I too had the same problem.
I was running node v 6.2 alongside using purgecss within my gulpfile. Problem only occurred when I created a new Laravel project; up until that point, I never had an issue with purgecss.
Following @Quentin's statement - how node versions prior to 7.6 do not support async functions - I decided to update my node version to 9.11.2
This worked for me:
1-
$ npm install -g n
$ n 9.11.2
2-
delete 'node_modules' from the route directory
3-
$ npm install
Still not sure how node/purgecss worked prior to updating.. but this did the trick.
Based on a link to Apache HTTP Components on this SO thread, I came across the Fluent facade API for HTTP Components. An example there shows how to set up a queue of asynchronous HTTP requests (and get notified of their completion/failure/cancellation). In my case, I didn't need a queue, just one async request at a time.
Here's where I ended up (also using URIBuilder from HTTP Components, example here).
import java.net.URI;
import java.net.URISyntaxException;
import java.util.concurrent.ExecutorService;
import java.util.concurrent.Executors;
import java.util.concurrent.Future;
import org.apache.http.client.fluent.Async;
import org.apache.http.client.fluent.Content;
import org.apache.http.client.fluent.Request;
import org.apache.http.client.utils.URIBuilder;
import org.apache.http.concurrent.FutureCallback;
//...
URIBuilder builder = new URIBuilder();
builder.setScheme("http").setHost("myhost.com").setPath("/folder")
.setParameter("query0", "val0")
.setParameter("query1", "val1")
...;
URI requestURL = null;
try {
requestURL = builder.build();
} catch (URISyntaxException use) {}
ExecutorService threadpool = Executors.newFixedThreadPool(2);
Async async = Async.newInstance().use(threadpool);
final Request request = Request.Get(requestURL);
Future<Content> future = async.execute(request, new FutureCallback<Content>() {
public void failed (final Exception e) {
System.out.println(e.getMessage() +": "+ request);
}
public void completed (final Content content) {
System.out.println("Request completed: "+ request);
System.out.println("Response:\n"+ content.asString());
}
public void cancelled () {}
});
function getURL(url){
return $.ajax({
type: "GET",
url: url,
cache: false,
async: false
}).responseText;
}
//example use
var msg=getURL("message.php");
alert(msg);
You don't really need to do anything manually, await
keyword pauses the function execution until blah()
returns.
private async void SomeFunction()
{
var x = await LoadBlahBlah(); <- Function is not paused
//rest of the code get's executed even if LoadBlahBlah() is still executing
}
private async Task<T> LoadBlahBlah()
{
await DoStuff(); <- function is paused
await DoMoreStuff();
}
T
is type of object blah()
returns
You can't really await
a void
function so LoadBlahBlah()
cannot be void
One issue with your ContentLoader is that internally it operates sequentially. A better pattern is to parallelize the work and then sychronize at the end, so we get
public class PageViewModel : IHandle<SomeMessage>
{
...
public async void Handle(SomeMessage message)
{
ShowLoadingAnimation();
// makes UI very laggy, but still not dead
await this.contentLoader.LoadContentAsync();
HideLoadingAnimation();
}
}
public class ContentLoader
{
public async Task LoadContentAsync()
{
var tasks = new List<Task>();
tasks.Add(DoCpuBoundWorkAsync());
tasks.Add(DoIoBoundWorkAsync());
tasks.Add(DoCpuBoundWorkAsync());
tasks.Add(DoSomeOtherWorkAsync());
await Task.WhenAll(tasks).ConfigureAwait(false);
}
}
Obviously, this doesn't work if any of the tasks require data from other earlier tasks, but should give you better overall throughput for most scenarios.
This is a short asynchronous function to use without requiring third party libs
Array.prototype.each = function (iterator, callback) {
var iterate = function () {
pointer++;
if (pointer >= this.length) {
callback();
return;
}
iterator.call(iterator, this[pointer], iterate, pointer);
}.bind(this),
pointer = -1;
iterate(this);
};
1) Normally, you would want to return a Task
. The main exception should be when you need to have a void
return type (for events). If there's no reason to disallow having the caller await
your task, why disallow it?
2) async
methods that return void
are special in another aspect: they represent top-level async operations, and have additional rules that come into play when your task returns an exception. The easiest way is to show the difference is with an example:
static async void f()
{
await h();
}
static async Task g()
{
await h();
}
static async Task h()
{
throw new NotImplementedException();
}
private void button1_Click(object sender, EventArgs e)
{
f();
}
private void button2_Click(object sender, EventArgs e)
{
g();
}
private void button3_Click(object sender, EventArgs e)
{
GC.Collect();
}
f
's exception is always "observed". An exception that leaves a top-level asynchronous method is simply treated like any other unhandled exception. g
's exception is never observed. When the garbage collector comes to clean up the task, it sees that the task resulted in an exception, and nobody handled the exception. When that happens, the TaskScheduler.UnobservedTaskException
handler runs. You should never let this happen. To use your example,
public static async void AsyncMethod2(int num)
{
await Task.Factory.StartNew(() => Thread.Sleep(num));
}
Yes, use async
and await
here, they make sure your method still works correctly if an exception is thrown.
for more information see: http://msdn.microsoft.com/en-us/magazine/jj991977.aspx
You are doing mistake in "configuration_page.jsp" file. here in this file , function loadXMLDoc() 's line number 2 should be like this:
var config=document.getElementsByName('configselect').value;
because you have declared only the name
attribute in your <select>
tag. So you should get this element by name.
After correcting this, it will run without any JavaScript error
As an example of the difference -- if you have a task the does something with the UI thread (e.g. a task that represents an animation in a Storyboard) if you Task.WaitAll()
then the UI thread is blocked and the UI is never updated. if you use await Task.WhenAll()
then the UI thread is not blocked, and the UI will be updated.
Very important to check if we have connectivity with isAvailable() and if is possible to establish a connection with isConnected()
private static ConnectivityManager manager;
public static boolean isOnline(Context context) {
ConnectivityManager connectivityManager = (ConnectivityManager) context.getSystemService(Context.CONNECTIVITY_SERVICE);
NetworkInfo networkInfo = connectivityManager.getActiveNetworkInfo();
return networkInfo != null && networkInfo.isAvailable() && networkInfo.isConnected();
}
and you can derterminate the type of network active WiFi :
public static boolean isConnectedWifi(Context context) {
ConnectivityManager connectivityManager = (ConnectivityManager) context.getSystemService(Context.CONNECTIVITY_SERVICE);
NetworkInfo networkInfo = connectivityManager.getActiveNetworkInfo();
return networkInfo != null && networkInfo.getType() == ConnectivityManager.TYPE_WIFI;
}
or mobile Móvil :
public static boolean isConnectedMobile(Context context) {
ConnectivityManager connectivityManager = (ConnectivityManager) context.getSystemService(Context.CONNECTIVITY_SERVICE);
NetworkInfo networkInfo = connectivityManager.getActiveNetworkInfo();
return networkInfo != null && networkInfo.getType() == ConnectivityManager.TYPE_MOBILE;
}
don´t forget the permissions:
<uses-permission android:name="android.permission.ACCESS_NETWORK_STATE" />
<uses-permission android:name="android.permission.INTERNET" />
Unfortunately PHP does not have any kind of native threading capabilities. So I think in this case you have no choice but to use some kind of custom code to do what you want to do.
If you search around the net for PHP threading stuff, some people have come up with ways to simulate threads on PHP.
You can call a function after the state value has updated:
this.setState({foo: 'bar'}, () => {
// Do something here.
});
Also, if you have lots of states to update at once, group them all within the same setState
:
Instead of:
this.setState({foo: "one"}, () => {
this.setState({bar: "two"});
});
Just do this:
this.setState({
foo: "one",
bar: "two"
});
The answers here are useful as a general guidance about await/async. They also contain some detail about how await/async is wired. I would like to share some practical experience with you that you should know before using this design pattern.
The term "await" is literal, so whatever thread you call it on will wait for the result of the method before continuing. On the foreground thread, this is a disaster. The foreground thread carries the burden of constructing your app, including views, view models, initial animations, and whatever else you have boot-strapped with those elements. So when you await the foreground thread, you stop the app. The user waits and waits when nothing appears to happen. This provides a negative user experience.
You can certainly await a background thread using a variety of means:
Device.BeginInvokeOnMainThread(async () => { await AnyAwaitableMethod(); });
// Notice that we do not await the following call,
// as that would tie it to the foreground thread.
try
{
Task.Run(async () => { await AnyAwaitableMethod(); });
}
catch
{}
The complete code for these remarks is at https://github.com/marcusts/xamarin-forms-annoyances. See the solution called AwaitAsyncAntipattern.sln.
The GitHub site also provides links to a more detailed discussion on this topic.
My most preferred way is,
var objectKeysArray = Object.keys(yourJsonObj)
objectKeysArray.forEach(function(objKey) {
var objValue = yourJsonObj[objKey]
})
This is more of an observation than an answer, but it may help others who were as frustrated as I was.
I kept getting this error from two tests in my suite. I thought I had simply broken the tests with the refactoring I was doing, so after backing out changes didn't work, I reverted to earlier code, twice (two revisions back) thinking it'd get rid of the error. Doing so changed nothing. I chased my tail all day yesterday, and part of this morning without resolving the issue.
I got frustrated and checked out the code onto a laptop this morning. Ran the entire test suite (about 180 tests), no errors. So the errors were never in the code or tests. Went back to my dev box and rebooted it to clear anything in memory that might have been causing the issue. No change, same errors on the same two tests. So I deleted the directory from my machine, and checked it back out. Voila! No errors.
No idea what caused it, or how to fix it, but deleting the working directory and checking it back out fixed whatever it was.
Hope this helps someone.
You have to pass the CancellationToken
to the Task, which will periodically monitors the token to see whether cancellation is requested.
// CancellationTokenSource provides the token and have authority to cancel the token
CancellationTokenSource cancellationTokenSource = new CancellationTokenSource();
CancellationToken token = cancellationTokenSource.Token;
// Task need to be cancelled with CancellationToken
Task task = Task.Run(async () => {
while(!token.IsCancellationRequested) {
Console.Write("*");
await Task.Delay(1000);
}
}, token);
Console.WriteLine("Press enter to stop the task");
Console.ReadLine();
cancellationTokenSource.Cancel();
In this case, the operation will end when cancellation is requested and the Task
will have a RanToCompletion
state. If you want to be acknowledged that your task has been cancelled, you have to use ThrowIfCancellationRequested
to throw an OperationCanceledException
exception.
Task task = Task.Run(async () =>
{
while (!token.IsCancellationRequested) {
Console.Write("*");
await Task.Delay(1000);
}
token.ThrowIfCancellationRequested();
}, token)
.ContinueWith(t =>
{
t.Exception?.Handle(e => true);
Console.WriteLine("You have canceled the task");
},TaskContinuationOptions.OnlyOnCanceled);
Console.WriteLine("Press enter to stop the task");
Console.ReadLine();
cancellationTokenSource.Cancel();
task.Wait();
Hope this helps to understand better.
Array.forEach
does not provide this nicety (oh if it would) but there are several ways to accomplish what you want:
function callback () { console.log('all done'); }
var itemsProcessed = 0;
[1, 2, 3].forEach((item, index, array) => {
asyncFunction(item, () => {
itemsProcessed++;
if(itemsProcessed === array.length) {
callback();
}
});
});
(thanks to @vanuan and others) This approach guarantees that all items are processed before invoking the "done" callback. You need to use a counter that gets updated in the callback. Depending on the value of the index parameter does not provide the same guarantee, because the order of return of the asynchronous operations is not guaranteed.
(a promise library can be used for older browsers):
Process all requests guaranteeing synchronous execution (e.g. 1 then 2 then 3)
function asyncFunction (item, cb) {
setTimeout(() => {
console.log('done with', item);
cb();
}, 100);
}
let requests = [1, 2, 3].reduce((promiseChain, item) => {
return promiseChain.then(() => new Promise((resolve) => {
asyncFunction(item, resolve);
}));
}, Promise.resolve());
requests.then(() => console.log('done'))
Process all async requests without "synchronous" execution (2 may finish faster than 1)
let requests = [1,2,3].map((item) => {
return new Promise((resolve) => {
asyncFunction(item, resolve);
});
})
Promise.all(requests).then(() => console.log('done'));
There are other asynchronous libraries, async being the most popular, that provide mechanisms to express what you want.
EditThe body of the question has been edited to remove the previously synchronous example code, so i've updated my answer to clarify. The original example used synchronous like code to model asynchronous behaviour, so the following applied:
array.forEach
is synchronous and so is res.write
, so you can simply put your callback after your call to foreach:
posts.foreach(function(v, i) {
res.write(v + ". index " + i);
});
res.end();
Use HttpWebRequest.BeginGetResponse()
HttpWebRequest webRequest;
void StartWebRequest()
{
webRequest.BeginGetResponse(new AsyncCallback(FinishWebRequest), null);
}
void FinishWebRequest(IAsyncResult result)
{
webRequest.EndGetResponse(result);
}
The callback function is called when the asynchronous operation is complete. You need to at least call EndGetResponse()
from this function.
The way to do it is to pass the tasks a callback that updates a shared counter. When the shared counter reaches zero you know that all tasks have finished so you can continue with your normal flow.
var ntasks_left_to_go = 4;
var callback = function(){
ntasks_left_to_go -= 1;
if(ntasks_left_to_go <= 0){
console.log('All tasks have completed. Do your stuff');
}
}
task1(callback);
task2(callback);
task3(callback);
task4(callback);
Of course, there are many ways to make this kind of code more generic or reusable and any of the many async programing libraries out there should have at least one function to do this kind of thing.
Both answers are wrong. You can. You need to call
$.ajaxSetup({
async: false
});
before your json ajax call. And you can set it to true after call retuns ( if there are other usages of ajax on page if you want them async )
Late, but to show an easy solution using promises
after their introduction in ES6, it handles asynchronous calls a lot easier:
You set the asynchronous code in a new promise:
var asyncFunct = new Promise(function(resolve, reject) {
$('#link').animate({ width: 200 }, 2000, function() {
console.log("finished");
resolve();
});
});
Note to set resolve()
when async call finishes.
Then you add the code that you want to run after async call finishes inside .then()
of the promise:
asyncFunct.then((result) => {
console.log("Exit");
});
Here is a snippet of it:
$('#link').click(function () {_x000D_
console.log("Enter");_x000D_
var asyncFunct = new Promise(function(resolve, reject) {_x000D_
$('#link').animate({ width: 200 }, 2000, function() {_x000D_
console.log("finished"); _x000D_
resolve();_x000D_
}); _x000D_
});_x000D_
asyncFunct.then((result) => {_x000D_
console.log("Exit"); _x000D_
});_x000D_
});
_x000D_
<script src="https://ajax.googleapis.com/ajax/libs/jquery/2.1.1/jquery.min.js"></script>_x000D_
<a href="#" id="link">Link</a>_x000D_
<span>Moving</span>
_x000D_
or JSFiddle
You shouldn't be looking at what happens around the call that creates the fiber but rather at what happens inside the fiber. Once you are inside the fiber you can program in sync style. For example:
function f1() { console.log('wait... ' + new Date); sleep(1000); console.log('ok... ' + new Date); } function f2() { f1(); f1(); } Fiber(function() { f2(); }).run();
Inside the fiber you call f1
, f2
and sleep
as if they were sync.
In a typical web application, you will create the Fiber in your HTTP request dispatcher. Once you've done that you can write all your request handling logic in sync style, even if it calls async functions (fs, databases, etc.).
HTML5's new 'async' attribute is supposed to do the trick. 'defer' is also supported in most browsers if you care about IE.
async - The HTML
<script async src="siteScript.js" onload="myInit()"></script>
defer - The HTML
<script defer src="siteScript.js" onload="myInit()"></script>
While analyzing the new adsense ad unit code I noticed the attribute and a search lead me here: http://davidwalsh.name/html5-async
When executing a sequence like: a>b>c>d>, if we get a failure in the middle of execution like:
a
b
c
fail
Then we re-start from the beginning:
a
b
c
d
this is synchronous
If, however, we have the same sequence to execute: a>b>c>d>, and we have a failure in the middle:
a
b
c
fail
...but instead of restarting from the beginning, we re-start from the point of failure:
c
d
...this is know as asynchronous.
In all these scenarios outerScopeVar
is modified or assigned a value asynchronously or happening in a later time(waiting or listening for some event to occur),for which the current execution will not wait.So all these cases current execution flow results in outerScopeVar = undefined
Let's discuss each examples(I marked the portion which is called asynchronously or delayed for some events to occur):
1.
Here we register an eventlistner which will be executed upon that particular event.Here loading of image.Then the current execution continuous with next lines img.src = 'lolcat.png';
and alert(outerScopeVar);
meanwhile the event may not occur. i.e, funtion img.onload
wait for the referred image to load, asynchrously. This will happen all the folowing example- the event may differ.
2.
Here the timeout event plays the role, which will invoke the handler after the specified time. Here it is 0
, but still it registers an asynchronous event it will be added to the last position of the Event Queue
for execution, which makes the guaranteed delay.
3.
4.
Node can be consider as a king of asynchronous coding.Here the marked function is registered as a callback handler which will be executed after reading the specified file.
5.
Obvious promise (something will be done in future) is asynchronous. see What are the differences between Deferred, Promise and Future in JavaScript?
https://www.quora.com/Whats-the-difference-between-a-promise-and-a-callback-in-Javascript
In addition to the above answers here is how you might handle a 500 series response from your api where you receive an error message encoded in json:
function callApi(url) {
return fetch(url)
.then(response => {
if (response.ok) {
return response.json().then(response => ({ response }));
}
return response.json().then(error => ({ error }));
})
;
}
let url = 'http://jsonplaceholder.typicode.com/posts/6';
const { response, error } = callApi(url);
if (response) {
// handle json decoded response
} else {
// handle json decoded 500 series response
}
It's pretty straightforward with some simple rules:
then
, return it - any promise you don't return will not be waited for outside..all
them - that way it waits for all the promises and no error from any of them are silenced.then
s, you can typically return in the middle - then
chains are usually at most 1 level deep.And some tips:
.map
than with for/push
- if you're mapping values with a function, map
lets you concisely express the notion of applying actions one by one and aggregating the results.Promise.all
than to execute things one after the other - each waiting before the next.Ok, so let's get started:
var items = [1, 2, 3, 4, 5];
var fn = function asyncMultiplyBy2(v){ // sample async action
return new Promise(resolve => setTimeout(() => resolve(v * 2), 100));
};
// map over forEach since it returns
var actions = items.map(fn); // run the function over all items
// we now have a promises array and we want to wait for it
var results = Promise.all(actions); // pass array of promises
results.then(data => // or just .then(console.log)
console.log(data) // [2, 4, 6, 8, 10]
);
// we can nest this of course, as I said, `then` chains:
var res2 = Promise.all([1, 2, 3, 4, 5].map(fn)).then(
data => Promise.all(data.map(fn))
).then(function(data){
// the next `then` is executed after the promise has returned from the previous
// `then` fulfilled, in this case it's an aggregate promise because of
// the `.all`
return Promise.all(data.map(fn));
}).then(function(data){
// just for good measure
return Promise.all(data.map(fn));
});
// now to get the results:
res2.then(function(data){
console.log(data); // [16, 32, 48, 64, 80]
});
Works for me:
List<Item> list = Task.Run(() => manager.GetList()).Result;
in this way it is not necessary to mark the method with async in the call.
As you know, MVC supports asynchronous controllers and you should take advantage of it. In case your Controller, performs a lengthy operation, (it might be a disk based I/o or a network call to another remote service), if the request is handled in synchronous manner, the IIS thread is busy the whole time. As a result, the thread is just waiting for the lengthy operation to complete. It can be better utilized by serving other requests while the operation requested in first is under progress. This will help in serving more concurrent requests. Your webservice will be highly scalable and will not easily run into C10k problem. It is a good idea to use async/await for db queries. and yes you can use them as many number of times as you deem fit.
Take a look here for excellent advise.
Apart from the solutions already mentioned, you can also download jquery.min.js
locally and then use it -
For downloading -
wget "https://ajax.googleapis.com/ajax/libs/jquery/3.1.0/jquery.min.js"
manifest.json -
"content_scripts": [
{
"js": ["/path/to/jquery.min.js", ...]
}
],
in html -
<script src="/path/to/jquery.min.js"></script>
Reference - https://developer.chrome.com/extensions/contentSecurityPolicy
Any recommendation on how to fix this?
Several. You can use bind:
for (i = 0; i < j; i++) {
asycronouseProcess(function (i) {
alert(i);
}.bind(null, i));
}
Or, if your browser supports let (it will be in the next ECMAScript version, however Firefox already supports it since a while) you could have:
for (i = 0; i < j; i++) {
let k = i;
asycronouseProcess(function() {
alert(k);
});
}
Or, you could do the job of bind
manually (in case the browser doesn't support it, but I would say you can implement a shim in that case, it should be in the link above):
for (i = 0; i < j; i++) {
asycronouseProcess(function(i) {
return function () {
alert(i)
}
}(i));
}
I usually prefer let
when I can use it (e.g. for Firefox add-on); otherwise bind
or a custom currying function (that doesn't need a context object).
Threading is another possible solution. Although the Celery based solution is better for applications at scale, if you are not expecting too much traffic on the endpoint in question, threading is a viable alternative.
This solution is based on Miguel Grinberg's PyCon 2016 Flask at Scale presentation, specifically slide 41 in his slide deck. His code is also available on github for those interested in the original source.
From a user perspective the code works as follows:
To convert an api call to a background task, simply add the @async_api decorator.
Here is a fully contained example:
from flask import Flask, g, abort, current_app, request, url_for
from werkzeug.exceptions import HTTPException, InternalServerError
from flask_restful import Resource, Api
from datetime import datetime
from functools import wraps
import threading
import time
import uuid
tasks = {}
app = Flask(__name__)
api = Api(app)
@app.before_first_request
def before_first_request():
"""Start a background thread that cleans up old tasks."""
def clean_old_tasks():
"""
This function cleans up old tasks from our in-memory data structure.
"""
global tasks
while True:
# Only keep tasks that are running or that finished less than 5
# minutes ago.
five_min_ago = datetime.timestamp(datetime.utcnow()) - 5 * 60
tasks = {task_id: task for task_id, task in tasks.items()
if 'completion_timestamp' not in task or task['completion_timestamp'] > five_min_ago}
time.sleep(60)
if not current_app.config['TESTING']:
thread = threading.Thread(target=clean_old_tasks)
thread.start()
def async_api(wrapped_function):
@wraps(wrapped_function)
def new_function(*args, **kwargs):
def task_call(flask_app, environ):
# Create a request context similar to that of the original request
# so that the task can have access to flask.g, flask.request, etc.
with flask_app.request_context(environ):
try:
tasks[task_id]['return_value'] = wrapped_function(*args, **kwargs)
except HTTPException as e:
tasks[task_id]['return_value'] = current_app.handle_http_exception(e)
except Exception as e:
# The function raised an exception, so we set a 500 error
tasks[task_id]['return_value'] = InternalServerError()
if current_app.debug:
# We want to find out if something happened so reraise
raise
finally:
# We record the time of the response, to help in garbage
# collecting old tasks
tasks[task_id]['completion_timestamp'] = datetime.timestamp(datetime.utcnow())
# close the database session (if any)
# Assign an id to the asynchronous task
task_id = uuid.uuid4().hex
# Record the task, and then launch it
tasks[task_id] = {'task_thread': threading.Thread(
target=task_call, args=(current_app._get_current_object(),
request.environ))}
tasks[task_id]['task_thread'].start()
# Return a 202 response, with a link that the client can use to
# obtain task status
print(url_for('gettaskstatus', task_id=task_id))
return 'accepted', 202, {'Location': url_for('gettaskstatus', task_id=task_id)}
return new_function
class GetTaskStatus(Resource):
def get(self, task_id):
"""
Return status about an asynchronous task. If this request returns a 202
status code, it means that task hasn't finished yet. Else, the response
from the task is returned.
"""
task = tasks.get(task_id)
if task is None:
abort(404)
if 'return_value' not in task:
return '', 202, {'Location': url_for('gettaskstatus', task_id=task_id)}
return task['return_value']
class CatchAll(Resource):
@async_api
def get(self, path=''):
# perform some intensive processing
print("starting processing task, path: '%s'" % path)
time.sleep(10)
print("completed processing task, path: '%s'" % path)
return f'The answer is: {path}'
api.add_resource(CatchAll, '/<path:path>', '/')
api.add_resource(GetTaskStatus, '/status/<task_id>')
if __name__ == '__main__':
app.run(debug=True)
The native Python way for asynchronous calls in 2021 with Python 3.9 suitable also for Jupyter / Ipython Kernel
Camabeh's answer is the way to go since Python 3.3.
async def display_date(loop): end_time = loop.time() + 5.0 while True: print(datetime.datetime.now()) if (loop.time() + 1.0) >= end_time: break await asyncio.sleep(1) loop = asyncio.get_event_loop() # Blocking call which returns when the display_date() coroutine is done loop.run_until_complete(display_date(loop)) loop.close()
This will work in Jupyter Notebook / Jupyter Lab but throw an error:
RuntimeError: This event loop is already running
Due to Ipython's usage of event loops we need something called nested asynchronous loops which is not yet implemented in Python. Luckily there is nest_asyncio to deal with the issue. All you need to do is:
!pip install nest_asyncio # use ! within Jupyter Notebook, else pip install in shell
import nest_asyncio
nest_asyncio.apply()
(Based on this thread)
Only when you call loop.close()
it throws another error as it probably refers to Ipython's main loop.
RuntimeError: Cannot close a running event loop
I'll update this answer as soon as someone answered to this github issue.
Most of the answers on this thread are either complex or will result in deadlock.
Following method is simple and it will avoid deadlock because we are waiting for the task to finish and only then getting its result-
var task = Task.Run(() => GenerateCodeAsync());
task.Wait();
string code = task.Result;
Furthermore, here is a reference to MSDN article that talks about exactly same thing- https://blogs.msdn.microsoft.com/jpsanders/2017/08/28/asp-net-do-not-use-task-result-in-main-context/
async Task<int> LongTask1() {
...
return 0;
}
async Task<int> LongTask2() {
...
return 1;
}
...
{
Task<int> t1 = LongTask1();
Task<int> t2 = LongTask2();
await Task.WhenAll(t1,t2);
//now we have t1.Result and t2.Result
}
without use queue, you can use the proc_open()
like this:
$descriptorspec = array(
0 => array("pipe", "r"),
1 => array("pipe", "w"),
2 => array("pipe", "w") //here curaengine log all the info into stderror
);
$command = 'ping stackoverflow.com';
$process = proc_open($command, $descriptorspec, $pipes);
//delay callback function_x000D_
function delay (seconds, callback){_x000D_
setTimeout(() =>{_x000D_
console.log('The long delay ended');_x000D_
callback('Task Complete');_x000D_
}, seconds*1000);_x000D_
}_x000D_
//Execute delay function_x000D_
delay(1, res => { _x000D_
console.log(res); _x000D_
})
_x000D_
In my experience over the past few months, I've realized that the best way to achieve this is:
class App extends React.Component{
constructor(){
super();
this.state = {
serverResponse: ''
}
}
componentDidMount(){
this.getData();
}
async getData(){
const res = await axios.get('url-to-get-the-data');
const { data } = await res;
this.setState({serverResponse: data})
}
render(){
return(
<div>
{this.state.serverResponse}
</div>
);
}
}
If you are trying to make post request on events such as click, then call getData()
function on the event and replace the content of it like so:
async getData(username, password){
const res = await axios.post('url-to-post-the-data', {
username,
password
});
...
}
Furthermore, if you are making any request when the component is about to load then simply replace async getData()
with async componentDidMount()
and change the render function like so:
render(){
return (
<div>{this.state.serverResponse}</div>
)
}
I would recommend you well tested PHP library: curl-easy
<?php
$request = new cURL\Request('http://www.externalsite.com/script2.php?variable=45');
$request->getOptions()
->set(CURLOPT_TIMEOUT, 5)
->set(CURLOPT_RETURNTRANSFER, true);
// add callback when the request will be completed
$request->addListener('complete', function (cURL\Event $event) {
$response = $event->response;
$content = $response->getContent();
echo $content;
});
while ($request->socketPerform()) {
// do anything else when the request is processed
}
Redux can't return a function instead of an action. It's just a fact. That's why people use Thunk. Read these 14 lines of code to see how it allows the async cycle to work with some added function layering:
function createThunkMiddleware(extraArgument) {
return ({ dispatch, getState }) => (next) => (action) => {
if (typeof action === 'function') {
return action(dispatch, getState, extraArgument);
}
return next(action);
};
}
const thunk = createThunkMiddleware();
thunk.withExtraArgument = createThunkMiddleware;
export default thunk;
The curses library can be used for this purpose. Of course, select()
and signal handlers can be used too to a certain extent.
One way is to use pcntl_fork()
in a recursive function.
function networkCall(){
$data = processGETandPOST();
$response = makeNetworkCall($data);
processNetworkResponse($response);
return true;
}
function runAsync($times){
$pid = pcntl_fork();
if ($pid == -1) {
die('could not fork');
} else if ($pid) {
// we are the parent
$times -= 1;
if($times>0)
runAsync($times);
pcntl_wait($status); //Protect against Zombie children
} else {
// we are the child
networkCall();
posix_kill(getmypid(), SIGKILL);
}
}
runAsync(3);
One thing about pcntl_fork()
is that when running the script by way of Apache, it doesn't work (it's not supported by Apache). So, one way to resolve that issue is to run the script using the php cli, like: exec('php fork.php',$output);
from another file. To do this you'll have two files: one that's loaded by Apache and one that's run with exec()
from inside the file loaded by Apache like this:
apacheLoadedFile.php
exec('php fork.php',$output);
fork.php
function networkCall(){
$data = processGETandPOST();
$response = makeNetworkCall($data);
processNetworkResponse($response);
return true;
}
function runAsync($times){
$pid = pcntl_fork();
if ($pid == -1) {
die('could not fork');
} else if ($pid) {
// we are the parent
$times -= 1;
if($times>0)
runAsync($times);
pcntl_wait($status); //Protect against Zombie children
} else {
// we are the child
networkCall();
posix_kill(getmypid(), SIGKILL);
}
}
runAsync(3);
You're the victim of the classic deadlock. task.Wait()
or task.Result
is a blocking call in UI thread which causes the deadlock.
Don't block in the UI thread. Never do it. Just await it.
private async void Button_Click(object sender, RoutedEventArgs
{
var task = GetResponseAsync<MyObject>("my url");
var items = await task;
}
Btw, why are you catching the WebException
and throwing it back? It would be better if you simply don't catch it. Both are same.
Also I can see you're mixing the asynchronous code with synchronous code inside the GetResponse
method. StreamReader.ReadToEnd
is a blocking call --you should be using StreamReader.ReadToEndAsync
.
Also use "Async" suffix to methods which returns a Task or asynchronous to follow the TAP("Task based Asynchronous Pattern") convention as Jon says.
Your method should look something like the following when you've addressed all the above concerns.
public static async Task<List<T>> GetResponseAsync<T>(string url)
{
HttpWebRequest request = (HttpWebRequest)HttpWebRequest.Create(url);
var response = (HttpWebResponse)await Task.Factory.FromAsync<WebResponse>(request.BeginGetResponse, request.EndGetResponse, null);
Stream stream = response.GetResponseStream();
StreamReader strReader = new StreamReader(stream);
string text = await strReader.ReadToEndAsync();
return JsonConvert.DeserializeObject<List<T>>(text);
}
//sample01_x000D_
(function(_){_[0]()})([_x000D_
function(){$('#art1').animate({'width':'10px'},100,this[1].bind(this))},_x000D_
function(){$('#art2').animate({'width':'10px'},100,this[2].bind(this))},_x000D_
function(){$('#art3').animate({'width':'10px'},100)},_x000D_
])_x000D_
_x000D_
//sample02_x000D_
(function(_){_.next=function(){_[++_.i].apply(_,arguments)},_[_.i=0]()})([_x000D_
function(){$('#art1').animate({'width':'10px'},100,this.next)},_x000D_
function(){$('#art2').animate({'width':'10px'},100,this.next)},_x000D_
function(){$('#art3').animate({'width':'10px'},100)},_x000D_
]);_x000D_
_x000D_
//sample03_x000D_
(function(_){_.next=function(){return _[++_.i].bind(_)},_[_.i=0]()})([_x000D_
function(){$('#art1').animate({'width':'10px'},100,this.next())},_x000D_
function(){$('#art2').animate({'width':'10px'},100,this.next())},_x000D_
function(){$('#art3').animate({'width':'10px'},100)},_x000D_
]);
_x000D_
How about calling a function from within your callback instead of returning a value in sync_call()?
function sync_call(input) {
var value;
// Assume the async call always succeed
async_call(input, function(result) {
value = result;
use_value(value);
} );
}
You may wish to also consider the class java.util.concurrent.FutureTask
.
If you are using Java 5 or later, FutureTask is a turnkey implementation of "A cancellable asynchronous computation."
There are even richer asynchronous execution scheduling behaviors available in the java.util.concurrent
package (for example, ScheduledExecutorService
), but FutureTask
may have all the functionality you require.
I would even go so far as to say that it is no longer advisable to use the first code pattern you gave as an example ever since FutureTask
became available. (Assuming you are on Java 5 or later.)
Using HTML5 and JavaScript, uploading async is quite easy, I create the uploading logic along with your html, this is not fully working as it needs the api, but demonstrate how it works, if you have the endpoint called /upload
from root of your website, this code should work for you:
const asyncFileUpload = () => {
const fileInput = document.getElementById("file");
const file = fileInput.files[0];
const uri = "/upload";
const xhr = new XMLHttpRequest();
xhr.upload.onprogress = e => {
const percentage = e.loaded / e.total;
console.log(percentage);
};
xhr.onreadystatechange = e => {
if (xhr.readyState === 4 && xhr.status === 200) {
console.log("file uploaded");
}
};
xhr.open("POST", uri, true);
xhr.setRequestHeader("X-FileName", file.name);
xhr.send(file);
}
_x000D_
<form>
<span>File</span>
<input type="file" id="file" name="file" size="10" />
<input onclick="asyncFileUpload()" id="upload" type="button" value="Upload" />
</form>
_x000D_
Also some further information about XMLHttpReques:
The XMLHttpRequest Object
All modern browsers support the XMLHttpRequest object. The XMLHttpRequest object can be used to exchange data with a web server behind the scenes. This means that it is possible to update parts of a web page, without reloading the whole page.
Create an XMLHttpRequest Object
All modern browsers (Chrome, Firefox, IE7+, Edge, Safari, Opera) have a built-in XMLHttpRequest object.
Syntax for creating an XMLHttpRequest object:
variable = new XMLHttpRequest();
Access Across Domains
For security reasons, modern browsers do not allow access across domains.
This means that both the web page and the XML file it tries to load, must be located on the same server.
The examples on W3Schools all open XML files located on the W3Schools domain.
If you want to use the example above on one of your own web pages, the XML files you load must be located on your own server.
For more details, you can continue reading here...
What you can do is in your .config for the app is create the resolve object for the route and in the function pass in $q (promise object) and the name of the service you're depending on, and resolve the promise in the callback function for the $http in the service like so:
ROUTE CONFIG
app.config(function($routeProvider){
$routeProvider
.when('/',{
templateUrl: 'home.html',
controller: 'homeCtrl',
resolve:function($q,MyService) {
//create the defer variable and pass it to our service
var defer = $q.defer();
MyService.fetchData(defer);
//this will only return when the promise
//has been resolved. MyService is going to
//do that for us
return defer.promise;
}
})
}
Angular won't render the template or make the controller available until defer.resolve() has been called. We can do that in our service:
SERVICE
app.service('MyService',function($http){
var MyService = {};
//our service accepts a promise object which
//it will resolve on behalf of the calling function
MyService.fetchData = function(q) {
$http({method:'GET',url:'data.php'}).success(function(data){
MyService.data = data;
//when the following is called it will
//release the calling function. in this
//case it's the resolve function in our
//route config
q.resolve();
}
}
return MyService;
});
Now that MyService has the data assigned to it's data property, and the promise in the route resolve object has been resolved, our controller for the route kicks into life, and we can assign the data from the service to our controller object.
CONTROLLER
app.controller('homeCtrl',function($scope,MyService){
$scope.servicedata = MyService.data;
});
Now all our binding in the scope of the controller will be able to use the data which originated from MyService.
As far as I know, it's the main entry point to your node package (library) for npm. It's needed if your npm project becomes a node package (library) which can be installed via npm by others.
Let's say you have a library with a build/, dist/, or lib/ folder. In this folder, you got the following compiled file for your library:
-lib/
--bundle.js
Then in your package.json, you tell npm how to access the library (node package):
{
"name": "my-library-name",
"main": "lib/bundle.js",
...
}
After installing the node package with npm to your JS project, you can import functionalities from your bundled bundle.js file:
import { add, subtract } from 'my-library-name';
This holds also true when using Code Splitting (e.g. Webpack) for your library. For instance, this webpack.config.js makes use of code splitting the project into multiple bundles instead of one.
module.exports = {
entry: {
main: './src/index.js',
add: './src/add.js',
subtract: './src/subtract.js',
},
output: {
path: `${__dirname}/lib`,
filename: '[name].js',
library: 'my-library-name',
libraryTarget: 'umd',
},
...
}
Still, you would define one main entry point to your library in your package.json:
{
"name": "my-library-name",
"main": "lib/main.js",
...
}
Then when using the library, you can import your files from your main entry point:
import { add, subtract } from 'my-library-name';
However, you can also bypass the main entry point from the package.json and import the code splitted bundles:
import add from 'my-library-name/lib/add';
import subtract from 'my-library-name/lib/subtract';
After all, the main property in your package.json only points to your main entry point file of your library.
This could be done by placing the loading icon in your html file (index.html for ex), so that users see the icon immediately after the html file has been loaded.
When your app finishes loading, you could simply remove that loading icon in a lifecycle hook, I usually do that in componentDidMount
.
The function makes the second one asynchronous.
The first one forces the program to wait for each line to finish it's run before the next one can continue. The second one allows each line to run together (and independently) at once.
Languages and frameworks (js, node.js) that allow asynchronous or concurrency is great for things that require real time transmission (eg. chat, stock applications).
If you are referring to the npm module sleep, it notes in the readme that sleep
will block execution. So you are right - it isn't what you want. Instead you want to use setTimeout which is non-blocking. Here is an example:
setTimeout(function() {
console.log('hello world!');
}, 5000);
For anyone looking to do this using es7 async/await, this example should help:
const snooze = ms => new Promise(resolve => setTimeout(resolve, ms));
const example = async () => {
console.log('About to snooze without halting the event loop...');
await snooze(1000);
console.log('done!');
};
example();
You can force asynchronous JavaScript in NodeJS to be synchronous with sync-rpc.
It will definitely freeze your UI though, so I'm still a naysayer when it comes to whether what it's possible to take the shortcut you need to take. It's not possible to suspend the One And Only Thread in JavaScript, even if NodeJS lets you block it sometimes. No callbacks, events, anything asynchronous at all will be able to process until your promise resolves. So unless you the reader have an unavoidable situation like the OP (or, in my case, are writing a glorified shell script with no callbacks, events, etc.), DO NOT DO THIS!
But here's how you can do this:
./calling-file.js
var createClient = require('sync-rpc');
var mySynchronousCall = createClient(require.resolve('./my-asynchronous-call'), 'init data');
var param1 = 'test data'
var data = mySynchronousCall(param1);
console.log(data); // prints: received "test data" after "init data"
./my-asynchronous-call.js
function init(initData) {
return function(param1) {
// Return a promise here and the resulting rpc client will be synchronous
return Promise.resolve('received "' + param1 + '" after "' + initData + '"');
};
}
module.exports = init;
LIMITATIONS:
These are both a consequence of how sync-rpc
is implemented, which is by abusing require('child_process').spawnSync
:
JSON.stringify
, so functions and non-enumerable properties like prototype chains will be lost.I would like to improve the code. When you canel the aSyncTask
the onCancelled()
(callback method of aSyncTask
) gets automatically called, and there you can hide your progressBarDialog
.
You can include this code as well:
public class information extends AsyncTask<String, String, String>
{
@Override
protected void onPreExecute() {
super.onPreExecute();
}
@Override
protected String doInBackground(String... arg0) {
return null;
}
@Override
protected void onPostExecute(String result) {
super.onPostExecute(result);
this.cancel(true);
}
@Override
protected void onProgressUpdate(String... values) {
super.onProgressUpdate(values);
}
@Override
protected void onCancelled() {
Toast.makeText(getApplicationContext(), "asynctack cancelled.....", Toast.LENGTH_SHORT).show();
dialog.hide(); /*hide the progressbar dialog here...*/
super.onCancelled();
}
}
Just passing by callbacks is not enough. You have to use settimer for example, to make function async.
Examples: Not async functions:
function a() {
var a = 0;
for(i=0; i<10000000; i++) {
a++;
};
b();
};
function b() {
var a = 0;
for(i=0; i<10000000; i++) {
a++;
};
c();
};
function c() {
for(i=0; i<10000000; i++) {
};
console.log("async finished!");
};
a();
console.log("This should be good");
If you will run above example, This should be good, will have to wait untill those functions will finish to work.
Pseudo multithread (async) functions:
function a() {
setTimeout ( function() {
var a = 0;
for(i=0; i<10000000; i++) {
a++;
};
b();
}, 0);
};
function b() {
setTimeout ( function() {
var a = 0;
for(i=0; i<10000000; i++) {
a++;
};
c();
}, 0);
};
function c() {
setTimeout ( function() {
for(i=0; i<10000000; i++) {
};
console.log("async finished!");
}, 0);
};
a();
console.log("This should be good");
This one will be trully async. This should be good will be writen before async finished.
A bit late to the party, but Krux has created a script for this, called Postscribe. We were able to use this to get past this issue.
From C# 5.0, you can specify the method as
public async Task<bool> doAsyncOperation()
{
// do work
return true;
}
bool result = await doAsyncOperation();
Does an implicit conversion occur between Task<> and int?
Nope. This is just part of how async
/await
works.
Any method declared as async
has to have a return type of:
void
(avoid if possible)Task
(no result beyond notification of completion/failure)Task<T>
(for a logical result of type T
in an async manner)The compiler does all the appropriate wrapping. The point is that you're asynchronously returning urlContents.Length
- you can't make the method just return int
, as the actual method will return when it hits the first await
expression which hasn't already completed. So instead, it returns a Task<int>
which will complete when the async method itself completes.
Note that await
does the opposite - it unwraps a Task<T>
to a T
value, which is how this line works:
string urlContents = await getStringTask;
... but of course it unwraps it asynchronously, whereas just using Result
would block until the task had completed. (await
can unwrap other types which implement the awaitable pattern, but Task<T>
is the one you're likely to use most often.)
This dual wrapping/unwrapping is what allows async to be so composable. For example, I could write another async method which calls yours and doubles the result:
public async Task<int> AccessTheWebAndDoubleAsync()
{
var task = AccessTheWebAsync();
int result = await task;
return result * 2;
}
(Or simply return await AccessTheWebAsync() * 2;
of course.)
For my answer, it is worth remembering that the TPL (Task-Parallel-Library), Task
class and TaskStatus
enumeration were introduced prior to the async-await keywords and the async-await keywords were not the original motivation of the TPL.
In the context of methods marked as async
, the resulting Task
is not a Task
representing the execution of the method, but a Task
for the continuation of the method.
This is only able to make use of a few possible states:
I understand that Running
could appear to have been a better default than WaitingForActivation
, however this could be misleading, as the majority of the time, an async method being executed is not actually running (i.e. it may be await
-ing something else). The other option may have been to add a new value to TaskStatus
, however this could have been a breaking change for existing applications and libraries.
All of this is very different to when making use of Task.Run
which is a part of the original TPL, this is able to make use of all the possible values of the TaskStatus
enumeration.
If you wish to keep track of the status of an async method, take a look at the IProgress(T)
interface, this will allow you to report the ongoing progress. This blog post, Async in 4.5: Enabling Progress and Cancellation in Async APIs will provide further information on the use of the IProgress(T)
interface.
You are trying to execute an asynchronous function
in a synchronous way, which is unfortunately not possible in Javascript
.
As you guessed correctly, the roomId=results
.... is executed when the loading from the DB completes, which is done asynchronously, so AFTER the resto of your code is completed.
Look at this article, it talks about .insert and not .find
, but the idea is the same : http://metaduck.com/01-asynchronous-iteration-patterns.html
Use dispatch group
dispatchGroup.enter()
FirstOperation(completion: { _ in
dispatchGroup.leave()
})
dispatchGroup.enter()
SecondOperation(completion: { _ in
dispatchGroup.leave()
})
dispatchGroup.wait() // Waits here on this thread until the two operations complete executing.
We use Akka in several projects at work, the most interesting of which is related to vehicle crash repair. Primarily in the UK but now expanding to the US, Asia, Australasia and Europe. We use actors to ensure that crash repair information is provided realtime to enable the safe and cost effective repair of vehicles.
The question with Akka is really more 'what can't you do with Akka'. Its ability to integrate with powerful frameworks, its powerful abstraction and all of the fault tolerance aspects make it a very comprehensive toolkit.
Another option is to use Promise.all to wait for an array of promises to resolve and then act on those.
Code below shows how to wait for all the promises to resolve and then deal with the results once they are all ready (as that seemed to be the objective of the question); Also for illustrative purposes, it shows output during execution (end finishes before middle).
function append_output(suffix, value) {
$("#output_"+suffix).append(value)
}
function kickOff() {
let start = new Promise((resolve, reject) => {
append_output("now", "start")
resolve("start")
})
let middle = new Promise((resolve, reject) => {
setTimeout(() => {
append_output("now", " middle")
resolve(" middle")
}, 1000)
})
let end = new Promise((resolve, reject) => {
append_output("now", " end")
resolve(" end")
})
Promise.all([start, middle, end]).then(results => {
results.forEach(
result => append_output("later", result))
})
}
kickOff()
_x000D_
<script src="https://ajax.googleapis.com/ajax/libs/jquery/2.1.1/jquery.min.js"></script>
Updated during execution: <div id="output_now"></div>
Updated after all have completed: <div id="output_later"></div>
_x000D_
The blocking models require the initiating application to block when the I/O has started. This means that it isn't possible to overlap processing and I/O at the same time. The synchronous non-blocking model allows overlap of processing and I/O, but it requires that the application check the status of the I/O on a recurring basis. This leaves asynchronous non-blocking I/O, which permits overlap of processing and I/O, including notification of I/O completion.
Look at the WAITFOR command.
E.g.
-- wait for 1 minute
WAITFOR DELAY '00:01'
-- wait for 1 second
WAITFOR DELAY '00:00:01'
This command allows you a high degree of precision but is only accurate within 10ms - 16ms on a typical machine as it relies on GetTickCount. So, for example, the call WAITFOR DELAY '00:00:00:001'
is likely to result in no wait at all.
If you're using C# 7.1 or later, go with the nawfal's answer and just change the return type of your Main method to Task
or Task<int>
. If you are not:
async Task MainAsync
like Johan said..GetAwaiter().GetResult()
to catch the underlying exception like do0g said.CTRL+C
should terminate the process immediately. (Thanks binki!)OperationCancelledException
- return an appropriate error code.The final code looks like:
private static int Main(string[] args)
{
var cts = new CancellationTokenSource();
Console.CancelKeyPress += (s, e) =>
{
e.Cancel = !cts.IsCancellationRequested;
cts.Cancel();
};
try
{
return MainAsync(args, cts.Token).GetAwaiter().GetResult();
}
catch (OperationCanceledException)
{
return 1223; // Cancelled.
}
}
private static async Task<int> MainAsync(string[] args, CancellationToken cancellationToken)
{
// Your code...
return await Task.FromResult(0); // Success.
}
Here is a working example, just run it and open storage.txt afterwards, to check the magical result
<?php
function curlGet($target){
$ch = curl_init();
curl_setopt($ch, CURLOPT_URL, $target);
curl_setopt($ch, CURLOPT_RETURNTRANSFER, 1);
$result = curl_exec ($ch);
curl_close ($ch);
return $result;
}
// Its the next 3 lines that do the magic
ignore_user_abort(true);
header("Connection: close"); header("Content-Length: 0");
echo str_repeat("s", 100000); flush();
$i = $_GET['i'];
if(!is_numeric($i)) $i = 1;
if($i > 4) exit;
if($i == 1) file_put_contents('storage.txt', '');
file_put_contents('storage.txt', file_get_contents('storage.txt') . time() . "\n");
sleep(5);
curlGet($_SERVER['HTTP_HOST'] . $_SERVER['SCRIPT_NAME'] . '?i=' . ($i + 1));
curlGet($_SERVER['HTTP_HOST'] . $_SERVER['SCRIPT_NAME'] . '?i=' . ($i + 1));
Neither of these options is correct. You're trying to implement a synchronous interface asynchronously. Don't do that. The problem is that when DoOperation()
returns, the operation won't be complete yet. Worse, if an exception happens during the operation (which is very common with IO operations), the user won't have a chance to deal with that exception.
What you need to do is to modify the interface, so that it is asynchronous:
interface IIO
{
Task DoOperationAsync(); // note: no async here
}
class IOImplementation : IIO
{
public async Task DoOperationAsync()
{
// perform the operation here
}
}
This way, the user will see that the operation is async
and they will be able to await
it. This also pretty much forces the users of your code to switch to async
, but that's unavoidable.
Also, I assume using StartNew()
in your implementation is just an example, you shouldn't need that to implement asynchronous IO. (And new Task()
is even worse, that won't even work, because you don't Start()
the Task
.)
From your referenced page:
http://googlecode.blogspot.com/2009/12/google-analytics-launches-asynchronous.html
Firefox 3.6 is the first browser to officially offer support for this new feature. If you're curious, here are more details on the official HTML5 async specification.
You can use jQuery's Deferred object along with the when method.
deferredArray = [];
forloop {
deferred = new $.Deferred();
ajaxCall(function() {
deferred.resolve();
}
deferredArray.push(deferred);
}
$.when(deferredArray, function() {
//this code is called after all the ajax calls are done
});
I find an library socket.io to test asynchronous logic. It looks simple and brief way using LinkedBlockingQueue. Here is example:
@Test(timeout = TIMEOUT)
public void message() throws URISyntaxException, InterruptedException {
final BlockingQueue<Object> values = new LinkedBlockingQueue<Object>();
socket = client();
socket.on(Socket.EVENT_CONNECT, new Emitter.Listener() {
@Override
public void call(Object... objects) {
socket.send("foo", "bar");
}
}).on(Socket.EVENT_MESSAGE, new Emitter.Listener() {
@Override
public void call(Object... args) {
values.offer(args);
}
});
socket.connect();
assertThat((Object[])values.take(), is(new Object[] {"hello client"}));
assertThat((Object[])values.take(), is(new Object[] {"foo", "bar"}));
socket.disconnect();
}
Using LinkedBlockingQueue take API to block until to get result just like synchronous way. And set timeout to avoid assuming too much time to wait the result.
For easy to use asynchronous convert all callback to promise use some library like "bluebird" .
.then(function(results) {
fs.writeFile(ASIN + '.json', JSON.stringify(results), function(err) {
if (err) {
console.log(err);
} else {
console.log("JSON saved");
return results;
}
})
}).catch(function(err) {
console.log(err);
});
Try solution with promise (bluebird)
var amazon = require('amazon-product-api');
var fs = require('fs');
var Promise = require('bluebird');
var client = amazon.createClient({
awsId: "XXX",
awsSecret: "XXX",
awsTag: "888"
});
var array = fs.readFileSync('./test.txt').toString().split('\n');
Promise.map(array, function (ASIN) {
client.itemLookup({
domain: 'webservices.amazon.de',
responseGroup: 'Large',
idType: 'ASIN',
itemId: ASIN
}).then(function(results) {
fs.writeFile(ASIN + '.json', JSON.stringify(results), function(err) {
if (err) {
console.log(err);
} else {
console.log("JSON saved");
return results;
}
})
}).catch(function(err) {
console.log(err);
});
});
I have the same problem trying to connect to an 3270 terminal using the s3270 scripting software in Python. Now I'm solving the problem with an subclass of Process that I found here:
http://code.activestate.com/recipes/440554/
And here is the sample taken from file:
def recv_some(p, t=.1, e=1, tr=5, stderr=0):
if tr < 1:
tr = 1
x = time.time()+t
y = []
r = ''
pr = p.recv
if stderr:
pr = p.recv_err
while time.time() < x or r:
r = pr()
if r is None:
if e:
raise Exception(message)
else:
break
elif r:
y.append(r)
else:
time.sleep(max((x-time.time())/tr, 0))
return ''.join(y)
def send_all(p, data):
while len(data):
sent = p.send(data)
if sent is None:
raise Exception(message)
data = buffer(data, sent)
if __name__ == '__main__':
if sys.platform == 'win32':
shell, commands, tail = ('cmd', ('dir /w', 'echo HELLO WORLD'), '\r\n')
else:
shell, commands, tail = ('sh', ('ls', 'echo HELLO WORLD'), '\n')
a = Popen(shell, stdin=PIPE, stdout=PIPE)
print recv_some(a),
for cmd in commands:
send_all(a, cmd + tail)
print recv_some(a),
send_all(a, 'exit' + tail)
print recv_some(a, e=0)
a.wait()
I have also tried some things using the asynchronous methods in python, how ever I have had much better luck using twisted for asynchronous programming. It has fewer problems and is well documented. Here is a link of something simmilar to what you are trying in twisted.
http://pythonquirks.blogspot.com/2011/04/twisted-asynchronous-http-request.html
Existing code is working, but is blocking the thread.
.Select(async ev => await ProcessEventAsync(ev))
creates a new Task for every event, but
.Select(t => t.Result)
blocks the thread waiting for each new task to end.
In the other hand your code produce the same result but keeps asynchronous.
Just one comment on your first code. This line
var tasks = await Task.WhenAll(events...
will produce a single Task<TResult[]> so the variable should be named in singular.
Finally your last code make the same but is more succinct.
For reference: Task.Wait / Task.WhenAll
Your code doesn't do what you might think it does. Async methods return immediately after the method begins waiting for the async result. It's insightful to use tracing in order to investigate how the code is actually behaving.
The code below does the following:
static TypeHashes _type = new TypeHashes(typeof(Program));
private void Run()
{
TracerConfig.Reset("debugoutput");
using (Tracer t = new Tracer(_type, "Run"))
{
for (int i = 0; i < 4; i++)
{
DoSomeThingAsync(i);
}
}
Application.Run(); // Start window message pump to prevent termination
}
private async void DoSomeThingAsync(int i)
{
using (Tracer t = new Tracer(_type, "DoSomeThingAsync"))
{
t.Info("Hi in DoSomething {0}",i);
try
{
int result = await Calculate(i);
t.Info("Got async result: {0}", result);
}
catch (ArgumentException ex)
{
t.Error("Got argument exception: {0}", ex);
}
}
}
Task<int> Calculate(int i)
{
var t = new Task<int>(() =>
{
using (Tracer t2 = new Tracer(_type, "Calculate"))
{
if( i % 2 == 0 )
throw new ArgumentException(String.Format("Even argument {0}", i));
return i++;
}
});
t.Start();
return t;
}
When you observe the traces
22:25:12.649 02172/02820 { AsyncTest.Program.Run
22:25:12.656 02172/02820 { AsyncTest.Program.DoSomeThingAsync
22:25:12.657 02172/02820 Information AsyncTest.Program.DoSomeThingAsync Hi in DoSomething 0
22:25:12.658 02172/05220 { AsyncTest.Program.Calculate
22:25:12.659 02172/02820 { AsyncTest.Program.DoSomeThingAsync
22:25:12.659 02172/02820 Information AsyncTest.Program.DoSomeThingAsync Hi in DoSomething 1
22:25:12.660 02172/02756 { AsyncTest.Program.Calculate
22:25:12.662 02172/02820 { AsyncTest.Program.DoSomeThingAsync
22:25:12.662 02172/02820 Information AsyncTest.Program.DoSomeThingAsync Hi in DoSomething 2
22:25:12.662 02172/02820 { AsyncTest.Program.DoSomeThingAsync
22:25:12.662 02172/02820 Information AsyncTest.Program.DoSomeThingAsync Hi in DoSomething 3
22:25:12.664 02172/02756 } AsyncTest.Program.Calculate Duration 4ms
22:25:12.666 02172/02820 } AsyncTest.Program.Run Duration 17ms ---- Run has completed. The async methods are now scheduled on different threads.
22:25:12.667 02172/02756 Information AsyncTest.Program.DoSomeThingAsync Got async result: 1
22:25:12.667 02172/02756 } AsyncTest.Program.DoSomeThingAsync Duration 8ms
22:25:12.667 02172/02756 { AsyncTest.Program.Calculate
22:25:12.665 02172/05220 Exception AsyncTest.Program.Calculate Exception thrown: System.ArgumentException: Even argument 0
at AsyncTest.Program.c__DisplayClassf.Calculateb__e() in C:\Source\AsyncTest\AsyncTest\Program.cs:line 124
at System.Threading.Tasks.Task`1.InvokeFuture(Object futureAsObj)
at System.Threading.Tasks.Task.InnerInvoke()
at System.Threading.Tasks.Task.Execute()
22:25:12.668 02172/02756 Exception AsyncTest.Program.Calculate Exception thrown: System.ArgumentException: Even argument 2
at AsyncTest.Program.c__DisplayClassf.Calculateb__e() in C:\Source\AsyncTest\AsyncTest\Program.cs:line 124
at System.Threading.Tasks.Task`1.InvokeFuture(Object futureAsObj)
at System.Threading.Tasks.Task.InnerInvoke()
at System.Threading.Tasks.Task.Execute()
22:25:12.724 02172/05220 } AsyncTest.Program.Calculate Duration 66ms
22:25:12.724 02172/02756 } AsyncTest.Program.Calculate Duration 57ms
22:25:12.725 02172/05220 Error AsyncTest.Program.DoSomeThingAsync Got argument exception: System.ArgumentException: Even argument 0
Server stack trace:
at AsyncTest.Program.c__DisplayClassf.Calculateb__e() in C:\Source\AsyncTest\AsyncTest\Program.cs:line 124
at System.Threading.Tasks.Task`1.InvokeFuture(Object futureAsObj)
at System.Threading.Tasks.Task.InnerInvoke()
at System.Threading.Tasks.Task.Execute()
Exception rethrown at [0]:
at System.Runtime.CompilerServices.TaskAwaiter.EndAwait()
at System.Runtime.CompilerServices.TaskAwaiter`1.EndAwait()
at AsyncTest.Program.DoSomeThingAsyncd__8.MoveNext() in C:\Source\AsyncTest\AsyncTest\Program.cs:line 106
22:25:12.725 02172/02756 Error AsyncTest.Program.DoSomeThingAsync Got argument exception: System.ArgumentException: Even argument 2
Server stack trace:
at AsyncTest.Program.c__DisplayClassf.Calculateb__e() in C:\Source\AsyncTest\AsyncTest\Program.cs:line 124
at System.Threading.Tasks.Task`1.InvokeFuture(Object futureAsObj)
at System.Threading.Tasks.Task.InnerInvoke()
at System.Threading.Tasks.Task.Execute()
Exception rethrown at [0]:
at System.Runtime.CompilerServices.TaskAwaiter.EndAwait()
at System.Runtime.CompilerServices.TaskAwaiter`1.EndAwait()
at AsyncTest.Program.DoSomeThingAsyncd__8.MoveNext() in C:\Source\AsyncTest\AsyncTest\Program.cs:line 0
22:25:12.726 02172/05220 } AsyncTest.Program.DoSomeThingAsync Duration 70ms
22:25:12.726 02172/02756 } AsyncTest.Program.DoSomeThingAsync Duration 64ms
22:25:12.726 02172/05220 { AsyncTest.Program.Calculate
22:25:12.726 02172/05220 } AsyncTest.Program.Calculate Duration 0ms
22:25:12.726 02172/05220 Information AsyncTest.Program.DoSomeThingAsync Got async result: 3
22:25:12.726 02172/05220 } AsyncTest.Program.DoSomeThingAsync Duration 64ms
You will notice that the Run method completes on thread 2820 while only one child thread has finished (2756). If you put a try/catch around your await method you can "catch" the exception in the usual way although your code is executed on another thread when the calculation task has finished and your contiuation is executed.
The calculation method traces the thrown exception automatically because I did use the ApiChange.Api.dll from the ApiChange tool. Tracing and Reflector helps a lot to understand what is going on. To get rid of threading you can create your own versions of GetAwaiter BeginAwait and EndAwait and wrap not a task but e.g. a Lazy and trace inside your own extension methods. Then you will get much better understanding what the compiler and what the TPL does.
Now you see that there is no way to get in a try/catch your exception back since there is no stack frame left for any exception to propagate from. Your code might be doing something totally different after you did initiate the async operations. It might call Thread.Sleep or even terminate. As long as there is one foreground thread left your application will happily continue to execute asynchronous tasks.
You can handle the exception inside the async method after your asynchronous operation did finish and call back into the UI thread. The recommended way to do this is with TaskScheduler.FromSynchronizationContext. That does only work if you have an UI thread and it is not very busy with other things.
There is a fs.readFileSync( path, options )
method, which is synchronous.
The trick to triggering an asynchronous stylesheet download is to use a <link>
element and set an invalid value for the media attribute (I'm using media="none", but any value will do). When a media query evaluates to false, the browser will still download the stylesheet, but it won't wait for the content to be available before rendering the page.
<link rel="stylesheet" href="css.css" media="none">
Once the stylesheet has finished downloading the media attribute must be set to a valid value so the style rules will be applied to the document. The onload event is used to switch the media property to all:
<link rel="stylesheet" href="css.css" media="none" onload="if(media!='all')media='all'">
This method of loading CSS will deliver useable content to visitors much quicker than the standard approach. Critical CSS can still be served with the usual blocking approach (or you can inline it for ultimate performance) and non-critical styles can be progressively downloaded and applied later in the parsing / rendering process.
This technique uses JavaScript, but you can cater for non-JavaScript browsers by wrapping the equivalent blocking <link>
elements in a <noscript>
element:
<link rel="stylesheet" href="css.css" media="none" onload="if(media!='all')media='all'"><noscript><link rel="stylesheet" href="css.css"></noscript>
You can see the operation in www.itcha.edu.sv
Source in http://keithclark.co.uk/
// A generic test function that can be configured
// with an arbitrary delay and to either resolve or reject
const test = (delay, resolveSuccessfully) => new Promise((resolve, reject) => setTimeout(() => {
console.log(`Done ${ delay }`);
resolveSuccessfully ? resolve(`Resolved ${ delay }`) : reject(`Reject ${ delay }`)
}, delay));
// Our async handler function
const handler = async () => {
// Promise 1 runs first, but resolves last
const p1 = test(10000, true);
// Promise 2 run second, and also resolves
const p2 = test(5000, true);
// Promise 3 runs last, but completes first (with a rejection)
// Note the catch to trap the error immediately
const p3 = test(1000, false).catch(e => console.log(e));
// Await all in parallel
const r = await Promise.all([p1, p2, p3]);
// Display the results
console.log(r);
};
// Run the handler
handler();
/*
Done 1000
Reject 1000
Done 5000
Done 10000
*/
Whilst setting p1, p2 and p3 is not strictly running them in parallel, they do not hold up any execution and you can trap contextual errors with a catch.
Starting with .Net 4.5 you can use Task.Run to simply start an action:
void Foo(string args){}
...
Task.Run(() => Foo("bar"));
I was using to many await, so i was not getting response , i converted in to sync call its started working
using (var client = new HttpClient())
using (var request = new HttpRequestMessage())
{
client.DefaultRequestHeaders.Accept.Add(new MediaTypeWithQualityHeaderValue("application/json"));
request.Method = HttpMethod.Get;
request.RequestUri = new Uri(URL);
var response = client.GetAsync(URL).Result;
response.EnsureSuccessStatusCode();
string responseBody = response.Content.ReadAsStringAsync().Result;
Using ES2017 you should have this as the function declaration
async function foo() {
var response = await $.ajax({url: '...'})
return response;
}
And executing it like this.
(async function() {
try {
var result = await foo()
console.log(result)
} catch (e) {}
})()
Or the Promise syntax
foo().then(response => {
console.log(response)
}).catch(error => {
console.log(error)
})
Yet another answer...but I usually find myself in a case, when I need to load data simultaneously and put it into variables, like:
var cats = new List<Cat>();
var dog = new Dog();
var loadDataTasks = new Task[]
{
Task.Run(async () => cats = await LoadCatsAsync()),
Task.Run(async () => dog = await LoadDogAsync())
};
try
{
await Task.WhenAll(loadDataTasks);
}
catch (Exception ex)
{
// handle exception
}
A better way to write the async function would be by returning a pending Promise from the start and then handling both rejections and resolutions within the callback of the promise, rather than just spitting out a rejected promise on error. Example:
async foo(id: string): Promise<A> {
return new Promise(function(resolve, reject) {
// execute some code here
if (success) { // let's say this is a boolean value from line above
return resolve(success);
} else {
return reject(error); // this can be anything, preferably an Error object to catch the stacktrace from this function
}
});
}
Then you just chain methods on the returned promise:
async function bar () {
try {
var result = await foo("someID")
// use the result here
} catch (error) {
// handle error here
}
}
bar()
Source - this tutorial:
https://developer.mozilla.org/en-US/docs/Web/JavaScript/Reference/Global_Objects/Promise
It's much simpler to run the task on the thread pool, rather than trying to trick the scheduler to run it synchronously. That way you can be sure that it won't deadlock. Performance is affected because of the context switch.
Task<MyResult> DoSomethingAsync() { ... }
// Starts the asynchronous task on a thread-pool thread.
// Returns a proxy to the original task.
Task<MyResult> task = Task.Run(() => DoSomethingAsync());
// Will block until the task is completed...
MyResult result = task.Result;
There is also at least one library for doing native threading from within Node.js: node-webworker-threads
https://github.com/audreyt/node-webworker-threads
This basically implements the Web Worker browser API for node.js.
You may use flask-crontab module, which is quite easy.
Step 1: pip install flask-crontab
Step 2:
from flask import Flask
from flask_crontab import Crontab
app = Flask(__name__)
crontab = Crontab(app)
Step 3:
@crontab.job(minute="0", hour="6", day="*", month="*", day_of_week="*")
def my_scheduled_job():
do_something()
Step 4: On cmd, hit
flask crontab add
Done. now simply run your flask application, and you can check your function will call at 6:00 every day.
You may take reference from Here (Official DOc).
The main reason you use the default queue over the main queue is to run tasks in the background.
For instance, if I am downloading a file from the internet and I want to update the user on the progress of the download, I will run the download in the priority default queue and update the UI in the main queue asynchronously.
dispatch_async(dispatch_get_global_queue( DISPATCH_QUEUE_PRIORITY_DEFAULT, 0), ^(void){
//Background Thread
dispatch_async(dispatch_get_main_queue(), ^(void){
//Run UI Updates
});
});
You just can't return the value directly because it is an async call. An async call means it is running in the background (actually scheduled for later execution) while your code continues to execute.
You also can't have such code in the class directly. It needs to be moved into a method or the constructor.
What you can do is not to subscribe()
directly but use an operator like map()
export class DataComponent{
someMethod() {
return this.http.get(path).map(res => {
return res.json();
});
}
}
In addition, you can combine multiple .map
with the same Observables as sometimes this improves code clarity and keeps things separate. Example:
validateResponse = (response) => validate(response);
parseJson = (json) => JSON.parse(json);
fetchUnits() {
return this.http.get(requestUrl).map(this.validateResponse).map(this.parseJson);
}
This way an observable will be return the caller can subscribe to
export class DataComponent{
someMethod() {
return this.http.get(path).map(res => {
return res.json();
});
}
otherMethod() {
this.someMethod().subscribe(data => this.data = data);
}
}
The caller can also be in another class. Here it's just for brevity.
data => this.data = data
and
res => return res.json()
are arrow functions. They are similar to normal functions. These functions are passed to subscribe(...)
or map(...)
to be called from the observable when data arrives from the response.
This is why data can't be returned directly, because when someMethod()
is completed, the data wasn't received yet.
If you don't insist on using pure Javascript, you can build a sequential code in Livescript and it looks pretty good. You might want to take a look at this example:
# application
do
i = 3
console.log td!, "start"
<- :lo(op) ->
console.log td!, "hi #{i}"
i--
<- wait-for \something
if i is 0
return op! # break
lo(op)
<- sleep 1500ms
<- :lo(op) ->
console.log td!, "hello #{i}"
i++
if i is 3
return op! # break
<- sleep 1000ms
lo(op)
<- sleep 0
console.log td!, "heyy"
do
a = 8
<- :lo(op) ->
console.log td!, "this runs in parallel!", a
a--
go \something
if a is 0
return op! # break
<- sleep 500ms
lo(op)
Output:
0ms : start
2ms : hi 3
3ms : this runs in parallel! 8
3ms : hi 2
505ms : this runs in parallel! 7
505ms : hi 1
1007ms : this runs in parallel! 6
1508ms : this runs in parallel! 5
2009ms : this runs in parallel! 4
2509ms : hello 0
2509ms : this runs in parallel! 3
3010ms : this runs in parallel! 2
3509ms : hello 1
3510ms : this runs in parallel! 1
4511ms : hello 2
4511ms : heyy
This is a Task that is returning a Task of type String (C# anonymous function or in other word a delegation is used 'Func')
public static async Task<string> MyTask()
{
//C# anonymous AsyncTask
return await Task.FromResult<string>(((Func<string>)(() =>
{
// your code here
return "string result here";
}))());
}
Explanation of shutdown and close: Graceful shutdown (msdn)
Shutdown (in your case) indicates to the other end of the connection there is no further intention to read from or write to the socket. Then close frees up any memory associated with the socket.
Omitting shutdown may cause the socket to linger in the OSs stack until the connection has been closed gracefully.
IMO the names 'shutdown' and 'close' are misleading, 'close' and 'destroy' would emphasise their differences.
You want to do more than just getState
. You want to react to changes in the store.
If you aren't using react-redux, you can do this:
function rerender() {
const state = store.getState();
render(
<div>
{ state.items.map((item) => <p> {item.title} </p> )}
</div>,
document.getElementById('app')
);
}
// subscribe to store
store.subscribe(rerender);
// do initial render
rerender();
// dispatch more actions and view will update
But better is to use react-redux. In this case you use the Provider like you mentioned, but then use connect to connect your component to the store.
The following snippet shows a way to ensure the awaited method completes before returning to the caller. HOWEVER, I wouldn't say it's good practice. Please edit my answer with explanations if you think otherwise.
public async Task AnAsyncMethodThatCompletes()
{
await SomeAsyncMethod();
DoSomeMoreStuff();
await Task.Factory.StartNew(() => { }); // <-- This line here, at the end
}
await AnAsyncMethodThatCompletes();
Console.WriteLine("AnAsyncMethodThatCompletes() completed.")
This is impossible as you cannot return from an asynchronous call inside a synchronous method.
In this case you need to pass a callback to foo that will receive the return value
function foo(address, fn){
geocoder.geocode( { 'address': address}, function(results, status) {
fn(results[0].geometry.location);
});
}
foo("address", function(location){
alert(location); // this is where you get the return value
});
The thing is, if an inner function call is asynchronous, then all the functions 'wrapping' this call must also be asynchronous in order to 'return' a response.
If you have a lot of callbacks you might consider taking the plunge and use a promise library like Q.
You want to use the gesturestart
, gesturechange
, and gestureend
events. These get triggered any time 2 or more fingers touch the screen.
Depending on what you need to do with the pinch gesture, your approach will need to be adjusted. The scale
multiplier can be examined to determine how dramatic the user's pinch gesture was. See Apple's TouchEvent documentation for details about how the scale
property will behave.
node.addEventListener('gestureend', function(e) {
if (e.scale < 1.0) {
// User moved fingers closer together
} else if (e.scale > 1.0) {
// User moved fingers further apart
}
}, false);
You could also intercept the gesturechange
event to detect a pinch as it happens if you need it to make your app feel more responsive.
select @count = sum(data) from
(
select count(*) as data from #tempregion
union
select count(*) as data from #tempmetro
union
select count(*) as data from #tempcity
union
select count(*) as data from #tempzips
) a
You can use these Extension Methods: (Save as PartialWithScript.cs)
namespace System.Web.Mvc.Html
{
public static class PartialWithScript
{
public static void RenderPartialWithScript(this HtmlHelper htmlHelper, string partialViewName)
{
if (htmlHelper.ViewBag.ScriptPartials == null)
{
htmlHelper.ViewBag.ScriptPartials = new List<string>();
}
if (!htmlHelper.ViewBag.ScriptPartials.Contains(partialViewName))
{
htmlHelper.ViewBag.ScriptPartials.Add(partialViewName);
}
htmlHelper.ViewBag.ScriptPartialHtml = true;
htmlHelper.RenderPartial(partialViewName);
}
public static void RenderPartialScripts(this HtmlHelper htmlHelper)
{
if (htmlHelper.ViewBag.ScriptPartials != null)
{
htmlHelper.ViewBag.ScriptPartialHtml = false;
foreach (string partial in htmlHelper.ViewBag.ScriptPartials)
{
htmlHelper.RenderPartial(partial);
}
}
}
}
}
Use like this:
Example partial: (_MyPartial.cshtml) Put the html in the if, and the js in the else.
@if (ViewBag.ScriptPartialHtml ?? true)
<p>I has htmls</p>
}
else {
<script type="text/javascript">
alert('I has javascripts');
</script>
}
In your _Layout.cshtml, or wherever you want the scripts from the partials on to be rendered, put the following (once): It will render only the javascript of all partials on the current page at this location.
@{ Html.RenderPartialScripts(); }
Then to use your partial, simply do this: It will render only the html at this location.
@{Html.RenderPartialWithScript("~/Views/MyController/_MyPartial.cshtml");}
String.Empty
and string.Empty
are equivalent. String
is the BCL class name; string
is its C# alias (or shortcut, if you will). Same as with Int32
and int
. See the docs for more examples.
As far as ""
is concerned, I'm not really sure.
Personally, I always use string.Empty
.
I see that at least you're not providing the same path as others in file_paths.xml. So please make sure you provide the exact the same package name or path in 3 places including:
android:authorities
attribute in manifestpath
attribute in file_paths.xmlauthority
argument when calling FileProvider.getUriForFile().By default, the access modifier for a class is internal
. That means to say, a class is accessible within the same assembly. But if we want the class to be accessed from other assemblies then it has to be made public.
<select id="test" name="form_select" onchange="showDiv()">
<option value="0">No</option>
<option value ="1">Yes</option>
</select>
<div id="hidden_div" style="display: none;">Hello hidden content</div>
<script>
function showDiv(){
getSelectValue = document.getElementById("test").value;
if(getSelectValue == "1"){
document.getElementById("hidden_div").style.display="block";
}else{
document.getElementById("hidden_div").style.display="none";
}
}
</script>
In most cases the slug should not change, so you really only want to calculate it on first save:
class Test(models.Model):
q = models.CharField(max_length=30)
s = models.SlugField(editable=False) # hide from admin
def save(self):
if not self.id:
self.s = slugify(self.q)
super(Test, self).save()
Calendar has a set() method that can set the year, month, and day-of-month in one call:
myCal.set( theYear, theMonth, theDay );
I just wanted to illustrate that the built-in solutions (SQL-only) are not always the best ones. At first I thought that because Django's QuerySet.objects.order_by
method accepts multiple arguments, you could easily chain them:
ordered_authors = Author.objects.order_by('-score', 'last_name')[:30]
But, it does not work as you would expect. Case in point, first is a list of presidents sorted by score (selecting top 5 for easier reading):
>>> auths = Author.objects.order_by('-score')[:5]
>>> for x in auths: print x
...
James Monroe (487)
Ulysses Simpson (474)
Harry Truman (471)
Benjamin Harrison (467)
Gerald Rudolph (464)
Using Alex Martelli's solution which accurately provides the top 5 people sorted by last_name
:
>>> for x in sorted(auths, key=operator.attrgetter('last_name')): print x
...
Benjamin Harrison (467)
James Monroe (487)
Gerald Rudolph (464)
Ulysses Simpson (474)
Harry Truman (471)
And now the combined order_by
call:
>>> myauths = Author.objects.order_by('-score', 'last_name')[:5]
>>> for x in myauths: print x
...
James Monroe (487)
Ulysses Simpson (474)
Harry Truman (471)
Benjamin Harrison (467)
Gerald Rudolph (464)
As you can see it is the same result as the first one, meaning it doesn't work as you would expect.
The python seaborn module is based on matplotlib, and produces a very nice heatmap.
Below is an implementation with seaborn, designed for the ipython/jupyter notebook.
import pandas as pd
import matplotlib.pyplot as plt
import seaborn as sns
%matplotlib inline
# import the data directly into a pandas dataframe
nba = pd.read_csv("http://datasets.flowingdata.com/ppg2008.csv", index_col='Name ')
# remove index title
nba.index.name = ""
# normalize data columns
nba_norm = (nba - nba.mean()) / (nba.max() - nba.min())
# relabel columns
labels = ['Games', 'Minutes', 'Points', 'Field goals made', 'Field goal attempts', 'Field goal percentage', 'Free throws made',
'Free throws attempts', 'Free throws percentage','Three-pointers made', 'Three-point attempt', 'Three-point percentage',
'Offensive rebounds', 'Defensive rebounds', 'Total rebounds', 'Assists', 'Steals', 'Blocks', 'Turnover', 'Personal foul']
nba_norm.columns = labels
# set appropriate font and dpi
sns.set(font_scale=1.2)
sns.set_style({"savefig.dpi": 100})
# plot it out
ax = sns.heatmap(nba_norm, cmap=plt.cm.Blues, linewidths=.1)
# set the x-axis labels on the top
ax.xaxis.tick_top()
# rotate the x-axis labels
plt.xticks(rotation=90)
# get figure (usually obtained via "fig,ax=plt.subplots()" with matplotlib)
fig = ax.get_figure()
# specify dimensions and save
fig.set_size_inches(15, 20)
fig.savefig("nba.png")
The output looks like this: I used the matplotlib Blues color map, but personally find the default colors quite beautiful. I used matplotlib to rotate the x-axis labels, as I couldn't find the seaborn syntax. As noted by grexor, it was necessary to specify the dimensions (fig.set_size_inches) by trial and error, which I found a bit frustrating.
As noted by Paul H, you can easily add the values to heat maps (annot=True), but in this case I didn't think it improved the figure. Several code snippets were taken from the excellent answer by joelotz.
This problem occurs because the Web site does not have the Directory Browsing
feature enabled, and the default document is not configured. To resolve this problem, use one of the following methods. To resolve this problem, I followed the steps in Method 1 as mentioned in the MS Support page and its the recommended method.
Method 1: Enable the Directory Browsing feature in IIS (Recommended)
Start IIS Manager. To do this, click Start, click Run, type inetmgr.exe, and then click OK.
In IIS Manager, expand server name, expand Web sites, and then click the website that you want to modify.
In the Features view, double-click Directory Browsing.
In the Actions pane, click Enable.
If that does not work for, you might be having different problem than just a Directory listing issue. So follow the below step,
Method 2: Add a default document
To resolve this problem, follow these steps:
Method 3: Enable the Directory Browsing feature in IIS Express
Note This method is for the web developers who experience the issue when they use IIS Express.
Follow these steps:
Open a command prompt, and then go to the IIS Express folder on your computer.
For example, go to the following folder in a command prompt:
C:\Program Files\IIS Express
Type the following command, and then press Enter:
appcmd set config /section:system.webServer/directoryBrowse /enabled:true
Here is an example on how to center an object vertically with jQuery:
var div= $('#div_SomeDivYouWantToAdjust');
div.css("top", ($(window).height() - div.height())/2 + 'px');
But you could easily change that to whatever your needs are.
Since the question Something like `this.class` instead of `ClassName.class`? is marked as a duplicate for this one (which is arguable because that question is about the class rather than class name), I'm posting the answer here:
class MyService {
private static Class thisClass = MyService.class;
// or:
//private static Class thisClass = new Object() { }.getClass().getEnclosingClass();
...
static void startService(Context context) {
Intent i = new Intent(context, thisClass);
context.startService(i);
}
}
It is important to define thisClass
as private because:
1) it must not be inherited: derived classes must either define their own thisClass
or produce an error message
2) references from other classes should be done as ClassName.class
rather than ClassName.thisClass
.
With thisClass
defined, access to the class name becomes:
thisClass.getName()
Here's an updated Swift 3 version based on Noodles answer
func cropping(to rect: CGRect) -> UIImage? {
if let cgCrop = cgImage?.cropping(to: rect) {
return UIImage(cgImage: cgCrop)
}
else if let ciCrop = ciImage?.cropping(to: rect) {
return UIImage(ciImage: ciCrop)
}
return nil
}
To get request.form
as a normal dictionary , use request.form.to_dict(flat=False)
.
To return JSON data for an API, pass it to jsonify
.
This example returns form data as JSON data.
@app.route('/form_to_json', methods=['POST'])
def form_to_json():
data = request.form.to_dict(flat=False)
return jsonify(data)
Here's an example of POST form data with curl, returning as JSON:
$ curl http://127.0.0.1:5000/data -d "name=ivanleoncz&role=Software Developer"
{
"name": "ivanleoncz",
"role": "Software Developer"
}
I wrote and released a Windows application that specifically solves the problem of comparing and merging XML files.
Project: Merge can perform two and three way comparisons and merges of any XML file (where two of the files are considered to be independent revisions of a common base file). You can instruct it to identify elements within the input files by attribute values, or the content of child elements, among other things.
It is fully controllable via the command line and can also generate text reports containing the differences between the files.
DISCLAIMER: this solution is not using Header.
If someone is looking for a lazy-lazy manner (also in WebApi), I'd suggest:
public YourResult Authorize([FromBody]BasicAuthCredentials credentials)
You are not getting from header, but at least you have an easy alternative. You can always check the object for null and fallback to header mechanism.
You can use this code:
int count;
try {
URL url = new URL(f_url[0]);
URLConnection conection = url.openConnection();
conection.setConnectTimeout(TIME_OUT);
conection.connect();
// Getting file length
int lenghtOfFile = conection.getContentLength();
// Create a Input stream to read file - with 8k buffer
InputStream input = new BufferedInputStream(url.openStream(),
8192);
// Output stream to write file
OutputStream output = new FileOutputStream(
"/sdcard/9androidnet.jpg");
byte data[] = new byte[1024];
long total = 0;
while ((count = input.read(data)) != -1) {
total += count;
// publishing the progress....
// After this onProgressUpdate will be called
publishProgress("" + (int) ((total * 100) / lenghtOfFile));
// writing data to file
output.write(data, 0, count);
}
// flushing output
output.flush();
// closing streams
output.close();
input.close();
} catch (SocketTimeoutException e) {
connectionTimeout=true;
} catch (Exception e) {
Log.e("Error: ", e.getMessage());
}
Connect with your mongodb instance from local system
It ll let you know all connected clients and their details
db.currentOp(true)
Since we have a virtual address space of 2^32 and each page size is 2^12, we can store (2^32/2^12) = 2^20 pages. Since each entry into this page table has an address of size 4 bytes, then we have 2^20*4 = 4MB. So the page table takes up 4MB in memory.
You'll need to clear out your cache to have it completely wiped. this help page from git will help you out. (it helped me) http://help.github.com/remove-sensitive-data/
Well, without generics, static interfaces are useless because all static method calls are resolved at compile time. So, there's no real use for them.
With generics, they have use -- with or without a default implementation. Obviously there would need to be overriding and so on. However, my guess is that such usage wasn't very OO (as the other answers point out obtusely) and hence wasn't considered worth the effort they'd require to implement usefully.
Since you asked a similar question, let's take it to step by step. It's a bit longer, but it may save you much more time than I have spent on writing this:
Property is an OOP feature designed for clean separation of client code. For example, in some e-shop you might have objects like this:
function Product(name,price) {
this.name = name;
this.price = price;
this.discount = 0;
}
var sneakers = new Product("Sneakers",20); // {name:"Sneakers",price:20,discount:0}
var tshirt = new Product("T-shirt",10); // {name:"T-shirt",price:10,discount:0}
Then in your client code (the e-shop), you can add discounts to your products:
function badProduct(obj) { obj.discount+= 20; ... }
function generalDiscount(obj) { obj.discount+= 10; ... }
function distributorDiscount(obj) { obj.discount+= 15; ... }
Later, the e-shop owner might realize that the discount can't be greater than say 80%. Now you need to find EVERY occurrence of the discount modification in the client code and add a line
if(obj.discount>80) obj.discount = 80;
Then the e-shop owner may further change his strategy, like "if the customer is reseller, the maximal discount can be 90%". And you need to do the change on multiple places again plus you need to remember to alter these lines anytime the strategy is changed. This is a bad design. That's why encapsulation is the basic principle of OOP. If the constructor was like this:
function Product(name,price) {
var _name=name, _price=price, _discount=0;
this.getName = function() { return _name; }
this.setName = function(value) { _name = value; }
this.getPrice = function() { return _price; }
this.setPrice = function(value) { _price = value; }
this.getDiscount = function() { return _discount; }
this.setDiscount = function(value) { _discount = value; }
}
Then you can just alter the getDiscount
(accessor) and setDiscount
(mutator) methods. The problem is that most of the members behave like common variables, just the discount needs special care here. But good design requires encapsulation of every data member to keep the code extensible. So you need to add lots of code that does nothing. This is also a bad design, a boilerplate antipattern. Sometimes you can't just refactor the fields to methods later (the eshop code may grow large or some third-party code may depend on the old version), so the boilerplate is lesser evil here. But still, it is evil. That's why properties were introduced into many languages. You could keep the original code, just transform the discount member into a property with get
and set
blocks:
function Product(name,price) {
this.name = name;
this.price = price;
//this.discount = 0; // <- remove this line and refactor with the code below
var _discount; // private member
Object.defineProperty(this,"discount",{
get: function() { return _discount; },
set: function(value) { _discount = value; if(_discount>80) _discount = 80; }
});
}
// the client code
var sneakers = new Product("Sneakers",20);
sneakers.discount = 50; // 50, setter is called
sneakers.discount+= 20; // 70, setter is called
sneakers.discount+= 20; // 80, not 90!
alert(sneakers.discount); // getter is called
Note the last but one line: the responsibility for correct discount value was moved from the client code (e-shop definition) to the product definition. The product is responsible for keeping its data members consistent. Good design is (roughly said) if the code works the same way as our thoughts.
So much about properties. But javascript is different from pure Object-oriented languages like C# and codes the features differently:
In C#, transforming fields into properties is a breaking change, so public fields should be coded as Auto-Implemented Properties if your code might be used in the separately compiled client.
In Javascript, the standard properties (data member with getter and setter described above) are defined by accessor descriptor (in the link you have in your question). Exclusively, you can use data descriptor (so you can't use i.e. value and set on the same property):
Both descriptors can have these members:
for(var i in theObject)
; if false, it will not be iterated, but it is still accessible as public* unless in strict mode - in that case JS stops execution with TypeError unless it is caught in try-catch block
To read these settings, use Object.getOwnPropertyDescriptor()
.
Learn by example:
var o = {};
Object.defineProperty(o,"test",{
value: "a",
configurable: true
});
console.log(Object.getOwnPropertyDescriptor(o,"test")); // check the settings
for(var i in o) console.log(o[i]); // nothing, o.test is not enumerable
console.log(o.test); // "a"
o.test = "b"; // o.test is still "a", (is not writable, no error)
delete(o.test); // bye bye, o.test (was configurable)
o.test = "b"; // o.test is "b"
for(var i in o) console.log(o[i]); // "b", default fields are enumerable
If you don't wish to allow the client code such cheats, you can restrict the object by three levels of confinement:
Object.isExtensible(<yourObject>)
to check if the method was used on the object. The prevention is shallow (read below).configurable: false
to all properties). Use Object.isSealed(<yourObject>)
to detect this feature on the object. The seal is shallow (read below).writable: false
to all properties with data descriptor). Setter's writable property is not affected (since it doesn't have one). The freeze is shallow: it means that if the property is Object, its properties ARE NOT frozen (if you wish to, you should perform something like "deep freeze", similar to deep copy - cloning). Use Object.isFrozen(<yourObject>)
to detect it.You don't need to bother with this if you write just a few lines fun. But if you want to code a game (as you mentioned in the linked question), you should care about good design. Try to google something about antipatterns and code smell. It will help you to avoid situations like "Oh, I need to completely rewrite my code again!", it can save you months of despair if you want to code a lot. Good luck.
if you find the same problem in windows server, then you need to run the command line with enough permission, such as administrator permission.
You cannot expect to parse a date with a SimpleDateFormat that is set up with a different format.
To parse your "Thu Jun 18 20:56:02 EDT 2009" date string you need a SimpleDateFormat like this (roughly):
SimpleDateFormat parser=new SimpleDateFormat("EEE MMM d HH:mm:ss zzz yyyy");
Use this to parse the string into a Date, and then your other SimpleDateFormat to turn that Date into the format you want.
String input = "Thu Jun 18 20:56:02 EDT 2009";
SimpleDateFormat parser = new SimpleDateFormat("EEE MMM d HH:mm:ss zzz yyyy");
Date date = parser.parse(input);
SimpleDateFormat formatter = new SimpleDateFormat("yyyy-MM-dd");
String formattedDate = formatter.format(date);
...
JavaDoc: http://docs.oracle.com/javase/7/docs/api/java/text/SimpleDateFormat.html
How can I create a copy of an object in Python?
So, if I change values of the fields of the new object, the old object should not be affected by that.
You mean a mutable object then.
In Python 3, lists get a copy
method (in 2, you'd use a slice to make a copy):
>>> a_list = list('abc')
>>> a_copy_of_a_list = a_list.copy()
>>> a_copy_of_a_list is a_list
False
>>> a_copy_of_a_list == a_list
True
Shallow copies are just copies of the outermost container.
list.copy
is a shallow copy:
>>> list_of_dict_of_set = [{'foo': set('abc')}]
>>> lodos_copy = list_of_dict_of_set.copy()
>>> lodos_copy[0]['foo'].pop()
'c'
>>> lodos_copy
[{'foo': {'b', 'a'}}]
>>> list_of_dict_of_set
[{'foo': {'b', 'a'}}]
You don't get a copy of the interior objects. They're the same object - so when they're mutated, the change shows up in both containers.
Deep copies are recursive copies of each interior object.
>>> lodos_deep_copy = copy.deepcopy(list_of_dict_of_set)
>>> lodos_deep_copy[0]['foo'].add('c')
>>> lodos_deep_copy
[{'foo': {'c', 'b', 'a'}}]
>>> list_of_dict_of_set
[{'foo': {'b', 'a'}}]
Changes are not reflected in the original, only in the copy.
Immutable objects do not usually need to be copied. In fact, if you try to, Python will just give you the original object:
>>> a_tuple = tuple('abc')
>>> tuple_copy_attempt = a_tuple.copy()
Traceback (most recent call last):
File "<stdin>", line 1, in <module>
AttributeError: 'tuple' object has no attribute 'copy'
Tuples don't even have a copy method, so let's try it with a slice:
>>> tuple_copy_attempt = a_tuple[:]
But we see it's the same object:
>>> tuple_copy_attempt is a_tuple
True
Similarly for strings:
>>> s = 'abc'
>>> s0 = s[:]
>>> s == s0
True
>>> s is s0
True
and for frozensets, even though they have a copy
method:
>>> a_frozenset = frozenset('abc')
>>> frozenset_copy_attempt = a_frozenset.copy()
>>> frozenset_copy_attempt is a_frozenset
True
Immutable objects should be copied if you need a mutable interior object copied.
>>> tuple_of_list = [],
>>> copy_of_tuple_of_list = tuple_of_list[:]
>>> copy_of_tuple_of_list[0].append('a')
>>> copy_of_tuple_of_list
(['a'],)
>>> tuple_of_list
(['a'],)
>>> deepcopy_of_tuple_of_list = copy.deepcopy(tuple_of_list)
>>> deepcopy_of_tuple_of_list[0].append('b')
>>> deepcopy_of_tuple_of_list
(['a', 'b'],)
>>> tuple_of_list
(['a'],)
As we can see, when the interior object of the copy is mutated, the original does not change.
Custom objects usually store data in a __dict__
attribute or in __slots__
(a tuple-like memory structure.)
To make a copyable object, define __copy__
(for shallow copies) and/or __deepcopy__
(for deep copies).
from copy import copy, deepcopy
class Copyable:
__slots__ = 'a', '__dict__'
def __init__(self, a, b):
self.a, self.b = a, b
def __copy__(self):
return type(self)(self.a, self.b)
def __deepcopy__(self, memo): # memo is a dict of id's to copies
id_self = id(self) # memoization avoids unnecesary recursion
_copy = memo.get(id_self)
if _copy is None:
_copy = type(self)(
deepcopy(self.a, memo),
deepcopy(self.b, memo))
memo[id_self] = _copy
return _copy
Note that deepcopy
keeps a memoization dictionary of id(original)
(or identity numbers) to copies. To enjoy good behavior with recursive data structures, make sure you haven't already made a copy, and if you have, return that.
So let's make an object:
>>> c1 = Copyable(1, [2])
And copy
makes a shallow copy:
>>> c2 = copy(c1)
>>> c1 is c2
False
>>> c2.b.append(3)
>>> c1.b
[2, 3]
And deepcopy
now makes a deep copy:
>>> c3 = deepcopy(c1)
>>> c3.b.append(4)
>>> c1.b
[2, 3]
Here is a comparison with np.einsum
to show how the indices are projected
np.allclose(np.einsum('ijk,ijk->ijk', a,b), a*b) # True
np.allclose(np.einsum('ijk,ikl->ijl', a,b), a@b) # True
np.allclose(np.einsum('ijk,lkm->ijlm',a,b), a.dot(b)) # True
I'd like to provide an alternate solution, a robust solution similar to what I am about to propose was required in the latest version of ggtern, since introducing the canvas rotation feature.
Basically, you need to determine the relative positions using trigonometry, by building a function which returns an element_text
object, given angle (ie degrees) and positioning (ie one of x,y,top or right) information.
#Load Required Libraries
library(ggplot2)
library(gridExtra)
#Build Function to Return Element Text Object
rotatedAxisElementText = function(angle,position='x'){
angle = angle[1];
position = position[1]
positions = list(x=0,y=90,top=180,right=270)
if(!position %in% names(positions))
stop(sprintf("'position' must be one of [%s]",paste(names(positions),collapse=", ")),call.=FALSE)
if(!is.numeric(angle))
stop("'angle' must be numeric",call.=FALSE)
rads = (angle - positions[[ position ]])*pi/180
hjust = 0.5*(1 - sin(rads))
vjust = 0.5*(1 + cos(rads))
element_text(angle=angle,vjust=vjust,hjust=hjust)
}
Frankly, in my opinion, I think that an 'auto' option should be made available in ggplot2
for the hjust
and vjust
arguments, when specifying the angle, anyway, lets demonstrate how the above works.
#Demonstrate Usage for a Variety of Rotations
df = data.frame(x=0.5,y=0.5)
plots = lapply(seq(0,90,length.out=4),function(a){
ggplot(df,aes(x,y)) +
geom_point() +
theme(axis.text.x = rotatedAxisElementText(a,'x'),
axis.text.y = rotatedAxisElementText(a,'y')) +
labs(title = sprintf("Rotated %s",a))
})
grid.arrange(grobs=plots)
Which produces the following:
You have to provide one of the various SLF4J implementation .jar files in the classpath, as well as the interface .jar file. This is documented.
Try:
chcp 65001
which will change the code page to UTF-8. Also, you need to use Lucida console fonts.
To emphasize a point made by @MatteoItalia, the efficiency difference is where the data is stored. Heap memory (required with vector
) requires a call to the system to allocate memory and this can be expensive if you are counting cycles. Stack memory (possible for array
) is virtually "zero-overhead" in terms of time, because the memory is allocated by just adjusting the stack pointer and it is done just once on entry to a function. The stack also avoids memory fragmentation. To be sure, std::array
won't always be on the stack; it depends on where you allocate it, but it will still involve one less memory allocation from the heap compared to vector. If you have a
definitely use a std::array
over a vector. If any of those requirements is not true, then use a std::vector
.
Question 1:
vectorOfGamers.push_back(Player)
This is problematic because you cannot directly push a class name into a vector. You can either push an object of class into the vector or push reference or pointer to class type into the vector. For example:
vectorOfGamers.push_back(Player(name, id))
//^^assuming name and id are parameters to the vector, call Player constructor
//^^In other words, push `instance` of Player class into vector
Question 2:
These 3 classes derives from Gamer. Can I create vector to hold objects of Dealer, Bot and Player at the same time? How do I do that?
Yes you can. You can create a vector of pointers that points to the base class Gamer
.
A good choice is to use a vector of smart_pointer
, therefore, you do not need to manage pointer memory by yourself. Since the other three classes are derived from Gamer
, based on polymorphism, you can assign derived class objects to base class pointers. You may find more information from this post: std::vector of objects / pointers / smart pointers to pass objects (buss error: 10)?
In the same shell, hold ctrl key and press keys p then q
The date solution is much better than others, I had to increment the time on 50 like that this is a Tweeter example:
//on click or your event handler..
var twMessage = "Your Message to share";
var now = new Date().valueOf();
setTimeout(function () {
if (new Date().valueOf() - now > 100) return;
var twitterUrl = "https://twitter.com/share?text="+twMessage;
window.open(twitterUrl, '_blank');
}, 50);
window.location = "twitter://post?message="+twMessage;
the only problem on Mobile IOS Safari is when you don't have the app installed on device, and so Safari show an alert that autodismiss when the new url is opened, anyway is a good solution for now!
cv:Mat mat;
int rows = mat.rows;
int cols = mat.cols;
cv::Size s = mat.size();
rows = s.height;
cols = s.width;
Also note that stride >= cols; this means that actual size of the row can be greater than element size x cols. This is different from the issue of continuous Mat and is related to data alignment.
MockitoAnnotations & the runner have been well discussed above, so I'm going to throw in my tuppence for the unloved:
XXX mockedXxx = mock(XXX.class);
I use this because I find it a little bit more descriptive and I prefer (not out right ban) unit tests not to use member variables as I like my tests to be (as much as they can be) self contained.
Omit the parenthesis:
ALTER TABLE User
ADD CONSTRAINT userProperties
FOREIGN KEY(properties)
REFERENCES Properties(ID)
if your using jellybean just start cmd, type adb devices to make sure your readable, type adb pull sdcard/ sdcard_(the date or extra) <---this file needs to be made in adb directory beforehand. PROFIT!
In other versions type adb pull mnt/sdcard/ sdcard_(the date or extra)
Remember to make file or your either gonna have a mess or it wont work.
Using VS 2010:
Let's say you have a Windows.Forms project. You add a UserControl (say MyControl) to the project, and design it all up. Now you want to add it to your toolbox.
As soon as the project is successfully built once, it will appear in your Framework Components. Right click the Toolbox to get the context menu, select "Choose Items...", and browse to the name of your control (MyControl) under the ".NET Framework Components" tab.
Advantage over using dlls: you can edit the controls in the same project as your form, and the form will build with the new controls. However, the control will only be avilable to this project.
Note: If the control has build errors, resolve them before moving on to the containing forms, or the designer has a heart attack.
Check if your form's action
URL includes the www
part of the domain, while the original page you have opened is viewed without www
.
Typically done for Canonical Urls..
I struggled for hours before stumbling upon this article and found the hint of Cross Domain.
If you want to check if both objects have the same properties name, you can do this:
function hasSameProps( obj1, obj2 ) {
return Object.keys( obj1 ).every( function( prop ) {
return obj2.hasOwnProperty( prop );
});
}
var obj1 = { prop1: 'hello', prop2: 'world', prop3: [1,2,3,4,5] },
obj2 = { prop1: 'hello', prop2: 'world', prop3: [1,2,3,4,5] };
console.log(hasSameProps(obj1, obj2));
In this way you are sure to check only iterable and accessible properties of both the objects.
EDIT - 2013.04.26:
The previous function can be rewritten in the following way:
function hasSameProps( obj1, obj2 ) {
var obj1Props = Object.keys( obj1 ),
obj2Props = Object.keys( obj2 );
if ( obj1Props.length == obj2Props.length ) {
return obj1Props.every( function( prop ) {
return obj2Props.indexOf( prop ) >= 0;
});
}
return false;
}
In this way we check that both the objects have the same number of properties (otherwise the objects haven't the same properties, and we must return a logical false) then, if the number matches, we go to check if they have the same properties.
Bonus
A possible enhancement could be to introduce also a type checking to enforce the match on every property.
There are the following ways of pressing keys - C#:
Driver.FindElement(By.Id("Value")).SendKeys(Keys.Return);
OR
OpenQA.Selenium.Interactions.Actions action = new OpenQA.Selenium.Interactions.Actions(Driver);
action.SendKeys(OpenQA.Selenium.Keys.Escape);
OR
IWebElement body = GlobalDriver.FindElement(By.TagName("body"));
body.SendKeys(Keys.Escape);
There are many possibilities. Simplest way is to just use pgAdmin and get this from SQL window. However if you want to get this programmatically then examinate pg_proc
and pg_trigger
system catalogs or routines
and triggers
views from information schema (that's SQL standard way, but it might not cover all features especially PostgreSQL-specific). For example:
SELECT
routine_definition
FROM
information_schema.routines
WHERE
specific_schema LIKE 'public'
AND routine_name LIKE 'functionName';
Don't you try it with that program? It'll goto finally block and executing the finally block, but, the exception won't be handled. But, that exception can be overruled in the finally block!
Take a peek at the ng-click
directive source:
...
compile: function($element, attr) {
var fn = $parse(attr[directiveName]);
return function(scope, element, attr) {
element.on(lowercase(name), function(event) {
scope.$apply(function() {
fn(scope, {$event:event});
});
});
};
}
It shows how the event
object is being passed on to the ng-click
expression, using $event
as a name of the parameter. This is done by the $parse service, which doesn't allow for the parameters to bleed into the target scope, which means the answer is no, you can't access the $event
object any other way but through the callback parameter.
How about
[@"7" intValue];
Additionally if you want an NSNumber
you could do
NSNumberFormatter *numberFormatter = [[NSNumberFormatter alloc] init];
[numberFormatter numberFromString:@"7"];
Do configure --help
and see what other options are available.
It is very common to provide different options to override different locations. By standard, --prefix
overrides all of them, so you need to override config location after specifying the prefix. This course of actions usually works for every automake-based project.
The worse case scenario is when you need to modify the configure script, or even worse, generated makefiles and config.h headers. But yeah, for Xfce you can try something like this:
./configure --prefix=/home/me/somefolder/mybuild/output/target --sysconfdir=/etc
I believe that should do it.
You could try this
Calendar today = Calendar.getInstance ();
today.add(Calendar.DAY_OF_YEAR, 0);
today.set(Calendar.HOUR_OF_DAY, hrs);
today.set(Calendar.MINUTE, mins );
today.set(Calendar.SECOND, 0);
and you could use today.getTime()
to retrieve value and compare.
The problem is that the timer
variable is local, and its value is lost after each function call.
You need to persist it, you can put it outside the function, or if you don't want to expose the variable as global, you can store it in a closure, e.g.:
var endAndStartTimer = (function () {
var timer; // variable persisted here
return function () {
window.clearTimeout(timer);
//var millisecBeforeRedirect = 10000;
timer = window.setTimeout(function(){alert('Hello!');},10000);
};
})();
LinearLayout layout = (LinearLayout)findViewById(R.id.layout);
View child = getLayoutInflater().inflate(R.layout.child, null);
layout.addView(child);
Let's assume that you are supposed to write a program to control a nuclear power-plant. It is pretty obvious that even the most minor mistake could have catastrophic results, therefore your code has to be bug-free (assuming that the JVM is bug-free for the sake of the argument).
Java is not a verifiable language, which means: you cannot calculate that the result of your operation will be perfect. The main reason for this are pointers: they can point anywhere or nowhere, therefore they cannot be calculated to be of this exact value, at least not within a reasonable span of code. Given this problem, there is no way to prove that your code is correct at a whole. But what you can do is to prove that you at least find every bug when it happens.
This idea is based on the Design-by-Contract (DbC) paradigm: you first define (with mathematical precision) what your method is supposed to do, and then verify this by testing it during actual execution. Example:
// Calculates the sum of a (int) + b (int) and returns the result (int).
int sum(int a, int b) {
return a + b;
}
While this is pretty obvious to work fine, most programmers will not see the hidden bug inside this one (hint: the Ariane V crashed because of a similar bug). Now DbC defines that you must always check the input and output of a function to verify that it worked correctly. Java can do this through assertions:
// Calculates the sum of a (int) + b (int) and returns the result (int).
int sum(int a, int b) {
assert (Integer.MAX_VALUE - a >= b) : "Value of " + a + " + " + b + " is too large to add.";
final int result = a + b;
assert (result - a == b) : "Sum of " + a + " + " + b + " returned wrong sum " + result;
return result;
}
Should this function now ever fail, you will notice it. You will know that there is a problem in your code, you know where it is and you know what caused it (similar to Exceptions). And what is even more important: you stop executing right when it happens to prevent any further code to work with wrong values and potentially cause damage to whatever it controls.
Java Exceptions are a similar concept, but they fail to verify everything. If you want even more checks (at the cost of execution speed) you need to use assertions. Doing so will bloat your code, but you can in the end deliver a product at a surprisingly short development time (the earlier you fix a bug, the lower the cost). And in addition: if there is any bug inside your code, you will detect it. There is no way of a bug slipping-through and cause issues later.
This still is not a guarantee for bug-free code, but it is much closer to that, than usual programs.
In your destination field you want to use VLOOKUP like so:
=VLOOKUP(Sheet1!A1:A100,Sheet2!A1:F100,6,FALSE)
VLOOKUP Arguments:
new moment(timeStamp,'yyyyMMddHHmmssfff').toDate()
If you're coding in an ASP.NET MVC Controller, use
using Microsoft.AspNet.Identity;
...
User.Identity.GetUserId();
Worth mentioning that User.Identity.IsAuthenticated
and User.Identity.Name
will work without adding the above mentioned using
statement. But GetUserId()
won't be present without it.
If you're in a class other than a Controller, use
HttpContext.Current.User.Identity.GetUserId();
In the default template of MVC 5, user ID is a GUID stored as a string.
No best practice yet, but found some valuable info on extending the user profile:
Identity
: https://devblogs.microsoft.com/aspnet/introducing-asp-net-identity-a-membership-system-for-asp-net-applications/return;
will exit a method in C#.
See code snippet below
using System;
namespace Exercise_strings
{
class Program
{
static void Main(string[] args)
{
Console.WriteLine("Input string separated by -");
var stringInput = Console.ReadLine();
if (string.IsNullOrWhiteSpace(stringInput))
{
Console.WriteLine("Nothing entered");
return;
}
}
So in this case if a user enters a null string or whitespace, the use of the return method terminates the Main method elegantly.
While you can, as others have noted here, put a DIV inside a TD (not as a direct child of TABLE), I strongly advise against using a DIV as a child of a TD. Unless, of course, you're a fan of headaches.
There is little to be gained and a whole lot to be lost, as there are many cross-browser discrepancies regarding how widths, margins, borders, etc., are handled when you combine the two. I can't tell you how many times I've had to clean up that kind of markup for clients because they were having trouble getting their HTML to display correctly in this or that browser.
Then again, if you're not fussy about how things look, disregard this advice.
I used this way to take the last record for each user that I have on my table. It was a query to get last location for salesman as per recent time detected on PDA devices.
CREATE FUNCTION dbo.UsersLocation()
RETURNS TABLE
AS
RETURN
Select GS.UserID, MAX(GS.UTCDateTime) 'LastDate'
From USERGPS GS
where year(GS.UTCDateTime) = YEAR(GETDATE())
Group By GS.UserID
GO
select gs.UserID, sl.LastDate, gs.Latitude , gs.Longitude
from USERGPS gs
inner join USER s on gs.SalesManNo = s.SalesmanNo
inner join dbo.UsersLocation() sl on gs.UserID= sl.UserID and gs.UTCDateTime = sl.LastDate
order by LastDate desc
The Windows version of Qt 4 includes both WebKit and classes to create ActiveX components. It probably isn't an ideal solution if you aren't already using Qt though.
If you are adding the View programmatically, you can use yourLayout.addView(view, 1);
where 1 is the index
.
[EDIT]
The expected output of the pluck
function has changed from Laravel 5.1 to 5.2. Hence why it is marked as deprecated in 5.1
In Laravel 5.1, pluck
gets a single column's value from the first result of a query.
In Laravel 5.2, pluck
gets an array with the values of a given column. So it's no longer deprecated, but it no longer do what it used to.
So short answer is use the value
function if you want one column from the first row and you are using Laravel 5.1 or above.
Thanks to Tomas Buteler for pointing this out in the comments.
[ORIGINAL] For anyone coming across this question who is using Laravel 5.1, pluck() has been deprecated and will be removed completely in Laravel 5.2.
Consider future proofing your code by using value()
instead.
return DB::table('users')->where('username', $username)->value('groupName');
the best and the secure way is to use HTML Purifier. Follow this link for some hints on using it with Zend Framework.
Yes, Ruby has very similar array-slicing syntax to Python. Here is the ri
documentation for the array index method:
--------------------------------------------------------------- Array#[]
array[index] -> obj or nil
array[start, length] -> an_array or nil
array[range] -> an_array or nil
array.slice(index) -> obj or nil
array.slice(start, length) -> an_array or nil
array.slice(range) -> an_array or nil
------------------------------------------------------------------------
Element Reference---Returns the element at index, or returns a
subarray starting at start and continuing for length elements, or
returns a subarray specified by range. Negative indices count
backward from the end of the array (-1 is the last element).
Returns nil if the index (or starting index) are out of range.
a = [ "a", "b", "c", "d", "e" ]
a[2] + a[0] + a[1] #=> "cab"
a[6] #=> nil
a[1, 2] #=> [ "b", "c" ]
a[1..3] #=> [ "b", "c", "d" ]
a[4..7] #=> [ "e" ]
a[6..10] #=> nil
a[-3, 3] #=> [ "c", "d", "e" ]
# special cases
a[5] #=> nil
a[6, 1] #=> nil
a[5, 1] #=> []
a[5..10] #=> []
Ran into this problem today when working with a set of web services, each in different projects, and a separate project containing integration tests for some of those services.
I've been using this setup for some time with EF5, without needing to include references to EF from the Integration Test Project.
Now, after upgrading to EF6, it seems I need to include a reference to EF6 in the integration test project too, even though it is not used there (pretty much as pointed out above by user3004275).
Indications you're facing the same problem:
The third point is what threw me off for a while, and I'm still not sure why this is required. Adding a ref to EF6 in my Integration Test project solved it in any case...
<EditText
android:id="@+id/editText3"
android:layout_width="wrap_content"
android:layout_height="wrap_content"
android:layout_weight="1"
android:ems="10"
android:inputType="number" />
I have tried every thing now try this one it shows other characters but you cant enter in the editText
edit.setRawInputType(Configuration.KEYBOARD_12KEY);
alert("xxxxxxxxxxx_456".substr(-3))
caveat: according to mdc, not IE compatible
Try without command mvn
in the command line. Example:
From:
mvn clean install jetty:run
To:
clean install jetty:run
I simplified the Javascript to trigger the video to start.
var bg = document.getElementById ("bg"); _x000D_
function playbg() {_x000D_
bg.play(); _x000D_
}
_x000D_
<video id="bg" style="min-width:100%; min-height:100%;" playsinline autoplay loop muted onload="playbg(); "><source src="Files/snow.mp4" type="video/mp4"></video>_x000D_
</td></tr>_x000D_
</table>
_x000D_
*"Files/snow.mp4" is just sample url
HI im going to leave this here cz i cant comment due to restrictions but i found AlexFitiskin's answer perfect, but a small correction was needed
document.getElementById('here').innerHTML = data.name;
This needed to be changed to
document.getElementById('here').innerHTML = data.n;
I know that after five years the owner of the post will not find it of any importance but this is for people who might come across in the future .
This error also occurs when you try to log in in your test version of the Facebook app and you have not added the user you are trying to test the log in with in the Roles -> Testers section.
To fix it, just add the email address of the Facebook account you are trying to log in with in the section above.
Finally, make sure the user you added accepts the request sent before you try to test otherwise the log in process will fail in the second screen just after the user accept the conditions.
Just use the crossOrigin
attribute and pass 'anonymous'
as the second parameter
var img = new Image();
img.setAttribute('crossOrigin', 'anonymous');
img.src = url;
It is from an external js file and it is the only file linked to the page.
OK.
When I double click this file I get the following error
Sounds like you're double-clicking/running a .js file, which will attempt to run the script outside the browser, like a command line script. And that would explain this error:
Windows Script Host Error: 'window' is not defined Code: 800A1391
... not an error you'll see in a browser. And of course, the browser is what supplies the window
object.
ADDENDUM: As a course of action, I'd suggest opening the relevant HTML file and taking a peek at the console. If you don't see anything there, it's likely your window.onload
definition is simply being hit after the browser fires the window.onload
event.
The following example centers a frame on the screen:
package com.zetcode;
import java.awt.Dimension;
import java.awt.EventQueue;
import java.awt.GraphicsEnvironment;
import java.awt.Point;
import javax.swing.JFrame;
public class CenterOnScreen extends JFrame {
public CenterOnScreen() {
initUI();
}
private void initUI() {
setSize(250, 200);
centerFrame();
setTitle("Center");
setDefaultCloseOperation(JFrame.EXIT_ON_CLOSE);
}
private void centerFrame() {
Dimension windowSize = getSize();
GraphicsEnvironment ge = GraphicsEnvironment.getLocalGraphicsEnvironment();
Point centerPoint = ge.getCenterPoint();
int dx = centerPoint.x - windowSize.width / 2;
int dy = centerPoint.y - windowSize.height / 2;
setLocation(dx, dy);
}
public static void main(String[] args) {
EventQueue.invokeLater(new Runnable() {
@Override
public void run() {
CenterOnScreen ex = new CenterOnScreen();
ex.setVisible(true);
}
});
}
}
In order to center a frame on a screen, we need to get the local
graphics environment. From this environment, we determine the
center point. In conjunction with the frame size, we manage
to center the frame. The setLocation()
is the method that
moves the frame to the central position.
Note that this is actually what the setLocationRelativeTo(null)
does:
public void setLocationRelativeTo(Component c) {
// target location
int dx = 0, dy = 0;
// target GC
GraphicsConfiguration gc = getGraphicsConfiguration_NoClientCode();
Rectangle gcBounds = gc.getBounds();
Dimension windowSize = getSize();
// search a top-level of c
Window componentWindow = SunToolkit.getContainingWindow(c);
if ((c == null) || (componentWindow == null)) {
GraphicsEnvironment ge = GraphicsEnvironment.getLocalGraphicsEnvironment();
gc = ge.getDefaultScreenDevice().getDefaultConfiguration();
gcBounds = gc.getBounds();
Point centerPoint = ge.getCenterPoint();
dx = centerPoint.x - windowSize.width / 2;
dy = centerPoint.y - windowSize.height / 2;
}
...
setLocation(dx, dy);
}
That query is failing and returning false
.
Put this after mysqli_query()
to see what's going on.
if (!$check1_res) {
printf("Error: %s\n", mysqli_error($con));
exit();
}
For more information:
http://docs.oracle.com/javase/tutorial/essential/exceptions/catch.html covers catching multiple exceptions in the same block.
try {
// your code
} catch (Exception1 | Exception2 ex) {
// Handle 2 exceptions in Java 7
}
I'm making study cards, and this thread was helpful, just wanted to put in my two cents.
Not exactly what asked but quite helpful
declare -u foo #When the variable is assigned a value, all lower-case characters are converted to upper-case.
foo=bar
echo $foo
BAR
And the opposite
declare -l foo #When the variable is assigned a value, all upper-case characters are converted to lower-case.
foo=BAR
echo $foo
bar
You can try/catch PDOException
s (your configs could differ but the important part is the try/catch):
try {
$dbh = new PDO(
DB_TYPE . ':host=' . DB_HOST . ';dbname=' . DB_NAME . ';charset=' . DB_CHARSET,
DB_USER,
DB_PASS,
[
PDO::ATTR_PERSISTENT => true,
PDO::ATTR_ERRMODE => PDO::ERRMODE_EXCEPTION,
PDO::MYSQL_ATTR_INIT_COMMAND => 'SET NAMES ' . DB_CHARSET . ' COLLATE ' . DB_COLLATE
]
);
} catch ( PDOException $e ) {
echo 'ERROR!';
print_r( $e );
}
The print_r( $e );
line will show you everything you need, for example I had a recent case where the error message was like unknown database 'my_db'
.
On Mac brew install graphviz
solved the problem for me.
Also you can use Lodash to direct convert object to array:
_.toArray({0:{a:4},1:{a:6},2:{a:5}})
[{a:4},{a:6},{a:5}]
In your case:
_.toArray(subjects).map((subject, i) => (
<li className="travelcompany-input" key={i}>
<span className="input-label">Name: {subject[name]}</span>
</li>
))}
I made this into a jQuery function:
jQuery.fn.sortDivs = function sortDivs() {
$("> div", this[0]).sort(dec_sort).appendTo(this[0]);
function dec_sort(a, b){ return ($(b).data("sort")) < ($(a).data("sort")) ? 1 : -1; }
}
So you have a big div like "#boo" and all your little divs inside of there:
$("#boo").sortDivs();
You need the "? 1 : -1" because of a bug in Chrome, without this it won't sort more than 10 divs! http://blog.rodneyrehm.de/archives/14-Sorting-Were-Doing-It-Wrong.html
Simply add the following CSS to the container element (here, the div
):
div {
display: flex;
justify-content: space-between;
}
div {_x000D_
display: flex;_x000D_
justify-content: space-between;_x000D_
}
_x000D_
<div>_x000D_
<img src="http://placehold.it/100x100" alt="" /> _x000D_
<img src="http://placehold.it/100x100" alt="" />_x000D_
<img src="http://placehold.it/100x100" alt="" />_x000D_
</div>
_x000D_
Use text-align: justify;
on the container element.
Then stretch the content to take up 100% width
<div>
<img src="http://placehold.it/100x100" alt="" />
<img src="http://placehold.it/100x100" alt="" />
<img src="http://placehold.it/100x100" alt="" />
</div>
div {
text-align: justify;
}
div img {
display: inline-block;
width: 100px;
height: 100px;
}
div:after {
content: '';
display: inline-block;
width: 100%;
}
div {_x000D_
text-align: justify;_x000D_
}_x000D_
_x000D_
div img {_x000D_
display: inline-block;_x000D_
width: 100px;_x000D_
height: 100px;_x000D_
}_x000D_
_x000D_
div:after {_x000D_
content: '';_x000D_
display: inline-block;_x000D_
width: 100%;_x000D_
}
_x000D_
<div>_x000D_
<img src="http://placehold.it/100x100" alt="" /> _x000D_
<img src="http://placehold.it/100x100" alt="" />_x000D_
<img src="http://placehold.it/100x100" alt="" />_x000D_
</div>
_x000D_
Using a $where
query will be slow, in part because it can't use indexes. For this sort of problem, I think it would be better to store a high value for the "expires" field that will naturally always be greater than Now(). You can either store a very high date millions of years in the future, or use a separate type to indicate never. The cross-type sort order is defined at here.
An empty Regex or MaxKey (if you language supports it) are both good choices.
Use the $
metacharacter to match the end of a string.
In Perl, this looks like:
my $str = 'red/white/blue';
my($last_match) = $str =~ m/.*\/(.*)$/;
Written in JavaScript, this looks like:
var str = 'red/white/blue'.match(/.*\/(.*)$/);
Seems like a straightforward html menu would be simpler. Use html5 data attributes for values or whatever method you want to store them and css to handle images as backgrounds or put them in the html itself.
Edit: If you are forced to convert from an existing select that you can't get rid of, there are some good plugins as well to modify a select to html. Wijmo and Chosen are a couple that come to mind
In some scenarios where you update a service and redirect to a new view(page) and then your directive gets loaded before your services are updated then you can use $rootScope.$broadcast if your $watch or $timeout fails
View
<service-history log="log" data-ng-repeat="log in requiedData"></service-history>
Controller
app.controller("MyController",['$scope','$rootScope', function($scope, $rootScope) {
$scope.$on('$viewContentLoaded', function () {
SomeSerive.getHistory().then(function(data) {
$scope.requiedData = data;
$rootScope.$broadcast("history-updation");
});
});
}]);
Directive
app.directive("serviceHistory", function() {
return {
restrict: 'E',
replace: true,
scope: {
log: '='
},
link: function($scope, element, attrs) {
function updateHistory() {
if(log) {
//do something
}
}
$rootScope.$on("history-updation", updateHistory);
}
};
});
After little investigation I concluded the followings: You have 2 options:
go with transformations. Very usefull package for this: https://bundletransformer.codeplex.com/ you need following transformation for every problematic bundle:
BundleResolver.Current = new CustomBundleResolver();
var cssTransformer = new StyleTransformer();
standardCssBundle.Transforms.Add(cssTransformer);
bundles.Add(standardCssBundle);
Advantages: of this solution, you can name your bundle whatever you want => you can combine css files into one bundle from different directories. Disadvantages: You need to transform every problematic bundle
You can get posted form data from request.form
and query string data from request.args
.
myvar = request.form["myvar"]
myvar = request.args["myvar"]
You can do it in two lines by first plotting the bar chart and then setting the appropriate ticks:
import matplotlib.pyplot as plt
D = {u'Label1':26, u'Label2': 17, u'Label3':30}
plt.bar(range(len(D)), list(D.values()), align='center')
plt.xticks(range(len(D)), list(D.keys()))
# # for python 2.x:
# plt.bar(range(len(D)), D.values(), align='center') # python 2.x
# plt.xticks(range(len(D)), D.keys()) # in python 2.x
plt.show()
Note that the penultimate line should read plt.xticks(range(len(D)), list(D.keys()))
in python3, because D.keys()
returns a generator, which matplotlib cannot use directly.
You can do this using select
import subprocess
from datetime import datetime
from select import select
def call_with_timeout(cmd, timeout):
started = datetime.now()
sp = subprocess.Popen(cmd, stdout=subprocess.PIPE)
while True:
p = select([sp.stdout], [], [], timeout)
if p[0]:
p[0][0].read()
ret = sp.poll()
if ret is not None:
return ret
if (datetime.now()-started).total_seconds() > timeout:
sp.kill()
return None
There is a RawFormat property of Image parameter which returns the file format of the image. You might try the following:
// extension method
public static byte[] imageToByteArray(this System.Drawing.Image image)
{
using(var ms = new MemoryStream())
{
image.Save(ms, image.RawFormat);
return ms.ToArray();
}
}
if(isset($response->records))
print "we've got records!";
If you are looking for solution without using Java String
functionality (i.e. split
, match
, etc.) then the following should help:
List<String> splitString(String string) {
List<String> list = new ArrayList<String>();
String token = "";
char curr;
for (int e = 0; e < string.length() + 1; e++) {
if (e == 0)
curr = string.charAt(0);
else {
curr = string.charAt(--e);
}
if (isNumber(curr)) {
while (e < string.length() && isNumber(string.charAt(e))) {
token += string.charAt(e++);
}
list.add(token);
token = "";
} else {
while (e < string.length() && !isNumber(string.charAt(e))) {
token += string.charAt(e++);
}
list.add(token);
token = "";
}
}
return list;
}
boolean isNumber(char c) {
return c >= '0' && c <= '9';
}
This solution will split numbers and 'words', where 'words' are strings that don't contain numbers. However, if you like to have only 'words' containing English letters then you can easily modify it by adding more conditions (like isNumber
method call) depending on your requirements (for example you may wish to skip words that contain non English letters). Also note that the splitString
method returns ArrayList
which later can be converted to String
array.
COPY . <destination>
Which would be in your case:
COPY . /
This is a simple example.
SELECT HEX(some_col) h
FROM some_table
ORDER BY h
you can also use
Dim intValue as integer = 65 ' letter A for instance
Dim strValue As String = Char.ConvertFromUtf32(intValue)
this doesn't requirement Microsoft.VisualBasic reference
DATEADD (datepart , number , date )
declare @num_hours int;
set @num_hours = 5;
select dateadd(HOUR, @num_hours, getdate()) as time_added,
getdate() as curr_date
From the command line:
psql -f 1.sql
psql -f 2.sql
From the psql
prompt:
\i 1.sql
\i 2.sql
Note that you may need to import the files in a specific order (for example: data definition before data manipulation). If you've got bash
shell (GNU/Linux, Mac OS X, Cygwin) and the files may be imported in the alphabetical order, you may use this command:
for f in *.sql ; do psql -f $f ; done
Here's the documentation of the psql
application (thanks, Frank): http://www.postgresql.org/docs/current/static/app-psql.html
The main alternative is:
Another alternative worth checking out:
As martijn-courteaux said, create a custom component it's the better option. In C# exists a component called PictureBox and I tried to create this component for Java, here is the code:
import java.awt.Dimension;
import java.awt.Graphics;
import java.awt.Image;
import javax.swing.Icon;
import javax.swing.ImageIcon;
import javax.swing.JComponent;
public class JPictureBox extends JComponent {
private Icon icon = null;
private final Dimension dimension = new Dimension(100, 100);
private Image image = null;
private ImageIcon ii = null;
private SizeMode sizeMode = SizeMode.STRETCH;
private int newHeight, newWidth, originalHeight, originalWidth;
public JPictureBox() {
JPictureBox.this.setPreferredSize(dimension);
JPictureBox.this.setOpaque(false);
JPictureBox.this.setSizeMode(SizeMode.STRETCH);
}
@Override
public void paintComponent(Graphics g) {
if (ii != null) {
switch (getSizeMode()) {
case NORMAL:
g.drawImage(image, 0, 0, ii.getIconWidth(), ii.getIconHeight(), null);
break;
case ZOOM:
aspectRatio();
g.drawImage(image, 0, 0, newWidth, newHeight, null);
break;
case STRETCH:
g.drawImage(image, 0, 0, this.getWidth(), this.getHeight(), null);
break;
case CENTER:
g.drawImage(image, (int) (this.getWidth() / 2) - (int) (ii.getIconWidth() / 2), (int) (this.getHeight() / 2) - (int) (ii.getIconHeight() / 2), ii.getIconWidth(), ii.getIconHeight(), null);
break;
default:
g.drawImage(image, 0, 0, this.getWidth(), this.getHeight(), null);
}
}
}
public Icon getIcon() {
return icon;
}
public void setIcon(Icon icon) {
this.icon = icon;
ii = (ImageIcon) icon;
image = ii.getImage();
originalHeight = ii.getIconHeight();
originalWidth = ii.getIconWidth();
}
public SizeMode getSizeMode() {
return sizeMode;
}
public void setSizeMode(SizeMode sizeMode) {
this.sizeMode = sizeMode;
}
public enum SizeMode {
NORMAL,
STRETCH,
CENTER,
ZOOM
}
private void aspectRatio() {
if (ii != null) {
newHeight = this.getHeight();
newWidth = (originalWidth * newHeight) / originalHeight;
}
}
}
If you want to add an image, choose the JPictureBox, after that go to Properties and find "icon" property and select an image. If you want to change the sizeMode property then choose the JPictureBox, after that go to Properties and find "sizeMode" property, you can choose some values:
If you want to learn more about this topic, you can check this video.
Starting with xdebug 3 you can use the following command line :
php -r "xdebug_info();"
And it will display useful information about your xdebug installation.
You must use OverridePendingTransition method to achieve it, which is in the Activity class. Sample Animations in the apidemos example's res/anim folder. Check it. More than check the demo in ApiDemos/App/Activity/animation.
Example:
@Override
public void onResume(){
// TODO LC: preliminary support for views transitions
this.overridePendingTransition(R.anim.in_from_right, R.anim.out_to_left);
}
As per latest api docs:
$(document).ready(function() {
$('#example').dataTable({
"order": []
});
});
Use a service api.
URL: https://fcm.googleapis.com/fcm/send
Method Type: POST
Headers:
Content-Type: application/json
Authorization: key=your api key
Body/Payload:
{ "notification": {
"title": "Your Title",
"text": "Your Text",
"click_action": "OPEN_ACTIVITY_1" // should match to your intent filter
},
"data": {
"keyname": "any value " //you can get this data as extras in your activity and this data is optional
},
"to" : "to_id(firebase refreshedToken)"
}
And with this in your app you can add below code in your activity to be called:
<intent-filter>
<action android:name="OPEN_ACTIVITY_1" />
<category android:name="android.intent.category.DEFAULT" />
</intent-filter>
Also check the answer on Firebase onMessageReceived not called when app in background
Note that you can also create your own structures using a Map.Entry as the main type, using its basic implementation AbstractMap.SimpleEntry. For instance, if you wanted to have an ordered list of entries, you could write:
List<Map.Entry<String, Integer>> entries = new ArrayList<>();
entries.add(new AbstractMap.SimpleEntry<String, Integer>(myStringValue, myIntValue));
And so on. From there, you have a list of tuples. Very useful when you want ordered tuples and a basic Map is a no-go.
you can get a files modified date using vbscript too
Set objFS=CreateObject("Scripting.FileSystemObject")
Set objArgs = WScript.Arguments
strFile= objArgs(0)
WScript.Echo objFS.GetFile(strFile).DateLastModified
save the above as mygetdate.vbs and on command line
c:\test> cscript //nologo mygetdate.vbs myfile
You can try the following:
function parseBool(val)
{
if ((typeof val === 'string' && (val.toLowerCase() === 'true' || val.toLowerCase() === 'yes')) || val === 1)
return true;
else if ((typeof val === 'string' && (val.toLowerCase() === 'false' || val.toLowerCase() === 'no')) || val === 0)
return false;
return null;
}
If it's a valid value, it returns the equivalent bool value otherwise it returns null.
Try following Steps for Apache
Go to Windows Services by typing Window + R, then typing services.msc
Enter a new service name as Apache2
(or similar)
Repeat the steps for the MySQL service
It's possible to set the center aligned view as an anchor for other views. In the example below "@+id/stat_2" centered horizontally in parent and it serves as an anchor for other views in this layout.
<android.support.constraint.ConstraintLayout xmlns:android="http://schemas.android.com/apk/res/android"
xmlns:app="http://schemas.android.com/apk/res-auto"
android:layout_width="match_parent"
android:layout_height="match_parent">
<TextView
android:id="@+id/stat_1"
android:layout_width="80dp"
android:layout_height="wrap_content"
android:layout_marginEnd="8dp"
android:gravity="center"
android:maxLines="1"
android:text="10"
android:textColor="#777"
android:textSize="22sp"
app:layout_constraintTop_toTopOf="@+id/stat_2"
app:layout_constraintEnd_toStartOf="@+id/divider_1" />
<TextView
android:id="@+id/stat_detail_1"
android:layout_width="wrap_content"
android:layout_height="wrap_content"
android:text="Streak"
android:textColor="#777"
android:textSize="12sp"
app:layout_constraintTop_toBottomOf="@+id/stat_1"
app:layout_constraintStart_toStartOf="@+id/stat_1"
app:layout_constraintEnd_toEndOf="@+id/stat_1" />
<View
android:id="@+id/divider_1"
android:layout_width="1dp"
android:layout_height="0dp"
android:layout_marginEnd="16dp"
android:background="#ccc"
app:layout_constraintTop_toTopOf="@+id/stat_2"
app:layout_constraintEnd_toStartOf="@+id/stat_2"
app:layout_constraintBottom_toBottomOf="@+id/stat_detail_2" />
<TextView
android:id="@+id/stat_2"
android:layout_width="80dp"
android:layout_height="wrap_content"
android:gravity="center"
android:maxLines="1"
android:text="243"
android:textColor="#777"
android:textSize="22sp"
app:layout_constraintTop_toTopOf="parent"
app:layout_constraintStart_toStartOf="parent"
app:layout_constraintEnd_toEndOf="parent"
app:layout_constraintBottom_toBottomOf="parent" />
<TextView
android:id="@+id/stat_detail_2"
android:layout_width="wrap_content"
android:layout_height="wrap_content"
android:maxLines="1"
android:text="Calories Burned"
android:textColor="#777"
android:textSize="12sp"
app:layout_constraintTop_toBottomOf="@+id/stat_2"
app:layout_constraintStart_toStartOf="@+id/stat_2"
app:layout_constraintEnd_toEndOf="@+id/stat_2" />
<View
android:id="@+id/divider_2"
android:layout_width="1dp"
android:layout_height="0dp"
android:layout_marginStart="16dp"
android:background="#ccc"
app:layout_constraintBottom_toBottomOf="@+id/stat_detail_2"
app:layout_constraintStart_toEndOf="@+id/stat_2"
app:layout_constraintTop_toTopOf="@+id/stat_2" />
<TextView
android:id="@+id/stat_3"
android:layout_width="80dp"
android:layout_height="wrap_content"
android:layout_marginStart="8dp"
android:gravity="center"
android:maxLines="1"
android:text="3200"
android:textColor="#777"
android:textSize="22sp"
app:layout_constraintTop_toTopOf="@+id/stat_2"
app:layout_constraintStart_toEndOf="@+id/divider_2" />
<TextView
android:id="@+id/stat_detail_3"
android:layout_width="wrap_content"
android:layout_height="wrap_content"
android:maxLines="1"
android:text="Steps"
android:textColor="#777"
android:textSize="12sp"
app:layout_constraintTop_toBottomOf="@+id/stat_3"
app:layout_constraintStart_toStartOf="@+id/stat_3"
app:layout_constraintEnd_toEndOf="@+id/stat_3" />
</android.support.constraint.ConstraintLayout>
Here's how it works on smallest smartphone (3.7 480x800 Nexus One) vs largest smartphone (5.5 1440x2560 Pixel XL)
No, you would need to give the do function in the constructor and the do function in the prototype different names.
What you may want to do is include a script on all pages that does the following ... 1. find the youtube-iframe : searching for it by width and height by title or by finding www.youtube.com in its source. You can do that by ... - looping through the window.frames by a for-in loop and then filter out by the properties
inject jscript in the iframe of the current page adding the onYoutubePlayerReady must-include-function http://shazwazza.com/post/Injecting-JavaScript-into-other-frames.aspx
Add the event listeners etc..
Hope this helps
Java7 update 45 64 bit direct download link is:
http://javadl.sun.com/webapps/download/AutoDL?BundleId=81821
Enum.GetValues(typeof(Foos))
Use list comprehension in python. Since you want 16 in the list too.. Use x2+1. Range function excludes the higher limit in the function.
list=[x for x in range(x1,x2+1)]
<? php
//1 Day = 24*60*60 = 86400
echo date("d-m-Y", time()+86400);
?>
If the current method is async then you can use TaskCompletionSource. Create a field that the event handler and the current method can access.
TaskCompletionSource<bool> tcs = null;
private async void Button_Click(object sender, RoutedEventArgs e)
{
tcs = new TaskCompletionSource<bool>();
await tcs.Task;
WelcomeTitle.Text = "Finished work";
}
private void Button_Click2(object sender, RoutedEventArgs e)
{
tcs?.TrySetResult(true);
}
This example uses a form that has a textblock named WelcomeTitle and two buttons. When the first button is clicked it starts the click event but stops at the await line. When the second button is clicked the task is completed and the WelcomeTitle text is updated. If you want to timeout as well then change
await tcs.Task;
to
await Task.WhenAny(tcs.Task, Task.Delay(25000));
if (tcs.Task.IsCompleted)
WelcomeTitle.Text = "Task Completed";
else
WelcomeTitle.Text = "Task Timed Out";
You can easily make SSH connections using SSHLibrary. Read this post :
https://workpython.blogspot.com/2020/04/creating-ssh-connections-with-python.html
I think I don't agree with your generalization. A team isn't just a collection of players. A team has so much more information about it - name, emblem, collection of management/admin staff, collection of coaching crew, then collection of players. So properly, your FootballTeam class should have 3 collections and not itself be a collection; if it is to properly model the real world.
You could consider a PlayerCollection class which like the Specialized StringCollection offers some other facilities - like validation and checks before objects are added to or removed from the internal store.
Perhaps, the notion of a PlayerCollection betters suits your preferred approach?
public class PlayerCollection : Collection<Player>
{
}
And then the FootballTeam can look like this:
public class FootballTeam
{
public string Name { get; set; }
public string Location { get; set; }
public ManagementCollection Management { get; protected set; } = new ManagementCollection();
public CoachingCollection CoachingCrew { get; protected set; } = new CoachingCollection();
public PlayerCollection Players { get; protected set; } = new PlayerCollection();
}
It should be:
SELECT SalesID, COUNT(*)
FROM AXDelNotesNoTracking
GROUP BY SalesID
HAVING COUNT(*) > 1
Regarding your initial query:
Edit:
And I just thought of this, if you want to see WHICH items are in there more than once (but this depends on which database you are using):
;WITH cte AS (
SELECT *, ROW_NUMBER() OVER (PARTITION BY SalesID ORDER BY SalesID) AS [Num]
FROM AXDelNotesNoTracking
)
SELECT *
FROM cte
WHERE cte.Num > 1
Of course, this just shows the rows that have appeared with the same SalesID but does not show the initial SalesID value that has appeared more than once. Meaning, if a SalesID shows up 3 times, this query will show instances 2 and 3 but not the first instance. Still, it might help depending on why you are looking for multiple SalesID values.
Edit2:
The following query was posted by APC below and is better than the CTE I mention above in that it shows all rows in which a SalesID has appeared more than once. I am including it here for completeness. I merely added an ORDER BY to keep the SalesID values grouped together. The ORDER BY might also help in the CTE above.
SELECT *
FROM AXDelNotesNoTracking
WHERE SalesID IN
( SELECT SalesID
FROM AXDelNotesNoTracking
GROUP BY SalesID
HAVING COUNT(*) > 1
)
ORDER BY SalesID
You can use StringComparer:
var list = new List<string>();
list.Add("cat");
list.Add("dog");
list.Add("moth");
if (list.Contains("MOTH", StringComparer.OrdinalIgnoreCase))
{
Console.WriteLine("found");
}
If you want the sum of all bars to be equal unity, weight each bin by the total number of values:
weights = np.ones_like(myarray) / len(myarray)
plt.hist(myarray, weights=weights)
Hope that helps, although the thread is quite old...
Note for Python 2.x: add casting to float()
for one of the operators of the division as otherwise you would end up with zeros due to integer division
Let's say the name of the parameter is "Id" in your SQL stored procedure, and the C# function you're using to call the database stored procedure is name of type int?
. Given that, following might solve your issue :
public void storedProcedureName(Nullable<int> id, string name)
{
var idParameter = id.HasValue ?
new SqlParameter("Id", id) :
new SqlParameter { ParameterName = "Id", SqlDbType = SqlDbType.Int, Value = DBNull.Value };
// to be continued...
A quick google indicates that pwdencrypt() is not deterministic, and your statement select pwdencrypt('AAAA') returns a different value on my installation!
See also this article http://www.theregister.co.uk/2002/07/08/cracking_ms_sql_server_passwords/
Some code for a variation on this problem. Using the above code got me my click events as needed, but I was then stuck trying to work out which button had been clicked. My scenario is I have a dynamic amount of tab pages. On each tab page are (all dynamically created) 2 charts, 2 DGVs and a pair of radio buttons. Each control has a unique name relative to the tab, but there could be 20 radio buttons with the same name if I had 20 tab pages. The radio buttons switch between which of the 2 graphs and DGVs you get to see. Here is the code for when one of the radio buttons gets checked (There's a nearly identical block that swaps the charts and DGVs back):
Private Sub radioFit_Components_CheckedChanged(ByVal sender As System.Object, ByVal e As System.EventArgs)
If sender.name = "radioFit_Components" And sender.visible Then
If sender.checked Then
For Each ctrl As Control In TabControl1.SelectedTab.Controls
Select Case ctrl.Name
Case "embChartSSE_Components"
ctrl.BringToFront()
Case "embChartSSE_Fit_Curve"
ctrl.SendToBack()
Case "dgvFit_Components"
ctrl.BringToFront()
End Select
Next
End If
End If
End Sub
This code will fire for any of the tab pages and swap the charts and DGVs over on any of the tab pages. The sender.visible check is to stop the code firing when the form is being created.
It seems to me you are using the wrong version...
TAP-Win32 should not be installed on the 64bit version. Download the right one and try again!
Screen Size Class
-
Hidden on all .d-none
Hidden only on xs .d-none .d-sm-block
Hidden only on sm .d-sm-none .d-md-block
Hidden only on md .d-md-none .d-lg-block
Hidden only on lg .d-lg-none .d-xl-block
Hidden only on xl .d-xl-none
Visible on all .d-block
Visible only on xs .d-block .d-sm-none
Visible only on sm .d-none .d-sm-block .d-md-none
Visible only on md .d-none .d-md-block .d-lg-none
Visible only on lg .d-none .d-lg-block .d-xl-none
Visible only on xl .d-none .d-xl-block
Refer this link http://getbootstrap.com/docs/4.0/utilities/display/#hiding-elements
4.5 link: https://getbootstrap.com/docs/4.5/utilities/display/#hiding-elements
If you want to declare a new substance with no parameter (knowing that the object have default parameters) don't write
type substance1();
but
type substance;
I had this issue once. It turned out to be database query issue. After re-create tables and index it has been fixed.
Although it says proxy error, when you look at server log, it shows execute query timeout. This is what I had before and how I solved it.
Starting from Java 10:
Set<E> oldSet = Set.of();
Set<E> newSet = Set.copyOf(oldSet);
Set.copyOf()
returns an unmodifiable Set
containing the elements of the given Collection
.
The given Collection
must not be null
, and it must not contain any null
elements.
One mistake I was making was saving the file as a.condarc
or b.condarc
.
Save it only as .condarc
and paste the following code in the file and save the file in your home directory. Make necessary changes to hostname, user etc.
channels:
- defaults
show_channel_urls: True
allow_other_channels: True
proxy_servers:
http: http://user:pass@hostname:port
https: http://user:pass@hostname:port
ssl_verify: False
In Adapter:
public void setFilter(List<Channel> newList){
mChannels = new ArrayList<>();
mChannels.addAll(newList);
notifyDataSetChanged();
}
In Activity:
searchView.setOnQueryTextListener(new SearchView.OnQueryTextListener() {
@Override
public boolean onQueryTextSubmit(String query) {
return false;
}
@Override
public boolean onQueryTextChange(String newText) {
newText = newText.toLowerCase();
ArrayList<Channel> newList = new ArrayList<>();
for (Channel channel: channels){
String channelName = channel.getmChannelName().toLowerCase();
if (channelName.contains(newText)){
newList.add(channel);
}
}
mAdapter.setFilter(newList);
return true;
}
});
You can also develop rich UI filled Android applications using Adobe AIR. If you plan to go that route then Flex Builder Burrito is the best IDE. Take a look at this post as to how easy it is to build an AIR4Android app http://blog.air4android.com/?p=13
Add in build.gradle module file
android {
...
buildFeatures {
viewBinding true
}
}
For Activity add
private lateinit var binding: ResultProfileBinding
override fun onCreate(savedInstanceState: Bundle?) {
super.onCreate(savedInstanceState)
binding = ResultProfileBinding.inflate(layoutInflater)
val view = binding.root
setContentView(view)
}
Add on click
binding.button.setOnClickListener { Log.d("TAG", "Example") }
This thread can help you: Passing request parameters as UTF-8 encoded strings
Basically:
request.setCharacterEncoding("UTF-8");
String login = request.getParameter("login");
String password = request.getParameter("password");
Or you use javascript on jsp file:
var userInput = $("#myInput").val();
var encodedUserInput = encodeURIComponent(userInput);
$("#hiddenImput").val(encodedUserInput);
and after recover on class:
String parameter = URLDecoder.decode(request.getParameter("hiddenImput"), "UTF-8");
Someone mentioned the Jquery Validation plugin, seems overkill if you just want to validate the url, here is the line of regex from the plugin:
return this.optional(element) || /^(https?|ftp):\/\/(((([a-z]|\d|-|\.|_|~|[\u00A0-\uD7FF\uF900-\uFDCF\uFDF0-\uFFEF])|(%[\da-f]{2})|[!\$&'\(\)\*\+,;=]|:)*@)?(((\d|[1-9]\d|1\d\d|2[0-4]\d|25[0-5])\.(\d|[1-9]\d|1\d\d|2[0-4]\d|25[0-5])\.(\d|[1-9]\d|1\d\d|2[0-4]\d|25[0-5])\.(\d|[1-9]\d|1\d\d|2[0-4]\d|25[0-5]))|((([a-z]|\d|[\u00A0-\uD7FF\uF900-\uFDCF\uFDF0-\uFFEF])|(([a-z]|\d|[\u00A0-\uD7FF\uF900-\uFDCF\uFDF0-\uFFEF])([a-z]|\d|-|\.|_|~|[\u00A0-\uD7FF\uF900-\uFDCF\uFDF0-\uFFEF])*([a-z]|\d|[\u00A0-\uD7FF\uF900-\uFDCF\uFDF0-\uFFEF])))\.)+(([a-z]|[\u00A0-\uD7FF\uF900-\uFDCF\uFDF0-\uFFEF])|(([a-z]|[\u00A0-\uD7FF\uF900-\uFDCF\uFDF0-\uFFEF])([a-z]|\d|-|\.|_|~|[\u00A0-\uD7FF\uF900-\uFDCF\uFDF0-\uFFEF])*([a-z]|[\u00A0-\uD7FF\uF900-\uFDCF\uFDF0-\uFFEF])))\.?)(:\d*)?)(\/((([a-z]|\d|-|\.|_|~|[\u00A0-\uD7FF\uF900-\uFDCF\uFDF0-\uFFEF])|(%[\da-f]{2})|[!\$&'\(\)\*\+,;=]|:|@)+(\/(([a-z]|\d|-|\.|_|~|[\u00A0-\uD7FF\uF900-\uFDCF\uFDF0-\uFFEF])|(%[\da-f]{2})|[!\$&'\(\)\*\+,;=]|:|@)*)*)?)?(\?((([a-z]|\d|-|\.|_|~|[\u00A0-\uD7FF\uF900-\uFDCF\uFDF0-\uFFEF])|(%[\da-f]{2})|[!\$&'\(\)\*\+,;=]|:|@)|[\uE000-\uF8FF]|\/|\?)*)?(\#((([a-z]|\d|-|\.|_|~|[\u00A0-\uD7FF\uF900-\uFDCF\uFDF0-\uFFEF])|(%[\da-f]{2})|[!\$&'\(\)\*\+,;=]|:|@)|\/|\?)*)?$/i.test(value);
Here is where they got it from: http://projects.scottsplayground.com/iri/
Pointed out by @nhahtdh This has been updated to:
// Copyright (c) 2010-2013 Diego Perini, MIT licensed
// https://gist.github.com/dperini/729294
// see also https://mathiasbynens.be/demo/url-regex
// modified to allow protocol-relative URLs
return this.optional( element ) || /^(?:(?:(?:https?|ftp):)?\/\/)(?:\S+(?::\S*)?@)?(?:(?!(?:10|127)(?:\.\d{1,3}){3})(?!(?:169\.254|192\.168)(?:\.\d{1,3}){2})(?!172\.(?:1[6-9]|2\d|3[0-1])(?:\.\d{1,3}){2})(?:[1-9]\d?|1\d\d|2[01]\d|22[0-3])(?:\.(?:1?\d{1,2}|2[0-4]\d|25[0-5])){2}(?:\.(?:[1-9]\d?|1\d\d|2[0-4]\d|25[0-4]))|(?:(?:[a-z\u00a1-\uffff0-9]-*)*[a-z\u00a1-\uffff0-9]+)(?:\.(?:[a-z\u00a1-\uffff0-9]-*)*[a-z\u00a1-\uffff0-9]+)*(?:\.(?:[a-z\u00a1-\uffff]{2,})).?)(?::\d{2,5})?(?:[/?#]\S*)?$/i.test( value );
It is possible by dumping, editing and reimporting the table.
This script will do it for you (Adapt the values at the start of the script to your needs):
#!/bin/bash
DB=/tmp/synapse/homeserver.db
TABLE="public_room_list_stream"
FIELD=visibility
OLD="BOOLEAN NOT NULL"
NEW="INTEGER NOT NULL"
TMP=/tmp/sqlite_$TABLE.sql
echo "### create dump"
echo ".dump '$TABLE'" | sqlite3 "$DB" >$TMP
echo "### editing the create statement"
sed -i "s|$FIELD $OLD|$FIELD $NEW|g" $TMP
read -rsp $'Press any key to continue deleting and recreating the table $TABLE ...\n' -n1 key
echo "### rename the original to '$TABLE"_backup"'"
sqlite3 "$DB" "PRAGMA busy_timeout=20000; ALTER TABLE '$TABLE' RENAME TO '$TABLE"_backup"'"
echo "### delete the old indexes"
for idx in $(echo "SELECT name FROM sqlite_master WHERE type == 'index' AND tbl_name LIKE '$TABLE""%';" | sqlite3 $DB); do
echo "DROP INDEX '$idx';" | sqlite3 $DB
done
echo "### reinserting the edited table"
cat $TMP | sqlite3 $DB
Everyone has overcomplicated this answer:
some_int = <256 bit integer>
some_bytes = some_int.to_bytes(32, sys.byteorder)
my_bytearray = bytearray(some_bytes)
You just need to know the number of bytes that you are trying to convert. In my use cases, normally I only use this large of numbers for crypto, and at that point I have to worry about modulus and what-not, so I don't think this is a big problem to be required to know the max number of bytes to return.
Since you are doing it as 768-bit math, then instead of 32 as the argument it would be 96.
There's no need to declare new variables in Python. If we're talking about variables in functions or modules, no declaration is needed. Just assign a value to a name where you need it: mymagic = "Magic"
. Variables in Python can hold values of any type, and you can't restrict that.
Your question specifically asks about classes, objects and instance variables though. The idiomatic way to create instance variables is in the __init__
method and nowhere else — while you could create new instance variables in other methods, or even in unrelated code, it's just a bad idea. It'll make your code hard to reason about or to maintain.
So for example:
class Thing(object):
def __init__(self, magic):
self.magic = magic
Easy. Now instances of this class have a magic
attribute:
thingo = Thing("More magic")
# thingo.magic is now "More magic"
Creating variables in the namespace of the class itself leads to different behaviour altogether. It is functionally different, and you should only do it if you have a specific reason to. For example:
class Thing(object):
magic = "Magic"
def __init__(self):
pass
Now try:
thingo = Thing()
Thing.magic = 1
# thingo.magic is now 1
Or:
class Thing(object):
magic = ["More", "magic"]
def __init__(self):
pass
thing1 = Thing()
thing2 = Thing()
thing1.magic.append("here")
# thing1.magic AND thing2.magic is now ["More", "magic", "here"]
This is because the namespace of the class itself is different to the namespace of the objects created from it. I'll leave it to you to research that a bit more.
The take-home message is that idiomatic Python is to (a) initialise object attributes in your __init__
method, and (b) document the behaviour of your class as needed. You don't need to go to the trouble of full-blown Sphinx-level documentation for everything you ever write, but at least some comments about whatever details you or someone else might need to pick it up.
I don't think it can. When a service is "stopped", it gets totally unloaded.
Well, OK, there's always a way I suppose. For instance, you could create a detached process to stop the service, then restart it, then exit.
for (var i in a) {
console.log(a[i],i)
}
i'm a huge fan of making an image the background of a div/node -- then you can just use the background-position: center
attribute to center it regardless of screen size
It might be worth noting that this can also occur when Windows blocks downloads that it considers to be unsafe. This can be addressed by right-clicking the jar file (such as ojdbc7.jar), and checking the 'Unblock' box at the bottom.
Windows JAR File Properties Dialog:
how about this?
public String fillSpaces(int len) {
/* the spaces string should contain spaces exceeding the max needed */
String spaces = " ";
return spaces.substring(0,len);
}
EDIT: I've written a simple code to test the concept and here what i found.
Method 1: adding single space in a loop:
public String execLoopSingleSpace(int len){
StringBuilder sb = new StringBuilder();
for(int i=0; i < len; i++) {
sb.append(' ');
}
return sb.toString();
}
Method 2: append 100 spaces and loop, then substring:
public String execLoopHundredSpaces(int len){
StringBuilder sb = new StringBuilder(" ")
.append(" ").append(" ").append(" ")
.append(" ").append(" ").append(" ")
.append(" ").append(" ").append(" ");
for (int i=0; i < len/100 ; i++) {
sb.append(" ")
.append(" ").append(" ").append(" ")
.append(" ").append(" ").append(" ")
.append(" ").append(" ").append(" ");
}
return sb.toString().substring(0,len);
}
The result I get creating 12,345,678 spaces:
C:\docs\Projects> java FillSpace 12345678
method 1: append single spaces for 12345678 times. Time taken is **234ms**. Length of String is 12345678
method 2: append 100 spaces for 123456 times. Time taken is **141ms**. Length of String is 12345678
Process java exited with code 0
and for 10,000,000 spaces:
C:\docs\Projects> java FillSpace 10000000
method 1: append single spaces for 10000000 times. Time taken is **157ms**. Length of String is 10000000
method 2: append 100 spaces for 100000 times. Time taken is **109ms**. Length of String is 10000000
Process java exited with code 0
combining direct allocation and iteration always takes less time, on average 60ms less when creating huge spaces. For smaller sizes, both results are negligible.
But please continue to comment :-)
I would suggest this way, one line iframe. no javascript needed at all. In query ?q=,
<iframe src="http://maps.google.com/maps?q=12.927923,77.627108&z=15&output=embed"></iframe>
_x000D_
You could create your own:
import java.awt.*;
import java.awt.event.ActionEvent;
import java.awt.event.ActionListener;
import java.awt.event.FocusEvent;
import java.awt.event.FocusListener;
import javax.swing.*;
public class Main {
public static void main(String[] args) {
final JFrame frame = new JFrame();
frame.setLayout(new BorderLayout());
final JTextField textFieldA = new HintTextField("A hint here");
final JTextField textFieldB = new HintTextField("Another hint here");
frame.add(textFieldA, BorderLayout.NORTH);
frame.add(textFieldB, BorderLayout.CENTER);
JButton btnGetText = new JButton("Get text");
btnGetText.addActionListener(new ActionListener() {
@Override
public void actionPerformed(ActionEvent e) {
String message = String.format("textFieldA='%s', textFieldB='%s'",
textFieldA.getText(), textFieldB.getText());
JOptionPane.showMessageDialog(frame, message);
}
});
frame.add(btnGetText, BorderLayout.SOUTH);
frame.setDefaultCloseOperation(WindowConstants.EXIT_ON_CLOSE);
frame.setVisible(true);
frame.pack();
}
}
class HintTextField extends JTextField implements FocusListener {
private final String hint;
private boolean showingHint;
public HintTextField(final String hint) {
super(hint);
this.hint = hint;
this.showingHint = true;
super.addFocusListener(this);
}
@Override
public void focusGained(FocusEvent e) {
if(this.getText().isEmpty()) {
super.setText("");
showingHint = false;
}
}
@Override
public void focusLost(FocusEvent e) {
if(this.getText().isEmpty()) {
super.setText(hint);
showingHint = true;
}
}
@Override
public String getText() {
return showingHint ? "" : super.getText();
}
}
If you're still on Java 1.5, replace the this.getText().isEmpty()
with this.getText().length() == 0
.
in your servlet
request.setAttribute("submitDone","done");
return mapping.findForward("success");
In your jsp
<c:if test="${not empty submitDone}">
<script>alert("Form submitted");
</script></c:if>
You might check your choice of quotes (use double-/ single quotes for values, strings, etc and backticks for column-names).
Since you only want to update the table master_user_profile
I'd recommend a nested query:
UPDATE
master_user_profile
SET
master_user_profile.fellow = 'y'
WHERE
master_user_profile.user_id IN (
SELECT tran_user_branch.user_id
FROM tran_user_branch WHERE tran_user_branch.branch_id = 17);
Use Addforce() method of a rigidbody compenent, make sure rigidbody is attached to the object and gravity is enabled, something like this
gameObj.rigidbody2D.AddForce(Vector3.up * 10 * Time.deltaTime); or
gameObj.rigidbody2D.AddForce(Vector3.up * 1000);
See which combination and what values matches your requirement and use accordingly. Hope it helps
If you want to do this with a Python script instead of having to run C / PHP code, here's a Python3 function that you can use to remove the embedding permissions from the font:
def convert_restricted_font(filename):
with open(filename, 'rb+') as font:
font.read(12)
while True:
_type = font.read(4)
if not _type:
raise Exception('Could not read the table definitions of the font.')
try:
_type = _type.decode()
except UnicodeDecodeError:
pass
except Exception as err:
pass
if _type != 'OS/2':
continue
loc = font.tell()
font.read(4)
os2_table_pointer = int.from_bytes(font.read(4), byteorder='big')
length = int.from_bytes(font.read(4), byteorder='big')
font.seek(os2_table_pointer + 8)
fs_type = int.from_bytes(font.read(2), byteorder='big')
print(f'Installable Embedding: {fs_type == 0}')
print(f'Restricted License: {fs_type & 2}')
print(f'Preview & Print: {fs_type & 4}')
print(f'Editable Embedding: {fs_type & 8}')
print(f'No subsetting: {fs_type & 256}')
print(f'Bitmap embedding only: {fs_type & 512}')
font.seek(font.tell()-2)
installable_embedding = 0 # True
font.write(installable_embedding.to_bytes(2, 'big'))
font.seek(os2_table_pointer)
checksum = 0
for i in range(length):
checksum += ord(font.read(1))
font.seek(loc)
font.write(checksum.to_bytes(4, 'big'))
break
if __name__ == '__main__':
convert_restricted_font("19700-webfont.ttf")
it works, but I ended up solving the problem of loading fonts in IE by https like this this
Original source in C can be found here.
new
isn't required and should be avoidedvar str = new String('asd'); // type: object
var str = String('asd'); // type: string
var num = new Number(12); // type: object
var num = Number(12); // type: number
new
is required, otherwise you'll get an errornew Date().getFullYear(); // correct, returns the current year, i.e. 2010
Date().getFullYear(); // invalid, returns an error
If you want to have your own nice looking wpf MessageBox: Create new Wpf Windows
here is xaml :
<Window x:Class="popup.MessageboxNew"
xmlns="http://schemas.microsoft.com/winfx/2006/xaml/presentation"
xmlns:x="http://schemas.microsoft.com/winfx/2006/xaml"
xmlns:d="http://schemas.microsoft.com/expression/blend/2008"
xmlns:mc="http://schemas.openxmlformats.org/markup-compatibility/2006"
xmlns:local="clr-namespace:popup"
mc:Ignorable="d"
Title="" SizeToContent="WidthAndHeight" WindowStartupLocation="CenterScreen" WindowStyle="None" ResizeMode="NoResize" AllowsTransparency="True" Background="Transparent" Opacity="1"
>
<Window.Resources>
</Window.Resources>
<Border x:Name="MainBorder" Margin="10" CornerRadius="8" BorderThickness="0" BorderBrush="Black" Padding="0" >
<Border.Effect>
<DropShadowEffect x:Name="DSE" Color="Black" Direction="270" BlurRadius="20" ShadowDepth="3" Opacity="0.6" />
</Border.Effect>
<Border.Triggers>
<EventTrigger RoutedEvent="Window.Loaded">
<BeginStoryboard>
<Storyboard>
<DoubleAnimation Storyboard.TargetName="DSE" Storyboard.TargetProperty="ShadowDepth" From="0" To="3" Duration="0:0:1" AutoReverse="False" />
<DoubleAnimation Storyboard.TargetName="DSE" Storyboard.TargetProperty="BlurRadius" From="0" To="20" Duration="0:0:1" AutoReverse="False" />
</Storyboard>
</BeginStoryboard>
</EventTrigger>
</Border.Triggers>
<Grid Loaded="FrameworkElement_OnLoaded">
<Grid.RowDefinitions>
<RowDefinition Height="Auto"/>
</Grid.RowDefinitions>
<Border Name="Mask" CornerRadius="8" Background="White" />
<Grid x:Name="Grid" Background="White">
<Grid.OpacityMask>
<VisualBrush Visual="{Binding ElementName=Mask}"/>
</Grid.OpacityMask>
<StackPanel Name="StackPanel" >
<TextBox Style="{DynamicResource MaterialDesignTextBox}" Name="TitleBar" IsReadOnly="True" IsHitTestVisible="False" Padding="10" FontFamily="Segui" FontSize="14"
Foreground="Black" FontWeight="Normal"
Background="Yellow" HorizontalAlignment="Stretch" VerticalAlignment="Center" Width="Auto" HorizontalContentAlignment="Center" BorderThickness="0"/>
<DockPanel Name="ContentHost" Margin="0,10,0,10" >
<TextBlock Margin="10" Name="Textbar"></TextBlock>
</DockPanel>
<DockPanel Name="ButtonHost" LastChildFill="False" HorizontalAlignment="Center" >
<Button Margin="10" Click="ButtonBase_OnClick" Width="70">Yes</Button>
<Button Name="noBtn" Margin="10" Click="cancel_Click" Width="70">No</Button>
</DockPanel>
</StackPanel>
</Grid>
</Grid>
</Border>
</Window>
for cs of this file :
public partial class MessageboxNew : Window
{
public MessageboxNew()
{
InitializeComponent();
//second time show error solved
if (Application.Current == null) new Application();
Application.Current.ShutdownMode = ShutdownMode.OnExplicitShutdown;
}
private void ButtonBase_OnClick(object sender, RoutedEventArgs e)
{
DialogResult = true;
}
private void cancel_Click(object sender, RoutedEventArgs e)
{
DialogResult = false;
}
private void FrameworkElement_OnLoaded(object sender, RoutedEventArgs e)
{
this.MouseDown += delegate { DragMove(); };
}
}
then create a class to use this :
public class Mk_MessageBox
{
public static bool? Show(string title, string text)
{
MessageboxNew msg = new MessageboxNew
{
TitleBar = {Text = title},
Textbar = {Text = text}
};
msg.noBtn.Focus();
return msg.ShowDialog();
}
}
now you can create your message box like this:
var result = Mk_MessageBox.Show("Remove Alert", "This is gonna remove directory from host! Are you sure?");
if (result == true)
{
// whatever
}
copy this to App.xaml inside
<Application.Resources>
<ResourceDictionary>
<ResourceDictionary.MergedDictionaries>
<!-- MahApps.Metro resource dictionaries. Make sure that all file names are Case Sensitive! -->
<ResourceDictionary Source="pack://application:,,,/MahApps.Metro;component/Styles/Controls.xaml" />
<ResourceDictionary Source="pack://application:,,,/MahApps.Metro;component/Styles/Fonts.xaml" />
<ResourceDictionary Source="pack://application:,,,/MahApps.Metro;component/Styles/Colors.xaml" />
<!-- Accent and AppTheme setting -->
<ResourceDictionary Source="pack://application:,,,/MahApps.Metro;component/Styles/Accents/Blue.xaml" />
<ResourceDictionary Source="pack://application:,,,/MahApps.Metro;component/Styles/Accents/BaseLight.xaml" />
<!--two new guys-->
<ResourceDictionary Source="pack://application:,,,/MaterialDesignColors;component/Themes/Recommended/Primary/MaterialDesignColor.LightBlue.xaml" />
<ResourceDictionary Source="pack://application:,,,/MaterialDesignColors;component/Themes/Recommended/Accent/MaterialDesignColor.Green.xaml" />
<ResourceDictionary Source="pack://application:,,,/MaterialDesignThemes.Wpf;component/Themes/MaterialDesignTheme.Light.xaml" />
<ResourceDictionary Source="pack://application:,,,/MaterialDesignThemes.Wpf;component/Themes/MaterialDesignTheme.Defaults.xaml" />
<ResourceDictionary Source="pack://application:,,,/MaterialDesignColors;component/Themes/Recommended/Primary/MaterialDesignColor.DeepPurple.xaml" />
<ResourceDictionary Source="pack://application:,,,/MaterialDesignColors;component/Themes/Recommended/Accent/MaterialDesignColor.Lime.xaml" />
</ResourceDictionary.MergedDictionaries>
</ResourceDictionary>
</Application.Resources>
-------------------------------
My Refrence : https://www.red-gate.com/simple-talk/dotnet/net-development/using-c-to-create-powershell-cmdlets-the-basics/
In which scenarios does one out-perform the other?
For smaller tables (less than 1000 rows) use a temp variable, otherwise use a temp table.
If we are use chosen dropdown list, then we can use below css(No JS/JQuery require)
<select chosen="{width: '100%'}" ng-
model="modelName" class="form-control input-
sm"
ng-
options="persons.persons as
persons.persons for persons in
jsonData"
ng-
change="anyFunction(anyParam)"
required>
<option value=""> </option>
</select>
<style>
.chosen-container .chosen-drop {
border-bottom: 0;
border-top: 1px solid #aaa;
top: auto;
bottom: 40px;
}
.chosen-container.chosen-with-drop .chosen-single {
border-top-left-radius: 0px;
border-top-right-radius: 0px;
border-bottom-left-radius: 5px;
border-bottom-right-radius: 5px;
background-image: none;
}
.chosen-container.chosen-with-drop .chosen-drop {
border-bottom-left-radius: 0px;
border-bottom-right-radius: 0px;
border-top-left-radius: 5px;
border-top-right-radius: 5px;
box-shadow: none;
margin-bottom: -16px;
}
</style>
$client = new \GuzzleHttp\Client();
$request = $client->post('http://demo.website.com/api', [
'body' => json_encode($dataArray)
]);
$response = $request->getBody();
Add
openssl.cafile
in php.ini
file
Without seeing your code, it's hard to answer other than a stab in the dark. I would guess that the string you're passing to encodeURIComponent(), which is the correct method to use, is coming from the result of accessing the innerHTML property. The solution is to get the innerText/textContent property value instead:
var str,
el = document.getElementById("myUrl");
if ("textContent" in el)
str = encodeURIComponent(el.textContent);
else
str = encodeURIComponent(el.innerText);
If that isn't the case, you can use the replace() method to replace the HTML entity:
encodeURIComponent(str.replace(/&/g, "&"));
The simplest solution is to follow the installation instruction from pip's home site.
Basically, this consists in:
sudo python get-pip.py
The main advantage of that solution is that it install pip for the python version that has been used to run get-pip.py
, which means that if you use the default OS X installation of python to run get-pip.py
you will install pip for the python install from the system.
Most solutions that use a package manager (homebrew or macport) on OS X create a redundant installation of python in the environment of the package manager which can create inconsistencies in your system since, depending on what you are doing, you may call one installation of python instead of another.
Cut can take several ranges in -f
:
Columns up to 4 and from 7 onwards:
cut -f -4,7-
or for fields 1,2,5,6 and from 10 onwards:
cut -f 1,2,5,6,10-
etc
for block elements:
<textarea style="width:100px; word-wrap:break-word;">_x000D_
ACTGATCGAGCTGAAGCGCAGTGCGATGCTTCGATGATGCTGACGATGCTACGATGCGAGCATCTACGATCAGTC_x000D_
</textarea>
_x000D_
for inline elements:
<span style="width:100px; word-wrap:break-word; display:inline-block;"> _x000D_
ACTGATCGAGCTGAAGCGCAGTGCGATGCTTCGATGATGCTGACGATGCTACGATGCGAGCATCTACGATCAGTC_x000D_
</span>
_x000D_
These are really two questions.
The first one is answered here: Calling a Sub in VBA
To the second one, protip: there is no main subroutine in VBA. Forget procedural, general-purpose languages. VBA subs are "macros" - you can run them by hitting Alt+F8 or by adding a button to your worksheet and calling up the sub you want from the automatically generated "ButtonX_Click" sub.
A little known (and little documented) fact about MATLAB's system()
function: On unixoid systems it uses whatever interpreter is given in the environment variable SHELL
or MATLAB_SHELL
at the time of starting MATLAB. So if you start MATLAB with
SHELL='/usr/bin/python' matlab
any subsequent system()
calls will use Python instead of your default shell as an interpreter.
Another alternative to @TouchBoarder's answer above is that you may also have two layout files with the same name but for different api versions. You should delete the older my_file.xml file
my_file.xml
my_file.xml(v21)
This is what worked for me:
Log on SSIS with Windows authentication.
1. Open services and find MSSQL NT Service account name and copy it:
2. Open folder from which SQL server should read from. Security - Group or user names tab - Add and paste there copied account:**
Your BULK INSERT
query should run fine now.
If problem persists try adding SQL Server Agent account to folder permissions in same way.
Make sure you restart MSSQL server in services after you are done.
Well it depends on how you want to call this code.
Are you calling it from a button click on a form, if so then on the properties for the button on form, go to the Event tab, then On Click item, select [Event Procedure]. This will open the VBA code window for that button. You would then call your Module.Routine and then this would trigger when you click the button.
Similar to this:
Private Sub Command1426_Click()
mdl_ExportMorning.ExportMorning
End Sub
This button click event calls the Module mdl_ExportMorning
and the Public Sub ExportMorning
.
As Seth stated thread safe means that a method or class instance can be used by multiple threads at the same time without any problems occuring.
Consider the following method:
private int myInt = 0;
public int AddOne()
{
int tmp = myInt;
tmp = tmp + 1;
myInt = tmp;
return tmp;
}
Now thread A
and thread B
both would like to execute AddOne()
. but A
starts first and reads the value of myInt (0)
into tmp
. Now for some reason the scheduler decides to halt thread A
and defer execution to thread B
. Thread B
now also reads the value of myInt
(still 0
) into it's own variable tmp
. Thread B
finishes the entire method, so in the end myInt = 1
. And 1
is returned. Now it's Thread A
's turn again. Thread A
continues. And adds 1
to tmp
(tmp
was 0
for thread A
). And then saves this value in myInt
. myInt
is again 1
.
So in this case the method AddOne()
was called two times, but because the method was not implemented in a thread safe way the value of myInt
is not 2
, as expected, but 1
because the second thread read the variable myInt
before the first thread finished updating it.
Creating thread safe methods is very hard in non trivial cases. And there are quite a few techniques. In Java you can mark a method as synchronized, this means that only one thread can execute that method at a given time. The other threads wait in line. This makes a method thread safe, but if there is a lot of work to be done in a method, then this wastes a lot of time. Another technique is to 'mark only a small part of a method as synchronized' by creating a lock or semaphore, and locking this small part (usually called the critical section). There are even some methods that are implemented as lockless thread safe, which means that they are built in such a way that multiple threads can race through them at the same time without ever causing problems, this can be the case when a method only executes one atomic call. Atomic calls are calls that can't be interrupted and can only be done by one thread at a time.
You should be able to continue the sequences directly in your existing -f
specification.
To skip both 5 and 7, try:
cut -d, -f-4,6-6,8-
As you're skipping a single sequential column, this can also be written as:
cut -d, -f-4,6,8-
To keep it going, if you wanted to skip 5, 7, and 11, you would use:
cut -d, -f-4,6-6,8-10,12-
To put it into a more-clear perspective, it is easier to visualize when you use starting/ending columns which go on the beginning/end of the sequence list, respectively. For instance, the following will print columns 2 through 20, skipping columns 5 and 11:
cut -d, -f2-4,6-10,12-20
So, this will print "2 through 4", skip 5, "6 through 10", skip 11, and then "12 through 20".
I use setInterval
to wait for the content loaded. I hope this can help you to solve that problem.
var $audio = $('#audio');
var src = $audio.attr('src');
var a;
a = window.setInterval(function(){
src = $audio.attr('src');
if(src != undefined){
window.clearInterval(a);
$('audio').mediaelementplayer({
audioWidth: '100%'
});
}
}, 0);
As alluded to in wickeD's answer, with replaceAll the replacement string is handled differently between replace and replaceAll. I expected a[3] and a[4] to have the same value, but they are different.
public static void main(String[] args) {
String[] a = new String[5];
a[0] = "\\";
a[1] = "X";
a[2] = a[0] + a[1];
a[3] = a[1].replaceAll("X", a[0] + "X");
a[4] = a[1].replace("X", a[0] + "X");
for (String s : a) {
System.out.println(s + "\t" + s.length());
}
}
The output of this is:
\ 1
X 1
\X 2
X 1
\X 2
This is different from perl where the replacement does not require the extra level of escaping:
#!/bin/perl
$esc = "\\";
$s = "X";
$s =~ s/X/${esc}X/;
print "$s " . length($s) . "\n";
which prints \X 2
This can be quite a nuisance, as when trying to use the value returned by java.sql.DatabaseMetaData.getSearchStringEscape() with replaceAll().
Normally, it's the value property
testArea.value
Or is there something I'm missing in what you need?
If you're recompiling a disassembled APK
with APK tool:
Just Set Memory Allocation a little bigger
set switch -Xmx1024m
to -Xmx2048m
java -Xmx2048m -jar signapk.jar -w testkey.x509.pem testkey.pk8 "%APKOUT%" "%SIGNED%"
you're good to go.. :)
I got this error because my AdonisJS server was not running before I ran the test. Running the server first fixed it.
I have Python 2.7.5, MySQL 5.6 and CentOS 7.1.1503.
For me it worked with the following command:
# pip install mysql-python
Note pre-requisites here:
Install Python pip:
# rpm -iUvh http://dl.fedoraproject.org/pub/epel/7/x86_64/e/epel-release-7-5.noarch.rpm
# yum -y update
Reboot the machine (if kernel is also updated)
# yum -y install python-pip
Install Python devel packages:
# yum install python-devel
Install MySQL devel packages:
# yum install mysql-devel
to pass many options you can pass a object to a @Input decorator with custom data in a single line.
In the template
<li *ngFor = 'let opt of currentQuestion.options'
[selectable] = 'opt'
[myOptions] ="{first: opt.val1, second: opt.val2}" // these are your multiple parameters
(selectedOption) = 'onOptionSelection($event)' >
{{opt.option}}
</li>
so in Directive class
@Directive({
selector: '[selectable]'
})
export class SelectableDirective{
private el: HTMLElement;
@Input('selectable') option:any;
@Input('myOptions') data;
//do something with data.first
...
// do something with data.second
}
Indexes are all about finding data quickly.
Indexes in a database are analogous to indexes that you find in a book. If a book has an index, and I ask you to find a chapter in that book, you can quickly find that with the help of the index. On the other hand, if the book does not have an index, you will have to spend more time looking for the chapter by looking at every page from the start to the end of the book.
In a similar fashion, indexes in a database can help queries find data quickly. If you are new to indexes, the following videos, can be very useful. In fact, I have learned a lot from them.
Index Basics
Clustered and Non-Clustered Indexes
Unique and Non-Unique Indexes
Advantages and disadvantages of indexes
I implemented all the previous answers and still had one view that did not work correctly.
It turned out the name of the view I was having the problem with was named 'Recent'. Apparently this confused the Internet Explorer browser.
After I changed the view name (in the controller) to a different name (I chose to 'Recent5'), the solutions above started to work.
I had also similar problem. In my case brokerUrl was not configured properly. So that's way I received following Error:
Cause: Error While attempting to add new Connection to the pool: nested exception is javax.jms.JMSException: Could not connect to broker URL : tcp://localhost:61616. Reason: java.net.ConnectException: Connection refused
& I resolved it following way.
ActiveMQConnectionFactory connectionFactory = new ActiveMQConnectionFactory();
connectionFactory.setBrokerURL("tcp://hostname:61616");
connectionFactory.setUserName("admin");
connectionFactory.setPassword("admin");
For me I just noticed that it was my .h archive with a '{'. Maye that can help someone =)
Hope this could help someone
$(document).on("input", ".numeric", function() {
this.value = this.value.match(/^\d+\.?\d{0,2}/);});
Now which drive letter did that removable device get?
Two ways to locate e.g. a USB-disk in git Bash
:
$ cat /proc/partitions major minor #blocks name win-mounts 8 0 500107608 sda 8 1 1048576 sda1 8 2 131072 sda2 8 3 496305152 sda3 C:\ 8 4 1048576 sda4 8 5 1572864 sda5 8 16 0 sdb 8 32 0 sdc 8 48 0 sdd 8 64 0 sde 8 80 3952639 sdf 8 81 3950592 sdf1 E:\ $ mount C:/Program Files/Git on / type ntfs (binary,noacl,auto) C:/Program Files/Git/usr/bin on /bin type ntfs (binary,noacl,auto) C:/Users/se2982/AppData/Local/Temp on /tmp type ntfs (binary,noacl,posix=0,usertemp) C: on /c type ntfs (binary,noacl,posix=0,user,noumount,auto) E: on /e type vfat (binary,noacl,posix=0,user,noumount,auto) G: on /g type ntfs (binary,noacl,posix=0,user,noumount,auto) H: on /h type ntfs (binary,noacl,posix=0,user,noumount,auto)
... so; likely drive letter in this example => /e
(or E:\ if you must), when knowing that C, G, and H are other things (in Windows).
Use numpy.array
to use shape
attribute.
>>> import numpy as np
>>> X = np.array([
... [[-9.035250067710876], [7.453250169754028], [33.34074878692627]],
... [[-6.63700008392334], [5.132999956607819], [31.66075038909912]],
... [[-5.1272499561309814], [8.251499891281128], [30.925999641418457]]
... ])
>>> X.shape
(3L, 3L, 1L)
NOTE X.shape
returns 3-items tuple for the given array; [n, T] = X.shape
raises ValueError
.
@Solution ((double) rand() / (RAND_MAX+1)) * (max-min+1) + min
Warning: Don't forget due to stretching and possible precision errors (even if RAND_MAX were large enough), you'll only be able to generate evenly distributed "bins" and not all numbers in [min,max].
@Solution: Bigrand
Warning: Note that this doubles the bits, but still won't be able to generate all numbers in your range in general, i.e., it is not necessarily true that BigRand() will generate all numbers between in its range.
Info: Your approach (modulo) is "fine" as long as the range of rand() exceeds your interval range and rand() is "uniform". The error for at most the first max - min numbers is 1/(RAND_MAX +1).
Also, I suggest to switch to the new random packagee in C++11 too, which offers better and more varieties of implementations than rand().
If you want to disable all constraints in the database just run this code:
-- disable all constraints
EXEC sp_MSforeachtable "ALTER TABLE ? NOCHECK CONSTRAINT all"
To switch them back on, run: (the print is optional of course and it is just listing the tables)
-- enable all constraints
exec sp_MSforeachtable @command1="print '?'", @command2="ALTER TABLE ? WITH CHECK CHECK CONSTRAINT all"
I find it useful when populating data from one database to another. It is much better approach than dropping constraints. As you mentioned it comes handy when dropping all the data in the database and repopulating it (say in test environment).
If you are deleting all the data you may find this solution to be helpful.
Also sometimes it is handy to disable all triggers as well, you can see the complete solution here.
According to this link DialogFragment fullscreen shows padding on sides this will work like a charm.
@Override
public Dialog onCreateDialog(final Bundle savedInstanceState) {
// the content
final RelativeLayout root = new RelativeLayout(getActivity());
root.setLayoutParams(new ViewGroup.LayoutParams(ViewGroup.LayoutParams.MATCH_PARENT, ViewGroup.LayoutParams.MATCH_PARENT));
// creating the fullscreen dialog
final Dialog dialog = new Dialog(getActivity());
dialog.requestWindowFeature(Window.FEATURE_NO_TITLE);
dialog.setContentView(root);
dialog.getWindow().setBackgroundDrawable(new ColorDrawable(Color.TRANSPARENT));
dialog.getWindow().setLayout(ViewGroup.LayoutParams.MATCH_PARENT, ViewGroup.LayoutParams.MATCH_PARENT);
return dialog;
}
After jQuery 1.7 the preferred methods are .on() and .off()
Sean's answer shows an example.
Use the jQuery functions
.live()
and.die()
. Available in jQuery 1.3.xFrom the docs:
To display each paragraph's text in an alert box whenever it is clicked:
$("p").live("click", function(){ alert( $(this).text() ); });
Also, the livequery plugin does this and has support for more events.
var test = parseInt($("#testid").val());
Maybe you can take a look at closure in JavaScript. Here is a working solution:
<!DOCTYPE html>_x000D_
<html>_x000D_
<head>_x000D_
<meta charset="utf-8" />_x000D_
<title>Test</title>_x000D_
</head>_x000D_
<body>_x000D_
<p class="button">Button 0</p>_x000D_
<p class="button">Button 1</p>_x000D_
<p class="button">Button 2</p>_x000D_
<script>_x000D_
var buttons = document.getElementsByClassName('button');_x000D_
for (var i=0 ; i < buttons.length ; i++){_x000D_
(function(index){_x000D_
buttons[index].onclick = function(){_x000D_
alert("I am button " + index);_x000D_
};_x000D_
})(i)_x000D_
}_x000D_
</script>_x000D_
</body>_x000D_
</html>
_x000D_
mysql_*
functions have been removed in PHP 7.
You now have two alternatives: MySQLi and PDO.
The following is a before (-) and after (+) comparison of a migration to the MySQLi alternative, taken straight out of working code:
-if (!$dbLink = mysql_connect($dbHost, $dbUser, $dbPass))
+if (!$dbLink = mysqli_connect($dbHost, $dbUser, $dbPass))
-if (!mysql_select_db($dbName, $dbLink))
+if (!mysqli_select_db($dbLink, $dbName))
-if (!$result = mysql_query($query, $dbLink)) {
+if (!$result = mysqli_query($dbLink, $query)) {
-if (mysql_num_rows($result) > 0) {
+if (mysqli_num_rows($result) > 0) {
-while ($row = mysql_fetch_array( $result, MYSQL_ASSOC )) {
+while ($row = mysqli_fetch_array( $result, MYSQLI_ASSOC )) {
-mysql_close($dbLink);
+mysqli_close($dbLink);
putting the UNIX_TIMESTAMP will do the trick.
SELECT id, NAME, form_id, UNIX_TIMESTAMP(updated_at) AS DATE
FROM wp_frm_items
WHERE user_id = 11 && form_id=9
ORDER BY DATE DESC
I wanted to checkout a single file to a directory, which was not part of a working copy.
Let's get the file at the following URL: http://subversion.repository.server/repository/module/directory/myfile
svn co http://subversion.repository.server/repository/module/directory/myfile /**directoryb**
So I checked out the given directory containing the target file I wanted to get to a dummy directory, (say etcb for the URL ending with /etc
).
Then I emptied the file .svn/entries from all files of the target directory I didn't needed, to leave just the file I wanted. In this .svn/entries file, you have a record for each file with its attributes so leave just the record concerning the file you want to get and save.
Now you need just to copy then ''.svn'' to the directory which will be a new "working copy". Then you just need to:
cp .svn /directory
cd /directory
svn update myfile
Now the directory directory is under version control. Do not forget to remove the directory directoryb which was just a ''temporary working copy''.
Using the C++ API, the function name has slightly changed and it writes now:
#include <opencv2/imgproc/imgproc.hpp>
cv::Mat greyMat, colorMat;
cv::cvtColor(colorMat, greyMat, CV_BGR2GRAY);
The main difficulties are that the function is in the imgproc module (not in the core), and by default cv::Mat are in the Blue Green Red (BGR) order instead of the more common RGB.
OpenCV 3
Starting with OpenCV 3.0, there is yet another convention.
Conversion codes are embedded in the namespace cv::
and are prefixed with COLOR
.
So, the example becomes then:
#include <opencv2/imgproc/imgproc.hpp>
cv::Mat greyMat, colorMat;
cv::cvtColor(colorMat, greyMat, cv::COLOR_BGR2GRAY);
As far as I have seen, the included file path hasn't changed (this is not a typo).
As close as I can tell, Chrome is looking for the header
Content-Type: text/xml
Then it works --- other iterations have failed.
Make sure your web server is providing this. It also explains why it fails for file://URI xml files.
Try the following (note that there should not be a space between the VAR
, =
, and GREG
).
SET VAR=GREG
ECHO %VAR%
PAUSE
With angular cli
npm install angular-material-icons --save
or
npm install material-design-icons-iconfont --save
material-design-icons-iconfont is the latest updated version of the icons. angular-material-icons is not updated for a long time
Wait wait wait install to be done and then add it to angular.json -> projects -> architect -> styles
"styles": [
"node_modules/material-design-icons/iconfont/material-icons.css",
"src/styles.scss"
],
or if you installed material-desing-icons-iconfont then
"styles": [
"node_modules/material-design-icons-iconfont/dist/material-design-icons.css",
"src/styles.scss"
],
Unobtrusive validation is enabled by default in new version of ASP.NET. Unobtrusive validation aims to decrease the page size by replacing the inline JavaScript for performing validation with a small JavaScript library that uses jQuery.
You can either disable it by editing web.config to include the following:
<appSettings>
<add key="ValidationSettings:UnobtrusiveValidationMode" value="None" />
</appSettings>
Or better yet properly configure it by modifying the Application_Start method in global.asax:
void Application_Start(object sender, EventArgs e)
{
RouteConfig.RegisterRoutes(System.Web.Routing.RouteTable.Routes);
ScriptManager.ScriptResourceMapping.AddDefinition("jquery",
new ScriptResourceDefinition
{
Path = "/~Scripts/jquery-2.1.1.min.js"
}
);
}
Page 399 of Beginning ASP.NET 4.5.1 in C# and VB provides a discussion on the benefit of unobtrusive validation and a walkthrough for configuring it.
For those looking for RouteConfig. It is added automatically when you make a new project in visual studio to the App_Code folder. The contents look something like this:
using System;
using System.Collections.Generic;
using System.Web;
using System.Web.Routing;
using Microsoft.AspNet.FriendlyUrls;
namespace @default
{
public static class RouteConfig
{
public static void RegisterRoutes(RouteCollection routes)
{
var settings = new FriendlyUrlSettings();
settings.AutoRedirectMode = RedirectMode.Permanent;
routes.EnableFriendlyUrls(settings);
}
}
}
Please check if postgres(or any other database service) is running properly.
You can't create arrays with a generic component type.
Create an array of an explicit type, like Object[]
, instead. You can then cast this to PCB[]
if you want, but I don't recommend it in most cases.
PCB[] res = (PCB[]) new Object[list.size()]; /* Not type-safe. */
If you want type safety, use a collection like java.util.List<PCB>
instead of an array.
By the way, if list
is already a java.util.List
, you should use one of its toArray()
methods, instead of duplicating them in your code. This doesn't get your around the type-safety problem though.