You need to cast your activity from getActivity() to AppCompatActivity first. Here's an example:

((AppCompatActivity) getActivity()).getSupportActionBar().setTitle();

The reason you have to cast it is because getActivity() returns a FragmentActivity and you need an AppCompatActivity

In Kotlin:

(activity as AppCompatActivity).supportActionBar?.title = "My Title"

API is code based integration while web service is message based integration with interoperable standards having a contract such as WSDL.

import os

os.system('cls')  # For Windows
os.system('clear')  # For Linux/OS X

Just a note about difference beetween static and dynamic.

• Static: you must set URL property every time you call web service. This because base URL if web service is in the proxy class constructor.
• Dynamic: a special configuration key will be created for you in your web.config file. By default proxy class will read URL from this key.

Same way you'd hide anything: visibility: hidden;

If you are using Query builder then you may use a blow

DB::table(Newsletter Subscription)
->select('*')
->whereIn('id', $send_users_list)
->get()

If you are working with Eloquent then you can use as below

$sendUsersList = Newsletter Subscription:: select ('*')
                ->whereIn('id', $send_users_list)
                ->get();

Because I always struggle to remember, a quick summary of what each of these do:

>>> pd.Timestamp.now()  # naive local time
Timestamp('2019-10-07 10:30:19.428748')

>>> pd.Timestamp.utcnow()  # tz aware UTC
Timestamp('2019-10-07 08:30:19.428748+0000', tz='UTC')

>>> pd.Timestamp.now(tz='Europe/Brussels')  # tz aware local time
Timestamp('2019-10-07 10:30:19.428748+0200', tz='Europe/Brussels')

>>> pd.Timestamp.now(tz='Europe/Brussels').tz_localize(None)  # naive local time
Timestamp('2019-10-07 10:30:19.428748')

>>> pd.Timestamp.now(tz='Europe/Brussels').tz_convert(None)  # naive UTC
Timestamp('2019-10-07 08:30:19.428748')

>>> pd.Timestamp.utcnow().tz_localize(None)  # naive UTC
Timestamp('2019-10-07 08:30:19.428748')

>>> pd.Timestamp.utcnow().tz_convert(None)  # naive UTC
Timestamp('2019-10-07 08:30:19.428748')

If you run the Get-Item or Get-ChildItem commands these will output System.IO.FileInfo and System.IO.DirectoryInfo objects that contain this information e.g.:

Get-Item c:\folder | Format-List  

Or you can access the property directly like so:

Get-Item c:\folder | Foreach {$_.LastWriteTime}

To start to filter folders & files based on last write time you can do this:

Get-ChildItem c:\folder | Where{$_.LastWriteTime -gt (Get-Date).AddDays(-7)}

Only a manual deletion of the specific dependency in the cache folder works... an artifactory built by a colleague in enterprise repo.

Syntax:

$(selector).text() returns the text content.

$(selector).text(content) sets the text content.

$(selector).text(function(index, curContent)) sets text content using a function.

kaynak: https://www.geeksforgeeks.org/jquery-change-the-text-of-a-span-element/

import json

myDict = {'dict': [{'a': 'none', 'b': 'none', 'c': 'none'}]}
test = json.dumps(myDict)
print(test)

{"dict": [{"a": "none", "b": "none", "c": "none"}]}

myDict['dict'].append(({'a': 'aaaa', 'b': 'aaaa', 'c': 'aaaa'}))
test = json.dumps(myDict)
print(test)

{"dict": [{"a": "none", "b": "none", "c": "none"}, {"a": "aaaa", "b": "aaaa", "c": "aaaa"}]}

Define a class for key definition in your group.

class KeyObj {

    ArrayList<Object> keys;

    public KeyObj( Object... objs ) {
        keys = new ArrayList<Object>();

        for (int i = 0; i < objs.length; i++) {
            keys.add( objs[i] );
        }
    }

    // Add appropriate isEqual() ... you IDE should generate this

}

Now in your code,

peopleByManyParams = people
            .collect(Collectors.groupingBy(p -> new KeyObj( p.age, p.other1, p.other2 ), Collectors.mapping((Person p) -> p, toList())));

You have misspelt the second pixels as pixel. The following works:

pixels = [1,2,3]
pixels[0] = 5

It appears that due to the typo you were trying to accidentally modify some tuple called pixel, and in Python tuples are immutable. Hence the confusing error message.

# file? will only return true for files
File.file?(filename)

and

# Will also return true for directories - watch out!
File.exist?(filename)

In my opinion, it would be a cleaner and easier solution to just set a class on the body and set the font-family in css according to that class.
don't know if that's an option in your case though.

Try ceiling...

SELECT Ceiling(45.01), Ceiling(45.49), Ceiling(45.99)

http://en.wikipedia.org/wiki/Floor_and_ceiling_functions

There's whereIn():

$items = DB::table('items')->whereIn('id', [1, 2, 3])->get();

There are many way you can do this. Those are given bellow:

Suppose your original number is given bellow:

 double number = 2354548.235;

Using NumberFormat:

NumberFormat formatter = new DecimalFormat("#0.00");
    System.out.println(formatter.format(number));

Using String.format:

System.out.println(String.format("%,.2f", number));

Using DecimalFormat and pattern:

NumberFormat nf = DecimalFormat.getInstance(Locale.ENGLISH);
        DecimalFormat decimalFormatter = (DecimalFormat) nf;
        decimalFormatter.applyPattern("#,###,###.##");
        String fString = decimalFormatter.format(number);
        System.out.println(fString);

Using DecimalFormat and pattern

DecimalFormat decimalFormat = new DecimalFormat("############.##");
        BigDecimal formattedOutput = new BigDecimal(decimalFormat.format(number));
        System.out.println(formattedOutput);

In all cases the output will be: 2354548.23

Note:

During rounding you can add RoundingMode in your formatter. Here are some rounding mode given bellow:

    decimalFormat.setRoundingMode(RoundingMode.CEILING);
    decimalFormat.setRoundingMode(RoundingMode.FLOOR);
    decimalFormat.setRoundingMode(RoundingMode.HALF_DOWN);
    decimalFormat.setRoundingMode(RoundingMode.HALF_UP);
    decimalFormat.setRoundingMode(RoundingMode.UP);

Here are the imports:

import java.math.BigDecimal;
import java.math.RoundingMode;
import java.text.DecimalFormat;
import java.text.NumberFormat;
import java.util.Locale;

You're missing quotes around your string:

...
var htmlString="<?php echo $htmlString; ?>";
...

Combining the answers from @Ortomala Lokni and @rogerdpack, another alternative is to have the dependent service monitor when the first one has started / done the thing you're waiting for.

For example, here's how I am making the fail2ban service wait for Docker to open port 443 (so that fail2ban's iptables entries take priority over Docker's):

[Service]
ExecStartPre=/bin/bash -c '(while ! nc -z -v -w1 localhost 443 > /dev/null; do echo "Waiting for port 443 to open..."; sleep 2; done); sleep 2'

Simply replace nc -z -v -w1 localhost 443 with a command that fails (non-zero exit code) while the first service is starting and succeeds once it is up.

For the Cassandra case, the ideal would be a command that only returns 0 when the cluster is available.

Maybe I am missing something (lots of many-upvotes-members answers here that seem to be looking at this different to I, which would seem implausible that I am correct), but length is not the correct terminology for counting something. Length is usually used to obtain what you are getting, and not what you are wanting.

$cars.count should give you what you seem to be looking for.

Use this procedure to create virtual env in ubuntu

Step 1

Install pip

   sudo apt-get install python-pip

step 2

Install virtualenv

   sudo pip install virtualenv

step 3

Create a dir to store your virtualenvs (I use ~/.virtualenvs)

   mkdir ~/.virtualenvs

or use this command to install specific version of python in env

virtualenv -p /usr/bin/python3.6 venv

step 4

   sudo pip install virtualenvwrapper

step 5

   sudo nano ~/.bashrc

step 6

Add this two line code at the end of the bashrc file

  export WORKON_HOME=~/.virtualenvs
  source /usr/local/bin/virtualenvwrapper.sh

step 7

Open new terminal (recommended)

step 8

Create a new virtualenv

  mkvirtualenv myawesomeproject

step 9

To load or switch between virtualenvs, use the workon command:

  workon myawesomeproject

step 10

To exit your new virtualenv, use

 deactivate

and make sure using pip vs pip3

OR follow the steps below to install virtual environment using python3

Install env

python3 -m venv my-project-env

and activate your virtual environment using the following command:

source my-project-env/bin/activate

or if you want particular python version

virtualenv --python=python3.7.5 myenv

This snippet uses Common Table Expressions to reduce redundant code and to improve readability. It is a variation of John Baughman's answer.

The syntax is for SQL Server.

WITH products AS (
            SELECT prod_name,
                   price
              FROM Products_Table
             WHERE prod_name LIKE '%foo%'
     ),
     defaults AS (
            SELECT '-' AS prod_name,
                   0   AS price
     )

SELECT * FROM products
UNION ALL
SELECT * FROM defaults
 WHERE NOT EXISTS ( SELECT * FROM products );

I got the same question here. If the document is huge, it is not a good idea to use XmlDocument. The fact is that the first element is the root element, based on which XmlReader can be used to get the root element. Using XmlReader will be much more efficient than using XmlDocument as it doesn't require load the whole document into memory.

  using (XmlReader reader = XmlReader.Create(<your_xml_file>)) {
    while (reader.Read()) {
      // first element is the root element
      if (reader.NodeType == XmlNodeType.Element) {
        System.Console.WriteLine(reader.Name);
        break;
      }
    }
  }

As mysql official documentation:

Starting with version 6.7, Connector/Net will no longer include the MySQL for Visual Studio integration. That functionality is now available in a separate product called MySQL for Visual Studio available using the MySQL Installer for Windows (see http://dev.mysql.com/tech-resources/articles/mysql-installer-for-windows.html).

Online Documentation:

MySQL Connector/Net Installation Instructions

In an Object Oriented parking lot, there will be no need for attendants because the cars will "know how to park".

Finding a usable car on the lot will be difficult; the most common models will either have all their moving parts exposed as public member variables, or they will be "fully encapsulated" cars with no windows or doors.

The parking spaces in our OO parking lot will not match the size and shape of the cars (an "impediance mismatch" between the spaces and the cars)

License tags on our lot will have a dot between each letter and digit. Handicaped parking will only be available for licenses beginning with "_", and licenses beginning with "m_" will be towed.

Simplest solution seems to be specifying the ylim range. Here is some code to do this automatically (left default, right - adjusted):

# default y-axis
barplot(dat, beside=TRUE)

# automatically adjusted y-axis
barplot(dat, beside=TRUE, ylim=range(pretty(c(0, dat))))

The trick is to use pretty() which returns a list of interval breaks covering all values of the provided data. It guarantees that the maximum returned value is 1) a round number 2) greater than maximum value in the data.

In the example 0 was also added pretty(c(0, dat)) which makes sure that axis starts from 0.

According to npm, the angular-cli has been renamed to @angular/cli you can use the following syntax to install it.

npm install -g @angular/cli

@coldmind answer is correct but lacks details.

The 'NOT NULL constraint failed' occurs when something tries to set None to the 'zipcode' property, while it has not been explicitely allowed.

It usually happens when:

1) your field has Null=False by default, so that the value in the database cannot be None (i.e. undefined) when the object is created and saved in the database (this happens after a objects_set.create() call or setting the .zipcode property and doing a .save() call).

For instance, if somewhere in your code an assignement results in:

model.zipcode = None

this error is raised

2) When creating or updating the database, Django is constrained to find a default value to fill the field, because Null=False by default. It does not find any because you haven't defined any. So this error can not only happen during code execution but also when creating the database?

3) Note that the same error would be returned of you define default=None, or if your default value with an incorrect type, for instance default='00000' instead of 00000 for your field (maybe can there be automatic conversion between char and integers, but I would advise against relying on it. Besides, explicit is better than implicit). Most likely an error would also be raised if the default value violates the max_length property, e.g. 123456

So you'll have to define the field by one of the following:

models.IntegerField(_('zipcode'), max_length=5, Null=True,
   blank=True)

models.IntegerField(_('zipcode'), max_length=5, Null=False,
   blank=True, default=00000)

models.IntegerField(_('zipcode'), max_length=5, blank=True,
   default=00000)

and then make a migration (python3 manage.py makemigration ) and then migrate (python3 manage.py migrate).

For safety you can also delete the last failed migration files in <app_name>/migrations/, there are usually named after this pattern:

<NUMBER>_auto_<DATE>_<HOUR>.py

Finally, if you don't set Null=True, make sure that mode.zipcode = None is never done anywhere.

I was looking for something and I found this post. I post this code that managed many-to-many relationships in case someone needs it.

    var UserInRole = db.UsersInRoles.Include(u => u.UserProfile).Include(u => u.Roles)
    .Select (m => new 
    {
        UserName = u.UserProfile.UserName,
        RoleName = u.Roles.RoleName
    });

To zoom relative to the mouse position, all you need is:

var position = e.GetPosition(image1);
image1.RenderTransformOrigin = new Point(position.X / image1.ActualWidth, position.Y / image1.ActualHeight);

I also wouldn't call two many (is_a? and kind_of? are aliases of the same method), but if you want to see more possibilities, turn your attention to #class method:

A = Class.new
B = Class.new A

a, b = A.new, B.new
b.class < A # true - means that b.class is a subclass of A
a.class < B # false - means that a.class is not a subclass of A
# Another possibility: Use #ancestors
b.class.ancestors.include? A # true - means that b.class has A among its ancestors
a.class.ancestors.include? B # false - means that B is not an ancestor of a.class

I just switched from Objective-C to Swift (4), and I find that I often use:

let allWords = String(format:"%@ %@ %@",message.body!, message.subject!, message.senderName!)

The name of an array is the address of its first element, so name is a pointer to memory containing the string "siva".

Also you don't need a pointer to display a character; you are just electing to use it directly from the array in this case. You could do this instead:

char c = *name;
printf("%c\n", c);

You can use df.index to access the index object and then get the values in a list using df.index.tolist(). Similarly, you can use df['col'].tolist() for Series.

Yes, it's historical. Without it, it creates an old-style class.

If you use type() on an old-style object, you just get "instance". On a new-style object you get its class.

In Swift :- var str_url = yourUrl.absoluteString

It will result a url in string.

how about:

document.write ("<br>");

(assuming you are in an html page, since a line feed alone will only show as a space)

Give a different alias

SELECT  Convert(varchar,A.InsertDate,103) as converted_Tran_Date from table as A
order by A.InsertDate 

You're looking for the JavaScriptSerializer class, which is used internally by JsonResult:

string json = new JavaScriptSerializer().Serialize(jsonResult.Data);

The condition i==j+1 will not be true for i==2. This can be fixed by a couple of changes to the inner loop:

#include <stdio.h>
int main(void)
{
 for (int i=2; i<100; i++)
 {
  for (int j=2; j<=i; j++)   // Changed upper bound
  {
    if (i == j)  // Changed condition and reversed order of if:s
      printf("%d\n",i);
    else if (i%j == 0)
      break;
  }
 }
}

For me it was a missing static keyword in one of the JUnit annotated methods, e.g.:

@AfterClass
public static void cleanUp() {
    // ...
}

Chances are you are struggling with the node.js dying whenever the server you are calling refuses to connect. Try this:

process.on('uncaughtException', function (err) {
    console.log(err);
}); 

This keeps your server running and also give you a place to attach the debugger and look for a deeper problem.

Although this is almost certainly not the OPs issue, you can also get Unable to establish SSL connection from wget if you're behind a proxy and don't have HTTP_PROXY and HTTPS_PROXY environment variables set correctly. Make sure to set HTTP_PROXY and HTTPS_PROXY to point to your proxy.

This is a common situation if you work for a large corporation.

Briefly, with more detail below,

• window is the execution context and global object for that context's JavaScript
• document contains the DOM, initialized by parsing HTML
• screen describes the physical display's full screen

See W3C and Mozilla references for details about these objects. The most basic relationship among the three is that each browser tab has its own window, and a window has window.document and window.screen properties. The browser tab's window is the global context, so document and screen refer to window.document and window.screen. More details about the three objects are below, following Flanagan's JavaScript: Definitive Guide.

window

Each browser tab has its own top-level window object. Each <iframe> (and deprecated <frame>) element has its own window object too, nested within a parent window. Each of these windows gets its own separate global object. window.window always refers to window, but window.parent and window.top might refer to enclosing windows, giving access to other execution contexts. In addition to document and screen described below, window properties include

• setTimeout() and setInterval() binding event handlers to a timer
• location giving the current URL
• history with methods back() and forward() giving the tab's mutable history
• navigator describing the browser software

document

Each window object has a document object to be rendered. These objects get confused in part because HTML elements are added to the global object when assigned a unique id. E.g., in the HTML snippet

<body>
  <p id="holyCow"> This is the first paragraph.</p>
</body>

the paragraph element can be referenced by any of the following:

• window.holyCow or window["holyCow"]
• document.getElementById("holyCow")
• document.querySelector("#holyCow")
• document.body.firstChild
• document.body.children[0]

screen

The window object also has a screen object with properties describing the physical display:

• screen properties width and height are the full screen

• screen properties availWidth and availHeight omit the toolbar

The portion of a screen displaying the rendered document is the viewport in JavaScript, which is potentially confusing because we call an application's portion of the screen a window when talking about interactions with the operating system. The getBoundingClientRect() method of any document element will return an object with top, left, bottom, and right properties describing the location of the element in the viewport.

LIB.EXE is the librarian for VS

http://msdn.microsoft.com/en-us/library/7ykb2k5f(VS.80).aspx

(like libtool on Unix)

I had this issue and what I did and solved the problem was that I used AsEnumerable() just before my Join clause. here is my query:

List<AccountViewModel> selectedAccounts;

 using (ctx = SmallContext.GetInstance()) {
                var data = ctx.Transactions.
                    Include(x => x.Source).
                    Include(x => x.Relation).
                    AsEnumerable().
                    Join(selectedAccounts, x => x.Source.Id, y => y.Id, (x, y) => x).
                    GroupBy(x => new { Id = x.Relation.Id, Name = x.Relation.Name }).
                    ToList();
            }

I was wondering why this issue happens, and now I think It is because after you make a query via LINQ, the result will be in memory and not loaded into objects, I don't know what that state is but they are in in some transitional state I think. Then when you use AsEnumerable() or ToList(), etc, you are placing them into physical memory objects and the issue is resolving.

Use this code, was better solution for me.

public static boolean containsWhiteSpace(String line){
    boolean space= false; 
    if(line != null){


        for(int i = 0; i < line.length(); i++){

            if(line.charAt(i) == ' '){
            space= true;
            }

        }
    }
    return space;
}

try to add these lines at the end of the file

<script src="https://code.jquery.com/jquery-3.2.1.slim.min.js" integrity="sha384-KJ3o2DKtIkvYIK3UENzmM7KCkRr/rE9/Qpg6aAZGJwFDMVNA/GpGFF93hXpG5KkN" crossorigin="anonymous"></script>
<script src="https://cdnjs.cloudflare.com/ajax/libs/popper.js/1.12.9/umd/popper.min.js" integrity="sha384-ApNbgh9B+Y1QKtv3Rn7W3mgPxhU9K/ScQsAP7hUibX39j7fakFPskvXusvfa0b4Q" crossorigin="anonymous"></script>
<script src="https://maxcdn.bootstrapcdn.com/bootstrap/4.0.0/js/bootstrap.min.js" integrity="sha384-JZR6Spejh4U02d8jOt6vLEHfe/JQGiRRSQQxSfFWpi1MquVdAyjUar5+76PVCmYl" crossorigin="anonymous"></script>
</body>
</html>

http://docs.python.org/howto/unicode.html#the-unicode-type

str = unicode(str, errors='replace')

or

str = unicode(str, errors='ignore')

Note: This will strip out (ignore) the characters in question returning the string without them.

For me this is ideal case since I'm using it as protection against non-ASCII input which is not allowed by my application.

Alternatively: Use the open method from the codecs module to read in the file:

import codecs
with codecs.open(file_name, 'r', encoding='utf-8',
                 errors='ignore') as fdata:

The official answer from Facebook (http://developers.facebook.com/bugs/282710765082535):

Mikhail,

The facebook android sdk no longer supports android 1.5 and 1.6. Please upgrade to the next api version.

Good luck with your implementation.

Use the in keyword.

if 'apples' in d:
    if d['apples'] == 20:
        print('20 apples')
    else:
        print('Not 20 apples')

If you want to get the value only if the key exists (and avoid an exception trying to get it if it doesn't), then you can use the get function from a dictionary, passing an optional default value as the second argument (if you don't pass it it returns None instead):

if d.get('apples', 0) == 20:
    print('20 apples.')
else:
    print('Not 20 apples.')

find:

^>([^\n\r]+)[\n\r]([A-Z\n\r]+)

\1 = some_varying_text

\2 = lines of all CAPS

Edit (proof that this works):

text = """> some_Varying_TEXT

DSJFKDAFJKDAFJDSAKFJADSFLKDLAFKDSAF
GATACAACATAGGATACA
GGGGGAAAAAAAATTTTTTTTT
CCCCAAAA

> some_Varying_TEXT2

DJASDFHKJFHKSDHF
HHASGDFTERYTERE
GAGAGAGAGAG
PPPPPAAAAAAAAAAAAAAAP
"""

import re

regex = re.compile(r'^>([^\n\r]+)[\n\r]([A-Z\n\r]+)', re.MULTILINE)
matches = [m.groups() for m in regex.finditer(text)]

for m in matches:
    print 'Name: %s\nSequence:%s' % (m[0], m[1])

The best way is to use:

$("#yourid option:selected").text();

Depending on the requirement, you could also use this way:

var v = $("#yourid").val();
$("#yourid option[value="+v+"]").text()

I would recommend setting the HR itself to be 0px high and use its border to be visible instead. I have noticed that when you zoom in and out (ctrl + mouse wheel) the thickness of HR itself changes, while when you set the border it always stays the same:

hr {
    height: 0px;
    border: none;
    border-top: 1px solid black;
}

If you have an array of activerecord relations and want to merge them all, you can do

array.inject(:merge)

You don't have that kind of control with a bare a tag. But you can hook up the tag's onclick handler to call window.open(...) with the right parameters. See here for examples: https://developer.mozilla.org/En/DOM/Window.open

I still don't think you can force window over tab directly though-- that depends on the browser and the user's settings.

It's probably best to use the Python Image Library to do this which I'm afraid is a separate download.

The easiest way to do what you want is via the load() method on the Image object which returns a pixel access object which you can manipulate like an array:

from PIL import Image

im = Image.open('dead_parrot.jpg') # Can be many different formats.
pix = im.load()
print im.size  # Get the width and hight of the image for iterating over
print pix[x,y]  # Get the RGBA Value of the a pixel of an image
pix[x,y] = value  # Set the RGBA Value of the image (tuple)
im.save('alive_parrot.png')  # Save the modified pixels as .png

Alternatively, look at ImageDraw which gives a much richer API for creating images.

You have to add just one line

useLibrary 'org.apache.http.legacy'

into build.gradle(Module: app), for example

apply plugin: 'com.android.application'

android {
    compileSdkVersion 24
    buildToolsVersion "25.0.0"

    useLibrary 'org.apache.http.legacy'

    defaultConfig {
        applicationId "com.avenues.lib.testotpappnew"
        minSdkVersion 15
        targetSdkVersion 24
        versionCode 1
        versionName "1.0"
        testInstrumentationRunner "android.support.test.runner.AndroidJUnitRunner"
    }
    buildTypes {
        release {
            minifyEnabled false
            proguardFiles getDefaultProguardFile('proguard-android.txt'), 'proguard-rules.pro'
        }
    }
}

dependencies {
    compile fileTree(dir: 'libs', include: ['*.jar'])
    androidTestCompile('com.android.support.test.espresso:espresso-core:2.2.2', {
        exclude group: 'com.android.support', module: 'support-annotations'
    })
    compile 'com.android.support:appcompat-v7:24.2.1'
    testCompile 'junit:junit:4.12'
}

You actually got it. Just forgot some quotes.

$(this).css({backgroundColor: 'red'});

or

$(this).css('background-color', 'red');

You don't need to pass over a map/object to set only one property. You can just put pass it as string. Note that if passing an object you cannot use a -. All CSS properties which have such a character are mapped with capital letters.

Reference: .css()

Yes, definietly requests is great package to use in something related to HTTP requests. but we need to be careful with the encoding type of the incoming data as well below is an example which explains the difference

from requests import get

# case when the response is byte array
url = 'some_image_url'

response = get(url)
with open('output', 'wb') as file:
    file.write(response.content)


# case when the response is text
# Here unlikely if the reponse content is of type **iso-8859-1** we will have to override the response encoding
url = 'some_page_url'

response = get(url)
# override encoding by real educated guess as provided by chardet
r.encoding = r.apparent_encoding

with open('output', 'w', encoding='utf-8') as file:
    file.write(response.content)

In PowerShell v5+, there is an Expand-Archive command (as well as Compress-Archive) built in:

Expand-Archive c:\a.zip -DestinationPath c:\a

Well, actually, React is not suitable for calling child methods from the parent. Some frameworks, like Cycle.js, allow easily access data both from parent and child, and react to it.

Also, there is a good chance you don't really need it. Consider calling it into existing component, it is much more independent solution. But sometimes you still need it, and then you have few choices:

• Pass method down, if it is a child (the easiest one, and it is one of the passed properties)
• add events library; in React ecosystem Flux approach is the most known, with Redux library. You separate all events into separated state and actions, and dispatch them from components
• if you need to use function from the child in a parent component, you can wrap in a third component, and clone parent with augmented props.

UPD: if you need to share some functionality which doesn't involve any state (like static functions in OOP), then there is no need to contain it inside components. Just declare it separately and invoke when need:

let counter = 0;
function handleInstantiate() {
   counter++;
}

constructor(props) {
   super(props);
   handleInstantiate();
}

Unfortunately, all of these solutions rely on specifying a fixed width. Since the tables are generated dynamically (statistical results pulled from a database), the width can not be known in advance.

The desired result can be achieved by wrapping the two tables within another table:

<table align="center"><tr><td>
//code for table on the left
</td><td>
//code for table on the right
</td></tr></table>

and the result is a perfectly centered pair of tables that responds fluidly to arbitrary widths and page (re)sizes (and the align="center" table attribute could be hoisted out into an outer div with margin autos).

I conclude that there are some layouts that can only be achieved with tables.

Go to File/Settings, Editor, click on General.

Scroll down, then ? Show quick documentation on mouse move.

Read these tutorials Asp.net Update Panel and Introduction to the UpdatePanel Control

Simple and understandable

Create a new string (string + char)

#include <stdio.h>    
#include <stdlib.h>

#define ERR_MESSAGE__NO_MEM "Not enough memory!"
#define allocator(element, type) _allocator(element, sizeof(type))

/** Allocator function (safe alloc) */
void *_allocator(size_t element, size_t typeSize)
{
    void *ptr = NULL;
    /* check alloc */
    if( (ptr = calloc(element, typeSize)) == NULL)
    {printf(ERR_MESSAGE__NO_MEM); exit(1);}
    /* return pointer */
    return ptr;
}

/** Append function (safe mode) */
char *append(const char *input, const char c)
{
    char *newString, *ptr;

    /* alloc */
    newString = allocator((strlen(input) + 2), char);
    /* Copy old string in new (with pointer) */
    ptr = newString;
    for(; *input; input++) {*ptr = *input; ptr++;}
    /* Copy char at end */
    *ptr = c;
    /* return new string (for dealloc use free().) */
    return newString;
}

/** Program main */
int main (int argc, const char *argv[])
{
    char *input = "Ciao Mondo"; // i am italian :), this is "Hello World"
    char c = '!';
    char *newString;

    newString = append(input, c);
    printf("%s\n",newString);
    /* dealloc */
    free(newString);
    newString = NULL;

    exit(0);
}

              0   1   2   3    4    5   6   7   8   9  10   11
newString is [C] [i] [a] [o] [\32] [M] [o] [n] [d] [o] [!] [\0]

Don't alter the array size ([len +1], etc.) without know its exact size, it may damage other data. alloc an array with the new size and put the old data inside instead, remember that, for a char array, the last value must be \0; calloc() sets all values to \0, which is excellent for char arrays.

I hope this helps.

DateTime temp;
try
{
    temp = Convert.ToDateTime(grd.Rows[e.RowIndex].Cells["dateg"].Value);
    grd.Rows[e.RowIndex].Cells["dateg"].Value = temp.ToString("yyyy/MM/dd");
}
catch 
{   
    MessageBox.Show("Sorry The date not valid", "Error", MessageBoxButtons.OK, MessageBoxIcon.Stop,MessageBoxDefaultButton.Button1,MessageBoxOptions .RightAlign);
    grd.Rows[e.RowIndex].Cells["dateg"].Value = null;
}

Another info: If you want use a Route Constraint, imagine that you want force that parameter has int datatype, then you need use this syntax:

[Route("v1/location/**{deviceOrAppid:int?}**", Name = "AddNewLocation")]

The ? character is put always before the last } character

For more information see: Optional URI Parameters and Default Values

One part of @gaurav solution worked for jQuery 2.1.3 and JQuery UI 1.10.2 with multiple sliders. My project is using four range sliders to filter data with this filter.js plugin. Other solutions were resetting the slider handles back to their starting end points just fine, but apparently they were not firing an event that filter.js understood. So here's how I looped through the sliders:

$("yourSliderSelection").each (function () {
    var hs = $(this); 
    var options = $(this).slider('option');

    //reset the ui
    $(this).slider( 'values', [ options.min, options.max ] ); 

    //refresh/trigger event so that filter.js can reset handling the data
    hs.slider('option', 'slide').call(
        hs, 
        null, 
        {
            handle: $('.ui-slider-handle', hs),
            values: [options.min, options.max]
        }
    );

});

The hs.slider() code resets the data, but not the UI in my scenario. Hope this helps others.

setval('sequence_name', sequence_value)

This is a style choice. It does not impact the performance of the code in the least, it just makes it more verbose for the reader.

mysqli_select_db() should have 2 parameters, the connection link and the database name -

mysqli_select_db($con, 'phpcadet') or die(mysqli_error($con));

Using mysqli_error in the die statement will tell you exactly what is wrong as opposed to a generic error message.

I'll go into differences at the hardware level, on x86. This is mostly irrelevant unless you're writing a compiler or using assembly language. But it's nice to know.

Firstly, x86 has native support for the two's complement representation of signed numbers. You can use other representations but this would require more instructions and generally be a waste of processor time.

What do I mean by "native support"? Basically I mean that there are a set of instructions you use for unsigned numbers and another set that you use for signed numbers. Unsigned numbers can sit in the same registers as signed numbers, and indeed you can mix signed and unsigned instructions without worrying the processor. It's up to the compiler (or assembly programmer) to keep track of whether a number is signed or not, and use the appropriate instructions.

Firstly, two's complement numbers have the property that addition and subtraction is just the same as for unsigned numbers. It makes no difference whether the numbers are positive or negative. (So you just go ahead and ADD and SUB your numbers without a worry.)

The differences start to show when it comes to comparisons. x86 has a simple way of differentiating them: above/below indicates an unsigned comparison and greater/less than indicates a signed comparison. (E.g. JAE means "Jump if above or equal" and is unsigned.)

There are also two sets of multiplication and division instructions to deal with signed and unsigned integers.

Lastly: if you want to check for, say, overflow, you would do it differently for signed and for unsigned numbers.

This stuff comes from ES file explorer

Just go into this app > settings

Then there is an option that says logging floating window, you just need to disable that and you will get rid of this infernal bubble for good

The problem is that echo works only under an execution block. i.e. anything after "xx:"

So anything above the first execution block is just initialization so no execution command can used.

So create a execution blocl

This is a new feature of C# 6 called an expression bodied member that allows you to define a getter only property using a lambda like function.

While it is considered syntactic sugar for the following, they may not produce identical IL:

public int MaxHealth
{
    get
    {
        return Memory[Address].IsValid
               ?   Memory[Address].Read<int>(Offs.Life.MaxHp)
               :   0;
    }
}

It turns out that if you compile both versions of the above and compare the IL generated for each you'll see that they are NEARLY the same.

Here is the IL for the classic version in this answer when defined in a class named TestClass:

.property instance int32 MaxHealth()
{
    .get instance int32 TestClass::get_MaxHealth()
}

.method public hidebysig specialname 
    instance int32 get_MaxHealth () cil managed 
{
    // Method begins at RVA 0x2458
    // Code size 71 (0x47)
    .maxstack 2
    .locals init (
        [0] int32
    )

    IL_0000: nop
    IL_0001: ldarg.0
    IL_0002: ldfld class [mscorlib]System.Collections.Generic.Dictionary`2<int64, class MemoryAddress> TestClass::Memory
    IL_0007: ldarg.0
    IL_0008: ldfld int64 TestClass::Address
    IL_000d: callvirt instance !1 class [mscorlib]System.Collections.Generic.Dictionary`2<int64, class MemoryAddress>::get_Item(!0)
    IL_0012: ldfld bool MemoryAddress::IsValid
    IL_0017: brtrue.s IL_001c

    IL_0019: ldc.i4.0
    IL_001a: br.s IL_0042

    IL_001c: ldarg.0
    IL_001d: ldfld class [mscorlib]System.Collections.Generic.Dictionary`2<int64, class MemoryAddress> TestClass::Memory
    IL_0022: ldarg.0
    IL_0023: ldfld int64 TestClass::Address
    IL_0028: callvirt instance !1 class [mscorlib]System.Collections.Generic.Dictionary`2<int64, class MemoryAddress>::get_Item(!0)
    IL_002d: ldarg.0
    IL_002e: ldfld class Offs TestClass::Offs
    IL_0033: ldfld class Life Offs::Life
    IL_0038: ldfld int64 Life::MaxHp
    IL_003d: callvirt instance !!0 MemoryAddress::Read<int32>(int64)

    IL_0042: stloc.0
    IL_0043: br.s IL_0045

    IL_0045: ldloc.0
    IL_0046: ret
} // end of method TestClass::get_MaxHealth

And here is the IL for the expression bodied member version when defined in a class named TestClass:

.property instance int32 MaxHealth()
{
    .get instance int32 TestClass::get_MaxHealth()
}

.method public hidebysig specialname 
    instance int32 get_MaxHealth () cil managed 
{
    // Method begins at RVA 0x2458
    // Code size 66 (0x42)
    .maxstack 2

    IL_0000: ldarg.0
    IL_0001: ldfld class [mscorlib]System.Collections.Generic.Dictionary`2<int64, class MemoryAddress> TestClass::Memory
    IL_0006: ldarg.0
    IL_0007: ldfld int64 TestClass::Address
    IL_000c: callvirt instance !1 class [mscorlib]System.Collections.Generic.Dictionary`2<int64, class MemoryAddress>::get_Item(!0)
    IL_0011: ldfld bool MemoryAddress::IsValid
    IL_0016: brtrue.s IL_001b

    IL_0018: ldc.i4.0
    IL_0019: br.s IL_0041

    IL_001b: ldarg.0
    IL_001c: ldfld class [mscorlib]System.Collections.Generic.Dictionary`2<int64, class MemoryAddress> TestClass::Memory
    IL_0021: ldarg.0
    IL_0022: ldfld int64 TestClass::Address
    IL_0027: callvirt instance !1 class [mscorlib]System.Collections.Generic.Dictionary`2<int64, class MemoryAddress>::get_Item(!0)
    IL_002c: ldarg.0
    IL_002d: ldfld class Offs TestClass::Offs
    IL_0032: ldfld class Life Offs::Life
    IL_0037: ldfld int64 Life::MaxHp
    IL_003c: callvirt instance !!0 MemoryAddress::Read<int32>(int64)

    IL_0041: ret
} // end of method TestClass::get_MaxHealth

See https://msdn.microsoft.com/en-us/magazine/dn802602.aspx for more information on this and other new features in C# 6.

See this post Difference between Property and Field in C# 3.0+ on the difference between a field and a property getter in C#.

Update:

Note that expression-bodied members were expanded to include properties, constructors, finalizers and indexers in C# 7.0.

This can also occur when:

1. You ran a process inside a Docker container, and:

2. Some files were generated by that process, and:

3. The destination of the files is mounted as a volume on the Docker host, and:

4. You are running git on the Docker host.

If this is the case, stage the files you wish to commit and run:

git diff --name-only --cached | xargs ls -l 

Files which meet the above criteria will be prefixed with:

-rw-r--r-- 1 root root ...

They are owned by root and not writable, which is not good. To fix that run:

 git diff --name-only --cached | xargs -i sh -c 'sudo chown $USER:$USER {}; chmod +w {}'

A cleaner solution would probably be to use the --user option, see this for Docker and this for Docker compose.

This is simple.

decimal decNumber = Convert.ToDecimal(value);
        return decNumber.ToString("0.####");

Tested.

Cheers :)

Those are the home directories of the users. Try cd ~(your username), for example.

There are two ways to go about doing this.

1. Create a state in the constructor that contains the text input. Attach an onChange event to the input box that updates state each time. Then onClick you could just alert the state object.

2. handleClick: function() { alert(this.refs.myInput.value); },

Installing psqlODBC on 64bit Windows

Though you can install 32 bit ODBC drivers on Win X64 as usual, you can't configure 32-bit DSNs via ordinary control panel or ODBC datasource administrator.

How to configure 32 bit ODBC drivers on Win x64

Configure ODBC DSN from %SystemRoot%\syswow64\odbcad32.exe

1. Start > Run
2. Enter: %SystemRoot%\syswow64\odbcad32.exe
3. Hit return.
4. Open up ODBC and select under the System DSN tab.
5. Select PostgreSQL Unicode

You may have to play with it and try different scenarios, think outside-the-box, remember this is open source.

Here, How I fixed an edit in a previous commit:

1. Save your work so far.

2. Stash your changes away for now if made: git stash Now your working copy is clean at the state of your last commit.

3. Make the edits and fixes.

4. Commit the changes in "amend" mode: git commit --all --amend

5. Your editor will come up asking for a log message (by default, the old log message). Save and quit the editor when you're happy with it.

   The new changes are added on to the old commit. See for yourself with git log and git diff HEAD^

6. Re-apply your stashed changes, if made: git stash apply

Also, you could use regex findall. It's a more general solution since it adds more control over the length of the number. It could be helpful in cases where you require a number with minimal length.

True if len(''.join(re.findall('\d+', '67389kjsdk'))) > 0 else False

Hope it helps some else.

You did not provide your validate.php code so I'm confused. You have to pass the data in JSON Format when when mail is success. You can use json_encode(); PHP function for that.

Add json_encdoe in validate.php in last

mail($to, $subject, $message, $headers); 
echo json_encode(array('success'=>'true'));

JS Code

success: function(data){ 
     if(data.success == true){ 
       alert('success'); 
    } 

Hope it works

I've used Blat ( http://www.blat.net/ ) for many years. It's a simple command line utility that can send email from command line. It's free and opensource.

You can use command like "Blat myfile.txt -to [email protected] -server smtp.domain.com -port 6000"

Here is some other software you can try to send email from command line (I've never used them):
http://caspian.dotconf.net/menu/Software/SendEmail/
http://www.petri.co.il/sendmail.htm
http://www.petri.co.il/software/mailsend105.zip
http://retired.beyondlogic.org/solutions/cmdlinemail/cmdlinemail.htm

Here ( http://www.petri.co.il/send_mail_from_script.htm ) you can find other various way of sending email from a VBS script, plus link to some of the mentioned software

The following VBScript code is taken from that page

Set objEmail = CreateObject("CDO.Message")
objEmail.From = "[email protected]"
objEmail.To = "[email protected]"
objEmail.Subject = "Server is down!"
objEmail.Textbody = "Server100 is no longer accessible over the network."
objEmail.Send

Save the file as something.vbs

Set Msg = CreateObject("CDO.Message")

With Msg

 .To = "[email protected]"
 .From = "[email protected]"
 .Subject = "Hello"
 .TextBody = "Just wanted to say hi."
 .Send

End With

Save the file as something2.vbs

I think these VBS scripts use the windows default mail server, if present. I've not tested these scripts...

There is a small issue in the First two configurations i think. The concepts of threads and cores like follows. The concept of threading is if the cores are ideal then use that core to process the data. So the memory is not fully utilized in first two cases. If you want to bench mark this example choose the machines which has more than 10 cores on each machine. Then do the bench mark.

But dont give more than 5 cores per executor there will be bottle neck on i/o performance.

So the best machines to do this bench marking might be data nodes which have 10 cores.

Data node machine spec: CPU: Core i7-4790 (# of cores: 10, # of threads: 20) RAM: 32GB (8GB x 4) HDD: 8TB (2TB x 4)

[
  {
    "name": "Pizza",
    "price": "10",
    "quantity": "7"
  },
  {
    "name": "Cerveja",
    "price": "12",
    "quantity": "5"
  },
  {
    "name": "Hamburguer",
    "price": "10",
    "quantity": "2"
  },
  {
    "name": "Fraldas",
    "price": "6",
    "quantity": "2"
  }
]

Here is your perfect Json that you can parse.

You can use the this customization to change the default mapping to java.util.Date

<xsd:annotation>
<xsd:appinfo>
    <jaxb:globalBindings>
        <jaxb:javaType name="java.util.Date" xmlType="xsd:dateTime"
                 parseMethod="org.apache.cxf.xjc.runtime.DataTypeAdapter.parseDateTime"
                 printMethod="org.apache.cxf.xjc.runtime.DataTypeAdapter.printDateTime"/>
    </jaxb:globalBindings>
</xsd:appinfo>

vim-gitgutter plugin can stage hunks without leaving vim editor using

:GitGutterStageHunk

Beside this, it provides other cool features like a diff sign column as in some modern IDEs

If only part of hunk should be staged vim-fugitive

:Gdiff

allows visual range selection then :'<,'>diffput or :'<,'>diffget to stage/revert individual line changes.

USING A VISUAL DIFF TOOL

The Default Answer (at the command line)

The top answers here correctly show how to view the cached/staged changes in the Index:

$ git diff --cached

or $ git diff --staged which is an alias.

Launching the Visual Diff Tool Instead

The default answer will spit out the diff changes at the git bash (i.e. on the command line or in the console). For those who prefer a visual representation of the staged file differences, there is a script available within git which launches a visual diff tool for each file viewed rather than showing them on the command line, called difftool:

$ git difftool --staged

This will do the same this as git diff --staged, except any time the diff tool is run (i.e. every time a file is processed by diff), it will launch the default visual diff tool (in my environment, this is kdiff3).

After the tool launches, the git diff script will pause until your visual diff tool is closed. Therefore, you will need to close each file in order to see the next one.

You Can Always Use difftool in place of diff in git commands

For all your visual diff needs, git difftool will work in place of any git diff command, including all options.

For example, to have the visual diff tool launch without asking whether to do it for each file, add the -y option (I think usually you'll want this!!):

$ git difftool -y --staged

In this case it will pull up each file in the visual diff tool, one at a time, bringing up the next one after the tool is closed.

Or to look at the diff of a particular file that is staged in the Index:

$ git difftool -y --staged <<relative path/filename>>

For all the options, see the man page:

$ git difftool --help

Setting up Visual Git Tool

To use a visual git tool other than the default, use the -t <tool> option:

$ git difftool -t <tool> <<other args>>

Or, see the difftool man page for how to configure git to use a different default visual diff tool.

Example .gitconfig entries for vscode as diff/merge tool

Part of setting up a difftool involves changing the .gitconfig file, either through git commands that change it behind the scenes, or editing it directly.

You can find your .gitconfig in your home directory,such as ~ in Unix or normally c:\users\<username> on Windows).

Or, you can open the user .gitconfig in your default Git editor with git config -e --global.

Here are example entries in my global user .gitconfig for VS Code as both diff tool and merge tool:

[diff]
    tool = vscode
    guitool = vscode
[merge]
    tool = vscode
    guitool = vscode
[mergetool]
    prompt = true
[difftool "vscode"]
    cmd = code --wait --diff \"$LOCAL\" \"$REMOTE\"
    path = c:/apps/vscode/code.exe
[mergetool "vscode"]
    cmd = code --wait \"$MERGED\"
    path = c:/apps/vscode/code.exe

It's on the top of the Homebrew homepage.

From a Terminal prompt:

ruby -e "$(curl -fsSL https://raw.githubusercontent.com/Homebrew/install/master/install)"

The command brew install wget is an example of how to use Homebrew to install another application (in this case, wget) after brew is already installed.

Edit:

Above command to install the Brew is migrated to:

/bin/bash -c "$(curl -fsSL https://raw.githubusercontent.com/Homebrew/install/master/install.sh)"

Just tried this recently and when trying to select the JDK... /System/Library/Java/JavaVirtualMachines/ appears as empty when opening&selecting through IntelliJ. Therefore i couldn't select the JDK...

I've found that to workaround this, when the finder windows open (pressing [+] JDK) just use the shortcut Shift + CMD + G to specify the path. (/System/Library/Java/JavaVirtualMachines/1.6.0.jdk in my case)

And voila, IntelliJ can find everything from that point on.

Please use below code

app.use(fileUpload());

Using Perl:

perl -p -i -e 's/ /\t/g' file.txt

It seems that you want to use step parameter of range function. From documentation:

range(start, stop[, step]) This is a versatile function to create lists containing arithmetic progressions. It is most often used in for loops. The arguments must be plain integers. If the step argument is omitted, it defaults to 1. If the start argument is omitted, it defaults to 0. The full form returns a list of plain integers [start, start + step, start + 2 * step, ...]. If step is positive, the last element is the largest start + i * step less than stop; if step is negative, the last element is the smallest start + i * step greater than stop. step must not be zero (or else ValueError is raised). Example:

 >>> range(10) [0, 1, 2, 3, 4, 5, 6, 7, 8, 9]
 >>> range(1, 11) [1, 2, 3, 4, 5, 6, 7, 8, 9, 10]
 >>> range(0, 30, 5) [0, 5, 10, 15, 20, 25]
 >>> range(0, 10, 3) [0, 3, 6, 9]
 >>> range(0, -10, -1) [0, -1, -2, -3, -4, -5, -6, -7, -8, -9]
 >>> range(0) []
 >>> range(1, 0) []

In your case to get [0,2,4] you can use:

range(0,6,2)

OR in your case when is a var:

idx = None
for i in range(len(str1)):
    if idx and i < idx:
        continue
    for j in range(len(str2)):
        if str1[i+j] != str2[j]:
            break
    else:
        idx = i+j

Here is one way to “untrack” any files that are would otherwise be ignored under the current set of exclude patterns:

(GIT_INDEX_FILE=some-non-existent-file \
git ls-files --exclude-standard --others --directory --ignored -z) |
xargs -0 git rm --cached -r --ignore-unmatch --

This leaves the files in your working directory but removes them from the index.

The trick used here is to provide a non-existent index file to git ls-files so that it thinks there are no tracked files. The shell code above asks for all the files that would be ignored if the index were empty and then removes them from the actual index with git rm.

After the files have been “untracked”, use git status to verify that nothing important was removed (if so adjust your exclude patterns and use git reset -- path to restore the removed index entry). Then make a new commit that leaves out the “crud”.

The “crud” will still be in any old commits. You can use git filter-branch to produce clean versions of the old commits if you really need a clean history (n.b. using git filter-branch will “rewrite history”, so it should not be undertaken lightly if you have any collaborators that have pulled any of your historical commits after the “crud” was first introduced).

for switch to another page, try with this code:

viewPager.postDelayed(new Runnable()
{
    @Override
    public void run()
    {
        viewPager.setCurrentItem(num, true);
    }
}, 100);

I have Had the same issue and the only Solution i found was open Package manager> Select Microsoft and .Net as Package Source and You will install it..

LDAP is a standard, AD is Microsoft's (proprietary) implementation (and more). Wikipedia has a good article that delves into the specifics. I found this document with a very detailed evaluation of AD from an LDAP perspective.

You need convert list to numpy array and then reshape:

df = pd.DataFrame(np.array(my_list).reshape(3,3), columns = list("abc"))
print (df)
   a  b  c
0  1  2  3
1  4  5  6
2  7  8  9

Your linker (ld) obviously doesn't like the order in which make arranges the GCC arguments so you'll have to change your Makefile a bit:

CC=gcc
CFLAGS=-Wall
LDFLAGS=-lm

.PHONY: all
all: client

.PHONY: clean
clean:
    $(RM) *~ *.o client

OBJECTS=client.o
client: $(OBJECTS)
    $(CC) $(CFLAGS) $(OBJECTS) -o client $(LDFLAGS)

In the line defining the client target change the order of $(LDFLAGS) as needed.

warning! this does not work with links.

var variable = 'variable', another = 'another';

['I would', 'like to'].join(' ') + ' a js ' + variable + ' together with ' + another + ' to create ' + [another, ...[variable].concat('name')].join(' ').concat('...');

You can add the script tags like how we use in the asp.net while doing client side validations like below.

@{
    ViewBag.Title = "Index";
}

<h2>Index</h2>
<script type="text/javascript" src="~/Scripts/jquery-3.1.1.min.js"></script>
<script type="text/javascript">
    $(function () {
       //Your code
    });
</script>

When compiling memcached under Centos 5.x i got the same problem.

The solution is to upgrade gcc and g++ to version 4.4 at least.

Make sure your CC/CXX is set (exported) to right binaries before compiling.

if ($inputs['type'] == 'attach') {

The code is valid, but it expects the function parameter $inputs to be an array. The "Illegal string offset" warning when using $inputs['type'] means that the function is being passed a string instead of an array. (And then since a string offset is a number, 'type' is not suitable.)

So in theory the problem lies elsewhere, with the caller of the code not providing a correct parameter.

However, this warning message is new to PHP 5.4. Old versions didn't warn if this happened. They would silently convert 'type' to 0, then try to get character 0 (the first character) of the string. So if this code was supposed to work, that's because abusing a string like this didn't cause any complaints on PHP 5.3 and below. (A lot of old PHP code has experienced this problem after upgrading.)

You might want to debug why the function is being given a string by examining the calling code, and find out what value it has by doing a var_dump($inputs); in the function. But if you just want to shut the warning up to make it behave like PHP 5.3, change the line to:

if (is_array($inputs) && $inputs['type'] == 'attach') {

Try this:

/[^{\}]+(?=})/g

For example

Welcome to RegExr v2.1 by #{gskinner.com},  #{ssd.sd} hosted by Media Temple!

will return gskinner.com, ssd.sd.

Have a look at the functions strcmp and strncmp.

This is what worked for me: instead of

<script src="https://cdn.jsdelivr.net/npm/@tensorflow/tfjs"></script>

try

<script src="https://cdn.jsdelivr.net/npm/@tensorflow/tfjs/dist/tf.min.js"> </script>

After that change I am not seeing the error anymore.

How about something like:

includes = $(wildcard include/*.h)

%.o: %.c ${includes}
    gcc -Wall -Iinclude ...

You could also use the wildcards directly, but I tend to find I need them in more than one place.

Note that this only works well on small projects, since it assumes that every object file depends on every header file.

Here's a minimalist version.

var isDate = function (date) {
    return!!(function(d){return(d!=='Invalid Date'&&!isNaN(d))})(new Date(date));
}

You can use

git rm -r --cached -- "path/to/directory"

to stage a deleted directory.

I had a similar issue using an X/Y chart but then also needed to calculate the correlation function on the two sets of Data.

=IF(A1>A2,A3,#N/A) allows the chart to be plotted but correlation of X & Y fails.

I solved this by =IF(A1>A2,A3,FALSE)

The FALSE can then be removed using conditional formatting or other tricks

It's very simple to control custom messages with the help of HTML5 event oninvalid

Here is code:

<input id="UserID"  type="text" required="required"
       oninvalid="this.setCustomValidity('Witinnovation')"
       onvalid="this.setCustomValidity('')">

This is most important:

onvalid="this.setCustomValidity('')"

I would like to mention that there's exception (not only) for 404 by default provided by Spring. See Spring documentation for details. So if you do not need your own exception you can simply do this:

 @RequestMapping(value = "/**", method = RequestMethod.GET)
 public ModelAndView show() throws NoSuchRequestHandlingMethodException {
    if(something == null)
         throw new NoSuchRequestHandlingMethodException("show", YourClass.class);

    ...

  }

The below code always gives the public IP of the client (and not a private IP behind a proxy).

from flask import request

if request.environ.get('HTTP_X_FORWARDED_FOR') is None:
    print(request.environ['REMOTE_ADDR'])
else:
    print(request.environ['HTTP_X_FORWARDED_FOR']) # if behind a proxy

Finish closes the whole application, this is is something i hate in Android development not finish that is fine but that they do not keep up wit ok syntax they have

startActivity(intent)

Why not

closeActivity(intent) ?

I used to send some values from my listview

How to send

mListview.setOnItemLongClickListener(new AdapterView.OnItemLongClickListener() {
        @Override
        public boolean onItemLongClick(AdapterView<?> parent, View view, int position, long id) {
            Favorite clickedObj = (Favorite) parent.getItemAtPosition(position);

            Bundle args = new Bundle();
            args.putString("tar_name", clickedObj.getNameTarife());
            args.putString("fav_name", clickedObj.getName());

            FragmentManager fragmentManager = getSupportFragmentManager();
            TarifeDetayPopup userPopUp = new TarifeDetayPopup();
            userPopUp.setArguments(args);
            userPopUp.show(fragmentManager, "sam");

            return false;
        }
    });

How to receive inside onCreate() method of DialogFragment

    Bundle mArgs = getArguments();
    String nameTrife = mArgs.getString("tar_name");
    String nameFav = mArgs.getString("fav_name");
    String name = "";

// Kotlin upload

 val fm = supportFragmentManager
        val dialogFragment = AddProgFargmentDialog() // my custom FargmentDialog
        var args: Bundle? = null
        args?.putString("title", model.title);
        dialogFragment.setArguments(args)
        dialogFragment.show(fm, "Sample Fragment")

// receive

 override fun onCreate(savedInstanceState: Bundle?) {
        super.onCreate(savedInstanceState)
        if (getArguments() != null) {
            val mArgs = arguments
            var myDay= mArgs.getString("title")
        }
    }

<%= link_to "http://www.facebook.com/sharer.php?u=" + article_url(article, :text => article.title), :class => "btn btn-primary" do %>   <i class="fa fa-facebook">     Facebook Share    </i> <%end%> 

I am assuming that current_article_url is http://0.0.0.0:4567/link_to_title

If you are the only the person working on the project, what you can do is:

 git checkout master
 git push origin +HEAD

This will set the tip of origin/master to the same commit as master (and so delete the commits between 41651df and origin/master)

Step 01: You need to add jenkins for environment variables, Then you can use jenkins commands

Step 02: Go to "C:\Program Files (x86)\Jenkins" with admin prompt

Step 03: Choose your option: jenkins.exe stop / jenkins.exe start / jenkins.exe restart

$_SESSION is your friend if you don't want to mess with Javascript

Let's say you're trying to pass an email:

On page A:

// Start the session
session_start();

// Set session variables
$_SESSION["email"] = "[email protected]";

header('Location: page_b.php');

And on Page B:

// Start the session
session_start();

// Show me the session!  
echo "<pre>";
print_r($_SESSION);
echo "</pre>";

To destroy the session

unset($_SESSION['email']);
session_destroy();

Call this method to check the network Connection.

public static bool IsConnectedToInternet()
        {
            bool returnValue = false;
            try
            {

                int Desc;
                returnValue = Utility.InternetGetConnectedState(out Desc, 0);
            }
            catch
            {
                returnValue = false;
            }
            return returnValue;
        }

Put this below line of code.

[DllImport("wininet.dll")]
        public extern static bool InternetGetConnectedState(out int Description, int ReservedValue);

I'm not allowed to use Turn Windows features on or off, but running all of these commands in an elevated command prompt (Run as Administrator) finally got Active Directory Users and Computers to show up under Administrative Tools on the start menu:

dism /online /enable-feature /featurename:RemoteServerAdministrationTools
dism /online /enable-feature /featurename:RemoteServerAdministrationTools-Roles
dism /online /enable-feature /featurename:RemoteServerAdministrationTools-Roles-AD
dism /online /enable-feature /featurename:RemoteServerAdministrationTools-Roles-AD-DS
dism /online /enable-feature /featurename:RemoteServerAdministrationTools-Roles-AD-DS-SnapIns
dism /online /enable-feature /featurename:RemoteServerAdministrationTools-Roles-AD-DS-AdministrativeCenter
dism /online /enable-feature /featurename:RemoteServerAdministrationTools-Roles-AD-DS-NIS
dism /online /enable-feature /featurename:RemoteServerAdministrationTools-Roles-AD-LDS
dism /online /enable-feature /featurename:RemoteServerAdministrationTools-Roles-AD-Powershell

I had downloaded and installed the RSAT (Windows 7 Link, Windows Vista Link) before running these commands.

It's quite likely that this is more than you features than you actually need, but at least it's not too few.

Great Answer by Jon.

I'm lazy though and I hate typing, so I created a simple cut and paste example for all the other people who are like me. Enjoy!

import java.util.ArrayList;
import java.util.List;

public class Main {

    public static void main(String[] args) {

        List<String> animals = new ArrayList<>();

        animals.add("Lion");
        animals.add("Tiger");
        animals.add("Cat");
        animals.add("Dog");

        System.out.println(animals); // [Lion, Tiger, Cat, Dog]

        // add() -> push(): Add items to the end of an array
        animals.add("Elephant");
        System.out.println(animals);  // [Lion, Tiger, Cat, Dog, Elephant]

        // remove() -> pop(): Remove an item from the end of an array
        animals.remove(animals.size() - 1);
        System.out.println(animals); // [Lion, Tiger, Cat, Dog]

        // add(0,"xyz") -> unshift(): Add items to the beginning of an array
        animals.add(0, "Penguin");
        System.out.println(animals); // [Penguin, Lion, Tiger, Cat, Dog]

        // remove(0) -> shift(): Remove an item from the beginning of an array
        animals.remove(0);
        System.out.println(animals); // [Lion, Tiger, Cat, Dog]

    }

}

Using jQuery 1.9 and above:

$("#mySelect :selected").prop('selected', false);

1. User-defined Exception can be Checked Exception or Unchecked Exception, It depends on the class it is extending to.

2. User-defined Exception can be Custom Checked Exception, if it is extending to Exception class

3. User-defined Exception can be Custom Unchecked Exception , if it is extending to Run time Exception class.

4. Define a class and make it a child to Exception or Run time Exception

The following configs works on Cent OS 6 or earlier

As stated above first have to disable selinux.

Step 1 nano /etc/sysconfig/selinux

Make sure the file has this configurations

SELINUX=disabled

SELINUXTYPE=targeted

Then restart the system

Step 2

iptables -A INPUT -m state --state NEW -p tcp --dport 8080 -j ACCEPT

Step 3

sudo service iptables save

For Cent OS 7

step 1

firewall-cmd --zone=public --permanent --add-port=8080/tcp

Step 2

firewall-cmd --reload

To blank it:

myObject["myVar"]=null;

To remove it:

delete myObject["myVar"]

as you can see in duplicate answers

One should check if QtyToRepair is updated at first.

ALTER TRIGGER [dbo].[tr_SCHEDULE_Modified]
   ON [dbo].[SCHEDULE]
   AFTER UPDATE
AS 
BEGIN
SET NOCOUNT ON;
    IF UPDATE (QtyToRepair) 
    BEGIN
        UPDATE SCHEDULE 
        SET modified = GETDATE()
           , ModifiedUser = SUSER_NAME()
           , ModifiedHost = HOST_NAME()
        FROM SCHEDULE S INNER JOIN Inserted I 
            ON S.OrderNo = I.OrderNo and S.PartNumber =    I.PartNumber
        WHERE S.QtyToRepair <> I.QtyToRepair
    END
END

If you can count on it always having 2 decimal places, you can just use a string operation:

$decimal = 1.25;
substr($decimal,-2);  // returns "25" as a string

No idea of performance but for my simple case this was much better...

Preface
Much of the information in this answer has been gathered based on experiments run on a Vista machine. Unless explicitly stated otherwise, I have not confirmed whether the information applies to other Windows versions.

FINDSTR output
The documentation never bothers to explain the output of FINDSTR. It alludes to the fact that matching lines are printed, but nothing more.

The format of matching line output is as follows:

filename:lineNumber:lineOffset:text

where

fileName: = The name of the file containing the matching line. The file name is not printed if the request was explicitly for a single file, or if searching piped input or redirected input. When printed, the fileName will always include any path information provided. Additional path information will be added if the /S option is used. The printed path is always relative to the provided path, or relative to the current directory if none provided.

Note - The filename prefix can be avoided when searching multiple files by using the non-standard (and poorly documented) wildcards < and >. The exact rules for how these wildcards work can be found here. Finally, you can look at this example of how the non-standard wildcards work with FINDSTR.

lineNumber: = The line number of the matching line represented as a decimal value with 1 representing the 1st line of the input. Only printed if /N option is specified.

lineOffset: = The decimal byte offset of the start of the matching line, with 0 representing the 1st character of the 1st line. Only printed if /O option is specified. This is not the offset of the match within the line. It is the number of bytes from the beginning of the file to the beginning of the line.

text = The binary representation of the matching line, including any <CR> and/or <LF>. Nothing is left out of the binary output, such that this example that matches all lines will produce an exact binary copy of the original file.

FINDSTR "^" FILE >FILE_COPY

The /A option sets the color of the fileName:, lineNumber:, and lineOffset: output only. The text of the matching line is always output with the current console color. The /A option only has effect when output is displayed directly to the console. The /A option has no effect if the output is redirected to a file or piped. See the 2018-08-18 edit in Aacini's answer for a description of the buggy behavior when output is redirected to CON.

Most control characters and many extended ASCII characters display as dots on XP
FINDSTR on XP displays most non-printable control characters from matching lines as dots (periods) on the screen. The following control characters are exceptions; they display as themselves: 0x09 Tab, 0x0A LineFeed, 0x0B Vertical Tab, 0x0C Form Feed, 0x0D Carriage Return.

XP FINDSTR also converts a number of extended ASCII characters to dots as well. The extended ASCII characters that display as dots on XP are the same as those that are transformed when supplied on the command line. See the "Character limits for command line parameters - Extended ASCII transformation" section, later in this post

Control characters and extended ASCII are not converted to dots on XP if the output is piped, redirected to a file, or within a FOR IN() clause.

Vista and Windows 7 always display all characters as themselves, never as dots.

Return Codes (ERRORLEVEL)

• 0 (success)
  • Match was found in at least one line of at least one file.
• 1 (failure)
  • No match was found in any line of any file.
  • Invalid color specified by /A:xx option
• 2 (error)
  • Incompatible options /L and /R both specified
  • Missing argument after /A:, /F:, /C:, /D:, or /G:
  • File specified by /F:file or /G:file not found
• 255 (error)
  • Too many regular expression character class terms
    see Regex character class term limit and BUG in part 2 of answer

Source of data to search (Updated based on tests with Windows 7)
Findstr can search data from only one of the following sources:

• filenames specified as arguments and/or using the /F:file option.

• stdin via redirection findstr "searchString" <file

• data stream from a pipe type file | findstr "searchString"

Arguments/options take precedence over redirection, which takes precedence over piped data.

File name arguments and /F:file may be combined. Multiple file name arguments may be used. If multiple /F:file options are specified, then only the last one is used. Wild cards are allowed in filename arguments, but not within the file pointed to by /F:file.

Source of search strings (Updated based on tests with Windows 7)
The /G:file and /C:string options may be combined. Multiple /C:string options may be specified. If multiple /G:file options are specified, then only the last one is used. If either /G:file or /C:string is used, then all non-option arguments are assumed to be files to search. If neither /G:file nor /C:string is used, then the first non-option argument is treated as a space delimited list of search terms.

File names must not be quoted within the file when using the /F:FILE option.
File names may contain spaces and other special characters. Most commands require that such file names are quoted. But the FINDSTR /F:files.txt option requires that filenames within files.txt must NOT be quoted. The file will not be found if the name is quoted.

BUG - Short 8.3 filenames can break the /D and /S options
As with all Windows commands, FINDSTR will attempt to match both the long name and the short 8.3 name when looking for files to search. Assume the current folder contains the following non-empty files:

b1.txt
b.txt2
c.txt

The following command will successfully find all 3 files:

findstr /m "^" *.txt

b.txt2 matches because the corresponding short name B9F64~1.TXT matches. This is consistent with the behavior of all other Windows commands.

But a bug with the /D and /S options causes the following commands to only find b1.txt

findstr /m /d:. "^" *.txt
findstr /m /s "^" *.txt

The bug prevents b.txt2 from being found, as well as all file names that sort after b.txt2 within the same directory. Additional files that sort before, like a.txt, are found. Additional files that sort later, like d.txt, are missed once the bug has been triggered.

Each directory searched is treated independently. For example, the /S option would successfully begin searching in a child folder after failing to find files in the parent, but once the bug causes a short file name to be missed in the child, then all subsequent files in that child folder would also be missed.

The commands work bug free if the same file names are created on a machine that has NTFS 8.3 name generation disabled. Of course b.txt2 would not be found, but c.txt would be found properly.

Not all short names trigger the bug. All instances of bugged behavior I have seen involve an extension that is longer than 3 characters with a short 8.3 name that begins the same as a normal name that does not require an 8.3 name.

The bug has been confirmed on XP, Vista, and Windows 7.

Non-Printable characters and the /P option
The /P option causes FINDSTR to skip any file that contains any of the following decimal byte codes:
0-7, 14-25, 27-31.

Put another way, the /P option will only skip files that contain non-printable control characters. Control characters are codes less than or equal to 31 (0x1F). FINDSTR treats the following control characters as printable:

 8  0x08  backspace
 9  0x09  horizontal tab
10  0x0A  line feed
11  0x0B  vertical tab
12  0x0C  form feed
13  0x0D  carriage return
26  0x1A  substitute (end of text)

All other control characters are treated as non-printable, the presence of which causes the /P option to skip the file.

Piped and Redirected input may have <CR><LF> appended
If the input is piped in and the last character of the stream is not <LF>, then FINDSTR will automatically append <CR><LF> to the input. This has been confirmed on XP, Vista and Windows 7. (I used to think that the Windows pipe was responsible for modifying the input, but I have since discovered that FINDSTR is actually doing the modification.)

The same is true for redirected input on Vista. If the last character of a file used as redirected input is not <LF>, then FINDSTR will automatically append <CR><LF> to the input. However, XP and Windows 7 do not alter redirected input.

FINDSTR hangs on XP and Windows 7 if redirected input does not end with <LF>
This is a nasty "feature" on XP and Windows 7. If the last character of a file used as redirected input does not end with <LF>, then FINDSTR will hang indefinitely once it reaches the end of the redirected file.

Last line of Piped data may be ignored if it consists of a single character
If the input is piped in and the last line consists of a single character that is not followed by <LF>, then FINDSTR completely ignores the last line.

Example - The first command with a single character and no <LF> fails to match, but the second command with 2 characters works fine, as does the third command that has one character with terminating newline.

> set /p "=x" <nul | findstr "^"

> set /p "=xx" <nul | findstr "^"
xx

> echo x| findstr "^"
x

Reported by DosTips user Sponge Belly at new findstr bug. Confirmed on XP, Windows 7 and Windows 8. Haven't heard about Vista yet. (I no longer have Vista to test).

Option syntax
Option letters are not case sensitive, so /i and /I are equivalent.

Options can be prefixed with either / or - Options may be concatenated after a single / or -. However, the concatenated option list may contain at most one multicharacter option such as OFF or F:, and the multi-character option must be the last option in the list.

The following are all equivalent ways of expressing a case insensitive regex search for any line that contains both "hello" and "goodbye" in any order

• /i /r /c:"hello.*goodbye" /c:"goodbye.*hello"

• -i -r -c:"hello.*goodbye" /c:"goodbye.*hello"

• /irc:"hello.*goodbye" /c:"goodbye.*hello"

Options may also be quoted. So /i, -i, "/i" and "-i" are all equivalent. Likewise, /c:string, "/c":string, "/c:"string and "/c:string" are all equivalent.

If a search string begins with a / or - literal, then the /C or /G option must be used. Thanks to Stephan for reporting this in a comment (since deleted).

Search String length limits
On Vista the maximum allowed length for a single search string is 511 bytes. If any search string exceeds 511 then the result is a FINDSTR: Search string too long. error with ERRORLEVEL 2.

When doing a regular expression search, the maximum search string length is 254. A regular expression with length between 255 and 511 will result in a FINDSTR: Out of memory error with ERRORLEVEL 2. A regular expression length >511 results in the FINDSTR: Search string too long. error.

On Windows XP the search string length is apparently shorter. Findstr error: "Search string too long": How to extract and match substring in "for" loop? The XP limit is 127 bytes for both literal and regex searches.

Line Length limits
Files specified as a command line argument or via the /F:FILE option have no known line length limit. Searches were successfully run against a 128MB file that did not contain a single <LF>.

Piped data and Redirected input is limited to 8191 bytes per line. This limit is a "feature" of FINDSTR. It is not inherent to pipes or redirection. FINDSTR using redirected stdin or piped input will never match any line that is >=8k bytes. Lines >= 8k generate an error message to stderr, but ERRORLEVEL is still 0 if the search string is found in at least one line of at least one file.

Default type of search: Literal vs Regular Expression
/C:"string" - The default is /L literal. Explicitly combining the /L option with /C:"string" certainly works but is redundant.

"string argument" - The default depends on the content of the very first search string. (Remember that <space> is used to delimit search strings.) If the first search string is a valid regular expression that contains at least one un-escaped meta-character, then all search strings are treated as regular expressions. Otherwise all search strings are treated as literals. For example, "51.4 200" will be treated as two regular expressions because the first string contains an un-escaped dot, whereas "200 51.4" will be treated as two literals because the first string does not contain any meta-characters.

/G:file - The default depends on the content of the first non-empty line in the file. If the first search string is a valid regular expression that contains at least one un-escaped meta-character, then all search strings are treated as regular expressions. Otherwise all search strings are treated as literals.

Recommendation - Always explicitly specify /L literal option or /R regular expression option when using "string argument" or /G:file.

BUG - Specifying multiple literal search strings can give unreliable results

The following simple FINDSTR example fails to find a match, even though it should.

echo ffffaaa|findstr /l "ffffaaa faffaffddd"

This bug has been confirmed on Windows Server 2003, Windows XP, Vista, and Windows 7.

Based on experiments, FINDSTR may fail if all of the following conditions are met:

• The search is using multiple literal search strings
• The search strings are of different lengths
• A short search string has some amount of overlap with a longer search string
• The search is case sensitive (no /I option)

In every failure I have seen, it is always one of the shorter search strings that fails.

For more info see Why doesn't this FINDSTR example with multiple literal search strings find a match?

Quotes and backslahses within command line arguments
Note - User MC ND's comments reflect the actual horrifically complicated rules for this section. There are 3 distinct parsing phases involved:

• First cmd.exe may require some quotes to be escaped as ^" (really nothing to do with FINDSTR)
• Next FINDSTR uses the pre 2008 MS C/C++ argument parser, which has special rules for " and \
• After the argument parser finishes, FINDSTR additionally treats \ followed by an alpha-numeric character as literal, but \ followed by non-alpha-numeric character as an escape character

The remainder of this highlighted section is not 100% correct. It can serve as a guide for many situations, but the above rules are required for total understanding.

Escaping Quote within command line search strings
Quotes within command line search strings must be escaped with backslash like \". This is true for both literal and regex search strings. This information has been confirmed on XP, Vista, and Windows 7.

Note: The quote may also need to be escaped for the CMD.EXE parser, but this has nothing to do with FINDSTR. For example, to search for a single quote you could use:

FINDSTR \^" file && echo found || echo not found

Escaping Backslash within command line literal search strings
Backslash in a literal search string can normally be represented as \ or as \\. They are typically equivalent. (There may be unusual cases in Vista where the backslash must always be escaped, but I no longer have a Vista machine to test).

But there are some special cases:

When searching for consecutive backslashes, all but the last must be escaped. The last backslash may optionally be escaped.

• \\ can be coded as \\\ or \\\\
• \\\ can be coded as \\\\\ or \\\\\\

Searching for one or more backslashes before a quote is bizarre. Logic would suggest that the quote must be escaped, and each of the leading backslashes would need to be escaped, but this does not work! Instead, each of the leading backslashes must be double escaped, and the quote is escaped normally:

• \" must be coded as \\\\\"
• \\" must be coded as \\\\\\\\\"

As previously noted, one or more escaped quotes may also require escaping with ^ for the CMD parser

The info in this section has been confirmed on XP and Windows 7.

Escaping Backslash within command line regex search strings

• Vista only: Backslash in a regex must be either double escaped like \\\\, or else single escaped within a character class set like [\\]

• XP and Windows 7: Backslash in a regex can always be represented as [\\]. It can normally be represented as \\. But this never works if the backslash precedes an escaped quote.

  One or more backslashes before an escaped quote must either be double escaped, or else coded as [\\]

  • \" may be coded as \\\\\" or [\\]\"
  • \\" may be coded as \\\\\\\\\" or [\\][\\]\" or \\[\\]\"

Escaping Quote and Backslash within /G:FILE literal search strings
Standalone quotes and backslashes within a literal search string file specified by /G:file need not be escaped, but they can be.

" and \" are equivalent.

\ and \\ are equivalent.

If the intent is to find \\, then at least the leading backslash must be escaped. Both \\\ and \\\\ work.

If the intent is to find ", then at least the leading backslash must be escaped. Both \\" and \\\" work.

Escaping Quote and Backslash within /G:FILE regex search strings
This is the one case where the escape sequences work as expected based on the documentation. Quote is not a regex metacharacter, so it need not be escaped (but can be). Backslash is a regex metacharacter, so it must be escaped.

Character limits for command line parameters - Extended ASCII transformation
The null character (0x00) cannot appear in any string on the command line. Any other single byte character can appear in the string (0x01 - 0xFF). However, FINDSTR converts many extended ASCII characters it finds within command line parameters into other characters. This has a major impact in two ways:

1. Many extended ASCII characters will not match themselves if used as a search string on the command line. This limitation is the same for literal and regex searches. If a search string must contain extended ASCII, then the /G:FILE option should be used instead.

2. FINDSTR may fail to find a file if the name contains extended ASCII characters and the file name is specified on the command line. If a file to be searched contains extended ASCII in the name, then the /F:FILE option should be used instead.

Here is a complete list of extended ASCII character transformations that FINDSTR performs on command line strings. Each character is represented as the decimal byte code value. The first code represents the character as supplied on the command line, and the second code represents the character it is transformed into. Note - this list was compiled on a U.S machine. I do not know what impact other languages may have on this list.

158 treated as 080     199 treated as 221     226 treated as 071
169 treated as 170     200 treated as 043     227 treated as 112
176 treated as 221     201 treated as 043     228 treated as 083
177 treated as 221     202 treated as 045     229 treated as 115
178 treated as 221     203 treated as 045     231 treated as 116
179 treated as 221     204 treated as 221     232 treated as 070
180 treated as 221     205 treated as 045     233 treated as 084
181 treated as 221     206 treated as 043     234 treated as 079
182 treated as 221     207 treated as 045     235 treated as 100
183 treated as 043     208 treated as 045     236 treated as 056
184 treated as 043     209 treated as 045     237 treated as 102
185 treated as 221     210 treated as 045     238 treated as 101
186 treated as 221     211 treated as 043     239 treated as 110
187 treated as 043     212 treated as 043     240 treated as 061
188 treated as 043     213 treated as 043     242 treated as 061
189 treated as 043     214 treated as 043     243 treated as 061
190 treated as 043     215 treated as 043     244 treated as 040
191 treated as 043     216 treated as 043     245 treated as 041
192 treated as 043     217 treated as 043     247 treated as 126
193 treated as 045     218 treated as 043     249 treated as 250
194 treated as 045     219 treated as 221     251 treated as 118
195 treated as 043     220 treated as 095     252 treated as 110
196 treated as 045     222 treated as 221     254 treated as 221
197 treated as 043     223 treated as 095
198 treated as 221     224 treated as 097

Any character >0 not in the list above is treated as itself, including <CR> and <LF>. The easiest way to include odd characters like <CR> and <LF> is to get them into an environment variable and use delayed expansion within the command line argument.

Character limits for strings found in files specified by /G:FILE and /F:FILE options
The nul (0x00) character can appear in the file, but it functions like the C string terminator. Any characters after a nul character are treated as a different string as if they were on another line.

The <CR> and <LF> characters are treated as line terminators that terminate a string, and are not included in the string.

All other single byte characters are included perfectly within a string.

Searching Unicode files
FINDSTR cannot properly search most Unicode (UTF-16, UTF-16LE, UTF-16BE, UTF-32) because it cannot search for nul bytes and Unicode typically contains many nul bytes.

However, the TYPE command converts UTF-16LE with BOM to a single byte character set, so a command like the following will work with UTF-16LE with BOM.

type unicode.txt|findstr "search"

Note that Unicode code points that are not supported by your active code page will be converted to ? characters.

It is possible to search UTF-8 as long as your search string contains only ASCII. However, the console output of any multi-byte UTF-8 characters will not be correct. But if you redirect the output to a file, then the result will be correctly encoded UTF-8. Note that if the UTF-8 file contains a BOM, then the BOM will be considered as part of the first line, which could throw off a search that matches the beginning of a line.

It is possible to search multi-byte UTF-8 characters if you put your search string in a UTF-8 encoded search file (without BOM), and use the /G option.

End Of Line
FINDSTR breaks lines immediately after every <LF>. The presence or absence of <CR> has no impact on line breaks.

Searching across line breaks
As expected, the . regex metacharacter will not match <CR> or <LF>. But it is possible to search across a line break using a command line search string. Both the <CR> and <LF> characters must be matched explicitly. If a multi-line match is found, only the 1st line of the match is printed. FINDSTR then doubles back to the 2nd line in the source and begins the search all over again - sort of a "look ahead" type feature.

Assume TEXT.TXT has these contents (could be Unix or Windows style)

A
A
A
B
A
A

Then this script

@echo off
setlocal
::Define LF variable containing a linefeed (0x0A)
set LF=^


::Above 2 blank lines are critical - do not remove

::Define CR variable containing a carriage return (0x0D)
for /f %%a in ('copy /Z "%~dpf0" nul') do set "CR=%%a"

setlocal enableDelayedExpansion
::regex "!CR!*!LF!" will match both Unix and Windows style End-Of-Line
findstr /n /r /c:"A!CR!*!LF!A" TEST.TXT

gives these results

1:A
2:A
5:A

Searching across line breaks using the /G:FILE option is imprecise because the only way to match <CR> or <LF> is via a regex character class range expression that sandwiches the EOL characters.

• [<TAB>-<0x0B>] matches <LF>, but it also matches <TAB> and <0x0B>

• [<0x0C>-!] matches <CR>, but it also matches <0x0C> and !

Note - the above are symbolic representations of the regex byte stream since I can't graphically represent the characters.

Answer continued in part 2 below...

select count(distinct(column_name)) AS columndatacount from table_name where somecondition=true

You can use this query, to count different/distinct data. Thanks

For future googlers (thousands have now googled this question):

To set your mind at ease, the onClick event does work with divs in react, so double-check your code syntax.

These are right:

<div onClick={doThis}>
<div onClick={() => doThis()}>

These are wrong:

<div onClick={doThis()}>
<div onClick={() => doThis}>

(and don't forget to close your tags... Watch for this:

<div onClick={doThis}

missing closing tag on the div)

For the first question, why not just use?

SELECT COUNT(*) FROM myTable 

to get the count.

And for the second question, the primary key of the row is what should be used to identify a particular row. Don't try and use the row number for that.

If you returned Row_Number() in your main query,

SELECT ROW_NUMBER() OVER (Order by Id) AS RowNumber, Field1, Field2, Field3
FROM User

Then when you want to go 5 rows back then you can take the current row number and use the following query to determine the row with currentrow -5

SELECT us.Id
FROM (SELECT ROW_NUMBER() OVER (ORDER BY id) AS Row, Id
     FROM User ) us 
WHERE Row = CurrentRow - 5   

you just provide one <folder> argument to npm install, argument should point toward the local folder instead of the package name:

npm install /path

Take a look at this question and this question for some good answers on C++ object instantiation.

This basic idea is that objects instantiated on the heap (using new) need to be cleaned up manually, those instantiated on the stack (without new) are automatically cleaned up when they go out of scope.

void SomeFunc()
{
    Point p1 = Point(0,0);
} // p1 is automatically freed

void SomeFunc2()
{
    Point *p1 = new Point(0,0);
    delete p1; // p1 is leaked unless it gets deleted
}

Python indexing starts at 0 (rather than 1), so your assignment "r[1,:] = r0" defines the second (i.e. index 1) element of r and leaves the first (index 0) element as a pair of zeros. The first value of i in your for loop is 0, so rr gets the square root of the dot product of the first entry in r with itself (which is 0), and the division by rr in the subsequent line throws the error.

For debug/release flags, see the CMAKE_BUILD_TYPE variable (you pass it as cmake -DCMAKE_BUILD_TYPE=value). It takes values like Release, Debug, etc.

https://gitlab.kitware.com/cmake/community/wikis/doc/cmake/Useful-Variables#compilers-and-tools

cmake uses the extension to choose the compiler, so just name your files .c.

You can override this with various settings:

For example:

set_source_files_properties(yourfile.c LANGUAGE CXX) 

Would compile .c files with g++. The link above also shows how to select a specific compiler for C/C++.

If we need to move from one component to another service then we have to define that service into app.module providers array.

1. Modify the definition of the function check_me as::

    function check_me(ev) {
   

2. Now you can access the methods and parameters of the event, in your case:

    ev.preventDefault();
   

3. Then, you have to pass the parameter on the onclick in the inline call::

    <button type="button" onclick="check_me(event);">Click Me!</button>
   

A useful link to understand this.

Full example:

<!DOCTYPE html>
<html lang="en">
  <head>
    <script type="text/javascript">
      function check_me(ev) {
        ev.preventDefault();
        alert("Hello World!")
      }
    </script>
  </head>
  <body>
    <button type="button" onclick="check_me(event);">Click Me!</button>
  </body>
</html>

Alternatives (best practices):

Although the above is the direct answer to the question (passing an event object to an inline event), there are other ways of handling events that keep the logic separated from the presentation

A. Using addEventListener:

<!DOCTYPE html>
<html lang="en">
  <head>
  </head>
  <body>
    <button id='my_button' type="button">Click Me!</button>

    <!-- put the javascript at the end to guarantee that the DOM is ready to use-->
    <script type="text/javascript">
      function check_me(ev) {
        ev.preventDefault();
        alert("Hello World!")
      }
      
      <!-- add the event to the button identified #my_button -->
      document.getElementById("my_button").addEventListener("click", check_me);
    </script>
  </body>
</html>

B. Isolating Javascript:

Both of the above solutions are fine for a small project, or a hackish quick and dirty solution, but for bigger projects, it is better to keep the HTML separated from the Javascript.

Just put this two files in the same folder:

• example.html:

<!DOCTYPE html>
<html lang="en">
  <head>
  </head>
  <body>
    <button id='my_button' type="button">Click Me!</button>

    <!-- put the javascript at the end to guarantee that the DOM is ready to use-->
    <script type="text/javascript" src="example.js"></script>
  </body>
</html>

• example.js:

function check_me(ev) {
    ev.preventDefault();
    alert("Hello World!")
}
document.getElementById("my_button").addEventListener("click", check_me);

This worked for me: :)

<button (click)="updatePendingApprovals(''+pendingApproval.personId, ''+pendingApproval.personId)">Approve</button>

updatePendingApprovals(planId: string, participantId: string) : void {
  alert('PlanId:' + planId + '    ParticipantId:' + participantId);
}

SwiftUI

If you are using the native SwiftUI TextField or just using the UIKit UITextField (here is how), you can observe for text changes like:

SwiftUI 2.0

From iOS 14, macOS 11, or any other OS contains SwiftUI 2.0, there is a new modifier called .onChange that detects any change of the given state:

struct ContentView: View {
    @State var text: String = ""

    var body: some View {
        TextField("Enter text here", text: $text)
            .onChange(of: text) {
                print($0) // You can do anything due to the change here.
                // self.autocomplete($0) // like this
            }
    }
}

SwiftUI 1.0

For older iOS and other SwiftUI 1.0 platforms, you can use onReceive with the help of the combine framework:

import Combine

.onReceive(Just(text)) { 
    print($0)
}

_{Note that you can use text.publisher instead of Just(text) but it returns the change instead of the entire value.}

A standard approach/workaround/solution is to add a class object to the constructor(s), like:

 public class Foo<T> {

    private Class<T> type;
    public Foo(Class<T> type) {
      this.type = type;
    }

    public Class<T> getType() {
      return type;
    }

    public T newInstance() {
      return type.newInstance();
    }
 }

//
//  iOSDevCenters+GIF.swift
//  GIF-Swift
//
//  Created by iOSDevCenters on 11/12/15.
//  Copyright © 2016 iOSDevCenters. All rights reserved.
//
import UIKit
import ImageIO


extension UIImage {

public class func gifImageWithData(data: NSData) -> UIImage? {
    guard let source = CGImageSourceCreateWithData(data, nil) else {
        print("image doesn't exist")
        return nil
    }

    return UIImage.animatedImageWithSource(source: source)
}

public class func gifImageWithURL(gifUrl:String) -> UIImage? {
    guard let bundleURL = NSURL(string: gifUrl)
        else {
            print("image named \"\(gifUrl)\" doesn't exist")
            return nil
    }
    guard let imageData = NSData(contentsOf: bundleURL as URL) else {
        print("image named \"\(gifUrl)\" into NSData")
        return nil
    }

    return gifImageWithData(data: imageData)
}

public class func gifImageWithName(name: String) -> UIImage? {
    guard let bundleURL = Bundle.main
        .url(forResource: name, withExtension: "gif") else {
            print("SwiftGif: This image named \"\(name)\" does not exist")
            return nil
    }

    guard let imageData = NSData(contentsOf: bundleURL) else {
        print("SwiftGif: Cannot turn image named \"\(name)\" into NSData")
        return nil
    }

    return gifImageWithData(data: imageData)
}

class func delayForImageAtIndex(index: Int, source: CGImageSource!) -> Double {
    var delay = 0.1

    let cfProperties = CGImageSourceCopyPropertiesAtIndex(source, index, nil)
    let gifProperties: CFDictionary = unsafeBitCast(CFDictionaryGetValue(cfProperties, Unmanaged.passUnretained(kCGImagePropertyGIFDictionary).toOpaque()), to: CFDictionary.self)

    var delayObject: AnyObject = unsafeBitCast(CFDictionaryGetValue(gifProperties, Unmanaged.passUnretained(kCGImagePropertyGIFUnclampedDelayTime).toOpaque()), to: AnyObject.self)

    if delayObject.doubleValue == 0 {
        delayObject = unsafeBitCast(CFDictionaryGetValue(gifProperties, Unmanaged.passUnretained(kCGImagePropertyGIFDelayTime).toOpaque()), to: AnyObject.self)
    }

    delay = delayObject as! Double

    if delay < 0.1 {
        delay = 0.1
    }

    return delay
}

class func gcdForPair(a: Int?, _ b: Int?) -> Int {
    var a = a
    var b = b
    if b == nil || a == nil {
        if b != nil {
            return b!
        } else if a != nil {
            return a!
        } else {
            return 0
        }
    }

    if a! < b! {
        let c = a!
        a = b!
        b = c
    }

    var rest: Int
    while true {
        rest = a! % b!

        if rest == 0 {
            return b!
        } else {
            a = b!
            b = rest
        }
    }
}

class func gcdForArray(array: Array<Int>) -> Int {
    if array.isEmpty {
        return 1
    }

    var gcd = array[0]

    for val in array {
        gcd = UIImage.gcdForPair(a: val, gcd)
    }

    return gcd
}

class func animatedImageWithSource(source: CGImageSource) -> UIImage? {
    let count = CGImageSourceGetCount(source)
    var images = [CGImage]()
    var delays = [Int]()

    for i in 0..<count {
        if let image = CGImageSourceCreateImageAtIndex(source, i, nil) {
            images.append(image)
        }

        let delaySeconds = UIImage.delayForImageAtIndex(index: Int(i), source: source)
        delays.append(Int(delaySeconds * 1000.0)) // Seconds to ms
    }

    let duration: Int = {
        var sum = 0

        for val: Int in delays {
            sum += val
        }

        return sum
    }()

    let gcd = gcdForArray(array: delays)
    var frames = [UIImage]()

    var frame: UIImage
    var frameCount: Int
    for i in 0..<count {
        frame = UIImage(cgImage: images[Int(i)])
        frameCount = Int(delays[Int(i)] / gcd)

        for _ in 0..<frameCount {
            frames.append(frame)
        }
    }

    let animation = UIImage.animatedImage(with: frames, duration: Double(duration) / 1000.0)

    return animation
}
}

Here is the file updated for Swift 3

In my application, it was enough to use:

myclassname.this

find is the common tool for this kind of task :

find ./my_dir -mtime +10 -type f -delete

EXPLANATIONS

• ./my_dir your directory (replace with your own)
• -mtime +10 older than 10 days
• -type f only files
• -delete no surprise. Remove it to test your find filter before executing the whole command

And take care that ./my_dir exists to avoid bad surprises !

In (ANSI) C99, you can use a designated initializer to initialize a structure:

MY_TYPE a = { .flag = true, .value = 123, .stuff = 0.456 };

Edit: Other members are initialized as zero: "Omitted field members are implicitly initialized the same as objects that have static storage duration." (https://gcc.gnu.org/onlinedocs/gcc/Designated-Inits.html)

It happens that I'm just starting to learn coding and I needed something similar as you have just asked in SQLite (I´m using [SQLiteStudio] (3.1.1)).

It happens that you must define the column's 'Constraint' as 'Not Null' then entering your desired definition using 'Default' 'Constraint' or it will not work (I don't know if this is an SQLite or the program requirment).

Here is the code I used:

CREATE TABLE <MY_TABLE> (
<MY_TABLE_KEY>       INTEGER    UNIQUE
                                PRIMARY KEY,
<MY_TABLE_SERIAL>    TEXT       DEFAULT (<MY_VALUE>) 
                                NOT NULL
<THE_REST_COLUMNS>
);

I don't think it's enough merely to get the response. I think you need to read it (get the entity and read it via EntityUtils.consume()).

e.g. (from the doc)

     System.out.println("<< Response: " + response.getStatusLine());
     System.out.println(EntityUtils.toString(response.getEntity()));

GetCursorPos() will return to you the x/y if you pass in a pointer to a POINT structure.

Hiding the cursor can be done with ShowCursor().

The error is:

Can not deserialize instance of java.lang.String out of START_ARRAY token at [Source: line: 1, column: 1095] (through reference chain: JsonGen["platforms"])

In JSON, platforms look like this:

"platforms": [
    {
        "platform": "iphone"
    },
    {
        "platform": "ipad"
    },
    {
        "platform": "android_phone"
    },
    {
        "platform": "android_tablet"
    }
]

So try change your pojo to something like this:

private List platforms;

public List getPlatforms(){
    return this.platforms;
}

public void setPlatforms(List platforms){
    this.platforms = platforms;
}

EDIT: you will need change mobile_networks too. Will look like this:

private List mobile_networks;

public List getMobile_networks() {
    return mobile_networks;
}

public void setMobile_networks(List mobile_networks) {
    this.mobile_networks = mobile_networks;
}

In addition to the answers above.

I wrote following test.exe as console application

static void Main(string[] args) {
  Console.WriteLine(
    System.Diagnostics.Process.GetCurrentProcess().MainModule.FileName);
  Console.WriteLine(
    System.Reflection.Assembly.GetEntryAssembly().Location);
  Console.WriteLine(
    System.Reflection.Assembly.GetExecutingAssembly().Location);
  Console.WriteLine(
    System.Reflection.Assembly.GetCallingAssembly().Location);
}

Then I compiled the project and renamed its output to the test2.exe file. The output lines were correct and the same.

But, if I start it in the Visual Studio, the result is:

d:\test2.vhost.exe

d:\test2.exe

d:\test2.exe

C:\Windows\Microsoft.NET\Framework\v2.0.50727\mscorlib.dll

The ReSharper plug-in to the Visual Studio has underlined the

System.Diagnostics.Process.GetCurrentProcess().MainModule

as possible System.NullReferenceException. If you look into documentation of the MainModule you will find that this property can throw also NotSupportedException, PlatformNotSupportedException and InvalidOperationException.

The GetEntryAssembly method is also not 100% "safe". MSDN:

The GetEntryAssembly method can return null when a managed assembly has been loaded from an unmanaged application. For example, if an unmanaged application creates an instance of a COM component written in C#, a call to the GetEntryAssembly method from the C# component returns null, because the entry point for the process was unmanaged code rather than a managed assembly.

For my solutions, I prefer the Assembly.GetEntryAssembly().Location.

More interest is if need to solve the problem for the virtualization. For example, we have a project, where we use a Xenocode Postbuild to link the .net code into one executable. This executable must be renamed. So all the methods above didn't work, because they only gets the information for the original assembly or inner process.

The only solution I found is

var location = System.Reflection.Assembly.GetEntryAssembly().Location;
var directory = System.IO.Path.GetDirectoryName(location);
var file = System.IO.Path.Combine(directory, 
  System.Diagnostics.Process.GetCurrentProcess().ProcessName + ".exe");

A clean way to download a file is:

import urllib

testfile = urllib.URLopener()
testfile.retrieve("http://randomsite.com/file.gz", "file.gz")

This downloads a file from a website and names it file.gz. This is one of my favorite solutions, from Downloading a picture via urllib and python.

This example uses the urllib library, and it will directly retrieve the file form a source.

You can achieve this by using the following query:

EXEC sp_msforeachdb 
    'IF EXISTS
    (
        SELECT  1 
        FROM    [?].sys.objects 
        WHERE   name LIKE ''OBJECT_TO_SEARCH''
    )
    SELECT 
        ''?''       AS DB, 
        name        AS Name, 
        type_desc   AS Type 
    FROM [?].sys.objects 
    WHERE name LIKE ''OBJECT_TO_SEARCH'''

Just replace OBJECT_TO_SEARCH with the actual object name you are interested in (or part of it, surrounded with %).

More details here: https://peevsvilen.blog/2019/07/30/search-for-an-object-in-sql-server/

UIAlertViews use a delegate to communicate with you, the client.

You add a second button, and you create an object to receive the delegate messages from the view:

class LogInErrorDelegate : UIAlertViewDelegate {

    init {}

    // not sure of the prototype of this, you should look it up
    func alertView(view :UIAlertView, clickedButtonAtIndex :Integer) -> Void {
        switch clickedButtonAtIndex {
            case 0: 
               userClickedOK() // er something
            case 1:
               userClickedRetry()
              /* Don't use "retry" as a function name, it's a reserved word */

            default:
               userClickedRetry()
        }
    }

    /* implement rest of the delegate */
}
logInErrorAlert.addButtonWithTitle("Retry")

var myErrorDelegate = LogInErrorDelegate()
logInErrorAlert.delegate = myErrorDelegate

It doesn't need to be complicated:

val = df.loc[df.wd==1, 'col_name'].values[0]

You don't need case in the where statement, just use parentheses and or:

Select * From Times
WHERE StartDate <= @Date AND EndDate >= @Date
AND (
    (@day = 'Monday' AND Monday = 1)
    OR (@day = 'Tuesday' AND Tuesday = 1)
    OR Wednesday = 1
)

Additionally, your syntax is wrong for a case. It doesn't append things to the string--it returns a single value. You'd want something like this, if you were actually going to use a case statement (which you shouldn't):

Select * From Times
WHERE (StartDate <= @Date) AND (EndDate >= @Date)
AND 1 = CASE WHEN @day = 'Monday' THEN Monday
             WHEN @day = 'Tuesday' THEN Tuesday
             ELSE Wednesday
        END 

And just for an extra umph, you can use the between operator for your date:

where @Date between StartDate and EndDate

Making your final query:

select
    * 
from 
    Times
where
    @Date between StartDate and EndDate
    and (
        (@day = 'Monday' and Monday = 1)
        or (@day = 'Tuesday' and Tuesday = 1)
        or Wednesday = 1
    )

To Completly remove Mysql from Ubuntu :

sudo apt-get remove --purge mysql-server mysql-client mysql-common
sudo apt-get autoremove
sudo apt-get autoclean

after this, if you are having issues with re installing, Try to remove Mysql files in :

sudo rm -rf /var/lib/mysql

Hope this helps .

The second option is feasible also if you're using safe updates mode (and you're getting an error indicating that you've tried to update a table without a WHERE that uses a KEY column), by adding:

UPDATE TableB  
SET TableB.value = (  
SELECT TableA.value  
    FROM TableA  
    WHERE TableA.name = TableB.name  
)  
**where TableB.id < X**  
;

Here are three ways you can check if dict is empty. I prefer using the first way only though. The other two ways are way too wordy.

test_dict = {}

if not test_dict:
    print "Dict is Empty"


if not bool(test_dict):
    print "Dict is Empty"


if len(test_dict) == 0:
    print "Dict is Empty"

The viewBox isn't the height of the container, it's the size of your drawing. Define your viewBox to be 100 units in width, then define your rect to be 10 units. After that, however large you scale the SVG, the rect will be 10% the width of the image.

I managed to stop the video using "get(0)" (Retrieve the DOM elements matched by the jQuery object):

$("#closeSimple").click(function() {
    $("div#simpleModal").removeClass("show");
    $("#videoContainer").get(0).pause();
    return false;
});

This is working for me.

    SizedBox(
             width: double.maxFinite,
             child: RaisedButton(
                 materialTapTargetSize: MaterialTapTargetSize.shrinkWrap,
                 child: new Text("Button 2"),
                 color: Colors.lightBlueAccent,
                 onPressed: () => debugPrint("Button 2"),
              ),
     ), 

If you are on MAC Install this globally

brew install mysql

then export path like this

export PATH=$PATH:/usr/local/mysql/bin

Than globally or in your venv whatever you like

pip install MySQL-Python

Note: globally for python3 as Mac can have both python2 & 3

pip3 install MySQL-Python

You could use Jquery indeed or plain good old javascript:

var opacityPercent=30;
document.getElementById("id").style.cssText="opacity:0."+opacityPercent+"; filter:progid:DXImageTransform.Microsoft.Alpha(style=0,opacity="+opacityPercent+");";

You put this in a function that you call on a setTimeout until the desired opacity is reached

This is what I am doing. It simply doesn't check the certificate anymore.

// always verify the host - dont check for certificate
final static HostnameVerifier DO_NOT_VERIFY = new HostnameVerifier() {
    public boolean verify(String hostname, SSLSession session) {
        return true;
    }
};

/**
 * Trust every server - dont check for any certificate
 */
private static void trustAllHosts() {
    // Create a trust manager that does not validate certificate chains
    TrustManager[] trustAllCerts = new TrustManager[] { new X509TrustManager() {
        public java.security.cert.X509Certificate[] getAcceptedIssuers() {
            return new java.security.cert.X509Certificate[] {};
        }

        public void checkClientTrusted(X509Certificate[] chain,
                String authType) throws CertificateException {
        }

        public void checkServerTrusted(X509Certificate[] chain,
                String authType) throws CertificateException {
        }
    } };

    // Install the all-trusting trust manager
    try {
        SSLContext sc = SSLContext.getInstance("TLS");
        sc.init(null, trustAllCerts, new java.security.SecureRandom());
        HttpsURLConnection
                .setDefaultSSLSocketFactory(sc.getSocketFactory());
    } catch (Exception e) {
        e.printStackTrace();
    }
}

and

    HttpURLConnection http = null;

    if (url.getProtocol().toLowerCase().equals("https")) {
        trustAllHosts();
        HttpsURLConnection https = (HttpsURLConnection) url.openConnection();
        https.setHostnameVerifier(DO_NOT_VERIFY);
        http = https;
    } else {
        http = (HttpURLConnection) url.openConnection();
    }

This is what I use to display images from blob:

echo '<img src="data:image/jpeg;base64,'.base64_encode($image->load()) .'" />';

You can convert a string to a DATE using the TO_DATE function, then reformat the date as another string using TO_CHAR, i.e.:

SELECT TO_CHAR(
         TO_DATE('15/August/2009,4:30 PM'
                ,'DD/Month/YYYY,HH:MI AM')
       ,'DD-MM-YYYY')
FROM DUAL;

15-08-2009

For example, if your table name is MYTABLE and the varchar2 column is MYDATESTRING:

SELECT TO_CHAR(
         TO_DATE(MYDATESTRING
                ,'DD/Month/YYYY,HH:MI AM')
       ,'DD-MM-YYYY')
FROM MYTABLE;

EDIT: to convert to array

int[] asIntegers = arr.Select(s => int.Parse(s)).ToArray();

This should do the trick:

var asIntegers = arr.Select(s => int.Parse(s));

    ps -eo pid,cmd,lstart | grep YOUR-PID-HERE

You can use BETWEEN:

DELETE FROM table
where id between 163 and 265

Here is a pure bash script (as printf is a bash builtin) :

#warning : spaces do matter
die(){ echo "$@" >&2;exit 1;}

p=48656c6c6f0a

test $((${#p} & 1)) == 0 || die "length is odd"
p2=''; for ((i=0; i<${#p}; i+=2));do p2=$p2\\x${p:$i:2};done
printf "$p2"

If bash is already running, this should be faster than any other solution which is launching a new process.

A web application is a software program which a user accesses over an internal network, or via the internet through a web browser. An example of one of the most widely used web applications is Google Docs, which facilitates most of the capabilities of Microsoft Word; it’s free and easy to use from any location.

A web site, on the other hand, is a collection of documents that are accessed via the internet through a web browser. Web sites can also contain web applications, which allow visitors to complete online tasks such as: Search, View, Buy, Checkout, and Pay.

I was trying to do the exact same thing, open a text file (a CSV for Pandas actually). Don't want to make a copy of it, just want to open it. The form-WTF has a nice file browser, but then it opens the file and makes a temporary file, which it presents as a memory stream. With a little work under the hood,

form = UploadForm() 
 if form.validate_on_submit(): 
      filename = secure_filename(form.fileContents.data.filename)  
      filestream =  form.fileContents.data 
      filestream.seek(0)
      ef = pd.read_csv( filestream  )
      sr = pd.DataFrame(ef)  
      return render_template('dataframe.html',tables=[sr.to_html(justify='center, classes='table table-bordered table-hover')],titles = [filename], form=form) 

try this script:

with open("data.json") as f:
    data = json.load(f)
    data["id"] = 134
    json.dump(data, open("data.json", "w"), indent = 4)

the result is:

{
    "name":"mynamme",
    "id":134
}

Just the arrangement is different, You can solve the problem by converting the "data" type to a list, then arranging it as you wish, then returning it and saving the file, like that:

index_add = 0
with open("data.json") as f:
    data = json.load(f)
    data_li = [[k, v] for k, v in data.items()]
    data_li.insert(index_add, ["id", 134])
    data = {data_li[i][0]:data_li[i][1] for i in range(0, len(data_li))}
    json.dump(data, open("data.json", "w"), indent = 4)

the result is:

{
    "id":134,
    "name":"myname"
}

you can add if condition in order not to repeat the key, just change it, like that:

index_add = 0
n_k = "id"
n_v = 134
with open("data.json") as f:
    data = json.load(f)
    if n_k in data:
        data[n_k] = n_v
    else:
       data_li = [[k, v] for k, v in data.items()]
       data_li.insert(index_add, [n_k, n_v])
       data = {data_li[i][0]:data_li[i][1] for i in range(0, len(data_li))}
    json.dump(data, open("data.json", "w"), indent = 4)

The CSS :active state means the active state of the clicked link - the moment when you clicked on it, but not released the mouse button yet, for example. It doesn't know which page you're on and can't apply any styles to the menu items.

To fix your problem you have to create a class and add it manually to the current page's menu:

a.active { color: #f00 }

<ul>
    <li><a href="index.php" class="active">HOME</a></li>
    <li><a href="two.php">PORTFOLIO</a></li>
    <li><a href="three.php">ABOUT</a></li>
    <li><a href="four.php">CONTACT</a></li>
    <li><a href="five.php">SHOP</a></li>
</ul>

1. Unzip the .ipa file by changing its extension with .zip
2. Go to Payload. You will find .app file
3. Right click the .app file and click Show package contents
4. Delete the _CodeSigned folder
5. Replace the embedded.mobileprovision file with the new provision profile
6. Go to KeyChain Access and make sure the certificate associated with the provisional profile is present

7. Execute the below mentioned command: /usr/bin/codesign -f -s "iPhone Distribution: Certificate Name" --resource-rules "Payload/Application.app/ResourceRules.plist" "Payload/Application.app"

8. Now zip the Payload folder again and change the .zip extension with .ipa

Hope this helpful.

For reference follow below mentioned link: http://www.modelmetrics.com/tomgersic/codesign-re-signing-an-ipa-between-apple-accounts/

SO So So simple solution , go to c:/Users/user_name/.ssh/ and delete all pub / private key pairs , this way heroku will generate keys for you.

The Request.Files collection contains any files uploaded with your form, regardless of whether they came from a FileUpload control or a manually written <input type="file">.

So you can just write a plain old file input tag in the middle of your WebForm, and then read the file uploaded from the Request.Files collection.

Here is a very simple piece of C# code to test the CommandTimeout with. It creates a new command which will wait for 2 seconds. Set the CommandTimeout to 1 second and you will see an exception when running it. Setting the CommandTimeout to either 0 or something higher than 2 will run fine. By the way, the default CommandTimeout is 30 seconds.

using System;
using System.Collections.Generic;
using System.Linq;
using System.Text;
using System.Threading.Tasks;

using System.Data.SqlClient;

namespace ConsoleApplication1
{
  class Program
  {
    static void Main(string[] args)
    {
      var builder = new SqlConnectionStringBuilder();
      builder.DataSource = "localhost";
      builder.IntegratedSecurity = true;
      builder.InitialCatalog = "master";

      var connectionString = builder.ConnectionString;

      using (var connection = new SqlConnection(connectionString))
      {
        connection.Open();

        using (var command = connection.CreateCommand())
        {
          command.CommandText = "WAITFOR DELAY '00:00:02'";
          command.CommandTimeout = 1;

          command.ExecuteNonQuery();
        }
      }
    }
  }
}

To encode the characters, you can use CGI.escapeHTML:

string = CGI.escapeHTML('test "escaping" <characters>')

To decode them, there is CGI.unescapeHTML:

CGI.unescapeHTML("test "unescaping" <characters>")

Of course, before that you need to include the CGI library:

require 'cgi'

And if you're in Rails, you don't need to use CGI to encode the string. There's the h method.

<%= h 'escaping <html>' %>

Just store the index generated in a variable, and then access the array using this varaible:

int idx = new Random().nextInt(fruits.length);
String random = (fruits[idx]);

P.S. I usually don't like generating new Random object per randoization - I prefer using a single Random in the program - and re-use it. It allows me to easily reproduce a problematic sequence if I later find any bug in the program.

According to this approach, I will have some variable Random r somewhere, and I will just use:

int idx = r.nextInt(fruits.length)

However, your approach is OK as well, but you might have hard time reproducing a specific sequence if you need to later on.

I prefer a mutex solution similar to the following. As this way it re-focuses on the app if it is already loaded

using System.Threading;

[DllImport("user32.dll")]
[return: MarshalAs(UnmanagedType.Bool)]
static extern bool SetForegroundWindow(IntPtr hWnd);

/// <summary>
/// The main entry point for the application.
/// </summary>
[STAThread]
static void Main()
{
   bool createdNew = true;
   using (Mutex mutex = new Mutex(true, "MyApplicationName", out createdNew))
   {
      if (createdNew)
      {
         Application.EnableVisualStyles();
         Application.SetCompatibleTextRenderingDefault(false);
         Application.Run(new MainForm());
      }
      else
      {
         Process current = Process.GetCurrentProcess();
         foreach (Process process in Process.GetProcessesByName(current.ProcessName))
         {
            if (process.Id != current.Id)
            {
               SetForegroundWindow(process.MainWindowHandle);
               break;
            }
         }
      }
   }
}

Use the shell error handling for unset variables (note the double $):

$ cat Makefile
foo:
        echo "something is set to $${something:?}"

$ make foo
echo "something is set to ${something:?}"
/bin/sh: something: parameter null or not set
make: *** [foo] Error 127


$ make foo something=x
echo "something is set to ${something:?}"
something is set to x

If you need a custom error message, add it after the ?:

$ cat Makefile
hello:
        echo "hello $${name:?please tell me who you are via \$$name}"

$ make hello
echo "hello ${name:?please tell me who you are via \$name}"
/bin/sh: name: please tell me who you are via $name
make: *** [hello] Error 127

$ make hello name=jesus
echo "hello ${name:?please tell me who you are via \$name}"
hello jesus

In some situations it is helpful to have a function to convert None to int zero:

def nz(value):

    '''
    Convert None to int zero else return value.
    '''

    if value == None:
        return 0
    return value

In cooperation with Andy E, this is the dark side of the force:

var _old = jQuery.Event.prototype.stopPropagation;

jQuery.Event.prototype.stopPropagation = function() {
    this.target.nodeName !== 'SPAN' && _old.apply( this, arguments );
};     

Example: http://jsfiddle.net/M4teA/2/

Remember, if all the events were bound via jQuery, you can handle those cases just here. In this example, we just call the original .stopPropagation() if we are not dealing with a <span>.

You cannot prevent the prevent, no.

What you could do is, to rewrite those event handlers manually in-code. This is tricky business, but if you know how to access the stored handler methods, you could work around it. I played around with it a little, and this is my result:

$( document.body ).click(function() {
    alert('Hi I am bound to the body!');
});

$( '#bar' ).click(function(e) {
    alert('I am the span and I do prevent propagation');
    e.stopPropagation();
});

$( '#yay' ).click(function() {
    $('span').each(function(i, elem) {
        var events        = jQuery._data(elem).events,
            oldHandler    = [ ],
            $elem         = $( elem );

        if( 'click' in events ) {                        
            [].forEach.call( events.click, function( click ) {
                oldHandler.push( click.handler );
            });

            $elem.off( 'click' );
        }

        if( oldHandler.length ) {
            oldHandler.forEach(function( handler ) {
                $elem.bind( 'click', (function( h ) {
                    return function() {
                        h.apply( this, [{stopPropagation: $.noop}] );
                    };
                }( handler )));
            });
        }
    });

    this.disabled = 1;
    return false;
});

Example: http://jsfiddle.net/M4teA/

Notice, the above code will only work with jQuery 1.7. If those click events were bound with an earlier jQuery version or "inline", you still can use the code but you would need to access the "old handler" differently.

I know I'm assuming a lot of "perfect world" scenario things here, for instance, that those handles explicitly call .stopPropagation() instead of returning false. So it still might be a useless academic example, but I felt to come out with it :-)

edit: hey, return false; will work just fine, the event objects is accessed in the same way.

SUMIF didn't worked for me, had to use SUMIFS.

=SUMIFS(TableAmount,TableMonth,"January")

TableAmount is the table to sum the values, TableMonth the table where we search the condition and January, of course, the condition to meet.

Hope this can help someone!

Watch out for certain headers such as HTTP_X_FORWARDED_FOR that appear to contain a single IP address. They may actually contain multiple addresses (a chain of proxies I assume).

They will appear to be comma delimited - and can be a lot longer than 45 characters total - so check before storing in DB.

If I understand correctly, you need a regex statement that checks for at least 6 characters (letters & numbers)?

/[0-9a-zA-Z]{6,}/

SELECTING DISTINCT PRODUCT AND DISPLAY COUNT PER PRODUCT

for another answer about this type of question this is my another answer for getting count of product base on product name distinct like this sample below:

Table Value

select * FROM Product

Counted Product Name

SELECT DISTINCT(Product_Name),
(SELECT COUNT(Product_Name) 
from Product  WHERE Product_Name = Prod.Product_Name)  
as `Product_Count`
from Product as Prod

Record Count: 4; Execution Time: 2ms

Just set the empty values to the input fields when modal is hiding.

$('#Modal_Id').on('hidden', function () {
   $('#Form_Id').find('input[type="text"]').val('');
});

This should work.

<!DOCTYPE html>
<html>
    <head>
        <title>Hello World</title>
        <style>
            html, body {
                width: 100%;
                height: 100%;
                margin: 0;
                padding: 0;
                background-color: green;
            }
            #container {
                width: inherit;
                height: inherit;
                margin: 0;
                padding: 0;
                background-color: pink;
            }
            h1 {
                margin: 0;
                padding: 0;
            }
        </style>
    </head>
    <body>
        <div id="container">
            <h1>Hello World</h1>
        </div>
    </body>
</html>

The background colors are there so you can see how this works. Copy this code to a file and open it in your browser. Try playing around with the CSS a bit and see what happens.

The width: inherit; height: inherit; pulls the width and height from the parent element. This should be the default and is not truly necessary.

Try removing the h1 { ... } CSS block and see what happens. You might notice the layout reacts in an odd way. This is because the h1 element is influencing the layout of its container. You could prevent this by declaring overflow: hidden; on the container or the body.

I'd also suggest you do some reading on the CSS Box Model.

Declare globally delayed listener:

var resize_timeout;

$(window).on('resize orientationchange', function(){
    clearTimeout(resize_timeout);

    resize_timeout = setTimeout(function(){
        $(window).trigger('resized');
    }, 250);
});

And below use listeners to resized event as you want:

$(window).on('resized', function(){
    console.log('resized');
});

In Python 3.6, they do not have a built-in unicode() method. Strings are already stored as unicode by default and no conversion is required. Example:

my_str = "\u221a25"
print(my_str)
>>> v25

To just add a custom content to the current UserAgent value, do the following:

1 - Get the user agent value from a NEW WEBVIEW

2 - Append the custom content to it

3 - Save the new value in a dictionary with the key UserAgent

4 - Save the dictionary in standardUserDefaults.

See the exemple below:

NSString *userAgentP1 = [[[UIWebView alloc] init] stringByEvaluatingJavaScriptFromString:@"navigator.userAgent"];
NSString *userAgentP2 = @"My_custom_value";
NSString *userAgent = [NSString stringWithFormat:@"%@ %@", userAgentP1, userAgentP2];
NSDictionary *dictionary = [NSDictionary dictionaryWithObjectsAndKeys:userAgent, @"UserAgent", nil];
[[NSUserDefaults standardUserDefaults] registerDefaults:dictionary];

Use p{width} column specifier: e.g. \begin{tabular}{ l p{10cm} } will put column's content into 10cm-wide parbox, and the text will be properly broken to several lines, like in normal paragraph.

You can also use tabular* environment to specify width for the entire table.

You can use the -notmatch operator to get the lines that don't have the characters you are interested in.

     Get-Content $FileName | foreach-object { 
     if ($_ -notmatch $arrayofStringsNotInterestedIn) { $) }

showSoftInput was not working for me at all.

I figured I needed to set the input mode : android:windowSoftInputMode="stateVisible" (here in the Activity component in the manifest)

Hope this help!