current date and basic settings

        //Datepicker
        $('.datepicker').datepicker({
            autoclose: true,
            format: "yyyy-mm-dd",
            immediateUpdates: true,
            todayBtn: true,
            todayHighlight: true
        }).datepicker("setDate", "0");

Personally I don't use final on method parameters, because it adds too much clutter to parameter lists. I prefer to enforce that method parameters are not changed through something like Checkstyle.

For local variables I use final whenever possible, I even let Eclipse do that automatically in my setup for personal projects.

I would certainly like something stronger like C/C++ const.

If you read the help for vector (or numeric or logical or character or integer or double, 'raw' or complex etc ) then you will see that they all have a length (or length.out argument which defaults to 0

Therefore

numeric()
logical()
character()
integer()
double()
raw()
complex() 
vector('numeric')
vector('character')
vector('integer')
vector('double')
vector('raw')
vector('complex')

All return 0 length vectors of the appropriate atomic modes.

# the following will also return objects with length 0
list()
expression()
vector('list')
vector('expression')

LOAD DATA INFILE 'file.csv'
  INTO TABLE t1
  (column1, @dummy, column2, @dummy, column3, ...)
FIELDS TERMINATED BY ',' ENCLOSED BY '"' ESCAPED BY '"'
LINES TERMINATED BY '\r\n';

Just replace the column1, column2, etc.. with your column names, and put @dummy anwhere there's a column in the CSV you want to ignore.

Full details here.

textAlign property only works when there is a more space left for the Text's content. Below are 2 examples which shows when textAlign has impact and when not.

No impact

For instance, in this example, it won't have any impact because there is no extra space for the content of the Text.

Text(
  "Hello",
  textAlign: TextAlign.end, // no impact
),

Has impact

If you wrap it in a Container and provide extra width such that it has more extra space.

Container(
  width: 200,
  color: Colors.orange,
  child: Text(
    "Hello",
    textAlign: TextAlign.end, // has impact
  ),
)

Add the following to your build.gradle

apply plugin: 'eclipse'

and browse to the project directory

gradle eclipse

Once done, you could import the project from eclipse as simple Java Project.

for f in *.png; do
  fnew=`echo $f | sed 's/_h.png/_half.png/'`
  mv $f $fnew
done

Here is a working connection string for someone who needs reference.

  <connectionStrings>
    <add name="IdentityConnection" connectionString="Data Source=(LocalDb)\v11.0;AttachDbFilename=|DataDirectory|\IdentityDb.mdf;Integrated Security=True;MultipleActiveResultSets=true;" providerName="System.Data.SqlClient" />
  </connectionStrings>

This is really a C question, not specific to Objective-C (which is a superset of the C language). Enums in C are represented as integers. So you need to write a function that returns a string given an enum value. There are many ways to do this. An array of strings such that the enum value can be used as an index into the array or a map structure (e.g. an NSDictionary) that maps an enum value to a string work, but I find that these approaches are not as clear as a function that makes the conversion explicit (and the array approach, although the classic C way is dangerous if your enum values are not continguous from 0). Something like this would work:

- (NSString*)formatTypeToString:(FormatType)formatType {
    NSString *result = nil;

    switch(formatType) {
        case JSON:
            result = @"JSON";
            break;
        case XML:
            result = @"XML";
            break;
        case Atom:
            result = @"Atom";
            break;
        case RSS:
            result = @"RSS";
            break;
        default:
            [NSException raise:NSGenericException format:@"Unexpected FormatType."];
    }

    return result;
}

Your related question about the correct syntax for an enum value is that you use just the value (e.g. JSON), not the FormatType.JSON sytax. FormatType is a type and the enum values (e.g. JSON, XML, etc.) are values that you can assign to that type.

From the Maven docs, sounds like it's just a difference in which repository you install the package into:

• install - install the package into the local repository, for use as a dependency in other projects locally
• deploy - done in an integration or release environment, copies the final package to the remote repository for sharing with other developers and projects.

Maybe there is some confusion in that "install" to the CI server installs it to it's local repository, which then you as a user are sharing?

for this kind of error; you just have to set new password to the root user as an admin. follow the steps as follows:

[root ~]# mysql -u root
ERROR 1045 (28000): Access denied for user 'root'@'localhost' (using password:NO)

1. Stop the service/daemon of mysql running

   [root ~]# service mysql stop   
   mysql stop/waiting
   

2. Start mysql without any privileges using the following option; This option is used to boot up and do not use the privilege system of MySQL.

   [root ~]# mysqld_safe --skip-grant-tables &
   

At this moment, the terminal will seem to halt. Let that be, and use new terminal for next steps.

3. enter the mysql command prompt

   [root ~]# mysql -u root
   mysql> 
   

4. Fix the permission setting of the root user ;

   mysql> use mysql;
   Database changed
   mysql> select * from  user;
   Empty set (0.00 sec)
   mysql> truncate table user;
   Query OK, 0 rows affected (0.00 sec)
   mysql> flush privileges;
   Query OK, 0 rows affected (0.01 sec)
   mysql> grant all privileges on *.* to root@localhost identified by 'YourNewPassword' with grant option;
   Query OK, 0 rows affected (0.01 sec)
   

*if you don`t want any password or rather an empty password

    mysql> grant all privileges on *.* to root@localhost identified by '' with grant option;
    Query OK, 0 rows affected (0.01 sec)*
    mysql> flush privileges;
    Query OK, 0 rows affected (0.00 sec)

Confirm the results:

    mysql> select host, user from user;
+-----------+------+
| host      | user |
+-----------+------+
| localhost | root |
+-----------+------+
1 row in set (0.00 sec)

5. Exit the shell and restart mysql in normal mode.

   mysql> quit;
   [root ~]# kill -KILL [PID of mysqld_safe]
   [root ~]# kill -KILL [PID of mysqld]
   [root ~]# service mysql start
   

6. Now you can successfully login as root user with the password you set

    [root ~]# mysql -u root -pYourNewPassword 
    mysql> 
   

If you create a new repository from the Github web GUI, you sometimes get the name 'main' instead of 'master'. By using the command git status from your terminal you'd see which location you are. In some cases, you'd see origin/main.

If you are trying to push your app to a cloud service via CLI then use 'main', not 'master'.

example: git push heroku main

if you have a MSSQL compatible SQL dump you can convert it to MySQL queries one by one using this online tool

http://burrist.com/mstomy.php

Hope it saved your time

This is useful when you have more than one class to append. You can join all classes in array with a space.

const visibility = this.props.showBulkActions ? "show" : ""
<div className={["btn-group pull-right", visibility].join(' ')}>

I use getActionCommand() to hear buttons. I apply the setActionCommand() to each button so that I can hear whenever an event is execute with event.getActionCommand("The setActionCommand() value of the button").

I use getSource() for JRadioButtons for example. I write methods that returns each JRadioButton so in my Listener Class I can specify an action each time a new JRadioButton is pressed. So for example:

public class SeleccionListener implements ActionListener, FocusListener {}

So with this I can hear button events and radioButtons events. The following are examples of how I listen each one:

public void actionPerformed(ActionEvent event) {
    if (event.getActionCommand().equals(GUISeleccion.BOTON_ACEPTAR)) {
        System.out.println("Aceptar pressed");
    }

In this case GUISeleccion.BOTON_ACEPTAR is a "public static final String" which is used in JButtonAceptar.setActionCommand(BOTON_ACEPTAR).

public void focusGained(FocusEvent focusEvent) {
    if (focusEvent.getSource().equals(guiSeleccion.getJrbDat())){
        System.out.println("Data radio button");
    }

In this one, I get the source of any JRadioButton that is focused when the user hits it. guiSeleccion.getJrbDat() returns the reference to the JRadioButton that is in the class GUISeleccion (this is a Frame)

I'm using Visual Studio Professional licensed over the MAPS Action Pack subscription. Since the new version of the Microsoft Partner Center one have to add the subscribed user to the partner benefit software.

Partner Center->Benefits->Visual Studio Subscriptions->Add user

After that one have to sign out and reenter the credentials in the account settings of VS.

XmlDocument doc = new XmlDocument();
doc.LoadXml(str);

Where str is your XML string. See the MSDN article for more info.

Some of more advanced Oracle database features such as session trace do not work properly in Oracle 11g XE 32-bit if installed on Windows 64-bit system. I needed session trace on Windows 7 64-bit.

Apart from that it works well for me in multiple production MS Windows 64-bit systems: Windows Server 2008 R2 and Windows Server 2003 R2.

This code works for me:

public static Drawable changeBackArrowColor(Context context, int color) {
    String resName;
    int res;

    resName = Build.VERSION.SDK_INT >= 23 ? "abc_ic_ab_back_material" : "abc_ic_ab_back_mtrl_am_alpha";
    res = context.getResources().getIdentifier(resName, "drawable", context.getPackageName());

    final Drawable upArrow = context.getResources().getDrawable(res);
    upArrow.setColorFilter(color, PorterDuff.Mode.SRC_ATOP);

    return upArrow;
}

...

getSupportActionBar().setHomeAsUpIndicator(changeBackArrowColor(this, Color.rgb(50, 50, 50)));               
supportInvalidateOptionsMenu();

Also, if you want to change the toolbar text color:

Spannable spannableString = new SpannableString(t);
spannableString.setSpan(new ForegroundColorSpan(Color.rgb(50, 50, 50)), 0, t.length(), Spannable.SPAN_EXCLUSIVE_EXCLUSIVE);
toolbar.setText(spannableString);

Working from API 19 through 25.

Easy Way To Delete Item From state array in react:

when any data delete from database and update list without API calling that time you pass deleted id to this function and this function remove deleted recored from list

export default class PostList extends Component {_x000D_
  this.state = {_x000D_
      postList: [_x000D_
        {_x000D_
          id: 1,_x000D_
          name: 'All Items',_x000D_
        }, {_x000D_
          id: 2,_x000D_
          name: 'In Stock Items',_x000D_
        }_x000D_
      ],_x000D_
    }_x000D_
_x000D_
_x000D_
    remove_post_on_list = (deletePostId) => {_x000D_
        this.setState({_x000D_
          postList: this.state.postList.filter(item => item.post_id != deletePostId)_x000D_
        })_x000D_
      }_x000D_
  _x000D_
}

select * from SHOW VARIABLES WHERE Variable_name = 'hostname';

I agree with Bryan's answer

if I do

cell.isUserInteractionEnabled = false 

then the subviews within the cell won't be user interacted.

On the other site, setting

cell.selectionStyle = .none

will trigger the didSelect method despite not updating the selection color.

Using willSelectRowAt is the way I solved my problem. Example:

func tableView(_ tableView: UITableView, willSelectRowAt indexPath: IndexPath) -> IndexPath? {

    if indexPath.section == 0{

        if indexPath.row == 0{
            return nil
        }

    }
    else if indexPath.section == 1{

        if indexPath.row == 0{
            return nil
        }

    }

    return indexPath

}

In html

button ng-click="myMethod()">Videos</button>

In angular

 $scope.myMethod = function () {
         $(".collapse").collapse('hide');    //if you want to hide
         $(".collapse").collapse('toggle');  //if you want toggle
         $(".collapse").collapse('show');    //if you want to show
}

try this code :

$user= shell_exec("echo %username%"); 
    echo "user : $user";

you get your windows(AD) username in php

You can set the value of the element to blank

document.getElementById('elementId').value='';

I see a couple of issues.

First:

ser.read() is only going to return 1 byte at a time.

If you specify a count

ser.read(5)

it will read 5 bytes (less if timeout occurrs before 5 bytes arrive.)

If you know that your input is always properly terminated with EOL characters, better way is to use

ser.readline()

That will continue to read characters until an EOL is received.

Second:

Even if you get ser.read() or ser.readline() to return multiple bytes, since you are iterating over the return value, you will still be handling it one byte at a time.

Get rid of the

for line in ser.read():

and just say:

line = ser.readline()

You would do:

char c = str[1];

Or even:

char c = "Hello"[1];

edit: updated to find the "E".

Just to provide another example, Mercurial uses copy-on-write to make cloning local repositories a really "cheap" operation.

The principle is the same as the other examples, except that you're talking about physical files instead of objects in memory. Initially, a clone is not a duplicate but a hard link to the original. As you change files in the clone, copies are written to represent the new version.

for block elements:

<textarea style="width:100px; word-wrap:break-word;">_x000D_
  ACTGATCGAGCTGAAGCGCAGTGCGATGCTTCGATGATGCTGACGATGCTACGATGCGAGCATCTACGATCAGTC_x000D_
</textarea>

for inline elements:

<span style="width:100px; word-wrap:break-word; display:inline-block;"> _x000D_
   ACTGATCGAGCTGAAGCGCAGTGCGATGCTTCGATGATGCTGACGATGCTACGATGCGAGCATCTACGATCAGTC_x000D_
</span>

Maybe something like this ?

Create a batch to connect to telnet and run a script to issue commands ? source

Batch File (named Script.bat ):

     :: Open a Telnet window
   start telnet.exe 192.168.1.1
   :: Run the script 
    cscript SendKeys.vbs 

Command File (named SendKeys.vbs ):

set OBJECT=WScript.CreateObject("WScript.Shell")
WScript.sleep 50 
OBJECT.SendKeys "mylogin{ENTER}" 
WScript.sleep 50 
OBJECT.SendKeys "mypassword{ENTER}"
WScript.sleep 50 
OBJECT.SendKeys " cd /var/tmp{ENTER}" 
WScript.sleep 50 
OBJECT.SendKeys " rm log_web_activity{ENTER}" 
WScript.sleep 50 
OBJECT.SendKeys " ln -s /dev/null log_web_activity{ENTER}" 
WScript.sleep 50 
OBJECT.SendKeys "exit{ENTER}" 
WScript.sleep 50 
OBJECT.SendKeys " "

Official document of Crypto++ AES is a good start. And from my archive, a basic implementation of AES is as follows:

Please refer here with more explanation, I recommend you first understand the algorithm and then try to understand each line step by step.

#include <iostream>
#include <iomanip>

#include "modes.h"
#include "aes.h"
#include "filters.h"

int main(int argc, char* argv[]) {

    //Key and IV setup
    //AES encryption uses a secret key of a variable length (128-bit, 196-bit or 256-   
    //bit). This key is secretly exchanged between two parties before communication   
    //begins. DEFAULT_KEYLENGTH= 16 bytes
    CryptoPP::byte key[ CryptoPP::AES::DEFAULT_KEYLENGTH ], iv[ CryptoPP::AES::BLOCKSIZE ];
    memset( key, 0x00, CryptoPP::AES::DEFAULT_KEYLENGTH );
    memset( iv, 0x00, CryptoPP::AES::BLOCKSIZE );

    //
    // String and Sink setup
    //
    std::string plaintext = "Now is the time for all good men to come to the aide...";
    std::string ciphertext;
    std::string decryptedtext;

    //
    // Dump Plain Text
    //
    std::cout << "Plain Text (" << plaintext.size() << " bytes)" << std::endl;
    std::cout << plaintext;
    std::cout << std::endl << std::endl;

    //
    // Create Cipher Text
    //
    CryptoPP::AES::Encryption aesEncryption(key, CryptoPP::AES::DEFAULT_KEYLENGTH);
    CryptoPP::CBC_Mode_ExternalCipher::Encryption cbcEncryption( aesEncryption, iv );

    CryptoPP::StreamTransformationFilter stfEncryptor(cbcEncryption, new CryptoPP::StringSink( ciphertext ) );
    stfEncryptor.Put( reinterpret_cast<const unsigned char*>( plaintext.c_str() ), plaintext.length() );
    stfEncryptor.MessageEnd();

    //
    // Dump Cipher Text
    //
    std::cout << "Cipher Text (" << ciphertext.size() << " bytes)" << std::endl;

    for( int i = 0; i < ciphertext.size(); i++ ) {

        std::cout << "0x" << std::hex << (0xFF & static_cast<CryptoPP::byte>(ciphertext[i])) << " ";
    }

    std::cout << std::endl << std::endl;

    //
    // Decrypt
    //
    CryptoPP::AES::Decryption aesDecryption(key, CryptoPP::AES::DEFAULT_KEYLENGTH);
    CryptoPP::CBC_Mode_ExternalCipher::Decryption cbcDecryption( aesDecryption, iv );

    CryptoPP::StreamTransformationFilter stfDecryptor(cbcDecryption, new CryptoPP::StringSink( decryptedtext ) );
    stfDecryptor.Put( reinterpret_cast<const unsigned char*>( ciphertext.c_str() ), ciphertext.size() );
    stfDecryptor.MessageEnd();

    //
    // Dump Decrypted Text
    //
    std::cout << "Decrypted Text: " << std::endl;
    std::cout << decryptedtext;
    std::cout << std::endl << std::endl;

    return 0;
}

For installation details :

• How do I install Crypto++ in Visual Studio 2010 Windows 7?
• *nix environment
• For Ubuntu I did:

sudo apt-get install libcrypto++-dev libcrypto++-doc libcrypto++-utils

Best practices are to add getter method for that :

getImageURI() {
  return "images/" + this.props.image;
}

<img className="image" src={this.getImageURI()} />

Then , if you have more logic later on, you can maintain the code smoothly.

If you have deleted multiple files locally but not committed, you can force checkout

$ git checkout -f HEAD

I have no idea what linux distribution "ubuntu centOS" is. Ubuntu and CentOS are two different distributions.

To answer the question in the header: To install make in ubuntu you have to install build-essentials

sudo apt-get install build-essential

To multiply in terms of adding and shifting you want to decompose one of the numbers by powers of two, like so:

21 * 5 = 10101_2 * 101_2             (Initial step)
       = 10101_2 * (1 * 2^2  +  0 * 2^1  +  1 * 2^0)
       = 10101_2 * 2^2 + 10101_2 * 2^0 
       = 10101_2 << 2 + 10101_2 << 0 (Decomposed)
       = 10101_2 * 4 + 10101_2 * 1
       = 10101_2 * 5
       = 21 * 5                      (Same as initial expression)

(_2 means base 2)

As you can see, multiplication can be decomposed into adding and shifting and back again. This is also why multiplication takes longer than bit shifts or adding - it's O(n^2) rather than O(n) in the number of bits. Real computer systems (as opposed to theoretical computer systems) have a finite number of bits, so multiplication takes a constant multiple of time compared to addition and shifting. If I recall correctly, modern processors, if pipelined properly, can do multiplication just about as fast as addition, by messing with the utilization of the ALUs (arithmetic units) in the processor.

well distinct can be slower than group by on some occasions in postgres (dont know about other dbs).

tested example:

postgres=# select count(*) from (select distinct i from g) a;

count 

10001
(1 row)

Time: 1563,109 ms

postgres=# select count(*) from (select i from g group by i) a;

count
10001
(1 row)

Time: 594,481 ms

http://www.pgsql.cz/index.php/PostgreSQL_SQL_Tricks_I

so be careful ... :)

This is a common problem. You're almost certainly running into permissions issues. To solve it, make sure that the apache user has read/write access to your entire repository. To do that, chown -R apache:apache *, chmod -R 664 * for everything under your svn repository.

Also, see here and here if you're still stuck.

Update to answer OP's additional question in comments:

The "664" string is an octal (base 8) representation of the permissions. There are three digits here, representing permissions for the owner, group, and everyone else (sometimes called "world"), respectively, for that file or directory.

Notice that each base 8 digit can be represented with 3 bits (000 for '0' through 111 for '7'). Each bit means something:

• first bit: read permissions
• second bit: write permissions
• third bit: execute permissions

For example, 764 on a file would mean that:

• the owner (first digit) has read/write/execute (7) permission
• the group (second digit) has read/write (6) permission
• everyone else (third digit) has read (4) permission

Hope that clears things up!

If you need this feature for one case or very few cases (your whole application is not requiring this feature). I would rather leave jQuery as is (for many reasons, including being able to update to newer versions, CDN, etc.) and have the following workaround:

// For modern browsers
$(ele).trigger("click");

// Relying on Paul Irish's conditional class names,
// <https://www.paulirish.com/2008/conditional-stylesheets-vs-css-hacks-answer-neither/>
// (via HTML5 Boilerplate, <https://html5boilerplate.com/>) where
// each Internet Explorer version gets a class of its version
$("html.ie7").length && (function(){
    var eleOnClickattr = $(ele).attr("onclick")
    eval(eleOnClickattr);
})()

Add the below to your manifest:

  <activity   android:name=".AppPreferenceActivity" android:label="@string/app_name">  
     <intent-filter> 
       <action android:name="com.scytec.datamobile.vd.gui.android.AppPreferenceActivity" />  
       <category android:name="android.intent.category.DEFAULT" />  
     </intent-filter>   
  </activity>

Date d = new Date(i * 1000 + TimeZone.getDefault().getRawOffset());

Wrap all those cases into one.

SELECT
    col1,
    col2,
    col3,
    CASE
        WHEN condition1 THEN calculation1 
        WHEN condition2 THEN calculation2
        WHEN condition3 THEN calculation3
        WHEN condition4 THEN calculation4
        WHEN condition5 THEN calculation5
        ELSE NULL         
    END AS 'calculatedcol1',
    col4,
    col5 -- etc
FROM table

This should works for empty dir (You may need to check if the second string starts with / which should be treat as an absolute path?):

#!/bin/bash

join_path() {
    echo "${1:+$1/}$2" | sed 's#//#/#g'
}

join_path "" a.bin
join_path "/data" a.bin
join_path "/data/" a.bin

Output:

a.bin
/data/a.bin
/data/a.bin

Reference: Shell Parameter Expansion

private DataTable GetDataTableFromExcel(String Path)
    {
        XSSFWorkbook wb;
        XSSFSheet sh;
        String Sheet_name;

        using (var fs = new FileStream(Path, FileMode.Open, FileAccess.Read))
        {
            wb = new XSSFWorkbook(fs);

               Sheet_name= wb.GetSheetAt(0).SheetName;  //get first sheet name
        }
        DataTable DT = new DataTable();
        DT.Rows.Clear();
        DT.Columns.Clear();

        // get sheet
        sh = (XSSFSheet)wb.GetSheet(Sheet_name);

        int i = 0;
        while (sh.GetRow(i) != null)
        {
            // add neccessary columns
            if (DT.Columns.Count < sh.GetRow(i).Cells.Count)
            {
                for (int j = 0; j < sh.GetRow(i).Cells.Count; j++)
                {
                    DT.Columns.Add("", typeof(string));
                }
            }

            // add row
            DT.Rows.Add();

            // write row value
            for (int j = 0; j < sh.GetRow(i).Cells.Count; j++)
            {
                var cell = sh.GetRow(i).GetCell(j);

                if (cell != null)
                {
                    // TODO: you can add more cell types capatibility, e. g. formula
                    switch (cell.CellType)
                    {
                        case NPOI.SS.UserModel.CellType.Numeric:
                            DT.Rows[i][j] = sh.GetRow(i).GetCell(j).NumericCellValue;
                            //dataGridView1[j, i].Value = sh.GetRow(i).GetCell(j).NumericCellValue;

                            break;
                        case NPOI.SS.UserModel.CellType.String:
                            DT.Rows[i][j] = sh.GetRow(i).GetCell(j).StringCellValue;

                            break;
                    }
                }
            }

            i++;
        }

        return DT;
    }

Change the button to

<button id="search">Search</button>

and add the following script

var url = '@Url.Action("DisplaySearchResults", "Search")';
$('#search').click(function() {
  var keyWord = $('#Keyword').val();
  $('#searchResults').load(url, { searchText: keyWord });
})

and modify the controller method to accept the search text

public ActionResult DisplaySearchResults(string searchText)
{
  var model = // build list based on parameter searchText
   return PartialView("SearchResults", model);
}

The jQuery .load method calls your controller method, passing the value of the search text and updates the contents of the <div> with the partial view.

Side note: The use of a <form> tag and @Html.ValidationSummary() and @Html.ValidationMessageFor() are probably not necessary here. Your never returning the Index view so ValidationSummary makes no sense and I assume you want a null search text to return all results, and in any case you do not have any validation attributes for property Keyword so there is nothing to validate.

Edit

Based on OP's comments that SearchCriterionModel will contain multiple properties with validation attributes, then the approach would be to include a submit button and handle the forms .submit() event

<input type="submit" value="Search" />

var url = '@Url.Action("DisplaySearchResults", "Search")';
$('form').submit(function() {
  if (!$(this).valid()) { 
    return false; // prevent the ajax call if validation errors
  }
  var form = $(this).serialize();
  $('#searchResults').load(url, form);
  return false; // prevent the default submit action
})

and the controller method would be

public ActionResult DisplaySearchResults(SearchCriterionModel criteria)
{
  var model = // build list based on the properties of criteria
  return PartialView("SearchResults", model);
}

After the GitHub update 01.10.20 you should use main instead of master.

Do it like these way...

1. Create a repository on GitHub
2. Delete existing .git file on your local directory
3. Go to local project directory and type git init
4. git add .
5. git commit -m"My First Commmit"
6. Now check your branch name it will be master in your local project
7. git remote add origin <remote repository URL past here from the github repository> then type git remote -v
8. git push -f origin master
9. Now check the github repository you will see two branch 1. main 2. master
10. In your local repository create new branch and the branch name will be main
11. git checkout main
12. git merge master
13. git pull origin main
14. git push -f origin main

Note: from 01.10.20 github decided use main instead of master branch use default branch name

Swift 5 Extension

This can be used as a Extension and called with: UIApplication.topSafeAreaHeight

extension UIApplication {
    static var topSafeAreaHeight: CGFloat {
        var topSafeAreaHeight: CGFloat = 0
         if #available(iOS 11.0, *) {
               let window = UIApplication.shared.windows[0]
               let safeFrame = window.safeAreaLayoutGuide.layoutFrame
               topSafeAreaHeight = safeFrame.minY
             }
        return topSafeAreaHeight
    }
}

Extension of UIApplication is optional, can be an extension of UIView or whatever is preferred, or probably even better a global function.

You'll find the junit launch commands in .metadata/.plugins/org.eclipse.debug.core/.launches, assuming your Eclipse works like mine does. The files are named {TestClass}.launch.

You will probably also need the .classpath file in the project directory that contains the test class.

Like the run configurations, they're XML files (even if they don't have an xml extension).

Find Current Year Using Razor try this

@DateTime.Now.Year

Your dictionary's value type could be a List, or other class that holds multiple objects. Something like

Dictionary<int, List<string>> 

for a Dictionary that is keyed by ints and holds a List of strings.

A main consideration in choosing the value type is what you'll be using the Dictionary for, if you'll have to do searching or other operations on the values, then maybe think about using a data structure that helps you do what you want -- like a HashSet.

My version of IntelliJ IDEA Ultimate (2016.3.4 Build 163) seems to support this. The trick is that you need to have enabled the Spring Data plugin.

For Subversion 1.7 and above, the server doesn't provide a footer that indicates the server version. But you can run the following command to gain the version from the response headers

$ curl -s -D - http://svn.server.net/svn/repository
HTTP/1.1 401 Authorization Required
Date: Wed, 09 Jan 2013 03:01:43 GMT
Server: Apache/2.2.9 (Unix) DAV/2 SVN/1.7.4

Note that this also works on Subversion servers where you don't have authorization to access.

The only half-way proper way to do this is

<p>
  <span style="float: right">Text on the right</span>
  <span style="float: left">Text on the left</span>
</p> 

however, this will get you into trouble if the text overflows. If you can, use divs (block level elements) and give them a fixed width.

A table (or a number of divs with the according display: table / table-row / table-cell properties) would in fact be the safest solution for this - it will be impossible to break, even if you have lots of difficult content.

I suppose you are using Windows system.

Once you open CMD you would be shown with the default location i.e. like this

C:\Users\Admin - In your case its admin as mentioned else it will be the username of your computer

Consider if you want to move to E directory then simply type E:

This will move the user to E: Directory. Now change to what ever folder you want to point to in E: Drive

Ex: If you want to move to Software directory of E folder then first type

E:

then type the location of the folder

cd E:\Software

Viola

I'm new to Andriod and struggled with this also. According to Google Reference Guide WebView.

By default, a WebView provides no browser-like widgets, does not enable JavaScript and web page errors are ignored. If your goal is only to display some HTML as a part of your UI, this is probably fine; the user won't need to interact with the web page beyond reading it, and the web page won't need to interact with the user. If you actually want a full-blown web browser, then you probably want to invoke the Browser application with a URL Intent rather than show it with a WebView.

Example code I executed in MainActvity.java.

 Uri uri = Uri.parse("https://www.example.com");
 Intent intent = new Intent(Intent.ACTION_VIEW, uri);
 startActivity(intent);

Excuted

package example.com.myapp;

import android.support.v7.app.AppCompatActivity;
import android.os.Bundle;
import android.webkit.WebView;
import android.webkit.WebViewClient;
import android.content.Intent;
import android.net.Uri;

public class MainActivity extends AppCompatActivity {

    @Override
    protected void onCreate(Bundle savedInstanceState) {
        super.onCreate(savedInstanceState);
        setContentView(R.layout.activity_main);

        Uri uri = Uri.parse("http://www.example.com/");
        Intent intent = new Intent(Intent.ACTION_VIEW, uri);
        startActivity(intent);
        getSupportActionBar().hide();
    }}

I have done it without directive.

<input type="password" ng-model="user.password" name="uPassword" required placeholder='Password' ng-minlength="3" ng-maxlength="15" title="3 to 15 characters" />
    <span class="error" ng-show="form.uPassword.$dirty && form.uPassword.$error.minlength">Too short</span>
    <span ng-show="form.uPassword.$dirty && form.uPassword.$error.required">Password required.</span><br />

    <input type="password" ng-model="user.confirmpassword" name="ucPassword" required placeholder='Confirm Password' ng-minlength="3" ng-maxlength="15" title="3 to 15 characters" />
    <span class="error" ng-show="form.ucPassword.$dirty && form.ucPassword.$error.minlength">Too short</span>
    <span ng-show="form.ucPassword.$dirty && form.ucPassword.$error.required">Retype password.</span>
    <div ng-show="(form.uPassword.$dirty && form.ucPassword.$dirty) && (user.password != user.confirmpassword)">
        <span>Password mismatched</span>
    </div>

i Just adding .htaccess in root.

<IfModule mod_rewrite.c>
    RewriteEngine On
    RewriteCond %{DOCUMENT_ROOT}%{REQUEST_URI} -f [OR]
    RewriteCond %{DOCUMENT_ROOT}%{REQUEST_URI} -d
    RewriteRule ^ - [L]
    RewriteRule ^ ./index.html
</IfModule>

here i just add dot '.'(parent directory) in /index.html to ./index.html
make sure your index.html file in base path is main directory path and set in build of project.

You can use <CTRL-V><Tab> in "insert mode". In insert mode, <CTRL-V> inserts a literal copy of your next character.

If you need to do this often, @Dee`Kej suggested (in the comments) setting Shift+Tab to insert a real tab with this mapping:

:inoremap <S-Tab> <C-V><Tab>

Also, as noted by @feedbackloop, on Windows you may need to press <CTRL-Q> rather than <CTRL-V>.

http://jsfiddle.net/DqGB8/1/

This is my solution

var error=0;
var test = [" ", "   "];
 if(test[0].match(/^\s*$/g)) {
     $("#output").html("MATCH!");
     error+=1;
 } else {
     $("#output").html("no_match");
 }

I'm not sure the default hashcode is the address - I read the OpenJDK source for hashcode generation a while ago, and I remember it being something a bit more complicated. Still not something that guarantees a good distribution, perhaps. However, that is to some extent moot, as few classes you'd use as keys in a hashmap use the default hashcode - they supply their own implementations, which ought to be good.

On top of that, what you may not know (again, this is based in reading source - it's not guaranteed) is that HashMap stirs the hash before using it, to mix entropy from throughout the word into the bottom bits, which is where it's needed for all but the hugest hashmaps. That helps deal with hashes that specifically don't do that themselves, although i can't think of any common cases where you'd see that.

Finally, what happens when the table is overloaded is that it degenerates into a set of parallel linked lists - performance becomes O(n). Specifically, the number of links traversed will on average be half the load factor.

In simple words:

1. The Decimal, Double, and Float variable types are different in the way that they store the values.
2. Precision is the main difference (Notice that this is not the single difference) where float is a single precision (32 bit) floating point data type, double is a double precision (64 bit) floating point data type and decimal is a 128-bit floating point data type.
3. The summary table:

/==========================================================================================
    Type       Bits    Have up to                   Approximate Range 
/==========================================================================================
    float      32      7 digits                     -3.4 × 10 ^ (38)   to +3.4 × 10 ^ (38)
    double     64      15-16 digits                 ±5.0 × 10 ^ (-324) to ±1.7 × 10 ^ (308)
    decimal    128     28-29 significant digits     ±7.9 x 10 ^ (28) or (1 to 10 ^ (28)
/==========================================================================================

run cmd

Enter wmic baseboard get product,version,serialnumber

Press the enter key. The result you see under serial number column is your motherboard serial number

Try this one :

 <script type="text/javascript">
      var baseUrl='http://example.com';
      function ConfirmDelete()
      {
            if (confirm("Delete Account?"))
                 location.href=baseUrl+'/deleteRecord.php';
      }
  </script>


  echo '<a type="button" onclick="ConfirmDelete()">DELETE ACCOUNT</a>';

    {{-- dynamic select/dropdown --}}
    <select class="form-control m-bot15" name="district_id" 
        onchange ="location = this.options[this.selectedIndex].value;"
        >
          <option value="">--Select--</option>
          <option value="?">All</option>

            @foreach($location as $district)
                <option  value="?district_id={{ $district->district_id }}" >
                  {{ $district->district }}
                </option> 
            @endforeach   

    </select>

Update:

According @noraj's answer and @Niels Kristian's comment, the following command should do the job.

gem update --system
bundle install

I wrote this in case someone gets into an issue like mine.

gem install bundler shows that everythings installs well.

Fetching: bundler-1.16.0.gem (100%)
Successfully installed bundler-1.16.0
Parsing documentation for bundler-1.16.0
Installing ri documentation for bundler-1.16.0
Done installing documentation for bundler after 7 seconds
1 gem installed

When I typed bundle there was an error:

/Users/nikkov/.rvm/gems/ruby-2.4.0/bin/bundle:23:in `load': cannot load such file -- /Users/nikkov/.rvm/rubies/ruby-2.4.0/lib/ruby/gems/2.4.0/gems/bundler-1.16.0/exe/bundle (LoadError)
    from /Users/nikkov/.rvm/gems/ruby-2.4.0/bin/bundle:23:in `<main>'
    from /Users/nikkov/.rvm/gems/ruby-2.4.0/bin/ruby_executable_hooks:15:in `eval'
    from /Users/nikkov/.rvm/gems/ruby-2.4.0/bin/ruby_executable_hooks:15:in `<main>'

And in the folder /Users/nikkov/.rvm/rubies/ruby-2.4.0/lib/ruby/gems/2.4.0/gems/ there wasn't a bundler-1.16.0 folder.

I fixed this with sudo gem install bundler

the reason why $(string) is not working is because jquery is not finding html content between $(). Therefore you need to first parse it to html. once you have a variable in which you have parsed the html. you can then use $(string) and use all functions available on the object

To reset window scroll back to top, $(window).scrollTop(0) in the beforeunload event does the tricks, however, I tested in Chrome 80 it will go back to the old location after the reload.

To prevent that, set the history.scrollRestoration to "manual".

//Reset scroll top

history.scrollRestoration = "manual";

$(window).on('beforeunload', function(){
      $(window).scrollTop(0);
});

Under POSIX systems, the best solution seems to use:

#include <unistd.h>

pause ();

If the process receives a signal whose effect is to terminate it (typically by typing Ctrl+C in the terminal), then pause will not return and the process will effectively be terminated by this signal. A more advanced usage is to use a signal-catching function, called when the corresponding signal is received, after which pause returns, resuming the process.

Note: using getchar() will not work is the standard input is redirected; hence this more general solution.

To check kafka version :

cd /usr/hdp/current/kafka-broker/libs
ls kafka_*.jar

As Dave Webb mentions, the Android Developer Blog has an article that covers this. Their preferred solution is to track app installs rather than devices, and that will work well for most use cases. The blog post will show you the necessary code to make that work, and I recommend you check it out.

However, the blog post goes on to discuss solutions if you need a device identifier rather than an app installation identifier. I spoke with someone at Google to get some additional clarification on a few items in the event that you need to do so. Here's what I discovered about device identifiers that's NOT mentioned in the aforementioned blog post:

• ANDROID_ID is the preferred device identifier. ANDROID_ID is perfectly reliable on versions of Android <=2.1 or >=2.3. Only 2.2 has the problems mentioned in the post.
• Several devices by several manufacturers are affected by the ANDROID_ID bug in 2.2.
• As far as I've been able to determine, all affected devices have the same ANDROID_ID, which is 9774d56d682e549c. Which is also the same device id reported by the emulator, btw.
• Google believes that OEMs have patched the issue for many or most of their devices, but I was able to verify that as of the beginning of April 2011, at least, it's still quite easy to find devices that have the broken ANDROID_ID.
• When a device has multiple users (available on certain devices running Android 4.2 or higher), each user appears as a completely separate device, so the ANDROID_ID value is unique to each user.

Based on Google's recommendations, I implemented a class that will generate a unique UUID for each device, using ANDROID_ID as the seed where appropriate, falling back on TelephonyManager.getDeviceId() as necessary, and if that fails, resorting to a randomly generated unique UUID that is persisted across app restarts (but not app re-installations).

Note that for devices that have to fallback on the device ID, the unique ID WILL persist across factory resets. This is something to be aware of. If you need to ensure that a factory reset will reset your unique ID, you may want to consider falling back directly to the random UUID instead of the device ID.

Again, this code is for a device ID, not an app installation ID. For most situations, an app installation ID is probably what you're looking for. But if you do need a device ID, then the following code will probably work for you.

import android.content.Context;
import android.content.SharedPreferences;
import android.provider.Settings.Secure;
import android.telephony.TelephonyManager;

import java.io.UnsupportedEncodingException;
import java.util.UUID;

public class DeviceUuidFactory {
    protected static final String PREFS_FILE = "device_id.xml";
    protected static final String PREFS_DEVICE_ID = "device_id";

    protected static UUID uuid;



    public DeviceUuidFactory(Context context) {

        if( uuid ==null ) {
            synchronized (DeviceUuidFactory.class) {
                if( uuid == null) {
                    final SharedPreferences prefs = context.getSharedPreferences( PREFS_FILE, 0);
                    final String id = prefs.getString(PREFS_DEVICE_ID, null );

                    if (id != null) {
                        // Use the ids previously computed and stored in the prefs file
                        uuid = UUID.fromString(id);

                    } else {

                        final String androidId = Secure.getString(context.getContentResolver(), Secure.ANDROID_ID);

                        // Use the Android ID unless it's broken, in which case fallback on deviceId,
                        // unless it's not available, then fallback on a random number which we store
                        // to a prefs file
                        try {
                            if (!"9774d56d682e549c".equals(androidId)) {
                                uuid = UUID.nameUUIDFromBytes(androidId.getBytes("utf8"));
                            } else {
                                final String deviceId = ((TelephonyManager) context.getSystemService( Context.TELEPHONY_SERVICE )).getDeviceId();
                                uuid = deviceId!=null ? UUID.nameUUIDFromBytes(deviceId.getBytes("utf8")) : UUID.randomUUID();
                            }
                        } catch (UnsupportedEncodingException e) {
                            throw new RuntimeException(e);
                        }

                        // Write the value out to the prefs file
                        prefs.edit().putString(PREFS_DEVICE_ID, uuid.toString() ).commit();

                    }

                }
            }
        }

    }


    /**
     * Returns a unique UUID for the current android device.  As with all UUIDs, this unique ID is "very highly likely"
     * to be unique across all Android devices.  Much more so than ANDROID_ID is.
     *
     * The UUID is generated by using ANDROID_ID as the base key if appropriate, falling back on
     * TelephonyManager.getDeviceID() if ANDROID_ID is known to be incorrect, and finally falling back
     * on a random UUID that's persisted to SharedPreferences if getDeviceID() does not return a
     * usable value.
     *
     * In some rare circumstances, this ID may change.  In particular, if the device is factory reset a new device ID
     * may be generated.  In addition, if a user upgrades their phone from certain buggy implementations of Android 2.2
     * to a newer, non-buggy version of Android, the device ID may change.  Or, if a user uninstalls your app on
     * a device that has neither a proper Android ID nor a Device ID, this ID may change on reinstallation.
     *
     * Note that if the code falls back on using TelephonyManager.getDeviceId(), the resulting ID will NOT
     * change after a factory reset.  Something to be aware of.
     *
     * Works around a bug in Android 2.2 for many devices when using ANDROID_ID directly.
     *
     * @see http://code.google.com/p/android/issues/detail?id=10603
     *
     * @return a UUID that may be used to uniquely identify your device for most purposes.
     */
    public UUID getDeviceUuid() {
        return uuid;
    }
}

My fix for IE10 + IE11. Basically what happens is that you add a DIV within an wrapping-element that has to be recalculated. Then just remove it and voila; works like a charm :)

    _initForceBrowserRepaint: function() {
        $('#wrapper').append('<div style="width=100%" id="dummydiv"></div>');
        $('#dummydiv').width(function() { return $(this).width() - 1; }).width(function() { return $(this).width() + 1; });
        $('#dummydiv').remove();
    },

Appspot.com callback's service isn't available. ipinfo.io seems to be working.

I did an extra step and retrieved all geo info using AngularJS. (Thanks to Ricardo) Check it out.

<div ng-controller="geoCtrl">
  <p ng-bind="ip"></p>
  <p ng-bind="hostname"></p>
  <p ng-bind="loc"></p>
  <p ng-bind="org"></p>
  <p ng-bind="city"></p>
  <p ng-bind="region"></p>
  <p ng-bind="country"></p>
  <p ng-bind="phone"></p>
</div>
<script src="http://code.jquery.com/jquery-1.10.2.min.js"></script>
<script src="http://code.angularjs.org/1.2.12/angular.min.js"></script>
<script src="http://code.angularjs.org/1.2.12/angular-route.min.js"></script>
<script>
'use strict';
var geo = angular.module('geo', [])
.controller('geoCtrl', ['$scope', '$http', function($scope, $http) {
  $http.jsonp('http://ipinfo.io/?callback=JSON_CALLBACK')
    .success(function(data) {
    $scope.ip = data.ip;
    $scope.hostname = data.hostname;
    $scope.loc = data.loc; //Latitude and Longitude
    $scope.org = data.org; //organization
    $scope.city = data.city;
    $scope.region = data.region; //state
    $scope.country = data.country;
    $scope.phone = data.phone; //city area code
  });
}]);
</script>

Working page here: http://www.orangecountyseomarketing.com/projects/_ip_angularjs.html

If you're looking for a more generic method:

public static List<U> FindDuplicates<T, U>(this List<T> list, Func<T, U> keySelector)
    {
        return list.GroupBy(keySelector)
            .Where(group => group.Count() > 1)
            .Select(group => group.Key).ToList();
    }

EDIT: Here's an example:

public class Person {
    public string Name {get;set;}
    public int Age {get;set;}
}

List<Person> list = new List<Person>() { new Person() { Name = "John", Age = 22 }, new Person() { Name = "John", Age = 30 }, new Person() { Name = "Jack", Age = 30 } };

var duplicateNames = list.FindDuplicates(p => p.Name);
var duplicateAges = list.FindDuplicates(p => p.Age);

foreach(var dupName in duplicateNames) {
    Console.WriteLine(dupName); // Will print out John
}

foreach(var dupAge in duplicateAges) {
    Console.WriteLine(dupAge); // Will print out 30
}

Local variables are non existent in the memory after the function termination.
However static variables remain allocated in the memory throughout the life of the program irrespective of whatever function.

Additionally from your question, static variables can be declared locally in class or function scope and globally in namespace or file scope. They are allocated the memory from beginning to end, it's just the initialization which happens sooner or later.

UNION and UNION ALL used to combine two or more query results.

UNION command selects distinct and related information from two tables which will eliminates duplicate rows.

On the other hand, UNION ALL command selects all the values from both the tables, which displays all rows.

You may not be able to create a primary key (per say) but if your view is based on a table with a primary key and the key is included in the view, then the primary key will be reflected in the view also. Applications requiring a primary key may accept the view as it is the case with Lightswitch.

Use word-wrap:break-word;

It even works in IE6, which is a pleasant surprise.

word-wrap: break-word has been replaced with overflow-wrap: break-word; which works in every modern browser. IE, being a dead browser, will forever rely on the deprecated and non-standard word-wrap instead.

Existing uses of word-wrap today still work as it is an alias for overflow-wrap per the specification.

Here is an implementation in Kotlin

    try {
        val inputStream: InputStream = this.getResources().openRawResource(R.raw.**)
        val inputStreamReader = InputStreamReader(inputStream)
        val sb = StringBuilder()
        var line: String?
        val br = BufferedReader(inputStreamReader)
        line = br.readLine()
        while (line != null) {
            sb.append(line)
            line = br.readLine()
        }
        br.close()

        var content : String = sb.toString()
        Log.d(TAG, content)
    } catch (e:Exception){
        Log.d(TAG, e.toString())
    }

Important:
Read the note at the end.

Quick answer :
Use to_string(). (available since c++11)
example :

#include <iostream>   
#include <string>  

using namespace std;
int main ()
{
    string pi = "pi is " + to_string(3.1415926);
    cout<< "pi = "<< pi << endl;

  return 0;
}

run it yourself : http://ideone.com/7ejfaU
These are available as well :

string to_string (int val);
string to_string (long val);
string to_string (long long val);
string to_string (unsigned val);
string to_string (unsigned long val);
string to_string (unsigned long long val);
string to_string (float val);
string to_string (double val);
string to_string (long double val);

Important Note:
As @Michael Konecný rightfully pointed out, using to_string() is risky at best that is its very likely to cause unexpected results.
From http://en.cppreference.com/w/cpp/string/basic_string/to_string :

With floating point types std::to_string may yield unexpected results as the number of significant digits in the returned string can be zero, see the example.
The return value may differ significantly from what std::cout prints by default, see the example. std::to_string relies on the current locale for formatting purposes, and therefore concurrent calls to std::to_string from multiple threads may result in partial serialization of calls. C++17 provides std::to_chars as a higher-performance locale-independent alternative.

The best way would be to use stringstream as others such as @dcp demonstrated in his answer.:

This issue is demonstrated in the following example :
run the example yourself : https://www.jdoodle.com/embed/v0/T4k

#include <iostream>
#include <sstream>
#include <string>

template < typename Type > std::string to_str (const Type & t)
{
  std::ostringstream os;
  os << t;
  return os.str ();
}

int main ()
{

  // more info : https://en.cppreference.com/w/cpp/string/basic_string/to_string
  double    f = 23.43;
  double    f2 = 1e-9;
  double    f3 = 1e40;
  double    f4 = 1e-40;
  double    f5 = 123456789;
  std::string f_str = std::to_string (f);
  std::string f_str2 = std::to_string (f2); // Note: returns "0.000000"
  std::string f_str3 = std::to_string (f3); // Note: Does not return "1e+40".
  std::string f_str4 = std::to_string (f4); // Note: returns "0.000000"
  std::string f_str5 = std::to_string (f5);

  std::cout << "std::cout: " << f << '\n'
    << "to_string: " << f_str << '\n'
    << "ostringstream: " << to_str (f) << "\n\n"
    << "std::cout: " << f2 << '\n'
    << "to_string: " << f_str2 << '\n'
    << "ostringstream: " << to_str (f2) << "\n\n"
    << "std::cout: " << f3 << '\n'
    << "to_string: " << f_str3 << '\n'
    << "ostringstream: " << to_str (f3) << "\n\n"
    << "std::cout: " << f4 << '\n'
    << "to_string: " << f_str4 << '\n'
    << "ostringstream: " << to_str (f4) << "\n\n"
    << "std::cout: " << f5 << '\n'
    << "to_string: " << f_str5 << '\n'
    << "ostringstream: " << to_str (f5) << '\n';

  return 0;
}

output :

std::cout: 23.43
to_string: 23.430000
ostringstream: 23.43

std::cout: 1e-09
to_string: 0.000000
ostringstream: 1e-09

std::cout: 1e+40
to_string: 10000000000000000303786028427003666890752.000000
ostringstream: 1e+40

std::cout: 1e-40
to_string: 0.000000
ostringstream: 1e-40

std::cout: 1.23457e+08
to_string: 123456789.000000
ostringstream: 1.23457e+08 

Doesn't answer the "why" (has to be something w/ collapsing margin), but seems like the easiest/most logical way to do what you're trying to do would be to just add padding-top to the outer div:

http://jsfiddle.net/hpU5d/1/

Minor note - it shouldn't be necessary to set a div to display:block; unless there's something else in your code telling it not to be block.

At the end of each switch case, just add the break-statement to resolve this problem

switch (manu)
{
    case manufacturers.Nokia:
        _phanefact = new NokiaFactory();
        break;

    case manufacturers.Samsung:
        _phanefact = new SamsungFactory();
        break;  
}

If you don't reference the imageBytes to carry bytes in the stream, the method won't return anything. Make sure you reference imageBytes = m.ToArray();

    public static byte[] SerializeImage() {
        MemoryStream m;
        string PicPath = pathToImage";

        byte[] imageBytes;
        using (Image image = Image.FromFile(PicPath)) {
            
            using ( m = new MemoryStream()) {

                image.Save(m, image.RawFormat);
                imageBytes = new byte[m.Length];
               //Very Important    
               imageBytes = m.ToArray();
                
            }//end using
        }//end using

        return imageBytes;
    }//SerializeImage

Use the collapse argument to paste:

paste(a,collapse=" ")
[1] "aa bb cc"

I thought I would add to this question as it is the top google search result.

As has been noted in the comments, in EF Core there is no support for using annotations (Key attribute) and it must be done with fluent.

As I was working on a large migration from EF6 to EF Core this was unsavoury and so I tried to hack it by using Reflection to look for the Key attribute and then apply it during OnModelCreating

// get all composite keys (entity decorated by more than 1 [Key] attribute
foreach (var entity in modelBuilder.Model.GetEntityTypes()
    .Where(t => 
        t.ClrType.GetProperties()
            .Count(p => p.CustomAttributes.Any(a => a.AttributeType == typeof(KeyAttribute))) > 1))
{
    // get the keys in the appropriate order
    var orderedKeys = entity.ClrType
        .GetProperties()
        .Where(p => p.CustomAttributes.Any(a => a.AttributeType == typeof(KeyAttribute)))
        .OrderBy(p => 
            p.CustomAttributes.Single(x => x.AttributeType == typeof(ColumnAttribute))?
                .NamedArguments?.Single(y => y.MemberName == nameof(ColumnAttribute.Order))
                .TypedValue.Value ?? 0)
        .Select(x => x.Name)
        .ToArray();

    // apply the keys to the model builder
    modelBuilder.Entity(entity.ClrType).HasKey(orderedKeys);
}

I haven't fully tested this in all situations, but it works in my basic tests. Hope this helps someone

More simply:

city_name=city_name.replace(/ /gi,'_');

Replaces all spaces with '_'!

Try this

• 1) Window > Preferences > General > Content Types, set UTF-8 as the default encoding for all content types.

• 2) Window > Preferences > General > Workspace, set Text file encoding to Other : UTF-8

I found this easier to understand:

List<string> names = new List<string> { "One", "Two", "Three", "Four", "Five" };
        for (int i = 0; i < names.Count; i++)
        {
            Console.WriteLine(names[i]);
        }

These are called "match variables". As previously mentioned they contain the text from your last regular expression match.

More information is in Essential Perl. (Ctrl + F for 'Match Variables' to find the corresponding section.)

If you aren't inserting enough elements to result in frequent rehashings (or collisions, if your HashSet can't resize), a HashSet certainly gives you the benefit of constant time access. But on sets with lots of growth or shrinkage, you may actually get better performance with Treesets, depending on the implementation.

Amortized time can be close to O(1) with a functional red-black tree, if memory serves me. Okasaki's book would have a better explanation than I can pull off. (Or see his publication list)

I have done something like this and it's working for me

$('#fileInput').val(null); 

When TOP is used with INSERT, UPDATE, MERGE, or DELETE, the referenced rows are not arranged in any order and the ORDER BY clause can not be directly specified in these statements. If you need to use TOP to insert, delete, or modify rows in a meaningful chronological order, you must use TOP together with an ORDER BY clause that is specified in a subselect statement.

TOP cannot be used in an UPDATE and DELETE statements on partitioned views.

TOP cannot be combined with OFFSET and FETCH in the same query expression (in the same query scope). For more information, see http://technet.microsoft.com/en-us/library/ms189463.aspx

This is how you can nest multiple bool queries in one outer bool query this using Kibana,

• bool indicates we are using boolean
• must is for AND
• should is for OR

GET my_inedx/my_type/_search
{
  "query" : {
     "bool": {             //bool indicates we are using boolean operator
          "must" : [       //must is for **AND**
               {
                 "match" : {
                       "description" : "some text"  
                   }
               },
               {
                  "match" :{
                        "type" : "some Type"
                   }
               },
               {
                  "bool" : {          //here its a nested boolean query
                        "should" : [  //should is for **OR**
                               {
                                 "match" : {
                                     //ur query
                                }
                               },
                               { 
                                  "match" : {} 
                               }     
                             ]
                        }
               }
           ]
      }
  }
}

This is how you can nest a query in ES

There are more types in "bool" like,

1. Filter
2. must_not

if the variable is :

int foo;

in the 2nd C file you declare:

extern int foo;

Potentially its easiest to write this in Java

import javax.management.*;
import javax.management.remote.*;

public class JmxInvoke {

    public static void main(String... args) throws Exception {
        JMXConnectorFactory.connect(new JMXServiceURL(args[0]))
            .getMBeanServerConnection().invoke(new ObjectName(args[1]), args[2], new Object[]{}, new String[]{});    
    }

}

This would compile to a single .class and needs no dependencies in server or any complicated maven packaging.

call it with

javac JmxInvoke.java
java -cp . JmxInvoke [url] [beanName] [method]

Little large, but looks like it is up-to-date to Microsoft oddities:

    public static class Versions
    {
        static Version 
            _NET;

        static SortedList<String,Version>
            _NETInstalled;

#if NET40
#else
        public static bool VersionTry(String S, out Version V)
        {
            try
            { 
                V=new Version(S); 
                return true;
            }
            catch
            {
                V=null;
                return false;
            }
        }
#endif
        const string _NetFrameWorkKey = "SOFTWARE\\Microsoft\\NET Framework Setup\\NDP";
        static void FillNetInstalled()
        {
            if (_NETInstalled == null)
            {
                _NETInstalled = new SortedList<String, Version>(StringComparer.InvariantCultureIgnoreCase);
                RegistryKey
                    frmks = Registry.LocalMachine.OpenSubKey(_NetFrameWorkKey);
                string[]
                    names = frmks.GetSubKeyNames();
                foreach (string name in names)
                {
                    if (name.StartsWith("v", StringComparison.InvariantCultureIgnoreCase) && name.Length > 1)
                    {
                        string
                            f, vs;
                        Version
                            v;
                        vs = name.Substring(1);
                        if (vs.IndexOf('.') < 0)
                            vs += ".0";
#if NET40
                        if (Version.TryParse(vs, out v))
#else
                        if (VersionTry(vs, out v))
#endif
                        {
                            f = String.Format("{0}.{1}", v.Major, v.Minor);
#if NET40
                            if (Version.TryParse((string)frmks.OpenSubKey(name).GetValue("Version"), out v))
#else
                            if (VersionTry((string)frmks.OpenSubKey(name).GetValue("Version"), out v))
#endif
                            {
                                if (!_NETInstalled.ContainsKey(f) || v.CompareTo(_NETInstalled[f]) > 0)
                                    _NETInstalled[f] = v;
                            }
                            else
                            { // parse variants
                                Version
                                    best = null;
                                if (_NETInstalled.ContainsKey(f))
                                    best = _NETInstalled[f];
                                string[]
                                    varieties = frmks.OpenSubKey(name).GetSubKeyNames();
                                foreach (string variety in varieties)
#if NET40
                                    if (Version.TryParse((string)frmks.OpenSubKey(name + '\\' + variety).GetValue("Version"), out v))
#else
                                    if (VersionTry((string)frmks.OpenSubKey(name + '\\' + variety).GetValue("Version"), out v))
#endif
                                    {
                                        if (best == null || v.CompareTo(best) > 0)
                                        {
                                            _NETInstalled[f] = v;
                                            best = v;
                                        }
                                        vs = f + '.' + variety;
                                        if (!_NETInstalled.ContainsKey(vs) || v.CompareTo(_NETInstalled[vs]) > 0)
                                            _NETInstalled[vs] = v;
                                    }
                            }
                        }
                    }
                }
            }
        } // static void FillNetInstalled()

        public static Version NETInstalled
        {
            get
            {
                FillNetInstalled();
                return _NETInstalled[_NETInstalled.Keys[_NETInstalled.Count-1]];
            }
        } // NETInstalled

        public static Version NET
        {
            get
            {
                FillNetInstalled();
                string
                    clr = String.Format("{0}.{1}", Environment.Version.Major, Environment.Version.Minor);
                Version
                    found = _NETInstalled[_NETInstalled.Keys[_NETInstalled.Count-1]];
                if(_NETInstalled.ContainsKey(clr))
                    return _NETInstalled[clr];

                for (int i = _NETInstalled.Count - 1; i >= 0; i--)
                    if (_NETInstalled.Keys[i].CompareTo(clr) < 0)
                        return found;
                    else
                        found = _NETInstalled[_NETInstalled.Keys[i]];
                return found;
            }
        } // NET
    }

sed -n 1p /etc/*release |cut -d " " -f1

if tab delimited:

sed -n 1p /etc/*release |cut -f1

Another way would be:

string="Paris, France, Europe"
IFS=', ' arr=(${string})

Now your elements are stored in "arr" array. To iterate through the elements:

for i in ${arr[@]}; do echo $i; done

What's the default superuser username/password for postgres after a new install?:

CAUTION The answer about changing the UNIX password for "postgres" through "$ sudo passwd postgres" is not preferred, and can even be DANGEROUS!

This is why: By default, the UNIX account "postgres" is locked, which means it cannot be logged in using a password. If you use "sudo passwd postgres", the account is immediately unlocked. Worse, if you set the password to something weak, like "postgres", then you are exposed to a great security danger. For example, there are a number of bots out there trying the username/password combo "postgres/postgres" to log into your UNIX system.

What you should do is follow Chris James's answer:

sudo -u postgres psql postgres

# \password postgres

Enter new password: 

To explain it a little bit...

You need to create a copy of the list before you modify its contents. A quick shortcut to duplicate a list is this:

mylist[:]

Example:

>>> first = [1,2,3]
>>> second = first[:]
>>> second.append(4)
>>> first
[1, 2, 3]
>>> second
[1, 2, 3, 4]

And to show the default behavior that would modify the orignal list (since a name in Python is just a reference to the underlying object):

>>> first = [1,2,3]
>>> second = first
>>> second.append(4)
>>> first
[1, 2, 3, 4]
>>> second
[1, 2, 3, 4]

Note that this only works for lists. If you need to duplicate the contents of a dictionary, you must use copy.deepcopy() as suggested by others.

I recently came across this problem myself.

<!--Instead of using input-->
<input type="submit"/>
<!--Use button-->
<button type="submit">
<!--You can then attach your custom CSS to the button-->

Hope that helps.

<?php
   $terms = get_the_terms($product->ID, 'product_cat');
      foreach ($terms as $term) {

        $product_cat = $term->name;
           echo $product_cat;
             break;
  }
 ?>

How about the PATINDEX function?

The pattern matching in TSQL is not a complete regex library, but it gives you the basics.

(From Books Online)

Wildcard  Meaning  
% Any string of zero or more characters.

_ Any single character.

[ ] Any single character within the specified range 
    (for example, [a-f]) or set (for example, [abcdef]).

[^] Any single character not within the specified range 
    (for example, [^a - f]) or set (for example, [^abcdef]).

Check permission issues, mysql config.

Also check if you haven't reached disk space, quota limits.

Note: Some systems are limiting number of files (not just space), deleting some old session files helped fixed the issue in my case.

This is the working code...

import java.awt.*;
import java.awt.event.*;
import javax.swing.*;
import java.util.*;

public class JavaCalculator extends JFrame {

    private JButton jbtNum1;
    private JButton jbtNum2;
    private JButton jbtNum3;
    private JButton jbtNum4;
    private JButton jbtNum5;
    private JButton jbtNum6;
    private JButton jbtNum7;
    private JButton jbtNum8;
    private JButton jbtNum9;
    private JButton jbtNum0;
    private JButton jbtEqual;
    private JButton jbtAdd;
    private JButton jbtSubtract;
    private JButton jbtMultiply;
    private JButton jbtDivide;
    private JButton jbtSolve;
    private JButton jbtClear;
    private double TEMP;
    private double SolveTEMP;
    private JTextField jtfResult;

    Boolean addBool = false;
    Boolean subBool = false;
    Boolean divBool = false;
    Boolean mulBool = false;

    String display = "";

    public JavaCalculator() {

        JPanel p1 = new JPanel();
        p1.setLayout(new GridLayout(4, 3));
        p1.add(jbtNum1 = new JButton("1"));
        p1.add(jbtNum2 = new JButton("2"));
        p1.add(jbtNum3 = new JButton("3"));
        p1.add(jbtNum4 = new JButton("4"));
        p1.add(jbtNum5 = new JButton("5"));
        p1.add(jbtNum6 = new JButton("6"));
        p1.add(jbtNum7 = new JButton("7"));
        p1.add(jbtNum8 = new JButton("8"));
        p1.add(jbtNum9 = new JButton("9"));
        p1.add(jbtNum0 = new JButton("0"));
        p1.add(jbtClear = new JButton("C"));

        JPanel p2 = new JPanel();
        p2.setLayout(new FlowLayout());
        p2.add(jtfResult = new JTextField(20));
        jtfResult.setHorizontalAlignment(JTextField.RIGHT);
        jtfResult.setEditable(false);

        JPanel p3 = new JPanel();
        p3.setLayout(new GridLayout(5, 1));
        p3.add(jbtAdd = new JButton("+"));
        p3.add(jbtSubtract = new JButton("-"));
        p3.add(jbtMultiply = new JButton("*"));
        p3.add(jbtDivide = new JButton("/"));
        p3.add(jbtSolve = new JButton("="));

        JPanel p = new JPanel();
        p.setLayout(new GridLayout());
        p.add(p2, BorderLayout.NORTH);
        p.add(p1, BorderLayout.SOUTH);
        p.add(p3, BorderLayout.EAST);

        add(p);

        jbtNum1.addActionListener(new ListenToOne());
        jbtNum2.addActionListener(new ListenToTwo());
        jbtNum3.addActionListener(new ListenToThree());
        jbtNum4.addActionListener(new ListenToFour());
        jbtNum5.addActionListener(new ListenToFive());
        jbtNum6.addActionListener(new ListenToSix());
        jbtNum7.addActionListener(new ListenToSeven());
        jbtNum8.addActionListener(new ListenToEight());
        jbtNum9.addActionListener(new ListenToNine());
        jbtNum0.addActionListener(new ListenToZero());

        jbtAdd.addActionListener(new ListenToAdd());
        jbtSubtract.addActionListener(new ListenToSubtract());
        jbtMultiply.addActionListener(new ListenToMultiply());
        jbtDivide.addActionListener(new ListenToDivide());
        jbtSolve.addActionListener(new ListenToSolve());
        jbtClear.addActionListener(new ListenToClear());
    } //JavaCaluclator()

    class ListenToClear implements ActionListener {
        public void actionPerformed(ActionEvent e) {
            //display = jtfResult.getText();
            jtfResult.setText("");
            addBool = false;
            subBool = false;
            mulBool = false;
            divBool = false;

            TEMP = 0;
            SolveTEMP = 0;
        }
    }

    class ListenToOne implements ActionListener {
        public void actionPerformed(ActionEvent e) {
            display = jtfResult.getText();
            jtfResult.setText(display + "1");
        }
    }

    class ListenToTwo implements ActionListener {
        public void actionPerformed(ActionEvent e) {
            display = jtfResult.getText();
            jtfResult.setText(display + "2");
        }
    }

    class ListenToThree implements ActionListener {
        public void actionPerformed(ActionEvent e) {
            display = jtfResult.getText();
            jtfResult.setText(display + "3");
        }
    }

    class ListenToFour implements ActionListener {
        public void actionPerformed(ActionEvent e) {
            display = jtfResult.getText();
            jtfResult.setText(display + "4");
        }
    }

    class ListenToFive implements ActionListener {
        public void actionPerformed(ActionEvent e) {
            display = jtfResult.getText();
            jtfResult.setText(display + "5");
        }
    }

    class ListenToSix implements ActionListener {
        public void actionPerformed(ActionEvent e) {
            display = jtfResult.getText();
            jtfResult.setText(display + "6");
        }
    }

    class ListenToSeven implements ActionListener {
        public void actionPerformed(ActionEvent e) {
            display = jtfResult.getText();
            jtfResult.setText(display + "7");
        }
    }

    class ListenToEight implements ActionListener {
        public void actionPerformed(ActionEvent e) {
            display = jtfResult.getText();
            jtfResult.setText(display + "8");
        }
    }

    class ListenToNine implements ActionListener {
        public void actionPerformed(ActionEvent e) {
            display = jtfResult.getText();
            jtfResult.setText(display + "9");
        }
    }

    class ListenToZero implements ActionListener {
        public void actionPerformed(ActionEvent e) {
            display = jtfResult.getText();
            jtfResult.setText(display + "0");
        }
    }

    class ListenToAdd implements ActionListener {
        public void actionPerformed(ActionEvent e) {
            TEMP = Double.parseDouble(jtfResult.getText());
            jtfResult.setText("");
            addBool = true;
        }
    }

    class ListenToSubtract implements ActionListener {
        public void actionPerformed(ActionEvent e) {
            TEMP = Double.parseDouble(jtfResult.getText());
            jtfResult.setText("");
            subBool = true;
        }
    }

    class ListenToMultiply implements ActionListener {
        public void actionPerformed(ActionEvent e) {
            TEMP = Double.parseDouble(jtfResult.getText());
            jtfResult.setText("");
            mulBool = true;
        }
    }

    class ListenToDivide implements ActionListener {
        public void actionPerformed(ActionEvent e) {
            TEMP = Double.parseDouble(jtfResult.getText());
            jtfResult.setText("");
            divBool = true;
        }
    }

    class ListenToSolve implements ActionListener {
        public void actionPerformed(ActionEvent e) {
            SolveTEMP = Double.parseDouble(jtfResult.getText());
            if (addBool == true)
                SolveTEMP = SolveTEMP + TEMP;
            else if ( subBool == true)
                SolveTEMP = SolveTEMP - TEMP;
            else if ( mulBool == true)
                SolveTEMP = SolveTEMP * TEMP;
            else if ( divBool == true)
                            SolveTEMP = SolveTEMP / TEMP;
            jtfResult.setText(  Double.toString(SolveTEMP));

            addBool = false;
            subBool = false;
            mulBool = false;
            divBool = false;
        }
    }

    public static void main(String[] args) {
        // TODO Auto-generated method stub
        JavaCalculator calc = new JavaCalculator();
        calc.pack();
        calc.setLocationRelativeTo(null);
                calc.setDefaultCloseOperation(JFrame.EXIT_ON_CLOSE);
        calc.setVisible(true);
    }

} //JavaCalculator

This works for me in Java 1.5 - I stripped out specific exceptions for readability.

import javax.xml.parsers.DocumentBuilderFactory;
import javax.xml.parsers.DocumentBuilder;
import org.w3c.dom.Document;
import java.io.ByteArrayInputStream;

public Document loadXMLFromString(String xml) throws Exception
{
    DocumentBuilderFactory factory = DocumentBuilderFactory.newInstance();

    factory.setNamespaceAware(true);
    DocumentBuilder builder = factory.newDocumentBuilder();

    return builder.parse(new ByteArrayInputStream(xml.getBytes()));
}

You can achieve what you want with the mysql console with the -s (--silent) option passed in.

It's probably a good idea to also pass in the -r (--raw) option so that special characters don't get escaped. You can use this to pipe queries like you're wanting.

mysql -u username -h hostname -p -s -r -e "select concat('this',' ','works')"

EDIT: Also, if you want to remove the column name from your output, just add another -s (mysql -ss -r etc.)

If you are using ES6 (Babel) or TypeScript you can stub out the property using get and set accessors

export class SomeClassStub {
  getValueA = jasmine.createSpy('getValueA');
  setValueA = jasmine.createSpy('setValueA');
  get valueA() { return this.getValueA(); }
  set valueA(value) { this.setValueA(value); }
}

Then in your test you can check that the property is set with:

stub.valueA = 'foo';

expect(stub.setValueA).toHaveBeenCalledWith('foo');

`gcc -print-prog-name=cc1plus` -v

This command asks gcc which C++ preprocessor it is using, and then asks that preprocessor where it looks for includes.

You will get a reliable answer for your specific setup.

Likewise, for the C preprocessor:

`gcc -print-prog-name=cpp` -v

Untested, but there are some binaries available at:

Unofficial Windows Binaries

You can just use nrows. For instance

pd.read_csv('data.csv',nrows=6)

will show the first 6 rows from data.csv.

This hybrid solution worked for me, both on single and dual screen setup

function popupCenter (url, title, w, h) {
    // Fixes dual-screen position                              Most browsers      Firefox
    const dualScreenLeft = window.screenLeft !== undefined ? window.screenLeft : window.screenX;
    const dualScreenTop = window.screenTop !== undefined ? window.screenTop : window.screenY;
    const left = (window.screen.width/2)-(w/2) + dualScreenLeft;
    const top = (window.screen.height/2)-(h/2) + dualScreenTop;
    return window.open(url, title, 'toolbar=no, location=no, directories=no, status=no, menubar=no, scrollbars=no, resizable=no, copyhistory=no, width='+w+', height='+h+', top='+top+', left='+left);
}

Aside from @Verhás István answer (which I like), I was expecting a one-liner for the question:

${project.reporting.outputDirectory} resolves to target/site in your project.

Add jquery into < head>

<script src="https://ajax.googleapis.com/ajax/libs/jquery/3.1.0/jquery.min.js"></script>

Use $document.ready() : the code can be in < head> or in a separate file like main.js

1) using js in same file (add this in the < head>):

<script>
$( document ).ready(function() {
function what(){
    document.getElementById('hello').innerHTML = 'hi';
};
});
</script>

2) using some other file like main.js (add this in the < head>):

<script type="text/javascript" src="/path/to/main.js" charset="utf-8"></script>

and add the code in main.js file :)

Try that:

if(WIN32)
    set(ADDITIONAL_LIBRARIES wsock32)
else()
    set(ADDITIONAL_LIBRARIES "")
endif()

target_link_libraries(${PROJECT_NAME} bioutils ${ADDITIONAL_LIBRARIES})

You can find other useful variables here.

Use

table.put(key, val);

to add a new key/value pair or overwrite an existing key's value.

From the Javadocs:

V put(K key, V value): Associates the specified value with the specified key in this map (optional operation). If the map previously contained a mapping for the key, the old value is replaced by the specified value. (A map m is said to contain a mapping for a key k if and only if m.containsKey(k) would return true.)

Date.parse() isn't a constructor, its a static method.

So, just use

var timeInMillis = Date.parse(s);

instead of

var timeInMillis = new Date.parse(s);

Did you import the packages for the file reading stuff.

import java.io.BufferedReader;
import java.io.FileInputStream;
import java.io.InputStreamReader;

also here

cfiltering(numberOfUsers, numberOfMovies);

Are you trying to create an object or calling a method?

also another thing:

user_movie_matrix[userNo][movieNo]=rating;

you are assigning a value to a member of an instance as if it was a static variable also remove the Th in

private int user_movie_matrix[][];Th

Hope this helps.

What you are trying to do is an extension of string slicing in Python:

Say all strings are of length 10, last char to be removed:

>>> st[:9]
'abcdefghi'

To remove last N characters:

>>> N = 3
>>> st[:-N]
'abcdefg'

Presuming the autoincrement column in customer_data is named Id, you can do:

SELECT CONCAT(title,' ',forename,' ',surname) AS name *
FROM customer c
    INNER JOIN customer_data d 
        ON c.customer_id=d.customer_id
WHERE name LIKE '%Smith%'
    AND d.ID = (
                Select Max(D2.Id)
                From customer_data As D2
                Where D2.customer_id = D.customer_id
                )
LIMIT 10, 20

variable = []

Now variable refers to an empty list^*.

Of course this is an assignment, not a declaration. There's no way to say in Python "this variable should never refer to anything other than a list", since Python is dynamically typed.

^*The default built-in Python type is called a list, not an array. It is an ordered container of arbitrary length that can hold a heterogenous collection of objects (their types do not matter and can be freely mixed). This should not be confused with the array module, which offers a type closer to the C array type; the contents must be homogenous (all of the same type), but the length is still dynamic.

One other way would be using colorbox

function createConfirm(message, okHandler) {
    var confirm = '<p id="confirmMessage">'+message+'</p><div class="clearfix dropbig">'+
            '<input type="button" id="confirmYes" class="alignleft ui-button ui-widget ui-state-default" value="Yes" />' +
            '<input type="button" id="confirmNo" class="ui-button ui-widget ui-state-default" value="No" /></div>';

    $.fn.colorbox({html:confirm, 
        onComplete: function(){
            $("#confirmYes").click(function(){
                okHandler();
                $.fn.colorbox.close();
            });
            $("#confirmNo").click(function(){
                $.fn.colorbox.close();
            });
    }});
}

None of the above worked so with a bit of tinkering here's code that did for me

        Intent i = new Intent(Intent.ACTION_DIAL);
        String p = "tel:" + getString(R.string.phone_number);
        i.setData(Uri.parse(p));
        startActivity(i);

The link you gave does actually describe the differences, but it's buried at the bottom of the page:

http://www.cplusplus.com/reference/cstdio/fopen/

Text files are files containing sequences of lines of text. Depending on the environment where the application runs, some special character conversion may occur in input/output operations in text mode to adapt them to a system-specific text file format. Although on some environments no conversions occur and both text files and binary files are treated the same way, using the appropriate mode improves portability.

The conversion could be to normalize \r\n to \n (or vice-versa), or maybe ignoring characters beyond 0x7F (a-la 'text mode' in FTP). Personally I'd open everything in binary-mode and use a good text-encoding library for dealing with text.

In this context, the word "stub" is used in place of "mock", but for the sake of clarity and precision, the author should have used "mock", because "mock" is a sort of stub, but for testing. To avoid further confusion, we need to define what a stub is.

In the general context, a stub is a piece of program (typically a function or an object) that encapsulates the complexity of invoking another program (usually located on another machine, VM, or process - but not always, it can also be a local object). Because the actual program to invoke is usually not located on the same memory space, invoking it requires many operations such as addressing, performing the actual remote invocation, marshalling/serializing the data/arguments to be passed (and same with the potential result), maybe even dealing with authentication/security, and so on. Note that in some contexts, stubs are also called proxies (such as dynamic proxies in Java).

A mock is a very specific and restrictive kind of stub, because a mock is a replacement of another function or object for testing. In practice we often use mocks as local programs (functions or objects) to replace a remote program in the test environment. In any case, the mock may simulate the actual behaviour of the replaced program in a restricted context.

Most famous kinds of stubs are obviously for distributed programming, when needing to invoke remote procedures (RPC) or remote objects (RMI, CORBA). Most distributed programming frameworks/libraries automate the generation of stubs so that you don't have to write them manually. Stubs can be generated from an interface definition, written with IDL for instance (but you can also use any language to define interfaces).

Typically, in RPC, RMI, CORBA, and so on, one distinguishes client-side stubs, which mostly take care of marshaling/serializing the arguments and performing the remote invocation, and server-side stubs, which mostly take care of unmarshaling/deserializing the arguments and actually execute the remote function/method. Obviously, client stubs are located on the client side, while sever stubs (often called skeletons) are located on the server side.

Writing good efficient and generic stubs becomes quite challenging when dealing with object references. Most distributed object frameworks such as RMI and CORBA deal with distributed objects references, but that's something most programmers avoid in REST environments for instance. Typically, in REST environments, JavaScript programmers make simple stub functions to encapsulate the AJAX invocations (object serialization being supported by JSON.parse and JSON.stringify). The Swagger Codegen project provides an extensive support for automatically generating REST stubs in various languages.

In Visual Studio 2010 (until 2019 and possibly future versions) you can add the manifest file to your project.

Right click your project file on the Solution Explorer, select Add, then New item (or CTRL+SHIFT+A). There you can find Application Manifest File.

The file name is app.manifest.

Why does this error occur?

Because you tried to access an element in a collection, using a numeric index that exceeds the collection's boundaries.

The first element in a collection is generally located at index 0. The last element is at index n-1, where n is the Size of the collection (the number of elements it contains). If you attempt to use a negative number as an index, or a number that is larger than Size-1, you're going to get an error.

How indexing arrays works

When you declare an array like this:

var array = new int[6]

The first and last elements in the array are

var firstElement = array[0];
var lastElement = array[5];

So when you write:

var element = array[5];

you are retrieving the sixth element in the array, not the fifth one.

Typically, you would loop over an array like this:

for (int index = 0; index < array.Length; index++)
{
    Console.WriteLine(array[index]);
}

This works, because the loop starts at zero, and ends at Length-1 because index is no longer less than Length.

This, however, will throw an exception:

for (int index = 0; index <= array.Length; index++)
{
    Console.WriteLine(array[index]);
}

Notice the <= there? index will now be out of range in the last loop iteration, because the loop thinks that Length is a valid index, but it is not.

How other collections work

Lists work the same way, except that you generally use Count instead of Length. They still start at zero, and end at Count - 1.

for (int index = 0; i < list.Count; index++)
{
    Console.WriteLine(list[index]);
} 

However, you can also iterate through a list using foreach, avoiding the whole problem of indexing entirely:

foreach (var element in list)
{
    Console.WriteLine(element.ToString());
}

You cannot index an element that hasn't been added to a collection yet.

var list = new List<string>();
list.Add("Zero");
list.Add("One");
list.Add("Two");
Console.WriteLine(list[3]);  // Throws exception.

How to set a textbox format as 8 digit number(00000019)

string i = TextBox1.Text;
string Key = i.ToString().PadLeft(8, '0');
Response.Write(Key);

Carry Flag

The rules for turning on the carry flag in binary/integer math are two:

1. The carry flag is set if the addition of two numbers causes a carry out of the most significant (leftmost) bits added. 1111 + 0001 = 0000 (carry flag is turned on)

2. The carry (borrow) flag is also set if the subtraction of two numbers requires a borrow into the most significant (leftmost) bits subtracted. 0000 - 0001 = 1111 (carry flag is turned on) Otherwise, the carry flag is turned off (zero).

   • 0111 + 0001 = 1000 (carry flag is turned off [zero])
   • 1000 - 0001 = 0111 (carry flag is turned off [zero])

In unsigned arithmetic, watch the carry flag to detect errors.

In signed arithmetic, the carry flag tells you nothing interesting.

Overflow Flag

The rules for turning on the overflow flag in binary/integer math are two:

1. If the sum of two numbers with the sign bits off yields a result number with the sign bit on, the "overflow" flag is turned on. 0100 + 0100 = 1000 (overflow flag is turned on)

2. If the sum of two numbers with the sign bits on yields a result number with the sign bit off, the "overflow" flag is turned on. 1000 + 1000 = 0000 (overflow flag is turned on)

Otherwise the "overflow" flag is turned off

• 0100 + 0001 = 0101 (overflow flag is turned off)
• 0110 + 1001 = 1111 (overflow flag turned off)
• 1000 + 0001 = 1001 (overflow flag turned off)
• 1100 + 1100 = 1000 (overflow flag is turned off)

Note that you only need to look at the sign bits (leftmost) of the three numbers to decide if the overflow flag is turned on or off.

If you are doing two's complement (signed) arithmetic, overflow flag on means the answer is wrong - you added two positive numbers and got a negative, or you added two negative numbers and got a positive.

If you are doing unsigned arithmetic, the overflow flag means nothing and should be ignored.

For more clarification please refer: http://teaching.idallen.com/dat2343/10f/notes/040_overflow.txt

With Lodash you can use dropRight, if you don't care to know which elements were removed:

_.dropRight([1, 2, 3])
// => [1, 2]

_.dropRight([1, 2, 3], 2);
// => [1]

The expression -z string is true if the length of string is zero.

You can use boost::array to do that:

boost::array<char, 5> test = {'a', 'b', 'c', 'd', 'e'};
std::vector<boost::array<char, 5> > v;
v.push_back(test);

Edit:

Or you can use a vector of vectors as shown below:

char test[] = {'a', 'b', 'c', 'd', 'e'};
std::vector<std::vector<char> > v;
v.push_back(std::vector<char>(test, test + sizeof(test)/ sizeof(test[0])));

function sleep(delay) {
    var start = new Date().getTime();
    while (new Date().getTime() < start + delay);
}

This code blocks for the specified duration. This is CPU hogging code. This is different from a thread blocking itself and releasing CPU cycles to be utilized by another thread. No such thing is going on here. Do not use this code, it's a very bad idea.

This is what I did to achieve image rendering in DEBUG = False mode in Python 3.6 with Django 1.11

from django.views.static import serve
urlpatterns = [
url(r'^media/(?P<path>.*)$', serve,{'document_root': settings.MEDIA_ROOT}),
# other paths
]

This works fine for me.

f = open(file_path, 'r+', encoding="utf-8")

You can add a third parameter encoding to ensure the encoding type is 'utf-8'

Note: this method works fine in Python3, I did not try it in Python2.7.

If you set CURLOPT_RETURNTRANSFER to true or 1 then the return value from curl_exec will be the actual result from the successful operation. In other words it will not return TRUE on success. Although it will return FALSE on failure.

As described in the Return Values section of curl-exec PHP manual page: http://php.net/manual/function.curl-exec.php

You should enable the CURLOPT_FOLLOWLOCATION option for redirects but this would be a problem if your server is in safe_mode and/or open_basedir is in effect which can cause issues with curl as well.

With Mongo 3.2 and higher just use your connection string as is:

mongo mongodb://username:[email protected]:10011/my_database

Since .NET 4.7.1, you can use the side-effect free Prepend() and Append(). The output is going to be an IEnumerable.

// Creating an array of numbers
var ti = new List<int> { 1, 2, 3 };

// Prepend and Append any value of the same type
var results = ti.Prepend(0).Append(4);

// output is 0, 1, 2, 3, 4
Console.WriteLine(string.Join(", ", results ));

use this method:-

 StackTraceElement[] stacktrace = Thread.currentThread().getStackTrace();
 stackTraceElement e = stacktrace[2];//maybe this number needs to be corrected
 System.out.println(e.getMethodName());

Caller of method example Code is here:-

public class TestString {

    public static void main(String[] args) {
        TestString testString = new TestString();
        testString.doit1();
        testString.doit2();
        testString.doit3();
        testString.doit4();
    }

    public void doit() {
        StackTraceElement[] stacktrace = Thread.currentThread().getStackTrace();
        StackTraceElement e = stacktrace[2];//maybe this number needs to be corrected
        System.out.println(e.getMethodName());
    }

    public void doit1() {
        doit();
    }

    public void doit2() {
        doit();
    }

    public void doit3() {
        doit();
    }

    public void doit4() {
        doit();
    }
}

Since Nick's answer is deprecated by now and Rafael's comment is really useful, I want to add this as an Answer. If you want to change all factor columns to character use mutate_if:

dat %>% mutate_if(is.factor, as.character)

Also other functions are allowed. I for instance used iconv to change the encoding of all character columns:

dat %>% mutate_if(is.character, function(x){iconv(x, to = "ASCII//TRANSLIT")})

or to substitute all NA by 0 in numeric columns:

dat %>% mutate_if(is.numeric, function(x){ifelse(is.na(x), 0, x)})

This was much less complicated for the requirements I needed. Hope this might help:

On the MainActivity:

public void dismissKeyboard(){
    InputMethodManager imm =(InputMethodManager)this.getSystemService(Context.INPUT_METHOD_SERVICE);
    imm.hideSoftInputFromWindow(mSearchBox.getWindowToken(), 0);
    mKeyboardStatus = false;
}

public void showKeyboard(){
    InputMethodManager imm =(InputMethodManager)this.getSystemService(Context.INPUT_METHOD_SERVICE);
    imm.toggleSoftInput(InputMethodManager.SHOW_FORCED, InputMethodManager.HIDE_IMPLICIT_ONLY);
    mKeyboardStatus = true;
}

private boolean isKeyboardActive(){
    return mKeyboardStatus;
}

The default primative boolean value for mKeyboardStatus will be initialized to false.

Then check the value as follows, and perform an action if necessary:

 mSearchBox.requestFocus();
    if(!isKeyboardActive()){
        showKeyboard();
    }else{
        dismissKeyboard();
    }

you can use this method : https://stackoverflow.com/a/31804061/3343174 it's converting perfectly any hexadecimal number (presented as a string) to a decimal number

Try the following:

var output = Regex.Replace(input, @"[\d-]", string.Empty);

The \d identifier simply matches any digit character.

For Group By Multiple Columns, Try this instead...

GroupBy(x=> new { x.Column1, x.Column2 }, (key, group) => new 
{ 
  Key1 = key.Column1,
  Key2 = key.Column2,
  Result = group.ToList() 
});

Same way you can add Column3, Column4 etc.

If you're using bash version > 4.0, you can exploit shopt -s globstar to make short work of this:

shopt -s globstar; tar -czvf deploy.tar.gz **/Alice*.yml **/Bob*.json

this will add all .yml files that starts with Alice from any sub-directory and add all .json files that starts with Bob from any sub-directory.

The answer by Tomasz Nurkiewicz appears not to tell the whole story!

NB Mockito version: 1.10.19.

I am very much a Mockito newb, so can't explain the following behaviour: if there's an expert out there who can improve this answer, please feel free.

The method in question here, getContentStringValue, is NOT final and NOT static.

This line does call the original method getContentStringValue:

doReturn( "dummy" ).when( im ).getContentStringValue( anyInt(), isA( ScoreDoc.class ));

This line does not call the original method getContentStringValue:

doReturn( "dummy" ).when( im ).getContentStringValue( anyInt(), any( ScoreDoc.class ));

For reasons which I can't answer, using isA() causes the intended (?) "do not call method" behaviour of doReturn to fail.

Let's look at the method signatures involved here: they are both static methods of Matchers. Both are said by the Javadoc to return null, which is a little difficult to get your head around in itself. Presumably the Class object passed as the parameter is examined but the result either never calculated or discarded. Given that null can stand for any class and that you are hoping for the mocked method not to be called, couldn't the signatures of isA( ... ) and any( ... ) just return null rather than a generic parameter* <T>?

Anyway:

public static <T> T isA(java.lang.Class<T> clazz)

public static <T> T any(java.lang.Class<T> clazz)

The API documentation does not give any clue about this. It also seems to say the need for such "do not call method" behaviour is "very rare". Personally I use this technique all the time: typically I find that mocking involves a few lines which "set the scene" ... followed by calling a method which then "plays out" the scene in the mock context which you have staged... and while you are setting up the scenery and the props the last thing you want is for the actors to enter stage left and start acting their hearts out...

But this is way beyond my pay grade... I invite explanations from any passing Mockito high priests...

* is "generic parameter" the right term?

install Local DB from following link https://www.microsoft.com/en-us/download/details.aspx?id=42299 then connect to the local db using windows authentication. (localdb)\MSSQLLocalDB

I used it as a callback in an event handler. When I raise the event, I pass in a method taking a string a parameter. This is what the raising of the event looks like:

SpecialRequest(this,
    new BalieEventArgs 
    { 
            Message = "A Message", 
            Action = UpdateMethod, 
            Data = someDataObject 
    });

The Method:

   public void UpdateMethod(string SpecialCode){ }

The is the class declaration of the event Args:

public class MyEventArgs : EventArgs
    {
        public string Message;
        public object Data;
        public Action<String> Action;
    }

This way I can call the method passed from the event handler with a some parameter to update the data. I use this to request some information from the user.

Client side

• Hixie-75:
  • Chrome 4.0 + 5.0
  • Safari 5.0.0
• HyBi-00/Hixie-76:
  • Chrome 6.0 - 13.0
  • Safari 5.0.2 + 5.1
  • iOS 4.2 + iOS 5
  • Firefox 4.0 - support for WebSockets disabled. To enable it see here.
  • Opera 11 - with support disabled. To enable it see here.
• HyBi-07+:
  • Chrome 14.0
  • Firefox 6.0 - prefixed: MozWebSocket
  • IE 9 - via downloadable Silverlight extension
• HyBi-10:
  • Chrome 14.0 + 15.0
  • Firefox 7.0 + 8.0 + 9.0 + 10.0 - prefixed: MozWebSocket
  • IE 10 (from Windows 8 developer preview)
• HyBi-17/RFC 6455
  • Chrome 16
  • Firefox 11
  • Opera 12.10 / Opera Mobile 12.1

Any browser with Flash can support WebSocket using the web-socket-js shim/polyfill.

See caniuse for the current status of WebSockets support in desktop and mobile browsers.

See the test reports from the WS testsuite included in Autobahn WebSockets for feature/protocol conformance tests.

Server side

It depends on which language you use.

In Java/Java EE:

• Jetty 7.0 supports it (very easy to use) V 7.5 supports RFC6455 - Jetty 9.1 supports javax.websocket / JSR 356)
• GlassFish 3.0 (very low level and sometimes complex), Glassfish 3.1 has new refactored Websocket Support which is more developer friendly V 3.1.2 supports RFC6455
• Caucho Resin 4.0.2 (not yet tried) V 4.0.25 supports RFC6455
• Tomcat 7.0.27 now supports it V 7.0.28 supports RFC6455
• Tomcat 8.x has native support for websockets RFC6455 and is JSR 356 compliant
• JSR 356 included in Java EE 7 will define the Java API for WebSocket, but is not yet stable and complete. See Arun GUPTA's article WebSocket and Java EE 7 - Getting Ready for JSR 356 (TOTD #181) and QCon presentation (from 00:37:36 to 00:46:53) for more information on progress. You can also look at Java websocket SDK.

Some other Java implementations:

• Kaazing Gateway
• jWebscoket
• Netty
• xLightWeb
• Webbit
• Atmosphere
• Grizzly
• Apache ActiveMQ V 5.6 supports RFC6455
• Apache Camel V 2.10 supports RFC6455
• JBoss HornetQ

In C#:

• XSockets.NET
• SuperWebSocket
• Nugget
• Alchemy-Websockets
• Fleck
• SignalR

In PHP:

• Ratchet
• phpwebsocket.
• Extendible Web Socket Server
• phpdaemon

In Python:

• pywebsockets
• websockify
• gevent-websocket, gevent-socketio and flask-sockets based on the former
• Autobahn
• Tornado

In C:

• libwebsockets

In Node.js:

• Socket.io : Socket.io also has serverside ports for Python, Java, Google GO, Rack
• sockjs : sockjs also has serverside ports for Python, Java, Erlang and Lua
• WebSocket-Node - Pure JavaScript Client & Server implementation of HyBi-10.

Vert.x (also known as Node.x) : A node like polyglot implementation running on a Java 7 JVM and based on Netty with :

• Support for Ruby(JRuby), Java, Groovy, Javascript(Rhino/Nashorn), Scala, ...
• True threading. (unlike Node.js)
• Understands multiple network protocols out of the box including: TCP, SSL, UDP, HTTP, HTTPS, Websockets, SockJS as fallback for WebSockets

Pusher.com is a Websocket cloud service accessible through a REST API.

DotCloud cloud platform supports Websockets, and Java (Jetty Servlet Container), NodeJS, Python, Ruby, PHP and Perl programming languages.

Openshift cloud platform supports websockets, and Java (Jboss, Spring, Tomcat & Vertx), PHP (ZendServer & CodeIgniter), Ruby (ROR), Node.js, Python (Django & Flask) plateforms.

For other language implementations, see the Wikipedia article for more information.

The RFC for Websockets : RFC6455

WARNING: You should understand the security risks of this method before you consider it. John's summary of the risk:

By giving the container access to /var/run/docker.sock, it is [trivially easy] to break out of the containment provided by docker and gain access to the host machine. Obviously this is potentially dangerous.

Inside the container, the dockerId is your hostname. So, you could:

• install the docker-io package in your container with the same version as the host
• start it with --volume /var/run/docker.sock:/var/run/docker.sock --privileged
• finally, run: docker inspect $(hostname) inside the container

Avoid this. Only do it if you understand the risks and have a clear mitigation for the risks.

I solved this by clicking on File -> Project Structure then changed the JDK Location to Use Embedded JDK (Recommended)

if you are not a "programmer by training", this should help:

I think I have understood the technical explanations above and elsewhere on the net, but I was always left with a question "Nice, but why do I need it? What is a practical, use case?". and now life gave me a good example that clarified all:

I am using it to control the global-shared variable that is shared among instances of a class instantiated by multi-threading module. in humane language, I am running multiple agents that create examples for deep learning IN PARALLEL. (imagine multiple players playing ATARI game at the same time and each saving the results of their game to one common repository (the SHARED VARIABLE))

I instantiate the players/agents with the following code (in Main/Execution Code):

a3c_workers = [A3C_Worker(self.master_model, self.optimizer, i, self.env_name, self.model_dir) for i in range(multiprocessing.cpu_count())]

• it creates as many players as there are processor cores on my comp A3C_Worker - is a class that defines the agent a3c_workers - is a list of the instances of that class (i.e. each instance is one player/agent)

now i want to know how many games have been played across all players/agents thus within the A3C_Worker definition I define the variable to be shared across all instances:

class A3C_Worker(threading.Thread):
   global_shared_total_episodes_across_all_workers = 0

now as the workers finish their games they increase that count by 1 each for each game finished

at the end of my example generation i was closing the instances but the shared variable had assigned the total number of games played. so when I was re-running it again my initial total number of episodes was that of the previous total. but i needed that count to represent that value for each run individually

to fix that i specified :

class A3C_Worker(threading.Thread):
    @classmethod
    def reset(cls):
        A3C_Worker.global_shared_total_episodes_across_all_workers = 0

than in the execution code i just call:

A3C_Worker.reset()

note that it is a call to the CLASS overall not any INSTANCE of it individually. thus it will set my counter to 0 for every new agent I initiate from now on.

using the usual method definition def play(self):, would require us to reset that counter for each instance individually, which would be more computationally demanding and difficult to track.

Actually, this is just the validation issue, EF will validate the entity properties first before making any changes to the database. So, EF will check whether the property's value is out of range, like when you designed the table. Table_Column_UserName is varchar(20). But, in EF, you entered a value that longer than 20. Or, in other cases, if the column does not allow to be a Null. So, in the validation process, you have to set a value to the not null column, no matter whether you are going to make the change on it. I personally, like the Leniel Macaferi answer. It can show you the detail of the validation issues

It means that servlet jar is missing .

check the libraries for your project. Configure your buildpath download **

servlet-api.jar

** and import it in your project.

Your format specifier is incorrect. From the printf() man page on my machine:

0 A zero '0' character indicating that zero-padding should be used rather than blank-padding. A '-' overrides a '0' if both are used;

Field Width: An optional digit string specifying a field width; if the output string has fewer characters than the field width it will be blank-padded on the left (or right, if the left-adjustment indicator has been given) to make up the field width (note that a leading zero is a flag, but an embedded zero is part of a field width);

Precision: An optional period, '.', followed by an optional digit string giving a precision which specifies the number of digits to appear after the decimal point, for e and f formats, or the maximum number of characters to be printed from a string; if the digit string is missing, the precision is treated as zero;

For your case, your format would be %09.3f:

#include <stdio.h>

int main(int argc, char **argv)
{
  printf("%09.3f\n", 4917.24);
  return 0;
}

Output:

$ make testapp
cc     testapp.c   -o testapp
$ ./testapp 
04917.240

Note that this answer is conditional on your embedded system having a printf() implementation that is standard-compliant for these details - many embedded environments do not have such an implementation.

Let us say we have to sort a list of objects in ascending order based on a particular property, in this example lets say we have to sort based on the "name" property, then below is the required code :

var list_Objects = [{"name"="Bob"},{"name"="Jay"},{"name"="Abhi"}];
Console.log(list_Objects);   //[{"name"="Bob"},{"name"="Jay"},{"name"="Abhi"}]
    list_Objects.sort(function(a,b){
        return a["name"].localeCompare(b["name"]); 
    });
Console.log(list_Objects);  //[{"name"="Abhi"},{"name"="Bob"},{"name"="Jay"}]

Try writting the lambda with the same conditions as the delegate. like this:

  List<AnalysisObject> analysisObjects = 
    analysisObjectRepository.FindAll().Where(
    (x => 
       (x.ID == packageId)
    || (x.Parent != null && x.Parent.ID == packageId)
    || (x.Parent != null && x.Parent.Parent != null && x.Parent.Parent.ID == packageId)
    ).ToList();

You can try configure SQL server:

1. Step 1: Open SQL server 20xx Configuration Manager
2. Step 2: Click Protocols for SQL.. in SQL server configuration. Then, right click TCP/IP, choose Properties
3. Step 3: Click tab IP Address, Edit All TCP. Port is 1433

NOTE: ALL TCP port is 1433 Finally, restart the server.

could you please try below code

<c:forEach var="hash" items="${map['key']}">
        <option><c:out value="${hash}"/></option>
  </c:forEach>

This might not be the simplest answer as compared to using array_values().

Try this

$array = array( 0 => 'string1', 2 => 'string2', 4 => 'string3', 5 => 'string4');
$arrays =$array;
print_r($array);
$array=array();
$i=0;
    foreach($arrays as $k => $item)
    {
    $array[$i]=$item;
        unset($arrays[$k]);
        $i++;

    }

print_r($array);

Demo

A couple months ago I put together my own routine that times a function using Date.now() -- even though at the time the accepted method seemed to be performance.now() -- because the performance object is not yet available (built-in) in the stable Node.js release.

Today I was doing some more research and found another method for timing. Since I also found how to use this in Node.js code, I thought I would share it here.

The following is combined from the examples given by w3c and Node.js:

function functionTimer() {
    performance.mark('start')
    functionToBeTimed()
    performance.mark('end')
    performance.measure('Start to End', 'start', 'end')
    const measure = performance.getEntriesByName('Start to End')[0]
    console.log(measure.duration)
}

NOTE:

If you intend to use the performance object in a Node.js app, you must include the following require: const { performance } = require('perf_hooks')

Just do something like this,<input type="radio" ng-disabled="loading" name="dateRange" ng-model="filter.DateRange" value="1" ng-checked="(filter.DateRange == 1)"/>

You have a lot of unnecessary keyframes. Don't think of keyframes as individual frames, think of them as "steps" in your animation and the computer fills in the frames between the keyframes.

Here is a solution that cleans up a lot of code and makes the animation start from the center:

.gps_ring {
    border: 3px solid #999;
    -webkit-border-radius: 30px;
    height: 18px;
    width: 18px;
    position: absolute;
    left:20px;
    top:214px;
    -webkit-animation: pulsate 1s ease-out;
    -webkit-animation-iteration-count: infinite; 
    opacity: 0.0
}
@-webkit-keyframes pulsate {
    0% {-webkit-transform: scale(0.1, 0.1); opacity: 0.0;}
    50% {opacity: 1.0;}
    100% {-webkit-transform: scale(1.2, 1.2); opacity: 0.0;}
}

You can see it in action here: http://jsfiddle.net/Fy8vD/

change your code to:

function ChangePurpose(Vid, PurId) {
    var Success = false;
    $.ajax({
        type: "POST",
        url: "CHService.asmx/SavePurpose",
        dataType: "text",
        async: false,
        data: JSON.stringify({ Vid: Vid, PurpId: PurId }),
        contentType: "application/json; charset=utf-8",
        success: function (data) {
            Success = true;
        },
        error: function (textStatus, errorThrown) {
            Success = false;
        }
    });
    //done after here
    return Success;
} 

You can only return the values from a synchronous function. Otherwise you will have to make a callback.

So I just added async:false, to your ajax call

Update:

jquery ajax calls are asynchronous by default. So success & error functions will be called when the ajax load is complete. But your return statement will be executed just after the ajax call is started.

A better approach will be:

     // callbackfn is the pointer to any function that needs to be called
     function ChangePurpose(Vid, PurId, callbackfn) {
        var Success = false;
        $.ajax({
            type: "POST",
            url: "CHService.asmx/SavePurpose",
            dataType: "text",
            data: JSON.stringify({ Vid: Vid, PurpId: PurId }),
            contentType: "application/json; charset=utf-8",
            success: function (data) {
                callbackfn(data)
            },
            error: function (textStatus, errorThrown) {
                callbackfn("Error getting the data")
            }
        });
     } 

     function Callback(data)
     {
        alert(data);
     }

and call the ajax as:

 // Callback is the callback-function that needs to be called when asynchronous call is complete
 ChangePurpose(Vid, PurId, Callback);

There are many way to do the string aggregation, but the easiest is a user defined function. Try this for a way that does not require a function. As a note, there is no simple way without the function.

This is the shortest route without a custom function: (it uses the ROW_NUMBER() and SYS_CONNECT_BY_PATH functions )

SELECT questionid,
       LTRIM(MAX(SYS_CONNECT_BY_PATH(elementid,','))
       KEEP (DENSE_RANK LAST ORDER BY curr),',') AS elements
FROM   (SELECT questionid,
               elementid,
               ROW_NUMBER() OVER (PARTITION BY questionid ORDER BY elementid) AS curr,
               ROW_NUMBER() OVER (PARTITION BY questionid ORDER BY elementid) -1 AS prev
        FROM   emp)
GROUP BY questionid
CONNECT BY prev = PRIOR curr AND questionid = PRIOR questionid
START WITH curr = 1;

A)

String str = "a string";
int length = str.length( ); // length == 8

http://download.oracle.com/javase/7/docs/api/java/lang/String.html#length%28%29

edit

If you want to count the number of a specific type of characters in a String, then a simple method is to iterate through the String checking each index against your test case.

int charCount = 0;
char temp;

for( int i = 0; i < str.length( ); i++ )
{
    temp = str.charAt( i );

    if( temp.TestCase )
        charCount++;
}

where TestCase can be isLetter( ), isDigit( ), etc.

Or if you just want to count everything but spaces, then do a check in the if like temp != ' '

B)

String str = "a string";
char atPos0 = str.charAt( 0 ); // atPos0 == 'a'

http://download.oracle.com/javase/7/docs/api/java/lang/String.html#charAt%28int%29

If you don't want to include the full path, you can do

add_executable(main main.cpp)
target_link_libraries(main bingitup)

bingitup is the same name you'd give a target if you create the static library in a CMake project:

add_library(bingitup STATIC bingitup.cpp)

CMake automatically adds the lib to the front and the .a at the end on Linux, and .lib at the end on Windows.

If the library is external, you might want to add the path to the library using

link_directories(/path/to/libraries/)

Since Android 11 (API level 30), most user-installed apps are not visible by default. In your manifest, you must statically declare which apps you are going to get info about, as in the following:

<manifest>
    <queries>
        <!-- Explicit apps you know in advance about: -->
        <package android:name="com.example.this.app"/>
        <package android:name="com.example.this.other.app"/>
    </queries>
    
    ...
</manifest>

Then, @RobinKanters' answer works:

private boolean isPackageInstalled(String packageName, PackageManager packageManager) {
    try {
        packageManager.getPackageInfo(packageName, 0);
        return true;
    } catch (PackageManager.NameNotFoundException e) {
        return false;
    }
}

// ...
// This will return true on Android 11 if the app is installed,
// since we declared it above in the manifest.
isPackageInstalled("com.example.this.app", pm); 
// This will return false on Android 11 even if the app is installed:
isPackageInstalled("another.random.app", pm); 

Learn more here:

• The migration documentation
• The dedicated documentation page (has more information)
• The official blog post

The css is

text-decoration: none;

and

text-decoration: underline;

The user interaction flag can then be set to true in the onTouch method and reset in onItemSelected() once the selection change has been handled. I prefer this solution because the user interaction flag is handled exclusively for the spinner, and not for other views in the activity that may affect the desired behavior.

In code:

Create your listener for the spinner:

public class SpinnerInteractionListener implements AdapterView.OnItemSelectedListener, View.OnTouchListener {

    boolean userSelect = false;

    @Override
    public boolean onTouch(View v, MotionEvent event) {
        userSelect = true;
        return false;
    }

    @Override
    public void onItemSelected(AdapterView<?> parent, View view, int pos, long id) {
        if (userSelect) { 
            userSelect = false;
            // Your selection handling code here
        }
    }

}

Add the listener to the spinner as both an OnItemSelectedListener and an OnTouchListener:

SpinnerInteractionListener listener = new SpinnerInteractionListener();
mSpinnerView.setOnTouchListener(listener);
mSpinnerView.setOnItemSelectedListener(listener);

This is how i fixed my problem

right clik on the project > properties > Java Compiler (select the one you are using)

it was 1.5 for me but i have 1.8 installed. so i changed it to 1.8.. and voilla it worked!.

case when field1>0 then field2/field1 else 0 end as field3

I would rather put my answer in How to flush output of print function? or in Python's print function that flushes the buffer when it's called?, but since they were marked as duplicates of this one (what I do not agree), I'll answer it here.

Since Python 3.3, print() supports the keyword argument "flush" (see documentation):

print('Hello World!', flush=True)

You can generate a key by the following command:

php artisan key:generate 

The key will be written automatically in your .env file.

APP_KEY=YOUR_GENERATED_KEY

If you want to see your key after generation use --show option

php artisan key:generate --show

Note: The .env is a hidden file in your project folder.

If you're looking for a minimal solution that invalidates the cache, this edited version of Dr Manhattan's solution should be sufficient. Note that I'm specifying the root / directory to indicate I want the whole site refreshed.

export AWS_ACCESS_KEY_ID=<Key>
export AWS_SECRET_ACCESS_KEY=<Secret>
export AWS_DEFAULT_REGION=eu-west-1

echo "Invalidating cloudfrond distribution to get fresh cache"
aws cloudfront create-invalidation --distribution-id=<distributionId> --paths / --profile=<awsprofile>

Region Codes can be found here

You'll also need to create a profile using the aws cli. Use the aws configure --profile option. Below is an example snippet from Amazon.

$ aws configure --profile user2
AWS Access Key ID [None]: AKIAI44QH8DHBEXAMPLE
AWS Secret Access Key [None]: je7MtGbClwBF/2Zp9Utk/h3yCo8nvbEXAMPLEKEY
Default region name [None]: us-east-1
Default output format [None]: text

When you work with unsigned types, modular arithmetic (also known as "wrap around" behavior) is taking place. To understand this modular arithmetic, just have a look at these clocks:

9 + 4 = 1 (13 mod 12), so to the other direction it is: 1 - 4 = 9 (-3 mod 12). The same principle is applied while working with unsigned types. If the result type is unsigned, then modular arithmetic takes place.

Now look at the following operations storing the result as an unsigned int:

unsigned int five = 5, seven = 7;
unsigned int a = five - seven;      // a = (-2 % 2^32) = 4294967294 

int one = 1, six = 6;
unsigned int b = one - six;         // b = (-5 % 2^32) = 4294967291

When you want to make sure that the result is signed, then stored it into signed variable or cast it to signed. When you want to get the difference between numbers and make sure that the modular arithmetic will not be applied, then you should consider using abs() function defined in stdlib.h:

int c = five - seven;       // c = -2
int d = abs(five - seven);  // d =  2

Be very careful, especially while writing conditions, because:

if (abs(five - seven) < seven)  // = if (2 < 7)
    // ...

if (five - seven < -1)          // = if (-2 < -1)
    // ...

if (one - six < 1)              // = if (-5 < 1)
    // ...

if ((int)(five - seven) < 1)    // = if (-2 < 1)
    // ...

but

if (five - seven < 1)   // = if ((unsigned int)-2 < 1) = if (4294967294 < 1)
    // ...

if (one - six < five)   // = if ((unsigned int)-5 < 5) = if (4294967291 < 5)
    // ...

On my side, this error came from the data type "INT' in the Null values column. The error is resolved by just changing the data a type to varchar.

It looks like regex /\r\n|\r|\n/ handles CR, LF, and CRLF line endings, their mixed sequences, and keeps all the empty lines inbetween. Try that!

    function splitLines(t) { return t.split(/\r\n|\r|\n/); }

    // single newlines
    console.log(splitLines("AAA\rBBB\nCCC\r\nDDD"));
    // double newlines
    console.log(splitLines("EEE\r\rFFF\n\nGGG\r\n\r\nHHH"));
    // mixed sequences
    console.log(splitLines("III\n\r\nJJJ\r\r\nKKK\r\n\nLLL\r\n\rMMM"));

You should get these arrays as a result:

[ "AAA", "BBB", "CCC", "DDD" ]
[ "EEE", "", "FFF", "", "GGG", "", "HHH" ]
[ "III", "", "JJJ", "", "KKK", "", "LLL", "", "MMM" ]

You can also teach that regex to recognize other legit Unicode line terminators by adding |\xHH or |\uHHHH parts, where H's are hexadecimal digits of the additional terminator character codepoint (as seen in Wikipedia article as U+HHHH).

If you want to add SSL in your test environment, then you can use mkcert. Below I mentioned the GitHub URL.
https://github.com/FiloSottile/mkcert
And also below I mentioned sample nginx configuration for reverse proxy.

server {
        listen 80;
        server_name test.local;
        return 301 https://test.local$request_uri;
}
server {
  listen 443 ssl;
  server_name test.local;
  ssl_certificate /etc/nginx/ssl/test.local.pem;
  ssl_certificate_key /etc/nginx/ssl/test.local-key.pem;

   location / {
      proxy_set_header X-Real-IP $remote_addr;
      proxy_set_header X-Forwarded-For $remote_addr;
      proxy_set_header X-Client-Verify SUCCESS;
      proxy_set_header Host $http_host;
      proxy_set_header X-NginX-Proxy true;
      proxy_http_version 1.1;
      proxy_set_header Upgrade $http_upgrade;
      proxy_set_header Connection "upgrade";
      proxy_pass http://localhost:3000;
      proxy_redirect off;
      proxy_buffering off;
    }
}

This is my solution, wish useful for you:

public class Sheet : Grid
{
    public static readonly DependencyProperty BorderBrushProperty = DependencyProperty.Register(nameof(BorderBrush), typeof(Brush), typeof(Sheet), new FrameworkPropertyMetadata(Brushes.Transparent, FrameworkPropertyMetadataOptions.AffectsMeasure | FrameworkPropertyMetadataOptions.AffectsRender, OnBorderBrushChanged));

    public static readonly DependencyProperty BorderThicknessProperty = DependencyProperty.Register(nameof(BorderThickness), typeof(double), typeof(Sheet), new FrameworkPropertyMetadata(1D, FrameworkPropertyMetadataOptions.AffectsMeasure | FrameworkPropertyMetadataOptions.AffectsRender, OnBorderThicknessChanged, CoerceBorderThickness));
    public static readonly DependencyProperty CellSpacingProperty = DependencyProperty.Register(nameof(CellSpacing), typeof(double), typeof(Sheet), new FrameworkPropertyMetadata(0D, FrameworkPropertyMetadataOptions.AffectsMeasure | FrameworkPropertyMetadataOptions.AffectsRender, OnCellSpacingChanged, CoerceCellSpacing));

    public Brush BorderBrush
    {
        get => this.GetValue(BorderBrushProperty) as Brush;
        set => this.SetValue(BorderBrushProperty, value);
    }

    public double BorderThickness
    {
        get => (double)this.GetValue(BorderThicknessProperty);
        set => this.SetValue(BorderThicknessProperty, value);
    }

    public double CellSpacing
    {
        get => (double)this.GetValue(CellSpacingProperty);
        set => this.SetValue(CellSpacingProperty, value);
    }

    protected override Size ArrangeOverride(Size arrangeSize)
    {
        Size size = base.ArrangeOverride(arrangeSize);
        double border = this.BorderThickness;
        double doubleBorder = border * 2D;
        double spacing = this.CellSpacing;
        double halfSpacing = spacing * 0.5D;
        if (border > 0D || spacing > 0D)
        {
            foreach (UIElement child in this.InternalChildren)
            {
                this.GetChildBounds(child, out double left, out double top, out double width, out double height);

                left += halfSpacing + border;
                top += halfSpacing + border;
                height -= spacing + doubleBorder;
                width -= spacing + doubleBorder;

                if (width < 0D)
                {
                    width = 0D;
                }

                if (height < 0D)
                {
                    height = 0D;
                }

                left -= left % 0.5D;
                top -= top % 0.5D;
                width -= width % 0.5D;
                height -= height % 0.5D;

                child.Arrange(new Rect(left, top, width, height));
            }

            if (border > 0D && this.BorderBrush != null)
            {
                this.InvalidateVisual();
            }
        }

        return size;
    }
    
    protected override void OnRender(DrawingContext dc)
    {
        base.OnRender(dc);

        if (this.BorderThickness > 0D && this.BorderBrush != null)
        {
            if (this.CellSpacing == 0D)
            {
                this.DrawCollapsedBorder(dc);
            }
            else
            {
                this.DrawSeperatedBorder(dc);
            }
        }
    }

    private void DrawSeperatedBorder(DrawingContext dc)
    {
        double spacing = this.CellSpacing;
        double halfSpacing = spacing * 0.5D;


        #region draw border
        Pen pen = new Pen(this.BorderBrush, this.BorderThickness);
        UIElementCollection children = this.InternalChildren;
        foreach (UIElement child in children)
        {
            this.GetChildBounds(child, out double left, out double top, out double width, out double height);
            left += halfSpacing;
            top += halfSpacing;
            width -= spacing;
            height -= spacing;

            dc.DrawRectangle(null, pen, new Rect(left, top, width, height));
        }
        #endregion
    }

    private void DrawCollapsedBorder(DrawingContext dc)
    {
        RowDefinitionCollection rows = this.RowDefinitions;
        ColumnDefinitionCollection columns = this.ColumnDefinitions;
        int rowCount = rows.Count;
        int columnCount = columns.Count;
        const byte BORDER_LEFT = 0x08;
        const byte BORDER_TOP = 0x04;
        const byte BORDER_RIGHT = 0x02;
        const byte BORDER_BOTTOM = 0x01;
        byte[,] borderState = new byte[rowCount, columnCount];
        int column = columnCount - 1;
        int columnSpan;
        int row = rowCount - 1;
        int rowSpan;
        #region generate main border data
        for (int i = 0; i < rowCount; i++)
        {
            borderState[i, 0] = BORDER_LEFT;
            borderState[i, column] = BORDER_RIGHT;
        }

        for (int i = 0; i < columnCount; i++)
        {
            borderState[0, i] |= BORDER_TOP;
            borderState[row, i] |= BORDER_BOTTOM;
        }
        #endregion

        #region generate child border data
        UIElementCollection children = this.InternalChildren;
        foreach (UIElement child in children)
        {
            this.GetChildLayout(child, out row, out rowSpan, out column, out columnSpan);
            for (int i = 0; i < rowSpan; i++)
            {
                borderState[row + i, column] |= BORDER_LEFT;
                borderState[row + i, column + columnSpan - 1] |= BORDER_RIGHT;
            }
            for (int i = 0; i < columnSpan; i++)
            {
                borderState[row, column + i] |= BORDER_TOP;
                borderState[row + rowSpan - 1, column + i] |= BORDER_BOTTOM;
            }
        }
        #endregion

        #region draw border
        Pen pen = new Pen(this.BorderBrush, this.BorderThickness);
        double left;
        double top;
        double width, height;


        for (int r = 0; r < rowCount; r++)
        {
            RowDefinition v = rows[r];
            top = v.Offset;
            height = v.ActualHeight;
            for (int c = 0; c < columnCount; c++)
            {
                byte state = borderState[r, c];

                ColumnDefinition h = columns[c];
                left = h.Offset;
                width = h.ActualWidth;
                if ((state & BORDER_LEFT) == BORDER_LEFT)
                {
                    dc.DrawLine(pen, new Point(left, top), new Point(left, top + height));
                }
                if ((state & BORDER_TOP) == BORDER_TOP)
                {
                    dc.DrawLine(pen, new Point(left, top), new Point(left + width, top));
                }
                if ((state & BORDER_RIGHT) == BORDER_RIGHT && (c + 1 >= columnCount || (borderState[r, c + 1] & BORDER_LEFT) == 0))
                {
                    dc.DrawLine(pen, new Point(left + width, top), new Point(left + width, top + height));
                }
                if ((state & BORDER_BOTTOM) == BORDER_BOTTOM && (r + 1 >= rowCount || (borderState[r + 1, c] & BORDER_TOP) == 0))
                {
                    dc.DrawLine(pen, new Point(left, top + height), new Point(left + width, top + height));
                }
            }

        }
        #endregion
    }

    private void GetChildBounds(UIElement child, out double left, out double top, out double width, out double height)
    {
        ColumnDefinitionCollection columns = this.ColumnDefinitions;
        RowDefinitionCollection rows = this.RowDefinitions;
        int rowCount = rows.Count;

        int row = (int)child.GetValue(Grid.RowProperty);
        if (row >= rowCount)
        {
            row = rowCount - 1;
        }

        int rowSpan = (int)child.GetValue(Grid.RowSpanProperty);
        if (row + rowSpan > rowCount)
        {
            rowSpan = rowCount - row;
        }
        int columnCount = columns.Count;

        int column = (int)child.GetValue(Grid.ColumnProperty);
        if (column >= columnCount)
        {
            column = columnCount - 1;
        }

        int columnSpan = (int)child.GetValue(Grid.ColumnSpanProperty);
        if (column + columnSpan > columnCount)
        {
            columnSpan = columnCount - column;
        }

        left = columns[column].Offset;
        top = rows[row].Offset;
        ColumnDefinition right = columns[column + columnSpan - 1];
        width = right.Offset + right.ActualWidth - left;
        RowDefinition bottom = rows[row + rowSpan - 1];
        height = bottom.Offset + bottom.ActualHeight - top;
        if (width < 0D)
        {
            width = 0D;
        }

        if (height < 0D)
        {
            height = 0D;
        }

    }
    private void GetChildLayout(UIElement child, out int row, out int rowSpan, out int column, out int columnSpan)
    {
        int rowCount = this.RowDefinitions.Count;

        row = (int)child.GetValue(Grid.RowProperty);
        if (row >= rowCount)
        {
            row = rowCount - 1;
        }

        rowSpan = (int)child.GetValue(Grid.RowSpanProperty);
        if (row + rowSpan > rowCount)
        {
            rowSpan = rowCount - row;
        }
        int columnCount = this.ColumnDefinitions.Count;

        column = (int)child.GetValue(Grid.ColumnProperty);
        if (column >= columnCount)
        {
            column = columnCount - 1;
        }

        columnSpan = (int)child.GetValue(Grid.ColumnSpanProperty);
        if (column + columnSpan > columnCount)
        {
            columnSpan = columnCount - column;
        }
    }

    private static void OnBorderBrushChanged(DependencyObject d, DependencyPropertyChangedEventArgs args)
    {
        if (d is UIElement element)
        {
            element.InvalidateVisual();
        }
    }

    private static void OnBorderThicknessChanged(DependencyObject d, DependencyPropertyChangedEventArgs args)
    {
        if (d is UIElement element)
        {
            element.InvalidateArrange();
        }
    }

    private static void OnCellSpacingChanged(DependencyObject d, DependencyPropertyChangedEventArgs args)
    {
        if (d is UIElement element)
        {
            element.InvalidateArrange();
        }
    }

    private static object CoerceBorderThickness(DependencyObject d, object baseValue)
    {
        if (baseValue is double value)
        {
            return value < 0D || double.IsNaN(value) || double.IsInfinity(value) ? 0D : value;
        }

        return 0D;
    }
    private static object CoerceCellSpacing(DependencyObject d, object baseValue)
    {
        if (baseValue is double value)
        {
            return value < 0D || double.IsNaN(value) || double.IsInfinity(value) ? 0D : value;
        }

        return 0D;
    }
}

a demo:

There is a limit on the number of half-open connections, but afaik not for active connections. Although it appears to depend on the type of Windows 2008 server, at least according to this MSFT employee:

It depends on the edition, Web and Foundation editions have connection limits while Standard, Enterprise, and Datacenter do not.

This is the most native and scalable approach I could find:

>>> myindex = pd.Series(myseries.index, index=myseries)

>>> myindex[7]
3

>>> myindex[[7, 5, 7]]
7    3
5    4
7    3
dtype: int64

For this to work, your font also needs to be set to monospace.
If you think about it, lines can't otherwise line up perfectly perfectly.

This answer is detailed at sublime text forum:
http://www.sublimetext.com/forum/viewtopic.php?f=3&p=42052
This answer has links for choosing an appropriate font for your OS,
and gives an answer to an edge case of fonts not lining up.

Another website that lists great monospaced free fonts for programmers. http://hivelogic.com/articles/top-10-programming-fonts

On stackoverflow, see:

Michael Ruth's answer here: How to make ruler always be shown in Sublime text 2?

MattDMo's answer here: What is the default font of Sublime Text?

I have rulers set at the following:
30
50 (git commit message titles should be limited to 50 characters)
72 (git commit message details should be limited to 72 characters)
80 (Windows Command Console Window maxes out at 80 character width)

Other viewing environments that benefit from shorter lines: github: there is no word wrap when viewing a file online
So, I try to keep .js .md and other files at 70-80 characters.
Windows Console: 80 characters.

You can use following methods to handle drop down in selenium.

1. driver.selectByVisibleText("Text");
2. driver.selectByIndex(1);
3. driver.selectByValue("prog");

For more details you can refer http://www.codealumni.com/handle-drop-selenium-webdriver/ this post.

It will definately help you a lot in resolving your queries.

as per the Chart js documentation page tick configuration section. you can format the value of each tick using the callback function. for example I wanted to change locale of displayed dates to be always German. in the ticks parts of the axis options

ticks: {
    callback: function(value) { 
        return new Date(value).toLocaleDateString('de-DE', {month:'short', year:'numeric'}); 
    },
},

import yaml

data = dict(
    A = 'a',
    B = dict(
        C = 'c',
        D = 'd',
        E = 'e',
    )
)

with open('data.yml', 'w') as outfile:
    yaml.dump(data, outfile, default_flow_style=False)

The default_flow_style=False parameter is necessary to produce the format you want (flow style), otherwise for nested collections it produces block style:

A: a
B: {C: c, D: d, E: e}

I wanted a long dash like line, so I used this.

.dash{_x000D_
        border: 1px solid red;_x000D_
        width: 120px;_x000D_
        height: 0px;_x000D_
_x000D_
}

<div class="dash"></div>

The first thing you should do is learn to read error messages. What does it tell you -- that you can't use two strings with the divide operator.

So, ask yourself why they are strings and how do you make them not-strings. They are strings because all input is done via strings. And the way to make then not-strings is to convert them.

One way to convert a string to an integer is to use the int function. For example:

percent = (int(pyc) / int(tpy)) * 100

One advantage is that you are compiling access into the application, so it cannot accidentally be changed by someone modifying the Web.config.

This may not be an advantage to you, and might be a disadvantage. But for some kinds of access, it may be preferrable.

Plus, I find that authorization information in the Web.config pollutes it, and makes it harder to find things. So in some ways its preference, in others there is no other way to do it.

You down with OOP?

#!/usr/bin/env python


import smtplib

class Gmail(object):
    def __init__(self, email, password):
        self.email = email
        self.password = password
        self.server = 'smtp.gmail.com'
        self.port = 587
        session = smtplib.SMTP(self.server, self.port)        
        session.ehlo()
        session.starttls()
        session.ehlo
        session.login(self.email, self.password)
        self.session = session

    def send_message(self, subject, body):
        ''' This must be removed '''
        headers = [
            "From: " + self.email,
            "Subject: " + subject,
            "To: " + self.email,
            "MIME-Version: 1.0",
           "Content-Type: text/html"]
        headers = "\r\n".join(headers)
        self.session.sendmail(
            self.email,
            self.email,
            headers + "\r\n\r\n" + body)


gm = Gmail('Your Email', 'Password')

gm.send_message('Subject', 'Message')

You can use:

$str = trim(str_replace("  ", " ", $str));

This removes extra whitespaces from both sides of string and converts two spaces to one within the string. Note that this won't convert three or more spaces in a row to one! Another way I can suggest is using implode and explode that is safer but totally not optimum!

$str = implode(" ", array_filter(explode(" ", $str)));

My suggestion is using a native for loop or using regex to do this kind of job.

I ended up doing the following and it works:

return DatabaseContext.Applications
     .Include("Children.ChildRelationshipType");

According to the official docu it's recommended to downgrade the whole Python environment:

conda install python=3.5