No.

The entire purpose is that it's a datastream, not a file. The data source should not have any knowledge of the user agent handling it as a file... and it doesn't.

The following command will create a copy in a new window. So you can continue see both original file and the new file.

:w {newfilename} | sp #

Try changing your code to this:

private void Test()
{            
    System.IO.MemoryStream data = new System.IO.MemoryStream(TestStream());

    byte[] buf = new byte[data.Length];
    data.Read(buf, 0, buf.Length);                       
}

Since value is the last entry, you can do:

metrics.sort_by(&:last)

brew switch to python3 by default, so if you want to still set python2 as default bin python, running:

brew unlink python && brew link python2 --force

Since ASP.NET MVC 3, you can use:

@Html.Raw(myString)

Check your js files actually exist on the server. I had this problem and discovered the js files hadn't been uploaded to the server and the server was actually returning the html page instead - which was the default document configured on the server (eg default.html)

$('#check1').prop('checked', true).uniform(); 
$('#check1').prop('checked', false).uniform(); 

This worked for me.

It's declared inside a closure, which means it can only be accessed there. If you want a variable accessible globally, you can remove the var:

$(function(){
    value = "10";
});
value; // "10"

This is equivalent to writing window.value = "10";.

Instead of loading a stream into a byte array and writing it to the response stream, you should have a look at HttpResponse.TransmitFile

Response.ContentType = "Application/pdf";
Response.TransmitFile(pathtofile);

If you want the PDF to open in a new window you would have to open the downloading page in a new window, for example like this:

<a href="viewpdf.aspx" target="_blank">View PDF</a>

As Shiraz Bhaiji answered, the metadata=res:///Model.csdl|res:///Model.ssdl|res://*/Model.msl was the case. However I still had problems with constructing the proper string based on my Model localization, namespaces and assemby name. The very simple solution was to rename the .edmx file in Visual Studio(after than rename and get back to the original name), which triggered the automatic refreshing of the string in my Web.config

0) go to phpmyadmin don't select any db
1) Click "Privileges". You'll see all the users on MySQL's privilege tables.
2) Check the user "root" whose Host value is localhost, and click the "Edit Privileges" icon.
3) In the "Change password" field, click "Password" and enter a new password.
4) Retype the password to confirm. Then click "Go" to apply the settings.

I gave it a try a while back (also: on GitHub). My implementation had some problems, which I won't get into here. Let me tell you, more importantly, what I learned.

Firstly, there's no way you're going to get a full implementation of IList<T> that is lockless and thread-safe. In particular, random insertions and removals are not going to work, unless you also forget about O(1) random access (i.e., unless you "cheat" and just use some sort of linked list and let the indexing suck).

What I thought might be worthwhile was a thread-safe, limited subset of IList<T>: in particular, one that would allow an Add and provide random read-only access by index (but no Insert, RemoveAt, etc., and also no random write access).

This was the goal of my ConcurrentList<T> implementation. But when I tested its performance in multithreaded scenarios, I found that simply synchronizing adds to a List<T> was faster. Basically, adding to a List<T> is lightning fast already; the complexity of the computational steps involved is miniscule (increment an index and assign to an element in an array; that's really it). You would need a ton of concurrent writes to see any sort of lock contention on this; and even then, the average performance of each write would still beat out the more expensive albeit lockless implementation in ConcurrentList<T>.

In the relatively rare event that the list's internal array needs to resize itself, you do pay a small cost. So ultimately I concluded that this was the one niche scenario where an add-only ConcurrentList<T> collection type would make sense: when you want guaranteed low overhead of adding an element on every single call (so, as opposed to an amortized performance goal).

It's simply not nearly as useful a class as you would think.

You can simply write

new ArrayList<MyEnum>(Arrays.asList(MyEnum.values()));

I also had same error but with codeigniter application. I changed

• my base URL in config.php to my localhost path

• in htaccess I changed RewriteBase /"my folder name in htdocs"

  and I able to login to my application.

Hope it might help.

As many mentioned the recursive approach, this is the function you can pass the searched name and the property to begin with to:

    public static void loopAttributes(PropertyInfo prop, string targetAttribute, object tempObject)
    {
        foreach (PropertyInfo nestedProp in prop.PropertyType.GetProperties())
        {
            if(nestedProp.Name == targetAttribute)
            {
                //found the matching attribute
            }
            loopAttributes(nestedProp, targetAttribute, prop.GetValue(tempObject);
        }
    }

//in the main function
foreach (PropertyInfo prop in rootObject.GetType().GetProperties())
{
    loopAttributes(prop, targetAttribute, rootObject);
}

If the array is a global, static, or automatic variable (int array[10];), then sizeof(array)/sizeof(array[0]) works.

If it is a dynamically allocated array (int* array = malloc(sizeof(int)*10);) or passed as a function argument (void f(int array[])), then you cannot find its size at run-time. You will have to store the size somewhere.
Note that sizeof(array)/sizeof(array[0]) compiles just fine even for the second case, but it will silently produce the wrong result.

this worked for me inside a directive and works without refreshing the baseurl (just adds the endpoint).Good for Single Page Apps with routing mechanism.

  $(location).attr('href', 'http://localhost:10005/#/endpoint') 

It's to access a member function or member variable of an object through a pointer, as opposed to a regular variable or reference.

For example: with a regular variable or reference, you use the . operator to access member functions or member variables.

std::string s = "abc";
std::cout << s.length() << std::endl;

But if you're working with a pointer, you need to use the -> operator:

std::string* s = new std::string("abc");
std::cout << s->length() << std::endl;

It can also be overloaded to perform a specific function for a certain object type. Smart pointers like shared_ptr and unique_ptr, as well as STL container iterators, overload this operator to mimic native pointer semantics.

For example:

std::map<int, int>::iterator it = mymap.begin(), end = mymap.end();
for (; it != end; ++it)
    std::cout << it->first << std::endl;

I found Steve Hibbert's response to be very helpful. The problem the OP seemed to be describing is that of an AutoGeneratedColumns on a GridView.

In this instance you can set which columns will be "visible" and which will be hidden when you bind a data table in the code behind.

For example: A Gridview is on the page as follows.

<asp:GridView ID="gv" runat="server" AutoGenerateColumns="False" >
</asp:GridView>

And then in the code behind a PopulateGridView routine is called during the page load event.

protected void PopulateGridView()
{
    DataTable dt = GetDataSource();
    gv.DataSource = dt;
    foreach (DataColumn col in dt.Columns)
    {
        BoundField field = new BoundField();
        field.DataField = col.ColumnName;
        field.HeaderText = col.ColumnName;
        if (col.ColumnName.EndsWith("ID"))
        {
            field.Visible = false;
        }
        gv.Columns.Add(field);
    }
    gv.DataBind();
}

In the above the GridView AutoGenerateColumns is set to False and the codebehind is used to create the bound fields. One is obtaining the datasource as a datatable through one's own process which here I labeled GetDataSource(). Then one loops through the columns collection of the datatable. If the column name meets a given criteria, you can set the bound field visible property accordingly. Then you bind the data to the gridview. This is very similar to AutoGenerateColumns="True" but you get to have criteria for the columns. This approach is most useful when the criteria for hiding and un-hiding is based upon the column name.

cURL is a way you can hit a URL from your code to get a HTML response from it. It's used for command line cURL from the PHP language.

<?php
// Step 1
$cSession = curl_init(); 
// Step 2
curl_setopt($cSession,CURLOPT_URL,"http://www.google.com/search?q=curl");
curl_setopt($cSession,CURLOPT_RETURNTRANSFER,true);
curl_setopt($cSession,CURLOPT_HEADER, false); 
// Step 3
$result=curl_exec($cSession);
// Step 4
curl_close($cSession);
// Step 5
echo $result;
?> 

Step 1: Initialize a curl session using curl_init().

Step 2: Set option for CURLOPT_URL. This value is the URL which we are sending the request to. Append a search term curl using parameter q=. Set option for CURLOPT_RETURNTRANSFER. True will tell curl to return the string instead of print it out. Set option for CURLOPT_HEADER, false will tell curl to ignore the header in the return value.

Step 3: Execute the curl session using curl_exec().

Step 4: Close the curl session we have created.

Step 5: Output the return string.

public function curlCall($apiurl, $auth, $rflag)
{
    $ch = curl_init($apiurl);
    curl_setopt($ch, CURLOPT_RETURNTRANSFER, 1);

    if($auth == 'auth') { 
        curl_setopt($ch, CURLOPT_USERPWD, "passw:passw");
    } else {
        curl_setopt($ch, CURLOPT_USERPWD, "ss:ss1");
    }
    curl_setopt($ch, CURLOPT_RETURNTRANSFER, true);
    $dt = curl_exec($ch);        
    curl_close($ch);
    if($rflag != 1) {
        $dt = json_decode($dt,true);        
    }
    return $dt;
}

This is also used for authentication. We can also set the username and password for authentication.

For more functionality, see the user manual or the following tutorial:

http://php.net/manual/en/ref.curl.php
http://www.startutorial.com/articles/view/php-curl

another option is to define Scanner input = new Scanner(System.in); inside the try block, this will create a new object each time you need to re-enter the values.

I have found something strange here about word-wrap only works with width property of CSS properly.

#ONLYwidth {_x000D_
  width: 200px;_x000D_
}_x000D_
_x000D_
#wordwrapWITHOUTWidth {_x000D_
  word-wrap: break-word;_x000D_
}_x000D_
_x000D_
#wordwrapWITHWidth {_x000D_
  width: 200px;_x000D_
  word-wrap: break-word;_x000D_
}

<b>This is the example of word-wrap only using width property</b>_x000D_
<p id="ONLYwidth">827938828ey823876te37257e5t328er6367r5erd663275e65r532r6s3624e5645376er563rdr753624e544341763r567r4e56r326r5632r65sr32dr32udr56r634r57rd63725</p>_x000D_
<br/>_x000D_
<b>This is the example of word-wrap without width property</b>_x000D_
<p id="wordwrapWITHOUTWidth">827938828ey823876te37257e5t328er6367r5erd663275e65r532r6s3624e5645376er563rdr753624e544341763r567r4e56r326r5632r65sr32dr32udr56r634r57rd63725</p>_x000D_
<br/>_x000D_
<b>This is the example of word-wrap with width property</b>_x000D_
<p id="wordwrapWITHWidth">827938828ey823876te37257e5t328er6367r5erd663275e65r532r6s3624e5645376er563rdr753624e544341763r567r4e56r326r5632r65sr32dr32udr56r634r57rd63725</p>

Here is a working demo that I have prepared about it. http://jsfiddle.net/Hss5g/2/

For Angular 5

app.module.ts

import {DatePipe} from '@angular/common';
.
.
.
providers: [DatePipe]

demo.component.ts

import { DatePipe } from '@angular/common';
.
.
constructor(private datePipe: DatePipe) {}

ngOnInit() {
   var date = new Date();
   console.log(this.datePipe.transform(date,"yyyy-MM-dd")); //output : 2018-02-13
}

more information angular/datePipe

Add this in MainActivity.

Intent intent = new Intent(getApplicationContext(), Heightimage.class);
startActivity(intent);

A small update to this one:

if you use the following it will update on the fly rather than on mouse release.

"change mousemove", function"

<script>
$('input[type="range"]').on("change mousemove", function () {
    var val = ($(this).val() - $(this).attr('min')) / ($(this).attr('max') - $(this).attr('min'));

    $(this).css('background-image',
                '-webkit-gradient(linear, left top, right top, '
                + 'color-stop(' + val + ', #2f466b), '
                + 'color-stop(' + val + ', #d3d3db)'
                + ')'
                );
});</script>

The good 'old C way still works. I recommend strtol or strtoul. Between the return status and the 'endPtr', you can give good diagnostic output. It also handles multiple bases nicely.

rfc2616

The Content-Length entity-header field indicates the size of the entity-body, in decimal number of OCTETs, sent to the recipient or, in the case of the HEAD method, the size of the entity-body that would have been sent had the request been a GET.

It doesn't matter what the content-type is.

Extension at post below.

Concatenating strings in awk can be accomplished by the print command AWK manual page, and you can do complicated combination. Here I was trying to change the 16 char to A and used string concatenation:

echo    CTCTCTGAAATCACTGAGCAGGAGAAAGATT | awk -v w=15 -v BA=A '{OFS=""; print substr($0, 1, w), BA, substr($0,w+2)}'
Output: CTCTCTGAAATCACTAAGCAGGAGAAAGATT

I used the substr function to extract a portion of the input (STDIN). I passed some external parameters (here I am using hard-coded values) that are usually shell variable. In the context of shell programming, you can write -v w=$width -v BA=$my_charval. The key is the OFS which stands for Output Field Separate in awk. Print function take a list of values and write them to the STDOUT and glue them with the OFS. This is analogous to the perl join function.

It looks that in awk, string can be concatenated by printing variable next to each other:

echo xxx | awk -v a="aaa" -v b="bbb" '{ print a b $1 "string literal"}'
# will produce: aaabbbxxxstring literal

I was facing "java.lang.OutOfMemoryError: Java heap space" error while building my project using maven install command.

I was able to get rid of it by changing maven runner settings.

Settings | Build, Execution, Deployment | Build Tools | Maven | Runner | VM options to -Xmx512m

There isn't any need for fake <td>s. Make use of border-spacing instead. Apply it like this:

HTML:

<table>
  <tr>
    <td>First Column</td>
    <td>Second Column</td>
    <td>Third Column</td>
  </tr>
</table>

CSS:

table {
  border-collapse: separate;
  border-spacing: 50px 0;
}

td {
  padding: 10px 0;
}

See it in action.

pixels = np.array(pixels) in this line you reassign pixels. So, it may not a list anyhow. Though pixels is not a list it has no attributes append. Does it make sense?

The answer differs depending on what OS is being considered. In general though:

For TCP, no. You can only have one application listening on the same port at one time. Now if you had 2 network cards, you could have one application listen on the first IP and the second one on the second IP using the same port number.

For UDP (Multicasts), multiple applications can subscribe to the same port.

Edit: Since Linux Kernel 3.9 and later, support for multiple applications listening to the same port was added using the SO_REUSEPORT option. More information is available at this lwn.net article.

dom event delegation is something different from the computer science definition.

It refers to handling bubbling events from many elements, like table cells, from a parent object, like the table. It can keep the code simpler, especially when adding or removing elements, and saves some memory.

To see a frequency count for column two (for example):

awk -F '\t' '{print $2}' * | sort | uniq -c | sort -nr

fileA.txt

z    z    a
a    b    c
w    d    e

fileB.txt

t    r    e
z    d    a
a    g    c

fileC.txt

z    r    a
v    d    c
a    m    c

Result:

  3 d
  2 r
  1 z
  1 m
  1 g
  1 b

In case this is useful to anyone I had this same issue. I was bringing in a footer into a web page via jQuery. Inside that footer were some Google scripts for ads and retargeting. I had to move those scripts from the footer and place them directly in the page and that eliminated the notice.

Hey i modify Kenny answer and custom it not always round function now it can be ceil and floor function

function roundToTheNearestAnything($value, $roundTo,$type='round')
    {
        $mod = $value%$roundTo;
        if($type=='round'){
            return $value+($mod<($roundTo/2)?-$mod:$roundTo-$mod);
        }elseif($type=='floor'){
            return $value+($mod<($roundTo/2)?-$mod:-$mod);
        }elseif($type=='ceil'){
            return $value+($mod<($roundTo/2)?$roundTo-$mod:$roundTo-$mod);
        }

    }

echo roundToTheNearestAnything(1872,25,'floor'); // 1850<br>
echo roundToTheNearestAnything(1872,25,'ceil'); // 1875<br>
echo roundToTheNearestAnything(1872,25,'round'); // 1875

public static boolean isJSONValid(String test) {
    try {
        isValidJSON(test);
        JsonFactory factory = new JsonFactory();
        JsonParser parser = factory.createParser(test);
        while (!parser.isClosed()) {
            parser.nextToken();
        }
    } catch (Exception e) {
        LOGGER.error("exception: ", e);
        return false;
    }
    return true;
}

private static void isValidJSON(String test) {
    try {
        new JSONObject(test);
    } catch (JSONException ex) {
        try {
            LOGGER.error("exception: ", ex);
            new JSONArray(test);
        } catch (JSONException ex1) {
            LOGGER.error("exception: ", ex1);
            throw new Exception("Invalid JSON.");
        }
    }
}

Above solution covers both the scenarios:

• duplicate key
• mismatched quotes or missing parentheses etc.

The loop attribute should do it:

<video width="320" height="240" autoplay loop>
  <source src="movie.mp4" type="video/mp4" />
  <source src="movie.ogg" type="video/ogg" />
  Your browser does not support the video tag.
</video>

Should you have a problem with the loop attribute (as we had in the past), listen to the videoEnd event and call the play() method when it fires.

Note1: I'm not sure about the behavior on Apple's iPad/iPhone, because they have some restrictions against autoplay.

Note2: loop="true" and autoplay="autoplay" are deprecated

with your own soup object:

soup.p.next_sibling.strip()

1. you grab the <p> directly with soup.p *(this hinges on it being the first <p> in the parse tree)
2. then use next_sibling on the tag object that soup.p returns since the desired text is nested at the same level of the parse tree as the <p>
3. .strip() is just a Python str method to remove leading and trailing whitespace

*otherwise just find the element using your choice of filter(s)

in the interpreter this looks something like:

In [4]: soup.p
Out[4]: <p>something</p>

In [5]: type(soup.p)
Out[5]: bs4.element.Tag

In [6]: soup.p.next_sibling
Out[6]: u'\n      THIS IS MY TEXT\n      '

In [7]: type(soup.p.next_sibling)
Out[7]: bs4.element.NavigableString

In [8]: soup.p.next_sibling.strip()
Out[8]: u'THIS IS MY TEXT'

In [9]: type(soup.p.next_sibling.strip())
Out[9]: unicode

(new Date().toString()).replace(/ \w+-\d+ \(.*\)$/,"")

This will have output: Tue Jul 10 2018 19:07:11

(new Date("2005-07-08T11:22:33+0000").toString()).replace(/ \w+-\d+ \(.*\)$/,"")

This will have output: Fri Jul 08 2005 04:22:33

Note: The time returned will depend on your local timezone

You repository is bare, i.e. it does not have a working tree attached to it. You can clone it locally to create a working tree for it, or you could use one of several other options to tell Git where the working tree is, e.g. the --work-tree option for single commands, or the GIT_WORK_TREE environment variable. There is also the core.worktree configuration option but it will not work in a bare repository (check the man page for what it does).

# git --work-tree=/path/to/work/tree checkout master
# GIT_WORK_TREE=/path/to/work/tree git status

You can convert the URL to a String and use it to create a new File. e.g.

URL url = new URL("http://google.com/pathtoaimage.jpg");
File f = new File(url.getFile());

Shouldn't you also be using the jspdf.plugin.from_html.js library? Besides the main library (jspdf.js), you must use other libraries for "special operations" (like jspdf.plugin.addimage.js for using images). Check https://github.com/MrRio/jsPDF.

It's better something like this...post the data to the self page and maybe do a check on user input.

   <?php
    require_once ( 'username.php' );

    if(isset($_POST)) {
      echo "form post"; // ex $_POST['textfield']
    }


    echo '
    <form name="form1" method="post" action="' . $_SERVER['PHP_SELF'] . '">
      <p>
        <label>
          <input type="text" name="textfield" id="textfield">
        </label>
      </p>
      <p>
        <label>
          <input type="submit" name="button" id="button" value="Submit">
        </label>
      </p>
    </form>';
    ?>

It normally means an un-aligned access.

An attempt to access memory that isn't physically present would also give a bus error, but you won't see this if you're using a processor with an MMU and an OS that's not buggy, because you won't have any non-existent memory mapped to your process's address space.

For the image that is not showing up. Open the image in the Image editor and check the type you are probably name it as "gif" but its saved in a different format that's one reason that the browser is unable to render it and it is not showing.
For the image stretching issue please specify the actual width and height dimensions in #banner instead of width: 100%; height: 200px that you have specified.

feof() indicates if one has tried to read past the end of file. That means it has little predictive effect: if it is true, you are sure that the next input operation will fail (you aren't sure the previous one failed BTW), but if it is false, you aren't sure the next input operation will succeed. More over, input operations may fail for other reasons than the end of file (a format error for formatted input, a pure IO failure -- disk failure, network timeout -- for all input kinds), so even if you could be predictive about the end of file (and anybody who has tried to implement Ada one, which is predictive, will tell you it can complex if you need to skip spaces, and that it has undesirable effects on interactive devices -- sometimes forcing the input of the next line before starting the handling of the previous one), you would have to be able to handle a failure.

So the correct idiom in C is to loop with the IO operation success as loop condition, and then test the cause of the failure. For instance:

while (fgets(line, sizeof(line), file)) {
    /* note that fgets don't strip the terminating \n, checking its
       presence allow to handle lines longer that sizeof(line), not showed here */
    ...
}
if (ferror(file)) {
   /* IO failure */
} else if (feof(file)) {
   /* format error (not possible with fgets, but would be with fscanf) or end of file */
} else {
   /* format error (not possible with fgets, but would be with fscanf) */
}

const express = require('express');_x000D_
let app = express();_x000D_
app.use(express.json());

This app.use(express.json) will now let you read the incoming post JSON object

I'm guessing that your complaint is that the exception is not firing. PDO is most likely configured to not throw exceptions. Enable them with this:

$db->setAttribute(PDO::ATTR_ERRMODE, PDO::ERRMODE_EXCEPTION); 

Java is always pass by value, with no exceptions, ever.

So how is it that anyone can be at all confused by this, and believe that Java is pass by reference, or think they have an example of Java acting as pass by reference? The key point is that Java never provides direct access to the values of objects themselves, in any circumstances. The only access to objects is through a reference to that object. Because Java objects are always accessed through a reference, rather than directly, it is common to talk about fields and variables and method arguments as being objects, when pedantically they are only references to objects. The confusion stems from this (strictly speaking, incorrect) change in nomenclature.

So, when calling a method

• For primitive arguments (int, long, etc.), the pass by value is the actual value of the primitive (for example, 3).
• For objects, the pass by value is the value of the reference to the object.

So if you have doSomething(foo) and public void doSomething(Foo foo) { .. } the two Foos have copied references that point to the same objects.

Naturally, passing by value a reference to an object looks very much like (and is indistinguishable in practice from) passing an object by reference.

Interestingly, the HttpWebResponse.GetResponseStream() that you get from the WebException.Response is not the same as the response stream that you would have received from server. In our environment, we're losing actual server responses when a 400 HTTP status code is returned back to the client using the HttpWebRequest/HttpWebResponse objects. From what we've seen, the response stream associated with the WebException's HttpWebResponse is generated at the client and does not include any of the response body from the server. Very frustrating, as we want to message back to the client the reason for the bad request.

PUT

$data = array('username'=>'dog','password'=>'tall');
$data_json = json_encode($data);

$ch = curl_init();
curl_setopt($ch, CURLOPT_URL, $url);
curl_setopt($ch, CURLOPT_HTTPHEADER, array('Content-Type: application/json','Content-Length: ' . strlen($data_json)));
curl_setopt($ch, CURLOPT_CUSTOMREQUEST, 'PUT');
curl_setopt($ch, CURLOPT_POSTFIELDS,$data_json);
curl_setopt($ch, CURLOPT_RETURNTRANSFER, true);
$response  = curl_exec($ch);
curl_close($ch);

POST

$ch = curl_init();
curl_setopt($ch, CURLOPT_URL, $url);
curl_setopt($ch, CURLOPT_HTTPHEADER, array('Content-Type: application/json'));
curl_setopt($ch, CURLOPT_POST, 1);
curl_setopt($ch, CURLOPT_POSTFIELDS,$data_json);
curl_setopt($ch, CURLOPT_RETURNTRANSFER, true);
$response  = curl_exec($ch);
curl_close($ch);

GET See @Dan H answer

DELETE

$ch = curl_init();
curl_setopt($ch, CURLOPT_URL, $url);
curl_setopt($ch, CURLOPT_CUSTOMREQUEST, "DELETE");
curl_setopt($ch, CURLOPT_POSTFIELDS,$data_json);
curl_setopt($ch, CURLOPT_RETURNTRANSFER, true);
$response  = curl_exec($ch);
curl_close($ch);

By using this query you can see all open transactions.

List All:

SHOW FULL PROCESSLIST  

if you want to kill a hang transaction copy transaction id and kill transaction by using this command:

KILL <id>    // e.g KILL 16543

How to build an image with custom name without using yml file:

docker build -t image_name .

How to run a container with custom name:

docker run -d --name container_name image_name

If you just need the indexed columns EXEC sp_helpindex 'TABLE_NAME'

I needed to print important warning about skipped tests exactly when PyTest muted literally everything.

I didn't want to fail a test to send a signal, so I did a hack as follow:

def test_2_YellAboutBrokenAndMutedTests():
    import atexit
    def report():
        print C_patch.tidy_text("""
In silent mode PyTest breaks low level stream structure I work with, so
I cannot test if my functionality work fine. I skipped corresponding tests.
Run `py.test -s` to make sure everything is tested.""")
    if sys.stdout != sys.__stdout__:
        atexit.register(report)

The atexit module allows me to print stuff after PyTest released the output streams. The output looks as follow:

============================= test session starts ==============================
platform linux2 -- Python 2.7.3, pytest-2.9.2, py-1.4.31, pluggy-0.3.1
rootdir: /media/Storage/henaro/smyth/Alchemist2-git/sources/C_patch, inifile: 
collected 15 items 

test_C_patch.py .....ssss....s.

===================== 10 passed, 5 skipped in 0.15 seconds =====================
In silent mode PyTest breaks low level stream structure I work with, so
I cannot test if my functionality work fine. I skipped corresponding tests.
Run `py.test -s` to make sure everything is tested.
~/.../sources/C_patch$

Message is printed even when PyTest is in silent mode, and is not printed if you run stuff with py.test -s, so everything is tested nicely already.

ADO Recordset has .State property, you can check if its value is adStateClosed or adStateOpen

If Not (rs Is Nothing) Then
  If (rs.State And adStateOpen) = adStateOpen Then rs.Close
  Set rs = Nothing
End If

MSDN about State property

Edit; The reason not to check .State against 1 or 0 is because even if it works 99.99% of the time, it is still possible to have other flags set which will cause the If statement fail the adStateOpen check.

Edit2:

For Late binding without the ActiveX Data Objects referenced, you have few options. Use the value of adStateOpen constant from ObjectStateEnum

If Not (rs Is Nothing) Then
  If (rs.State And 1) = 1 Then rs.Close
  Set rs = Nothing
End If

Or you can define the constant yourself to make your code more readable (defining them all for a good example.)

Const adStateClosed As Long = 0 'Indicates that the object is closed.
Const adStateOpen As Long = 1 'Indicates that the object is open.
Const adStateConnecting As Long = 2 'Indicates that the object is connecting.
Const adStateExecuting As Long = 4 'Indicates that the object is executing a command.
Const adStateFetching As Long = 8 'Indicates that the rows of the object are being retrieved.    

[...]

If Not (rs Is Nothing) Then

    ' ex. If (0001 And 0001) = 0001 (only open flag) -> true
    ' ex. If (1001 And 0001) = 0001 (open and retrieve) -> true
    '    This second example means it is open, but its value is not 1
    '    and If rs.State = 1 -> false, even though it is open
    If (rs.State And adStateOpen) = adStateOpen Then 
        rs.Close
    End If

    Set rs = Nothing
End If

Use xpath more directly for both performance and clarity.

time_path <- "//start-valid-time"
temp_path <- "//temperature[@type='hourly']/value"

df <- data.frame(
    latitude=data[["number(//point/@latitude)"]],
    longitude=data[["number(//point/@longitude)"]],
    start_valid_time=sapply(data[time_path], xmlValue),
    hourly_temperature=as.integer(sapply(data[temp_path], as, "integer"))

leading to

> head(df, 2)
  latitude longitude          start_valid_time hourly_temperature
1    29.81    -82.42 2014-02-14T18:00:00-05:00                 60
2    29.81    -82.42 2014-02-14T19:00:00-05:00                 55

If you want to set the same value on a collection of rows, you can use the update() method combined with any query term to update all rows in one query:

some_list = ModelClass.objects.filter(some condition).values('id')
ModelClass.objects.filter(pk__in=some_list).update(foo=bar)

If you want to update a collection of rows with different values depending on some condition, you can in best case batch the updates according to values. Let's say you have 1000 rows where you want to set a column to one of X values, then you could prepare the batches beforehand and then only run X update-queries (each essentially having the form of the first example above) + the initial SELECT-query.

If every row requires a unique value there is no way to avoid one query per update. Perhaps look into other architectures like CQRS/Event sourcing if you need performance in this latter case.

check the demo - http://jsfiddle.net/S8g4E/6/

use css -

#container { width: 300px; height: 300px; border:1px solid red; display: table;}
#up { background: green; display: table-row; }
#down { background:pink; display: table-row;}

If you are using Android Studio 3.0, add the Google maven repository as shown below:

allprojects {
  repositories {
    jcenter()
    google()
 }
}

Not orthodox, but it works for me sometimes; set your comment as another attribute:

<node usefulAttr="foo" comment="Your comment here..."/>

You could run: mvn exec:exec -Dexec.args="arg1".

This will pass the argument arg1 to your program.

You should specify the main class fully qualified, for example, a Main.java that is in a package test would need

mvn exec:java  -Dexec.mainClass=test.Main

By using the -f parameter, as decribed here, you can also run it from other directories.

mvn exec:java -Dexec.mainClass=test.Main -f folder/pom.xm

For multiple arguments, simply separate them with a space as you would at the command line.

mvn exec:java -Dexec.mainClass=test.Main -Dexec.args="arg1 arg2 arg3"

For arguments separated with a space, you can group using 'argument separated with space' inside the quotation marks.

mvn exec:java -Dexec.mainClass=test.Main -Dexec.args="'argument separated with space' 'another one'"

It's entirely possible to set your layout to assume the proportions of an a4 page. You would only have to set width and height accordingly (possibly check with window.innerHeight and window.innerWidth although I'm not sure if that is reliable).

The tricky part is with printing A4. Javascript for example only supports printing pages rudimentarily with the window.print method. As @Prutswonder suggested creating a PDF from the webpage probably is the most sophisticated way of doing this (other than supplying PDF documentation in the first place). However, this is not as trivial as one might think. Here's a link that has a description of an all open source Java class to create PDFs from HTML: http://www.javaworld.com/javaworld/jw-04-2006/jw-0410-html.html .

Obviously once you have created a PDF with A4 proportions printing it will result in a clean A4 print of your page. Whether that's worth the time investment is another question.

here's another way

import numpy as np
set(np.concatenate(df.values))

Put the div in another div and set the parent div's style to position:relative; Then on the child div set the following CSS properties: position:absolute; bottom:0;

In TorpedoQuery it look like this

Entity from = from(Entity.class);
where(from.getCode()).in("Joe", "Bob");
Query<Entity> select = select(from);

public static TEnum ConvertByName<TEnum>(this Enum source, bool ignoreCase = false) where TEnum : struct
{
    // if limited by lack of generic enum constraint
    if (!typeof(TEnum).IsEnum)
    {
        throw new InvalidOperationException("enumeration type required.");
    }

    TEnum result;
    if (!Enum.TryParse(source.ToString(), ignoreCase, out result))
    {
        throw new Exception("conversion failure.");
    }

    return result;
}

your dependency based on data is trying to find their respective entities which one has not been created, comments the dependencies based on data and runs the app again.

<!-- <dependency> -->
        <!-- <groupId>org.springframework.boot</groupId> -->
        <!-- <artifactId>spring-boot-starter-data-jpa</artifactId> -->
        <!-- </dependency> -->

The post needs an update after the links option is deprecated.

Basically, links is no longer needed because its main purpose, making container reachable by another by adding environment variable, is included implicitly with network. When containers are placed in the same network, they are reachable by each other using their container name and other alias as host.

For docker run, --link is also deprecated and should be replaced by a custom network.

docker network create mynet
docker run -d --net mynet --name container1 my_image
docker run -it --net mynet --name container1 another_image

depends_on expresses start order (and implicitly image pulling order), which was a good side effect of links.

Also check if You don't change alpha on that view. I am investigating issue when i change alpha on some views, with elevation. They simply loose elevation when alpha is changed and changed back to 1f.

Some limited flexibility is available if your using the Afterglow Theme.

https://github.com/YabataDesign/afterglow-theme

You can edit your user preferences in the following way.

Sublime Text -> Preferences -> Settings - User:

{
    "sidebar_size_14": true
}

https://github.com/YabataDesign/afterglow-theme#sidebar-size-options

Long story short: Don't use FileInputStream as a parameter or variable type. Use the abstract base class, in this case InputStream instead.

To remove one or more columns by name, when the column names are known (as opposed to being determined at run-time), I like the subset() syntax. E.g. for the data-frame

df <- data.frame(a=1:3, d=2:4, c=3:5, b=4:6)

to remove just the a column you could do

Data <- subset( Data, select = -a )

and to remove the b and d columns you could do

Data <- subset( Data, select = -c(d, b ) )

You can remove all columns between d and b with:

Data <- subset( Data, select = -c( d : b )

As I said above, this syntax works only when the column names are known. It won't work when say the column names are determined programmatically (i.e. assigned to a variable). I'll reproduce this Warning from the ?subset documentation:

Warning:

This is a convenience function intended for use interactively. For programming it is better to use the standard subsetting functions like '[', and in particular the non-standard evaluation of argument 'subset' can have unanticipated consequences.

As all have mentioned it is

request.getHeader("referer");

I would like to add some more details about security aspect of referer header in contrast with accepted answer. In Open Web Application Security Project(OWASP) cheat sheets, under Cross-Site Request Forgery (CSRF) Prevention Cheat Sheet it mentions about importance of referer header.

More importantly for this recommended Same Origin check, a number of HTTP request headers can't be set by JavaScript because they are on the 'forbidden' headers list. Only the browsers themselves can set values for these headers, making them more trustworthy because not even an XSS vulnerability can be used to modify them.

The Source Origin check recommended here relies on three of these protected headers: Origin, Referer, and Host, making it a pretty strong CSRF defense all on its own.

You can refer Forbidden header list here. User agent(ie:browser) has the full control over these headers not the user.

In addition to the differences already noted, there's another extremely important difference that I just now discovered the hard way: unlike np.mean, np.average doesn't allow the dtype keyword, which is essential for getting correct results in some cases. I have a very large single-precision array that is accessed from an h5 file. If I take the mean along axes 0 and 1, I get wildly incorrect results unless I specify dtype='float64':

>T.shape
(4096, 4096, 720)
>T.dtype
dtype('<f4')

m1 = np.average(T, axis=(0,1))                #  garbage
m2 = np.mean(T, axis=(0,1))                   #  the same garbage
m3 = np.mean(T, axis=(0,1), dtype='float64')  # correct results

Unfortunately, unless you know what to look for, you can't necessarily tell your results are wrong. I will never use np.average again for this reason but will always use np.mean(.., dtype='float64') on any large array. If I want a weighted average, I'll compute it explicitly using the product of the weight vector and the target array and then either np.sum or np.mean, as appropriate (with appropriate precision as well).

Do you want to address the individual bytes of a 32-bit int? One possible method is a union:

union
{
    unsigned int integer;
    unsigned char byte[4];
} foo;

int main()
{
    foo.integer = 123456789;
    printf("%u %u %u %u\n", foo.byte[3], foo.byte[2], foo.byte[1], foo.byte[0]);
}

Note: corrected the printf to reflect unsigned values.

In general the best way is to Change the table collation. However I have an old application and are not really able to estimate the outcome whether this has side effects. Therefore I tried somehow to convert the string into some other format that solved the collation problem. What I found working is to do the string compare by converting the strings into a hexadecimal representation of it's characters. On the database this is done with HEX(column). For PHP you may use this function:

public static function strToHex($string)
{
    $hex = '';
    for ($i=0; $i<strlen($string); $i++){
        $ord = ord($string[$i]);
        $hexCode = dechex($ord);
        $hex .= substr('0'.$hexCode, -2);
    }
    return strToUpper($hex);
}

When doing the database query, your original UTF8 string must be converted first into an iso string (e.g. using utf8_decode() in PHP) before using it in the DB. Because of the collation type the database cannot have UTF8 characters inside so the comparism should work event though this changes the original string (converting UTF8 characters that are not existend in the ISO charset result in a ? or these are removed entirely). Just make sure that when you write data into the database, that you use the same UTF8 to ISO conversion.

When using bootstrap 4 or 5, flexbox could be used to achieve desired effect:

<body class="d-flex flex-column min-vh-100">
    <header>HEADER</header>
    <content>CONTENT</content>
    <footer class="mt-auto"></footer>
</body>

Please check the examples: Bootstrap 4 Bootstrap 5

In bootstrap 3 and without use of bootstrap. The simplest and cross browser solution for this problem is to set a minimal height for body object. And then set absolute position for the footer with bottom: 0 rule.

body {
  min-height: 100vh;
  position: relative;
  margin: 0;
  padding-bottom: 100px; //height of the footer
  box-sizing: border-box;
}

footer {
  position: absolute;
  bottom: 0;
  height: 100px;
}

Please check this example: Bootstrap 3

There are some working solutions here already, but here's another one:

>>> import types
>>> class Dummy: pass
>>> type(Dummy) is types.ClassType
True

OCT. 2016 UPDATE

Since the -moz-element() property doesn't seem to be widely supported by other browsers except to FF, there's an even easier technique to apply blurring without affecting the contents of the container. The use of pseudoelements is ideal in this case in combination with svg blur filter.

Check the demo using pseudo-element

(Demo was tested in FF v49, Chrome v53, Opera 40 - IE doesn't seem to support blur either with css or svg filter)

The only way (so far) of having a blur effect in the background without js plugins, is the use of -moz-element() property in combination with the svg blur filter. With -moz-element() you can define an element as a background image of another element. Then you apply the svg blur filter. OPTIONAL: You can utilize some jQuery for scrolling if your background is in fixed position.

See my demo here

I understand it is a quite complicated solution and limited to FF (element() applies only to Mozilla at the moment with -moz-element() property) but at least there's been some effort in the past to implement in webkit browsers and hopefully it will be implemented in the future.

I have found very easy way to configure spacing between cells or rows by using IB.

Just select UICollectionView from storyboard/Xib file and click in Size Inspector as specified in below image.

For configuring space programatically use following properties.

1) For setting space between rows.

[self.collectionView setMinimumLineSpacing:5];

2) For setting space between items/cells.

[self.collectionView setMinimumInteritemSpacing:5];

Try this:

Python Cryptography Toolkit (pycrypto) is required

$ pip install pycrypto

Code:

from Crypto.Cipher import AES
from base64 import b64encode, b64decode


class Crypt:

    def __init__(self, salt='SlTKeYOpHygTYkP3'):
        self.salt = salt.encode('utf8')
        self.enc_dec_method = 'utf-8'

    def encrypt(self, str_to_enc, str_key):
        try:
            aes_obj = AES.new(str_key, AES.MODE_CFB, self.salt)
            hx_enc = aes_obj.encrypt(str_to_enc.encode('utf8'))
            mret = b64encode(hx_enc).decode(self.enc_dec_method)
            return mret
        except ValueError as value_error:
            if value_error.args[0] == 'IV must be 16 bytes long':
                raise ValueError('Encryption Error: SALT must be 16 characters long')
            elif value_error.args[0] == 'AES key must be either 16, 24, or 32 bytes long':
                raise ValueError('Encryption Error: Encryption key must be either 16, 24, or 32 characters long')
            else:
                raise ValueError(value_error)

    def decrypt(self, enc_str, str_key):
        try:
            aes_obj = AES.new(str_key.encode('utf8'), AES.MODE_CFB, self.salt)
            str_tmp = b64decode(enc_str.encode(self.enc_dec_method))
            str_dec = aes_obj.decrypt(str_tmp)
            mret = str_dec.decode(self.enc_dec_method)
            return mret
        except ValueError as value_error:
            if value_error.args[0] == 'IV must be 16 bytes long':
                raise ValueError('Decryption Error: SALT must be 16 characters long')
            elif value_error.args[0] == 'AES key must be either 16, 24, or 32 bytes long':
                raise ValueError('Decryption Error: Encryption key must be either 16, 24, or 32 characters long')
            else:
                raise ValueError(value_error)

Usage:

        test_crpt = Crypt()
        test_text = """Lorem ipsum dolor sit amet, consectetur adipisicing elit, sed do eiusmod
tempor incididunt ut labore et dolore magna aliqua. Ut enim ad minim veniam,
quis nostrud exercitation ullamco laboris nisi ut aliquip ex ea commodo
consequat. Duis aute irure dolor in reprehenderit in voluptate velit esse
cillum dolore eu fugiat nulla pariatur. Excepteur sint occaecat cupidatat non
proident, sunt in culpa qui officia deserunt mollit anim id est laborum.
Lorem ipsum dolor sit amet, consectetur adipisicing elit, sed do eiusmod
tempor incididunt ut labore et dolore magna aliqua. Ut enim ad minim veniam,
quis nostrud exercitation ullamco laboris nisi ut aliquip ex ea commodo
consequat. Duis aute irure dolor in reprehenderit in voluptate velit esse
cillum dolore eu fugiat nulla pariatur. Excepteur sint occaecat cupidatat non
proident, sunt in culpa qui officia deserunt mollit anim id est laborum.
Lorem ipsum dolor sit amet, consectetur adipisicing elit, sed do eiusmod
tempor incididunt ut labore et dolore magna aliqua. Ut enim ad minim veniam,
quis nostrud exercitation ullamco laboris nisi ut aliquip ex ea commodo
consequat. Duis aute irure dolor in reprehenderit in voluptate velit esse
cillum dolore eu fugiat nulla pariatur. Excepteur sint occaecat cupidatat non
proident, sunt in culpa qui officia deserunt mollit anim id est laborum."""

        test_key = 'MyKey4TestingYnP'
        test_enc_text = test_crpt.encrypt(test_text, test_key)
        test_dec_text = test_crpt.decrypt(test_enc_text, test_key)
        print(f'Encrypted:{test_enc_text}  Decrypted:{test_dec_text}')

No it doesn't. I would expect this in a future api release, but for now we are stuck with EditText. Another option is this library:
https://github.com/marvinlabs/android-floatinglabel-widgets

Here is the simple API-less "readable script" version I use for pre-padding a string. (Simple, Readable, and Adjustable).

while(str.length() < desired_length)
  str = '0'+str;

In the cell you want your result to appear, use the following formula:

=COUNTIF(A1:A200,"<>")

That will count all cells which have a value and ignore all empty cells in the range of A1 to A200.

NORMSINV (mentioned in a comment) is the inverse of the CDF of the standard normal distribution. Using scipy, you can compute this with the ppf method of the scipy.stats.norm object. The acronym ppf stands for percent point function, which is another name for the quantile function.

In [20]: from scipy.stats import norm

In [21]: norm.ppf(0.95)
Out[21]: 1.6448536269514722

Check that it is the inverse of the CDF:

In [34]: norm.cdf(norm.ppf(0.95))
Out[34]: 0.94999999999999996

By default, norm.ppf uses mean=0 and stddev=1, which is the "standard" normal distribution. You can use a different mean and standard deviation by specifying the loc and scale arguments, respectively.

In [35]: norm.ppf(0.95, loc=10, scale=2)
Out[35]: 13.289707253902945

If you look at the source code for scipy.stats.norm, you'll find that the ppf method ultimately calls scipy.special.ndtri. So to compute the inverse of the CDF of the standard normal distribution, you could use that function directly:

In [43]: from scipy.special import ndtri

In [44]: ndtri(0.95)
Out[44]: 1.6448536269514722

In C++, variable length arrays are not legal. G++ allows this as an "extension" (because C allows it), so in G++ (without being -pedantic about following the C++ standard), you can do:

int n = 10;
double a[n]; // Legal in g++ (with extensions), illegal in proper C++

If you want a "variable length array" (better called a "dynamically sized array" in C++, since proper variable length arrays aren't allowed), you either have to dynamically allocate memory yourself:

int n = 10;
double* a = new double[n]; // Don't forget to delete [] a; when you're done!

Or, better yet, use a standard container:

int n = 10;
std::vector<double> a(n); // Don't forget to #include <vector>

If you still want a proper array, you can use a constant, not a variable, when creating it:

const int n = 10;
double a[n]; // now valid, since n isn't a variable (it's a compile time constant)

Similarly, if you want to get the size from a function in C++11, you can use a constexpr:

constexpr int n()
{
    return 10;
}

double a[n()]; // n() is a compile time constant expression

The composer documentation states that:

After adding the autoload field, you have to re-run install to re-generate the vendor/autoload.php file.

Assuming your "src" dir resides at the same level as "vendor" dir:

• src
  • AppName
• vendor
• composer.json

the following config is absolutely correct:

{
    "autoload": {
        "psr-0": {"AppName": "src/"}
    }
}

but you must re-update/install dependencies to make it work for you, i.e. run:

php composer.phar update

This command will get the latest versions of the dependencies and update the file "vendor/composer/autoload_namespaces.php" to match your configuration.

Also as noted by @Dom, you can use composer dump-autoload to update the autoloader without having to go through an update.

Please set http content type in header and also make sure the server is authenticating CORS. This is how to do it in PHP:

//NOT A TESTED CODE
header('Content-Type: application/json;charset=UTF-8');
header('Access-Control-Allow-Origin: *');
header('Access-Control-Allow-Methods: DELETE, HEAD, GET, OPTIONS, POST, PUT');
header('Access-Control-Allow-Headers: Content-Type, Content-Range, Content-Disposition, Content-Description');
header('Access-Control-Max-Age: 1728000');

Please refer to:

http://www.w3.org/TR/cors/#cross-origin-request-with-preflight-0

How does Access-Control-Allow-Origin header work?

Put them in an arrayList in your first class like:

import java.util.ArrayList;
    public class numbers {

    private int number1 = 50;
    private int number2 = 100;

    public ArrayList<int> getNumberList() {
        ArrayList<int> numbersList= new ArrayList<int>();
        numbersList.add(number1);
        numberList.add(number2);
        ....
        return numberList;
    }
}

Then, in your test class you can call numbers.getNumberList() to get your arrayList. In addition, you might want to create methods like addToList / removeFromList in your numbers class so you can handle it the way you need it.

You can also access a variable declared in one class from another simply like

numbers.numberList;

if you have it declared there as public.

But it isn't such a good practice in my opinion, since you probably need to modify this list in your code later. Note that you have to add your class to the import list.

If you can tell me what your app requirements are, i'll be able tell you more precise what i think it's best to do.

The WITH clause for Common Table Expressions go at the top.

Wrapping every insert in a CTE has the benefit of visually segregating the query logic from the column mapping.

Spot the mistake:

WITH _INSERT_ AS (
  SELECT
    [BatchID]      = blah
   ,[APartyNo]     = blahblah
   ,[SourceRowID]  = blahblahblah
  FROM Table1 AS t1
)
INSERT Table2
      ([BatchID], [SourceRowID], [APartyNo])
SELECT [BatchID], [APartyNo], [SourceRowID]   
FROM _INSERT_

Same mistake:

INSERT Table2 (
  [BatchID]
 ,[SourceRowID]
 ,[APartyNo]
)
SELECT
  [BatchID]      = blah
 ,[APartyNo]     = blahblah
 ,[SourceRowID]  = blahblahblah
FROM Table1 AS t1

A few lines of boilerplate make it extremely easy to verify the code inserts the right number of columns in the right order, even with a very large number of columns. Your future self will thank you later.

For those of you who don't have a subclass of UITableViewCell:

- (UITableViewCell *)tableView:(UITableView *)tableView cellForRowAtIndexPath:(NSIndexPath *)indexPath {
 [...]

      CGSize itemSize = CGSizeMake(40, 40);
      UIGraphicsBeginImageContextWithOptions(itemSize, NO, UIScreen.mainScreen.scale);
      CGRect imageRect = CGRectMake(0.0, 0.0, itemSize.width, itemSize.height);
      [cell.imageView.image drawInRect:imageRect];
      cell.imageView.image = UIGraphicsGetImageFromCurrentImageContext();
      UIGraphicsEndImageContext();

 [...]
     return cell;
}

The code above sets the size to be 40x40.

Swift 2

    let itemSize = CGSizeMake(25, 25);
    UIGraphicsBeginImageContextWithOptions(itemSize, false, UIScreen.mainScreen().scale);
    let imageRect = CGRectMake(0.0, 0.0, itemSize.width, itemSize.height);
    cell.imageView?.image!.drawInRect(imageRect)
    cell.imageView?.image! = UIGraphicsGetImageFromCurrentImageContext();
    UIGraphicsEndImageContext();

Or you can use another(not tested) approach suggested by @Tommy:

- (UITableViewCell *)tableView:(UITableView *)tableView cellForRowAtIndexPath:(NSIndexPath *)indexPath {
 [...]

      CGSize itemSize = CGSizeMake(40, 40);
      UIGraphicsBeginImageContextWithOptions(itemSize, NO, 0.0)          
 [...]
     return cell;
}

Swift 3+

let itemSize = CGSize.init(width: 25, height: 25)
UIGraphicsBeginImageContextWithOptions(itemSize, false, UIScreen.main.scale);
let imageRect = CGRect.init(origin: CGPoint.zero, size: itemSize)
cell?.imageView?.image!.draw(in: imageRect)
cell?.imageView?.image! = UIGraphicsGetImageFromCurrentImageContext()!;
UIGraphicsEndImageContext();

The code above is the Swift 3+ version of the above.

You have to use absolute position along with your desired height. in your CSS, do the following:

#id-of-iFrame {
    position: absolute;
    height: 100%;
}

#include <cstdlib>
...
/*wherever you want it to end, e.g. in an if-statement:*/
if (T == 0)
{
exit(0);
}

bufferedWriter.write(text + "\n"); This method can work, but the new line character can be different between platforms, so alternatively, you can use this method:

bufferedWriter.write(text);
bufferedWriter.newline();

The answers for this old but relevant question are wildly variable in speed.

The fastest of the solution posted by kxr.

However, this is even faster and otherwise not here:

def f1(arr, find, replace):
    # fast and readable
    base=0
    for cnt in range(arr.count(find)):
        offset=arr.index(find, base)
        arr[offset]=replace
        base=offset+1

Here is timing for the various solutions. The faster ones are 3X faster than accepted answer and 5X faster than the slowest answer here.

To be fair, all methods needed to do inlace replacement of the array sent to the function.

Please see timing code below:

def f1(arr, find, replace):
    # fast and readable
    base=0
    for cnt in range(arr.count(find)):
        offset=arr.index(find, base)
        arr[offset]=replace
        base=offset+1
        
def f2(arr,find,replace):
    # accepted answer
    for i,e in enumerate(arr):
        if e==find: 
            arr[i]=replace
        
def f3(arr,find,replace):
    # in place list comprehension
    arr[:]=[replace if e==find else e for e in arr]
    
def f4(arr,find,replace):
    # in place map and lambda -- SLOW
    arr[:]=list(map(lambda x: x if x != find else replace, arr))
    
def f5(arr,find,replace):
    # find index with comprehension
    for i in [i for i, e in enumerate(arr) if e==find]:
        arr[i]=replace
        
def f6(arr,find,replace):
    # FASTEST but a little les clear
    try:
        while True:
            arr[arr.index(find)]=replace
    except ValueError:
        pass    

def f7(lst, old, new):
    """replace list elements (inplace)"""
    i = -1
    try:
        while 1:
            i = lst.index(old, i + 1)
            lst[i] = new
    except ValueError:
        pass
    
    
import time     

def cmpthese(funcs, args=(), cnt=1000, rate=True, micro=True):
    """Generate a Perl style function benchmark"""                   
    def pprint_table(table):
        """Perl style table output"""
        def format_field(field, fmt='{:,.0f}'):
            if type(field) is str: return field
            if type(field) is tuple: return field[1].format(field[0])
            return fmt.format(field)     

        def get_max_col_w(table, index):
            return max([len(format_field(row[index])) for row in table])         

        col_paddings=[get_max_col_w(table, i) for i in range(len(table[0]))]
        for i,row in enumerate(table):
            # left col
            row_tab=[row[0].ljust(col_paddings[0])]
            # rest of the cols
            row_tab+=[format_field(row[j]).rjust(col_paddings[j]) for j in range(1,len(row))]
            print(' '.join(row_tab))                

    results={}
    for i in range(cnt):
        for f in funcs:
            start=time.perf_counter_ns()
            f(*args)
            stop=time.perf_counter_ns()
            results.setdefault(f.__name__, []).append(stop-start)
    results={k:float(sum(v))/len(v) for k,v in results.items()}     
    fastest=sorted(results,key=results.get, reverse=True)
    table=[['']]
    if rate: table[0].append('rate/sec')
    if micro: table[0].append('\u03bcsec/pass')
    table[0].extend(fastest)
    for e in fastest:
        tmp=[e]
        if rate:
            tmp.append('{:,}'.format(int(round(float(cnt)*1000000.0/results[e]))))

        if micro:
            tmp.append('{:,.1f}'.format(results[e]/float(cnt)))

        for x in fastest:
            if x==e: tmp.append('--')
            else: tmp.append('{:.1%}'.format((results[x]-results[e])/results[e]))
        table.append(tmp) 

    pprint_table(table)                    



if __name__=='__main__':
    import sys
    import time 
    print(sys.version)
    cases=(
        ('small, found', 9, 100),
        ('small, not found', 99, 100),
        ('large, found', 9, 1000),
        ('large, not found', 99, 1000)
    )
    for txt, tgt, mul in cases:
        print(f'\n{txt}:')
        arr=[1,2,3,4,5,6,7,8,9,0]*mul 
        args=(arr,tgt,'X')
        cmpthese([f1,f2,f3, f4, f5, f6, f7],args)   

And the results:

3.9.1 (default, Feb  3 2021, 07:38:02) 
[Clang 12.0.0 (clang-1200.0.32.29)]

small, found:
   rate/sec µsec/pass     f4     f3     f5     f2     f6     f7     f1
f4  133,982       7.5     -- -38.8% -49.0% -52.5% -78.5% -78.6% -82.9%
f3  219,090       4.6  63.5%     -- -16.6% -22.4% -64.8% -65.0% -72.0%
f5  262,801       3.8  96.1%  20.0%     --  -6.9% -57.8% -58.0% -66.4%
f2  282,259       3.5 110.7%  28.8%   7.4%     -- -54.6% -54.9% -63.9%
f6  622,122       1.6 364.3% 184.0% 136.7% 120.4%     --  -0.7% -20.5%
f7  626,367       1.6 367.5% 185.9% 138.3% 121.9%   0.7%     -- -19.9%
f1  782,307       1.3 483.9% 257.1% 197.7% 177.2%  25.7%  24.9%     --

small, not found:
   rate/sec µsec/pass     f4     f5     f2     f3     f6     f7     f1
f4   13,846      72.2     -- -40.3% -41.4% -47.8% -85.2% -85.4% -86.2%
f5   23,186      43.1  67.5%     --  -1.9% -12.5% -75.2% -75.5% -76.9%
f2   23,646      42.3  70.8%   2.0%     -- -10.8% -74.8% -75.0% -76.4%
f3   26,512      37.7  91.5%  14.3%  12.1%     -- -71.7% -72.0% -73.5%
f6   93,656      10.7 576.4% 303.9% 296.1% 253.3%     --  -1.0%  -6.5%
f7   94,594      10.6 583.2% 308.0% 300.0% 256.8%   1.0%     --  -5.6%
f1  100,206      10.0 623.7% 332.2% 323.8% 278.0%   7.0%   5.9%     --

large, found:
   rate/sec µsec/pass     f4     f2     f5     f3     f6     f7     f1
f4      145   6,889.4     -- -33.3% -34.8% -48.6% -85.3% -85.4% -85.8%
f2      218   4,593.5  50.0%     --  -2.2% -22.8% -78.0% -78.1% -78.6%
f5      223   4,492.4  53.4%   2.3%     -- -21.1% -77.5% -77.6% -78.2%
f3      282   3,544.0  94.4%  29.6%  26.8%     -- -71.5% -71.6% -72.3%
f6      991   1,009.5 582.4% 355.0% 345.0% 251.1%     --  -0.4%  -2.8%
f7      995   1,005.4 585.2% 356.9% 346.8% 252.5%   0.4%     --  -2.4%
f1    1,019     981.3 602.1% 368.1% 357.8% 261.2%   2.9%   2.5%     --

large, not found:
   rate/sec µsec/pass     f4     f5     f2     f3     f6     f7     f1
f4      147   6,812.0     -- -35.0% -36.4% -48.9% -85.7% -85.8% -86.1%
f5      226   4,424.8  54.0%     --  -2.0% -21.3% -78.0% -78.1% -78.6%
f2      231   4,334.9  57.1%   2.1%     -- -19.6% -77.6% -77.7% -78.2%
f3      287   3,484.0  95.5%  27.0%  24.4%     -- -72.1% -72.2% -72.8%
f6    1,028     972.3 600.6% 355.1% 345.8% 258.3%     --  -0.4%  -2.7%
f7    1,033     968.2 603.6% 357.0% 347.7% 259.8%   0.4%     --  -2.3%
f1    1,057     946.2 619.9% 367.6% 358.1% 268.2%   2.8%   2.3%     --

<Switch android:layout_width="wrap_content" 
                    android:layout_height="wrap_content"
                    android:thumb="@drawable/custom_switch_inner_holo_light"
                    android:track="@drawable/custom_switch_track_holo_light"
                    android:textOn="@string/yes"
                    android:textOff="@string/no"/>

drawable/custom_switch_inner_holo_light.xml

<selector xmlns:android="http://schemas.android.com/apk/res/android">
    <item android:state_enabled="false" android:drawable="@drawable/custom_switch_thumb_disabled_holo_light" />
    <item android:state_pressed="true"  android:drawable="@drawable/custom_switch_thumb_pressed_holo_light" />
    <item android:state_checked="true"  android:drawable="@drawable/custom_switch_thumb_activated_holo_light" />
    <item                               android:drawable="@drawable/custom_switch_thumb_holo_light" />
</selector>

drawable/custom_switch_track_holo_light.xml

<selector xmlns:android="http://schemas.android.com/apk/res/android">
    <item android:state_focused="true"  android:drawable="@drawable/custom_switch_bg_focused_holo_light" />
    <item                               android:drawable="@drawable/custom_switch_bg_holo_light" />
</selector>

Next images are 9.paths drawables and they must be in different density (mdpi, hdpi, xhdpi, xxhdpi). As example I give xxhdpi (you can resize they if u needed):

drawable/custom_switch_thumb_disabled_holo_light

drawable/custom_switch_thumb_pressed_holo_light

drawable/custom_switch_thumb_activated_holo_light

drawable/custom_switch_thumb_holo_light

drawable/custom_switch_bg_focused_holo_light

drawable/custom_switch_bg_holo_light

First of all, you lack parentheses to call GetType. What you see is the MethodInfo describing the GetType method on [DayOfWeek]. To actually call GetType, you should do:

$a.GetType();
$b.GetType();

You should see that $a is a [DayOfWeek], and $b is a custom object generated by the Select-Object cmdlet to capture only the DayOfWeek property of a data object. Hence, it's an object with a DayOfWeek property only:

C:\> $b.DayOfWeek -eq $a
True

Source code of CSS/JS we usually minified/compress. Now if we want to debug those minified files then we have to add following line at the end of minified file

/*# sourceMappingURL=bootstrap.min.css.map */

This tells compiler where is source file actually mapped.

In the case of JS its make sense
but in the case of CSS, its actually debugging of SCSS.

To Remove Warning: remove /*# sourceMappingURL=bootstrap.min.css.map */ from the end of minified file, .

What is also useful, if you use it for Machine_learning and want to seperate always the same data, you could use:

df.sample(n=len(df), random_state=42)

this makes sure, that you keep your random choice always replicatable

You are running Python 2 code on Python 3. In Python 3, the module has been renamed to http.client.

You could try to run the 2to3 tool on your code, and try to have it translated automatically. References to httplib will automatically be rewritten to use http.client instead.

You can use new Date().getTime() for getting timestamps. Then you can calculate the difference between end and start and finally transform the timestamp which is ms into s.

const start = new Date().getTime();
const end = new Date().getTime();

const diff = end - start;
const seconds = Math.floor(diff / 1000 % 60);

if the current thread is killed and you use Thread.Sleep and it is executing then you might get a ThreadAbortException. With Task.Delay you can always provide a cancellation token and gracefully kill it. Thats one reason I would choose Task.Delay. see http://social.technet.microsoft.com/wiki/contents/articles/21177.visual-c-thread-sleep-vs-task-delay.aspx

I also agree efficiency is not paramount in this case.

CREATE TABLE Employees
(
    Id int,
    Name varchar(50) not null,
    Photo varbinary(max) not null
)


INSERT INTO Employees (Id, Name, Photo) 
SELECT 10, 'John', BulkColumn 
FROM Openrowset( Bulk 'C:\photo.bmp', Single_Blob) as EmployeePicture

Yes,Closure (Lambda Expressions) is the new feature with the upcoming Java SE 8 release. You can get more info about this from the below link: http://docs.oracle.com/javase/tutorial/java/javaOO/lambdaexpressions.html

For me this problem arised while trying to connect to the SAP Hana database. When I got this error,

OperationalError: Lost connection to HANA server (ConnectionResetError(10054, 'An existing connection was forcibly closed by the remote host', None, 10054, None))

I tried to run the code for connection(mentioned below), which created that error, again and it worked.

    import pyhdb
    connection = pyhdb.connect(host="example.com",port=30015,user="user",password="secret")
    cursor = connection.cursor()
    cursor.execute("SELECT 'Hello Python World' FROM DUMMY")
    cursor.fetchone()
    connection.close()

It was because the server refused to connect. It might require you to wait for a while and try again. Try closing the Hana Studio by logging off and then logging in again. Keep running the code for a number of times.

Great Thanks to @Massimo Cafaro and Shaybc I was able achieve below tasks

in iOS 8 :

Record audio & Save

Play Saved Recording

1.Add "AVFoundation.framework" to your project

in .h file

2.Add below import statement 'AVFoundation/AVFoundation.h'.

3.Define "AVAudioRecorderDelegate"

4.Create a layout with Record, Play buttons and their action methids

5.Define Recorder and Player etc.

Here is the complete example code which may help you.

ViewController.h

#import <UIKit/UIKit.h>
#import <AVFoundation/AVFoundation.h>

@interface ViewController : UIViewController <AVAudioRecorderDelegate>

@property(nonatomic,strong) AVAudioRecorder *recorder;
@property(nonatomic,strong) NSMutableDictionary *recorderSettings;
@property(nonatomic,strong) NSString *recorderFilePath;
@property(nonatomic,strong) AVAudioPlayer *audioPlayer;
@property(nonatomic,strong) NSString *audioFileName;

- (IBAction)startRecording:(id)sender;
- (IBAction)stopRecording:(id)sender;

- (IBAction)startPlaying:(id)sender;
- (IBAction)stopPlaying:(id)sender;

@end

Then do the job in

ViewController.m

#import "ViewController.h"

#define DOCUMENTS_FOLDER [NSHomeDirectory() stringByAppendingPathComponent:@"Documents"]

@interface ViewController ()
@end

@implementation ViewController

@synthesize recorder,recorderSettings,recorderFilePath;
@synthesize audioPlayer,audioFileName;


#pragma mark - View Controller Life cycle methods
- (void)viewDidLoad
{
    [super viewDidLoad];
}
- (void)didReceiveMemoryWarning
{
    [super didReceiveMemoryWarning];
}


#pragma mark - Audio Recording
- (IBAction)startRecording:(id)sender
{
    AVAudioSession *audioSession = [AVAudioSession sharedInstance];
    NSError *err = nil;
    [audioSession setCategory :AVAudioSessionCategoryPlayAndRecord error:&err];
    if(err)
    {
        NSLog(@"audioSession: %@ %ld %@", [err domain], (long)[err code], [[err userInfo] description]);
        return;
    }
    [audioSession setActive:YES error:&err];
    err = nil;
    if(err)
    {
        NSLog(@"audioSession: %@ %ld %@", [err domain], (long)[err code], [[err userInfo] description]);
        return;
    }
    
    recorderSettings = [[NSMutableDictionary alloc] init];
    [recorderSettings setValue :[NSNumber numberWithInt:kAudioFormatLinearPCM] forKey:AVFormatIDKey];
    [recorderSettings setValue:[NSNumber numberWithFloat:44100.0] forKey:AVSampleRateKey];
    [recorderSettings setValue:[NSNumber numberWithInt: 2] forKey:AVNumberOfChannelsKey];
    [recorderSettings setValue :[NSNumber numberWithInt:16] forKey:AVLinearPCMBitDepthKey];
    [recorderSettings setValue :[NSNumber numberWithBool:NO] forKey:AVLinearPCMIsBigEndianKey];
    [recorderSettings setValue :[NSNumber numberWithBool:NO] forKey:AVLinearPCMIsFloatKey];
    
    // Create a new audio file
    audioFileName = @"recordingTestFile";
    recorderFilePath = [NSString stringWithFormat:@"%@/%@.caf", DOCUMENTS_FOLDER, audioFileName] ;
    
    NSURL *url = [NSURL fileURLWithPath:recorderFilePath];
    err = nil;
    recorder = [[ AVAudioRecorder alloc] initWithURL:url settings:recorderSettings error:&err];
    if(!recorder){
        NSLog(@"recorder: %@ %ld %@", [err domain], (long)[err code], [[err userInfo] description]);
        UIAlertView *alert =
        [[UIAlertView alloc] initWithTitle: @"Warning" message: [err localizedDescription] delegate: nil
                         cancelButtonTitle:@"OK" otherButtonTitles:nil];
        [alert show];
        return;
    }
    
    //prepare to record
    [recorder setDelegate:self];
    [recorder prepareToRecord];
    recorder.meteringEnabled = YES;
    
    BOOL audioHWAvailable = audioSession.inputIsAvailable;
    if (! audioHWAvailable) {
        UIAlertView *cantRecordAlert =
        [[UIAlertView alloc] initWithTitle: @"Warning"message: @"Audio input hardware not available"
                                  delegate: nil cancelButtonTitle:@"OK" otherButtonTitles:nil];
        [cantRecordAlert show];
        return;
    }
    
    // start recording
    [recorder recordForDuration:(NSTimeInterval) 60];//Maximum recording time : 60 seconds default
    NSLog(@"Recroding Started");
}

- (IBAction)stopRecording:(id)sender
{
    [recorder stop];
    NSLog(@"Recording Stopped");
}

- (void)audioRecorderDidFinishRecording:(AVAudioRecorder *) aRecorder successfully:(BOOL)flag
{
    NSLog (@"audioRecorderDidFinishRecording:successfully:");
}


#pragma mark - Audio Playing
- (IBAction)startPlaying:(id)sender
{
    NSLog(@"playRecording");
    
    AVAudioSession *audioSession = [AVAudioSession sharedInstance];
    [audioSession setCategory:AVAudioSessionCategoryPlayback error:nil];
    
     NSURL *url = [NSURL fileURLWithPath:[NSString stringWithFormat:@"%@/%@.caf", DOCUMENTS_FOLDER, audioFileName]];
    NSError *error;
    audioPlayer = [[AVAudioPlayer alloc] initWithContentsOfURL:url error:&error];
    audioPlayer.numberOfLoops = 0;
    [audioPlayer play];
    NSLog(@"playing");
}
- (IBAction)stopPlaying:(id)sender
{
    [audioPlayer stop];
    NSLog(@"stopped");
}

@end

You can use @Async annotation from jcabi-aspects and AspectJ:

public class Foo {
  @Async
  public void save() {
    // to be executed in the background
  }
}

When you call save(), a new thread starts and executes its body. Your main thread continues without waiting for the result of save().

I know an answer has already been accepted, but wanted to point a few things out.

Setting the content-type and charset is obviously a good practice, doing it on the server is much better, because it ensures consistency across your application.

However, I would use UTF-8 only when the language of my application uses a lot of characters that are available only in the UTF-8 charset. If you want to show a unicode character or symbol in one of cases, you can do so without changing the charset of your page.

HTML renderers have always been able to display symbols which are not part of the encoding character set of the page, as long as you mention the symbol in its numeric character reference (NCR). Sounds weird but its true.

So, even if your html has a header that states it has an encoding of ansi or any of the iso charsets, you can display a check mark by using its html character reference, in decimal - &#10003; or in hex - &#x2713;

So its a little difficult to understand why you are facing this issue on your pages. Can you check if the NCR value is correct, this is a good reference http://www.fileformat.info/info/unicode/char/2713/index.htm

The problem is that you don't have the administrator rights to access it as running or compilation of something is being done in the basic C drive. To eliminate this problem, run the devcpp.exe as an administrator. You could also change the permission from properties and allowing access read write modify etc for the system and by the system.

Wrap your $adr in urlencode(). I was having this problem and this solved it for me.

We tried several things before arriving at an acceptable solution:

xxd -u /usr/bin/xxd | grep 'DF'
00017b0: 4010 8D05 0DFF FF0A 0300 53E3 0610 A003  @.........S.....


root# grep -ibH "df" /usr/bin/xxd
Binary file /usr/bin/xxd matches
xxd -u /usr/bin/xxd | grep -H 'DF'
(standard input):00017b0: 4010 8D05 0DFF FF0A 0300 53E3 0610 A003  @.........S.....

Then found we could get usable results with

xxd -u /usr/bin/xxd > /tmp/xxd.hex ; grep -H 'DF' /tmp/xxd

Note that using a simple search target like 'DF' will incorrectly match characters that span across byte boundaries, i.e.

xxd -u /usr/bin/xxd | grep 'DF'
00017b0: 4010 8D05 0DFF FF0A 0300 53E3 0610 A003  @.........S.....
--------------------^^

So we use an ORed regexp to search for ' DF' OR 'DF ' (the searchTarget preceded or followed by a space char).

The final result seems to be

xxd -u -ps -c 10000000000 DumpFile > DumpFile.hex
egrep ' DF|DF ' Dumpfile.hex

0001020: 0089 0424 8D95 D8F5 FFFF 89F0 E8DF F6FF  ...$............
-----------------------------------------^^
0001220: 0C24 E871 0B00 0083 F8FF 89C3 0F84 DF03  .$.q............
--------------------------------------------^^

check out my js lib for caching: https://github.com/hoangnd25/cacheJS

My blog post: New way to cache your data with Javascript

Features:

• Conveniently use array as key for saving cache
• Support array and localStorage
• Clear cache by context (clear all blog posts with authorId="abc")
• No dependency

Basic usage:

Saving cache:

cacheJS.set({blogId:1,type:'view'},'<h1>Blog 1</h1>');
cacheJS.set({blogId:2,type:'view'},'<h1>Blog 2</h1>', null, {author:'hoangnd'});
cacheJS.set({blogId:3,type:'view'},'<h1>Blog 3</h1>', 3600, {author:'hoangnd',categoryId:2});

Retrieving cache:

cacheJS.get({blogId: 1,type: 'view'});

Flushing cache

cacheJS.removeByKey({blogId: 1,type: 'view'});
cacheJS.removeByKey({blogId: 2,type: 'view'});

cacheJS.removeByContext({author:'hoangnd'});

Switching provider

cacheJS.use('array');
cacheJS.use('array').set({blogId:1},'<h1>Blog 1</h1>')};

<input type="button" onclick="functionA();functionB();" />

function functionA()
{

}

function functionB()
{

}

I ran into a situation where I needed to have an appendable string of unknown size. These are the benchmark results (python 2.7.3):

$ python -m timeit -s 's=""' 's+="a"'
10000000 loops, best of 3: 0.176 usec per loop
$ python -m timeit -s 's=[]' 's.append("a")'
10000000 loops, best of 3: 0.196 usec per loop
$ python -m timeit -s 's=""' 's="".join((s,"a"))'
100000 loops, best of 3: 16.9 usec per loop
$ python -m timeit -s 's=""' 's="%s%s"%(s,"a")'
100000 loops, best of 3: 19.4 usec per loop

This seems to show that '+=' is the fastest. The results from the skymind link are a bit out of date.

(I realize that the second example is not complete, the final list would need to be joined. This does show, however, that simply preparing the list takes longer than the string concat.)

With pure JavaScript:

console.log(window.location.href)

Using Angular:

this.router.url

import { Component } from '@angular/core';
import { Router } from '@angular/router';

@Component({
    template: 'The href is: {{href}}'
    /*
    Other component settings
    */
})
export class Component {
    public href: string = "";

    constructor(private router: Router) {}

    ngOnInit() {
        this.href = this.router.url;
        console.log(this.router.url);
    }
}

The plunkr is here: https://plnkr.co/edit/0x3pCOKwFjAGRxC4hZMy?p=preview

There is no space allocated for the strings. use array (or) pointers with malloc() and free()

Other than that

#import <stdio.h>
#import <string.h>

should be

#include <stdio.h>
#include <string.h>

NOTE:

• anything that is malloc()ed must be free()'ed
• you need to allocate n + 1 bytes for a string which is of length n (the last byte is for \0)

Please you the following code as a reference

#include <stdio.h>
#include <stdlib.h>
#include <string.h>

int main(int argc, char *argv[])
{
    //char *str1 = "First string";
    char *str1 = "First string is a big string";
    char *str2 = NULL;

    if ((str2 = (char *) malloc(sizeof(char) * strlen(str1) + 1)) == NULL) {
        printf("unable to allocate memory \n");
        return -1; 
    }   

    strcpy(str2, str1);

    printf("str1 : %s \n", str1);
    printf("str2 : %s \n", str2);

    free(str2);
    return 0;
}

The JsonParser constructor has been deprecated. Use the static method instead:

JsonObject asJsonObject = JsonParser.parseString(request.schema).getAsJsonObject();

To Replace backslash at particular location:

if ((stringValue.contains("\\"))&&(stringValue.indexOf("\\", location-1)==(location-1))) {
    stringValue=stringValue.substring(0,location-1);
}

Here is the sample code.

System.IO.MemoryStream ms = new System.IO.MemoryStream();
System.IO.StreamWriter writer = new System.IO.StreamWriter(ms);
writer.Write("Hello its my sample file");
writer.Flush();
writer.Dispose();
ms.Position = 0;

System.Net.Mime.ContentType ct = new System.Net.Mime.ContentType(System.Net.Mime.MediaTypeNames.Text.Plain);
System.Net.Mail.Attachment attach = new System.Net.Mail.Attachment(ms, ct);
attach.ContentDisposition.FileName = "myFile.txt";

// I guess you know how to send email with an attachment
// after sending email
ms.Close();

Edit 1

You can specify other file types by System.Net.Mime.MimeTypeNames like System.Net.Mime.MediaTypeNames.Application.Pdf

Based on Mime Type you need to specify correct extension in FileName for instance "myFile.pdf"

You can call a stored procedure using the following syntax:

$result = mysql_query('CALL getNodeChildren(2)');

Try this:

var request = (HttpWebRequest)WebRequest.Create("http://www.example.com/recepticle.aspx");

var postData = "thing1=hello";
    postData += "&thing2=world";
var data = Encoding.ASCII.GetBytes(postData);

request.Method = "POST";
request.ContentType = "application/x-www-form-urlencoded";
request.ContentLength = data.Length;

using (var stream = request.GetRequestStream())
{
    stream.Write(data, 0, data.Length);
}

var response = (HttpWebResponse)request.GetResponse();

var responseString = new StreamReader(response.GetResponseStream()).ReadToEnd();

I seem to recall reading this article more than once, and the answer is only close to what I need.

Usually when I think I'm going to need a DO WHILE in T-SQL it's because I'm iterating a cursor, and I'm looking largely for optimal clarity (vs. optimal speed). In T-SQL that seems to fit a WHILE TRUE / IF BREAK.

If that's the scenario that brought you here, this snippet may save you a moment. Otherwise, welcome back, me. Now I can be certain I've been here more than once. :)

DECLARE Id INT, @Title VARCHAR(50)
DECLARE Iterator CURSOR FORWARD_ONLY FOR
SELECT Id, Title FROM dbo.SourceTable
OPEN Iterator
WHILE 1=1 BEGIN
    FETCH NEXT FROM @InputTable INTO @Id, @Title
    IF @@FETCH_STATUS < 0 BREAK
    PRINT 'Do something with ' + @Title
END
CLOSE Iterator
DEALLOCATE Iterator

Unfortunately, T-SQL doesn't seem to offer a cleaner way to singly-define the loop operation, than this infinite loop.

including over directories can be processed by proxy file

• root
• .....|__web
• .....|.........|_requiredDbSettings.php
• .....|
• .....|___db
• .....|.........|_dbsettings.php
• .....|

• .....|_proxy.php

  dbsettings.php:
  $host='localhost';
  $user='username':
  $pass='pass';
  
  proxy.php:
  include_once 'db/dbsettings.php
  
  requiredDbSettings.php:
  include_once './../proxy.php';
  

Try:

$("#test tr:eq(2)").remove();

Kotlin

import android.graphics.BitmapFactory
import android.os.Bundle
import android.support.v4.graphics.drawable.RoundedBitmapDrawableFactory
import kotlinx.android.synthetic.main.activity_main.*

val bitmap = BitmapFactory.decodeResource(resources, R.drawable.myImage)
val rounded = RoundedBitmapDrawableFactory.create(resources, bitmap)
rounded.cornerRadius = 20f
profileImageView.setImageDrawable(rounded)

To make ImageView Circular we can change cornerRadius with:

rounded.isCircular = true

As of this date, the correct way according to the dynamic routing docs is:

this.$route.params.yourProperty

instead of

this.$route.query.yourProperty

This is my implementation of RotatableImageView. Usage is very easy: just copy attrs.xml and RotatableImageView.java into your project and add RotatableImageView to your layout. Set desired rotation angle using example:angle parameter.

<FrameLayout xmlns:android="http://schemas.android.com/apk/res/android"
    xmlns:example="http://schemas.android.com/apk/res/com.example"
    android:layout_width="match_parent"
    android:layout_height="wrap_content">

    <com.example.views.RotatableImageView
        android:id="@+id/layout_example_image"
        android:layout_width="wrap_content"
        android:layout_height="wrap_content"
        android:adjustViewBounds="true"
        android:scaleType="fitCenter"
        android:src="@drawable/ic_layout_arrow"
        example:angle="180" />
</FrameLayout>

If you have some problems with displaying image, try change code in RotatableImageView.onDraw() method or use draw() method instead.

For those it might help, I use this list as a reference to define my content-type when I have to deal with images on my app.

It says that jpg extension can be declared with Content-type : image/jpeg

There isn't any image/jpg attribute for content-type.

First is understanding that RFID is very generic term. NFC is subset of RFID technology. NFC is used for prox card, credit cards, tap and go payment system. Your phones can read and emulate NFC (Apple pay, Google pay, etc.), if they support NFC. NFC is very short distance and low power - which is why you see tap and go type usage.

The more common RFID are the tags you see here and there. They come in a wide ranges of styles, uses and frequency.

HF - high frequency tags are what they use for "chipping" animals - cattle, dogs, cats. Read range is about 12 inches and requires an external antenna that is powered the bigger the antenna the more power it needs and the further it can read.

UFH tags look similar to HF tags but have a read range of several feet.

Also HF tags come single read and multi read. UFH is exclusviely multi read.

Mutiread means when a reader is active, you can litterally read about 1700 tags in under 10 seconds.

But this is a function of the size of the antenna and how much power you can push through the reader.

As to the direct question about Android and RFID - the best way to go is to get an external handheld reader that connects to your mobile device via Bluetooth. Bluetooth libraries exist for all mobile devices - Android, Apple, Windows. From there its just a matter of the manufacturer documentation about how to open a socket to the reader and how to decode the serial information.

The TSL line of readers is very popular because you don't have to deal with reading bytes and all that low level serial jazz that other manufactures do. They have a nice set of commands that are easy to use to control the reader.

Other manufactures are basic in that you open a serial socket and then read the output like you would see in terminal app like PuTTY.

MacOS

add this string in file ~/.bashrc or ~/.zshrc

export ANDROID_HOME="/Users/<userlogin>/Library/Android/sdk"

For me I found the solution after a lot of try which is replacing

HttpClient

with

System.Net.Http.HttpClient

If you using webpack in your application, you can simply set it there, using DefinePlugin...

So in your plugin section, set the NODE_ENV to production:

plugins: [
  new webpack.DefinePlugin({
    'process.env.NODE_ENV': '"production"',
  })
]

I think you're looking for dispatch_after(). It requires your block to accept no parameters, but you can just let the block capture those variables from your local scope instead.

int parameter1 = 12;
float parameter2 = 144.1;

// Delay execution of my block for 10 seconds.
dispatch_after(dispatch_time(DISPATCH_TIME_NOW, 10 * NSEC_PER_SEC), dispatch_get_main_queue(), ^{
    NSLog(@"parameter1: %d parameter2: %f", parameter1, parameter2);
});

More: https://developer.apple.com/documentation/dispatch/1452876-dispatch_after

The code starts file search from root colon, If I want to start search from a specific directory, to avoid going to that directory every time, where I should put one. I did it like

Sub GetFilePath()
FileSelected = "G:\Audits\A2010"
Set myFile = Application.FileDialog(msoFileDialogOpen)
With myFile
.Title = "Choose File"
.AllowMultiSelect = False
If .Show <> -1 Then
Exit Sub
End If
FileSelected = .SelectedItems(1)
End With

ActiveSheet.Range("C14") = FileSelected
End Sub

But it could not start reach from "G:\Audits\A2010"

If you have commons-io included in your project, you can do it without creating unecessary objects with org.apache.commons.io.FilenameUtils

String uri = "http://base_path/some_segment/id";
String fileName = FilenameUtils.getName(uri);
System.out.println(fileName);

Will give you the last part of the path, which is the id

New in HTML5: Use calc (on height)

<html style="width:100%; height:100%; margin: 0px; padding: 0px;">
<body style="width:100%; height:100%; margin: 0px; padding: 0px;">
<div style="width:100%; height:30px; background-color:#cccccc;">Banner</div>
<iframe src="http://www.google.com.tw" style="width:100%; height: calc(100% - 30px);"></iframe>
</body>
</html>

// from http://wezfurlong.org/blog/2006/nov/http-post-from-php-without-curl
function do_post_request($url, $data, $optional_headers = null)
{
  $params = array('http' => array(
              'method' => 'POST',
              'content' => $data
            ));
  if ($optional_headers !== null) {
    $params['http']['header'] = $optional_headers;
  }
  $ctx = stream_context_create($params);
  $fp = @fopen($url, 'rb', false, $ctx);
  if (!$fp) {
    throw new Exception("Problem with $url, $php_errormsg");
  }
  $response = @stream_get_contents($fp);
  if ($response === false) {
    throw new Exception("Problem reading data from $url, $php_errormsg");
  }
  return $response;
}

1.) Create an arraylist of appropriate type, in this case i.e String

2.) Create a JSONObject while passing your string to JSONObject constructor as input

• As JSONObject notation is represented by braces i.e {}
• Where as JSONArray notation is represented by square brackets i.e []

3.) Retrieve JSONArray from JSONObject (created at 2nd step) using "interests" as index.

4.) Traverse JASONArray using loops upto the length of array provided by length() function

5.) Retrieve your JSONObjects from JSONArray using getJSONObject(index) function

6.) Fetch the data from JSONObject using index '"interestKey"'.

Note : JSON parsing uses the escape sequence for special nested characters if the json response (usually from other JSON response APIs) contains quotes (") like this

`"{"key":"value"}"`

should be like this

`"{\"key\":\"value\"}"`

so you can use JSONParser to achieve escaped sequence format for safety as

JSONParser parser = new JSONParser();
JSONObject json = (JSONObject) parser.parse(inputString);

Code :

JSONParser parser = new JSONParser();
String response = "{interests : [{interestKey:Dogs}, {interestKey:Cats}]}";

JSONObject jsonObj = (JSONObject) parser.parse(response);

or

JSONObject jsonObj = new JSONObject("{interests : [{interestKey:Dogs}, {interestKey:Cats}]}");

List<String> interestList = new ArrayList<String>();

JSONArray jsonArray = jsonObj.getJSONArray("interests");

for(int i = 0 ; i < jsonArray.length() ; i++){
    interestList.add(jsonArray.getJSONObject(i).optString("interestKey"));
}

Note : Sometime you may see some exceptions when the values are not available in appropriate type or is there is no mapping key so in those cases when you are not sure about the presence of value so use optString, optInt, optBoolean etc which will simply return the default value if it is not present and even try to convert value to int if it is of string type and vice-versa so Simply No null or NumberFormat exceptions at all in case of missing key or value

From docs

Get an optional string associated with a key. It returns the defaultValue if there is no such key.

 public String optString(String key, String defaultValue) {

  String missingKeyValue = json_data.optString("status","N/A");
  // note there is no such key as "status" in response
  // will return "N/A" if no key found 

or To get empty string i.e "" if no key found then simply use

  String missingKeyValue = json_data.optString("status");
  // will return "" if no key found where "" is an empty string

Further reference to study

• How to convert String to JSONObject in Java
• Convert one array list item into multiple Items

Instead of using this:

$(document).ready(function() { /* your code */ });

Use this:

jQuery(function($) { /* your code */ })(jQuery);

It is more concise and does the same thing, it also doesn't depend on the $ variable to be the jQuery object.

Fixed it...

Get-ChildItem C:\Windows\ -recurse -include @("*.txt*","*.pdf") |
Where-Object {$_.CreationTime -gt "01/01/2013" -and $_.CreationTime -lt "12/02/2014"} | 
Select-Object FullName, CreationTime, @{Name="Mbytes";Expression={$_.Length/1Kb}}, @{Name="Age";Expression={(((Get-Date) - $_.CreationTime).Days)}} | 
Export-Csv C:\search_TXT-and-PDF_files_01012013-to-12022014_sort.txt

Try \r\n where \r is carriage return. Also ensure that your output do not have new line, because debugger can show you special characters in form of \n, \r, \t etc.

Excel has to be able to handle the exact same situation.

Put those things into Excel, save them as CSV, and examine the file with a text editor. Then you'll know the rules Excel is applying to these situations.

Make Java produce the same output.

The formats used by Excel are published, by the way...

****Edit 1:**** Here's what Excel does
****Edit 2:**** Note that php's fputcsv does the same exact thing as excel if you use " as the enclosure.

[email protected]
Richard
"This is what I think"

gets transformed into this:

Email,Fname,Quoted  
[email protected],Richard,"""This is what I think"""

Here is a more generic solution based on @Arun answer

public abstract class TextViewLinkHandler extends LinkMovementMethod {

    public boolean onTouchEvent(TextView widget, Spannable buffer, MotionEvent event) {
        if (event.getAction() != MotionEvent.ACTION_UP)
            return super.onTouchEvent(widget, buffer, event);

        int x = (int) event.getX();
        int y = (int) event.getY();

        x -= widget.getTotalPaddingLeft();
        y -= widget.getTotalPaddingTop();

        x += widget.getScrollX();
        y += widget.getScrollY();

        Layout layout = widget.getLayout();
        int line = layout.getLineForVertical(y);
        int off = layout.getOffsetForHorizontal(line, x);

        URLSpan[] link = buffer.getSpans(off, off, URLSpan.class);
        if (link.length != 0) {
            onLinkClick(link[0].getURL());
        }
        return true;
    }

    abstract public void onLinkClick(String url);
}

To use it just implement onLinkClick of TextViewLinkHandler class. For instance:

    textView.setMovementMethod(new TextViewLinkHandler() {
        @Override
        public void onLinkClick(String url) {
            Toast.makeText(textView.getContext(), url, Toast.LENGTH_SHORT).show();
        }
    });

I use org.reflections:

Reflections reflections = new Reflections("com.mycompany");    
Set<Class<? extends MyInterface>> classes = reflections.getSubTypesOf(MyInterface.class);

Another example:

public static void main(String[] args) throws IllegalAccessException, InstantiationException {
    Reflections reflections = new Reflections("java.util");
    Set<Class<? extends List>> classes = reflections.getSubTypesOf(java.util.List.class);
    for (Class<? extends List> aClass : classes) {
        System.out.println(aClass.getName());
        if(aClass == ArrayList.class) {
            List list = aClass.newInstance();
            list.add("test");
            System.out.println(list.getClass().getName() + ": " + list.size());
        }
    }
}

UPDATE chart.js 2.1 and above

var chart = new Chart(ctx, {
    ...
    options:{
        scales:{
            xAxes: [{
                display: false //this will remove all the x-axis grid lines
            }]
        }
    }
});


var chart = new Chart(ctx, {
    ...
    options: {
        scales: {
            xAxes: [{
                ticks: {
                    display: false //this will remove only the label
                }
            }]
        }
    }
});

Reference: chart.js documentation

Old answer (written when the current version was 1.0 beta) just for reference below:

To avoid displaying labels in chart.js you have to set scaleShowLabels : false and also avoid to pass the labels:

<script>
    var options = {
        ...
        scaleShowLabels : false
    };
    var lineChartData = {
        //COMMENT THIS LINE TO AVOID DISPLAYING THE LABELS
        //labels : ["1","2","3","4","5","6","7"],
        ... 
    }
    ...
</script>

Ok, using this technologies....

• FlyingSaucer Project
• IKVM
• Stub
• Boo

The src can be downloaded from here it needs nant

The above answer is not according to what Google Doc Referred for Location Tracking in Google api v2.

I just followed the official tutorial and ended up with this class that is fetching the current location and centring the map on it as soon as i get that.

you can extend this class to have LocationReciever to have periodic Location Update. I just executed this code on api level 7

http://developer.android.com/training/location/retrieve-current.html

Here it goes.

import android.app.Activity;
import android.app.Dialog;
import android.content.Intent;
import android.content.IntentSender;
import android.location.Location;
import android.os.Bundle;
import android.support.v4.app.DialogFragment;
import android.support.v4.app.FragmentActivity;
import android.util.Log;
import android.widget.Toast;

import com.google.android.gms.common.ConnectionResult;
import com.google.android.gms.common.GooglePlayServicesClient;
import com.google.android.gms.common.GooglePlayServicesUtil;
import com.google.android.gms.location.LocationClient;
import com.google.android.gms.maps.CameraUpdate;
import com.google.android.gms.maps.CameraUpdateFactory;
import com.google.android.gms.maps.GoogleMap;
import com.google.android.gms.maps.GoogleMap.OnMapLongClickListener;
import com.google.android.gms.maps.SupportMapFragment;
import com.google.android.gms.maps.model.LatLng;


public class MainActivity extends FragmentActivity implements 
    GooglePlayServicesClient.ConnectionCallbacks, 
    GooglePlayServicesClient.OnConnectionFailedListener{

private SupportMapFragment mapFragment;
private GoogleMap map;
private LocationClient mLocationClient;
/*
 * Define a request code to send to Google Play services
 * This code is returned in Activity.onActivityResult
 */
private final static int CONNECTION_FAILURE_RESOLUTION_REQUEST = 9000;

// Define a DialogFragment that displays the error dialog
public static class ErrorDialogFragment extends DialogFragment {

    // Global field to contain the error dialog
    private Dialog mDialog;

    // Default constructor. Sets the dialog field to null
    public ErrorDialogFragment() {
        super();
        mDialog = null;
    }

    // Set the dialog to display
    public void setDialog(Dialog dialog) {
        mDialog = dialog;
    }

    // Return a Dialog to the DialogFragment.
    @Override
    public Dialog onCreateDialog(Bundle savedInstanceState) {
        return mDialog;
    }
}

@Override
protected void onCreate(Bundle savedInstanceState) {
    super.onCreate(savedInstanceState);
    setContentView(R.layout.main_activity);

    mLocationClient = new LocationClient(this, this, this);

    mapFragment = ((SupportMapFragment) getSupportFragmentManager().findFragmentById(R.id.map));
    map = mapFragment.getMap();

    map.setMyLocationEnabled(true);

}

/*
 * Called when the Activity becomes visible.
 */
@Override
protected void onStart() {
    super.onStart();
    // Connect the client.
    if(isGooglePlayServicesAvailable()){
        mLocationClient.connect();
    }

}

/*
 * Called when the Activity is no longer visible.
 */
@Override
protected void onStop() {
    // Disconnecting the client invalidates it.
    mLocationClient.disconnect();
    super.onStop();
}

/*
 * Handle results returned to the FragmentActivity
 * by Google Play services
 */
@Override
protected void onActivityResult(
                int requestCode, int resultCode, Intent data) {
    // Decide what to do based on the original request code
    switch (requestCode) {

        case CONNECTION_FAILURE_RESOLUTION_REQUEST:
            /*
             * If the result code is Activity.RESULT_OK, try
             * to connect again
             */
            switch (resultCode) {
                case Activity.RESULT_OK:
                    mLocationClient.connect();
                    break;
            }

    }
}

private boolean isGooglePlayServicesAvailable() {
    // Check that Google Play services is available
    int resultCode =  GooglePlayServicesUtil.isGooglePlayServicesAvailable(this);
    // If Google Play services is available
    if (ConnectionResult.SUCCESS == resultCode) {
        // In debug mode, log the status
        Log.d("Location Updates", "Google Play services is available.");
        return true;
    } else {
        // Get the error dialog from Google Play services
        Dialog errorDialog = GooglePlayServicesUtil.getErrorDialog( resultCode,
                                                                                                              this,
                                                                                                              CONNECTION_FAILURE_RESOLUTION_REQUEST);

        // If Google Play services can provide an error dialog
        if (errorDialog != null) {
            // Create a new DialogFragment for the error dialog
            ErrorDialogFragment errorFragment = new ErrorDialogFragment();
            errorFragment.setDialog(errorDialog);
            errorFragment.show(getSupportFragmentManager(), "Location Updates");
        }

        return false;
    }
}

/*
 * Called by Location Services when the request to connect the
 * client finishes successfully. At this point, you can
 * request the current location or start periodic updates
 */
@Override
public void onConnected(Bundle dataBundle) {
    // Display the connection status
    Toast.makeText(this, "Connected", Toast.LENGTH_SHORT).show();
    Location location = mLocationClient.getLastLocation();
    LatLng latLng = new LatLng(location.getLatitude(), location.getLongitude());
    CameraUpdate cameraUpdate = CameraUpdateFactory.newLatLngZoom(latLng, 17);
    map.animateCamera(cameraUpdate);
}

/*
 * Called by Location Services if the connection to the
 * location client drops because of an error.
 */
@Override
public void onDisconnected() {
    // Display the connection status
    Toast.makeText(this, "Disconnected. Please re-connect.",
            Toast.LENGTH_SHORT).show();
}

/*
 * Called by Location Services if the attempt to
 * Location Services fails.
 */
@Override
public void onConnectionFailed(ConnectionResult connectionResult) {
    /*
     * Google Play services can resolve some errors it detects.
     * If the error has a resolution, try sending an Intent to
     * start a Google Play services activity that can resolve
     * error.
     */
    if (connectionResult.hasResolution()) {
        try {
            // Start an Activity that tries to resolve the error
            connectionResult.startResolutionForResult(
                    this,
                    CONNECTION_FAILURE_RESOLUTION_REQUEST);
            /*
            * Thrown if Google Play services canceled the original
            * PendingIntent
            */
        } catch (IntentSender.SendIntentException e) {
            // Log the error
            e.printStackTrace();
        }
    } else {
       Toast.makeText(getApplicationContext(), "Sorry. Location services not available to you", Toast.LENGTH_LONG).show();
    }
}

}

If CURLOPT_FAILONERROR is false, http errors will not trigger curl errors.

<?php
if (@$_GET['curl']=="yes") {
  header('HTTP/1.1 503 Service Temporarily Unavailable');
} else {
  $ch=curl_init($url = "http://".$_SERVER['SERVER_NAME'].$_SERVER['PHP_SELF']."?curl=yes");
  curl_setopt($ch, CURLOPT_FAILONERROR, true);
  $response=curl_exec($ch);
  $http_status = curl_getinfo($ch, CURLINFO_HTTP_CODE);
  $curl_errno= curl_errno($ch);
  if ($http_status==503)
    echo "HTTP Status == 503 <br/>";
  echo "Curl Errno returned $curl_errno <br/>";
}

You can pass a numpy array or matrix as an argument when initializing a sparse matrix. For a CSR matrix, for example, you can do the following.

>>> import numpy as np
>>> from scipy import sparse
>>> A = np.array([[1,2,0],[0,0,3],[1,0,4]])
>>> B = np.matrix([[1,2,0],[0,0,3],[1,0,4]])

>>> A
array([[1, 2, 0],
       [0, 0, 3],
       [1, 0, 4]])

>>> sA = sparse.csr_matrix(A)   # Here's the initialization of the sparse matrix.
>>> sB = sparse.csr_matrix(B)

>>> sA
<3x3 sparse matrix of type '<type 'numpy.int32'>'
        with 5 stored elements in Compressed Sparse Row format>

>>> print sA
  (0, 0)        1
  (0, 1)        2
  (1, 2)        3
  (2, 0)        1
  (2, 2)        4

Unlike Java, you cannot define multiple constructors. However, you can define a default value if one is not passed.

def __init__(self, city="Berlin"):
  self.city = city

var a = 10;

myFunction();

function myFunction(){
   a = 20;
}

alert("Value of 'a' outside the function " + a); //outputs 20

In the top of the bootstrap.css you should have comments like the below:

/*!
 * Bootstrap v2.3.1
 *
 * Copyright 2012 Twitter, Inc
 * Licensed under the Apache License v2.0
 * http://www.apache.org/licenses/LICENSE-2.0
 *
 * Designed and built with all the love in the world @twitter by @mdo and @fat.
 */

If they are not there, then they have probably been deleted.

VERSIONS:

You can review version history here. Backward compatibility shouldn't be broken if the source is v2.0.0 (Jan 2012) and above. If it is prior to v2.0.0 there are details on upgrading here.

npm view <package> version - returns the latest available version on the package.

npm list --depth=0 - returns versions of all installed modules without dependencies.

npm list - returns versions of all modules and dependencies.

And lastly to get node version: node -v

You need to choose a Property to sort by and pass it as a lambda expression to OrderByDescending

like:

.OrderByDescending(x => x.Delivery.SubmissionDate);

Really, though the first version of your LINQ statement should work. Is t.Delivery.SubmissionDate actually populated with valid dates?

Here is my minimal wrapper around cURL to be able just to fetch a webpage as a string. This is useful, for example, for unit testing. It is basically a RAII wrapper around the C code.

Install "libcurl" on your machine yum install libcurl libcurl-devel or equivalent.

Usage example:

CURLplusplus client;
string x = client.Get("http://google.com");
string y = client.Get("http://yahoo.com");

Class implementation:

#include <curl/curl.h>


class CURLplusplus
{
private:
    CURL* curl;
    stringstream ss;
    long http_code;
public:
    CURLplusplus()
            : curl(curl_easy_init())
    , http_code(0)
    {

    }
    ~CURLplusplus()
    {
        if (curl) curl_easy_cleanup(curl);
    }
    std::string Get(const std::string& url)
    {
        CURLcode res;
        curl_easy_setopt(curl, CURLOPT_URL, url.c_str());
        curl_easy_setopt(curl, CURLOPT_FOLLOWLOCATION, 1L);
        curl_easy_setopt(curl, CURLOPT_WRITEFUNCTION, write_data);
        curl_easy_setopt(curl, CURLOPT_WRITEDATA, this);

        ss.str("");
        http_code = 0;
        res = curl_easy_perform(curl);
        if (res != CURLE_OK)
        {
            throw std::runtime_error(curl_easy_strerror(res));
        }
        curl_easy_getinfo(curl, CURLINFO_RESPONSE_CODE, &http_code);
        return ss.str();
    }
    long GetHttpCode()
    {
        return http_code;
    }
private:
    static size_t write_data(void *buffer, size_t size, size_t nmemb, void *userp)
    {
        return static_cast<CURLplusplus*>(userp)->Write(buffer,size,nmemb);
    }
    size_t Write(void *buffer, size_t size, size_t nmemb)
    {
        ss.write((const char*)buffer,size*nmemb);
        return size*nmemb;
    }
};

If you want to create new component without .spec file, you can use

ng g c component-name --spec false

You can find these options using ng g c --help

You can do assignments within if statements in Java as well. A good example would be reading something in and writing it out:

http://www.exampledepot.com/egs/java.io/CopyFile.html?l=new

The code:

// Copies src file to dst file.
// If the dst file does not exist, it is created
void copy(File src, File dst) throws IOException 
{
    InputStream in = new FileInputStream(src);
    OutputStream out = new FileOutputStream(dst);

    // Transfer bytes from in to out
    byte[] buf = new byte[1024];
    int len;
    while ((len = in.read(buf)) > 0) {
        out.write(buf, 0, len);
    }
    in.close();
    out.close();
}

I created this Function after researching on the internet since I wanted to print an XML string when you select a row from a data grid view.

static void HighlightPhrase(RichTextBox box, string StartTag, string EndTag, string ControlTag, Color color1, Color color2)
{
    int pos = box.SelectionStart;
    string s = box.Text;
    for (int ix = 0; ; )
    {
        int jx = s.IndexOf(StartTag, ix, StringComparison.CurrentCultureIgnoreCase);
        if (jx < 0) break;
        int ex = s.IndexOf(EndTag, ix, StringComparison.CurrentCultureIgnoreCase);
        box.SelectionStart = jx;
        box.SelectionLength = ex - jx + 1;
        box.SelectionColor = color1;
        
        int bx = s.IndexOf(ControlTag, ix, StringComparison.CurrentCultureIgnoreCase);
        int bxtest = s.IndexOf(StartTag, (ex + 1), StringComparison.CurrentCultureIgnoreCase);
        if (bx == bxtest)
        {
            box.SelectionStart = ex + 1;
            box.SelectionLength = bx - ex + 1;
            box.SelectionColor = color2;
        }
        
        ix = ex + 1;
    }
    box.SelectionStart = pos;
    box.SelectionLength = 0;
}

and this is how you call it

   HighlightPhrase(richTextBox1, "<", ">","</", Color.Red, Color.Black);

Here is the codepen demo showing the solution:

• Demo - Fill remaining vertical space with CSS using display:flex

Important highlights:

• all containers from html, body, ... .container, should have the height set to 100%
• introducing flex to ANY of the flex items will trigger calculation of the items sizes based on flex distribution:
  • if only one cell is set to flex, for example: flex: 1 then this flex item will occupy the remaining of the space
  • if there are more than one with the flex property, the calculation will be more complicated. For example, if the item 1 is set to flex: 1 and the item 2 is se to flex: 2 then the item 2 will take twice more of the remaining space
    • NOT TRUE: the item 2 will be twice larger than the item 1
    • check more about the concept of the remaining space: https://developer.mozilla.org/en-US/docs/Web/CSS/flex-grow
• Main Size Property
  • depends on the value of the flex-direction property
  • in our case height is just a preferred size
  • it will be overwritten in the presence of flex property: https://www.w3.org/TR/css-flexbox-1/#propdef-flex
    • When a box is a flex item, flex is consulted instead of the main size property to determine the main size of the box
  • min-* and max-* will be respected

Go to PhpMyAdmin, click on desired database, go to Privilages tab and create new user "remote", and give him all privilages and in host field set "Any host" option(%).

This little and simple trick I just learnt may help someone trying to avoid :before or :after pseudo elements altogether (for whatever reason) in changing text on hover. You can add both texts in the HTML, but vary the CSS 'display' property based on hover. Assuming the second text 'Add' has a class named 'add-label'; here is a little modification:

span.add-label{
 display:none;
}
.item:hover span.align{
 display:none;
}
.item:hover span.add-label{
 display:block;
}

Here is a demonstration on codepen: https://codepen.io/ifekt/pen/zBaEVJ

HTML href link click:

<a ="{{ route('download',$name->file) }}"> Download  </a>

In controller:

public function download($file){
    $file_path = public_path('uploads/cv/'.$file);
    return response()->download( $file_path);
}

In route:

Route::get('/download/{file}','Controller@download')->name('download');

To disable a single rule for the rest of the file below:

/* eslint no-undef: "off"*/
const uploadData = new FormData();

Came across this issue two days back, spent whole complete two days, So I found that I need to give the access to IUSR user group at DCOMCNFG --> My Computer Properties --> Com Security --> Launch and Activation Permissions --> Edit defaults and give all rights to IUSR.

hope it will help someone....

You could store that const value in the enum like so. But why even use the const? Are you persisting the enum's?

public class SO3990319 {
   public static enum PAGE {
      SIGN_CREATE(1);
      private final int constValue;

      private PAGE(int constValue) {
         this.constValue = constValue;
      }

      public int constValue() {
         return constValue;
      }
   }

   public static void main(String[] args) {
      System.out.println("Name:    " + PAGE.SIGN_CREATE.name());
      System.out.println("Ordinal: " + PAGE.SIGN_CREATE.ordinal());
      System.out.println("Const:   " + PAGE.SIGN_CREATE.constValue());

      System.out.println("Enum: " + PAGE.valueOf("SIGN_CREATE"));
   }
}

Edit:

It depends on what you're using the int's for whether to use EnumMap or instance field.

• Bloch on Enum instance fields (Item 31: Use instance fields instead of ordinals)
• Bloch on EnumMap (Item 33: Use EnumMap instead of ordinal indexing)

If you don't support legacy browsers, I'd use flexbox because it's well supported and will simply solve most of your layout problems.

#table-id td:nth-child(1) { 
    /* nth-child(1) is the first column, change to fit your needs */
    display: flex;
    justify-content: center;
}

This centers all content in the first <td> of every row.

Alternative to @Peter Monks.

If the number in the 'in' statement is small and fixed.

DECLARE @var1 varchar(30), @var2 varchar(30), @var3  varchar(30);

SET @var1 = 'james';
SET @var2 = 'same';
SET @var3 = 'dogcat';

Select * FROM Database Where x in (@var1,@var2,@var3);

You can also use html to override the css locally. I was having a similar issue and this worked for me:

<html>
<body>

<h4>A nested List:</h4>
<ul style="PADDING-LEFT: 12px">
  <li>Coffee</li>
  <li>Tea
    <ul>
    <li>Black tea</li>
    <li>Green tea</li>
    </ul>
  </li>
  <li>Milk</li>
</ul>

</body>
</html>

Take a look at this forum http://htmlcoderhelper.com/why-is-using-a-wild-card-with-a-java-import-statement-bad/. Theres a discussion on how using wildcards can lead to conflicts if you add new classes to the packages and if there are two classes with the same name in different packages where only one of them will be imported.

Update

List<Integer> i = new ArrayList<Integer>(Arrays.asList(0,1,2,3,4,5,6,7,8,9,10));
List<Integer> j = new ArrayList<Integer>();

You need to specify the type for array list or the compiler will give that warning because it cannot identify that you are using the list in a type safe way.

Here is a slightly easier method I just came up with when researching this:

git fetch {remote}
git checkout FETCH_HEAD -- {file}

Use the CKEditor method setData():

CKEDITOR.instances[**fieldname**].setData(**your data**)

None of the answers provided here are completely correct when using TypeScript, as you may not know the kind of element that is selected.

This would therefore be preferred:

if (document.activeElement instanceof HTMLElement)
    document.activeElement.blur();

I would furthermore discourage using the solution provided in the accepted answer, as the resulting blurring is not part of the official spec, and could break at any moment.

You should simply install request locally within your project.

Just cd to the folder containing your js file and run

npm install request

changing these functions will allow you to log the listeners added:

EventTarget.prototype.addEventListener
EventTarget.prototype.attachEvent
EventTarget.prototype.removeEventListener
EventTarget.prototype.detachEvent

read the rest of the listeners with

console.log(someElement.onclick);
console.log(someElement.getAttribute("onclick"));

Having the same issue in Flask, I had already a template that loaded JQuery, Popper and Bootstrap. I was extending that template into other template that I was using as a base to load the page that had the table.

For some reason in Flask apparently the files in the outer template load before the files in the tables above in the hierarchy (the ones you are extending) so JQuery was loading before the DataTables files causing the issue.

I had to create another template where I run all my imports of JS CDNs in the same place, that solved the issue.

Try this:

public void LoadData()
        {
            SqlConnection con = new SqlConnection("Data Source=.;Initial Catalog=Stocks;Integrated Security=True;Pooling=False");
            SqlDataAdapter sda = new SqlDataAdapter("Select * From [Stocks].[dbo].[product]", con);
            DataTable dt = new DataTable();
            sda.Fill(dt);
            DataGridView1.Rows.Clear();

        foreach (DataRow item in dt.Rows)
        {
            int n = DataGridView1.Rows.Add();
            DataGridView1.Rows[n].Cells[0].Value = item["ProductCode"].ToString();
            DataGridView1.Rows[n].Cells[1].Value = item["Productname"].ToString();
            DataGridView1.Rows[n].Cells[2].Value = item["qty"].ToString();                
            if ((bool)item["productstatus"])
            {
                DataGridView1.Rows[n].Cells[3].Value = "Active";
            }
            else
            {
                DataGridView1.Rows[n].Cells[3].Value = "Deactive";
            }

The following code works fine:

@using (Html.BeginForm("Upload", "Upload", FormMethod.Post, 
                                      new { enctype = "multipart/form-data" }))
{
    @Html.ValidationSummary(true)
    <fieldset>
        Select a file <input type="file" name="file" />
        <input type="submit" value="Upload" />
    </fieldset>
}

and generates as expected:

<form action="/Upload/Upload" enctype="multipart/form-data" method="post">    
    <fieldset>
        Select a file <input type="file" name="file" />
        <input type="submit" value="Upload" />
    </fieldset>
</form>

On the other hand if you are writing this code inside the context of other server side construct such as an if or foreach you should remove the @ before the using. For example:

@if (SomeCondition)
{
    using (Html.BeginForm("Upload", "Upload", FormMethod.Post, 
                                      new { enctype = "multipart/form-data" }))
    {
        @Html.ValidationSummary(true)
        <fieldset>
            Select a file <input type="file" name="file" />
            <input type="submit" value="Upload" />
        </fieldset>
    }
}

As far as your server side code is concerned, here's how to proceed:

[HttpPost]
public ActionResult Upload(HttpPostedFileBase file) 
{
    if (file != null && file.ContentLength > 0) 
    {
        var fileName = Path.GetFileName(file.FileName);
        var path = Path.Combine(Server.MapPath("~/content/pics"), fileName);
        file.SaveAs(path);
    }
    return RedirectToAction("Upload");
}

Your code is doing a log of a number that is less than or equal to zero. That's mathematically undefined, so Python's log function raises an exception. Here's an example:

>>> from math import log
>>> log(-1)
Traceback (most recent call last):
  File "<pyshell#59>", line 1, in <module>
    log(-1)
ValueError: math domain error

Without knowing what your newtonRaphson2 function does, I'm not sure I can guess where the invalid x[2] value is coming from, but hopefully this will lead you on the right track.

Assuming that your data in data.frame called maxinozone, you can do this

max(maxinozone[1, ], na.rm = TRUE)

I believe you need quotes around the model:

JSON.stringify({ "model": source })

The <font> tag has been deprecated, at least in XHTML. That means that it's use is officially "frowned upon," and there is no guarantee that future browsers will continue to display the text as you intended.

You have to use CSS. Go with the <span> tag, or a separate style sheet. According to its specification, the <span> tag has no semantic meaning and just allows you to change the style of a particular region.

The password of keystore by default is: "changeit". I functioned to my commands you entered here, for the import of the certificate. I hope you have already solved your problem.

But why stop with MessageBox-specific implementation? Use the class below like this:

    private void OnFormClosing(object sender, FormClosingEventArgs e)
    {
        DialogResult dg;
        using (DialogCenteringService centeringService = new DialogCenteringService(this)) // center message box
        {
            dg = MessageBox.Show(this, "Are you sure?", "Confirm exit", MessageBoxButtons.YesNo, MessageBoxIcon.Question);
        }

        if (dg == DialogResult.No)
        {
            e.Cancel = true;
        }
    }

The code that you can use with anything that shows dialog windows, even if they're owned by another thread (our app has multiple UI threads):

(Here is the updated code which takes monitor working areas into account, so that the dialog isn't centered between two monitors or is partly off-screen. With it you'll need enum SetWindowPosFlags, which is below)

public class DialogCenteringService : IDisposable
{
    private readonly IWin32Window owner;
    private readonly HookProc hookProc;
    private readonly IntPtr hHook = IntPtr.Zero;

    public DialogCenteringService(IWin32Window owner)
    {
        if (owner == null) throw new ArgumentNullException("owner");

        this.owner = owner;
        hookProc = DialogHookProc;

        hHook = SetWindowsHookEx(WH_CALLWNDPROCRET, hookProc, IntPtr.Zero, GetCurrentThreadId());
    }

    private IntPtr DialogHookProc(int nCode, IntPtr wParam, IntPtr lParam)
    {
        if (nCode < 0)
        {
            return CallNextHookEx(hHook, nCode, wParam, lParam);
        }

        CWPRETSTRUCT msg = (CWPRETSTRUCT)Marshal.PtrToStructure(lParam, typeof(CWPRETSTRUCT));
        IntPtr hook = hHook;

        if (msg.message == (int)CbtHookAction.HCBT_ACTIVATE)
        {
            try
            {
                CenterWindow(msg.hwnd);
            }
            finally
            {
                UnhookWindowsHookEx(hHook);
            }
        }

        return CallNextHookEx(hook, nCode, wParam, lParam);
    }

    public void Dispose()
    {
        UnhookWindowsHookEx(hHook);
    }

    private void CenterWindow(IntPtr hChildWnd)
    {
        Rectangle recChild = new Rectangle(0, 0, 0, 0);
        bool success = GetWindowRect(hChildWnd, ref recChild);

        if (!success)
        {
            return;
        }

        int width = recChild.Width - recChild.X;
        int height = recChild.Height - recChild.Y;

        Rectangle recParent = new Rectangle(0, 0, 0, 0);
        success = GetWindowRect(owner.Handle, ref recParent);

        if (!success)
        {
            return;
        }

        Point ptCenter = new Point(0, 0);
        ptCenter.X = recParent.X + ((recParent.Width - recParent.X) / 2);
        ptCenter.Y = recParent.Y + ((recParent.Height - recParent.Y) / 2);


        Point ptStart = new Point(0, 0);
        ptStart.X = (ptCenter.X - (width / 2));
        ptStart.Y = (ptCenter.Y - (height / 2));

        //MoveWindow(hChildWnd, ptStart.X, ptStart.Y, width, height, false);
        Task.Factory.StartNew(() => SetWindowPos(hChildWnd, (IntPtr)0, ptStart.X, ptStart.Y, width, height, SetWindowPosFlags.SWP_ASYNCWINDOWPOS | SetWindowPosFlags.SWP_NOSIZE | SetWindowPosFlags.SWP_NOACTIVATE | SetWindowPosFlags.SWP_NOOWNERZORDER | SetWindowPosFlags.SWP_NOZORDER));
    }

    // some p/invoke

    // ReSharper disable InconsistentNaming
    public delegate IntPtr HookProc(int nCode, IntPtr wParam, IntPtr lParam);

    public delegate void TimerProc(IntPtr hWnd, uint uMsg, UIntPtr nIDEvent, uint dwTime);

    private const int WH_CALLWNDPROCRET = 12;

    // ReSharper disable EnumUnderlyingTypeIsInt
    private enum CbtHookAction : int
    // ReSharper restore EnumUnderlyingTypeIsInt
    {
        // ReSharper disable UnusedMember.Local
        HCBT_MOVESIZE = 0,
        HCBT_MINMAX = 1,
        HCBT_QS = 2,
        HCBT_CREATEWND = 3,
        HCBT_DESTROYWND = 4,
        HCBT_ACTIVATE = 5,
        HCBT_CLICKSKIPPED = 6,
        HCBT_KEYSKIPPED = 7,
        HCBT_SYSCOMMAND = 8,
        HCBT_SETFOCUS = 9
        // ReSharper restore UnusedMember.Local
    }

    [DllImport("kernel32.dll")]
    static extern int GetCurrentThreadId();

    [DllImport("user32.dll")]
    private static extern bool GetWindowRect(IntPtr hWnd, ref Rectangle lpRect);

    [DllImport("user32.dll")]
    private static extern int MoveWindow(IntPtr hWnd, int X, int Y, int nWidth, int nHeight, bool bRepaint);

    [DllImport("user32.dll")]
    [return: MarshalAs(UnmanagedType.Bool)]
    private static extern bool SetWindowPos(IntPtr hWnd, IntPtr hWndInsertAfter, int x, int y, int cx, int cy, SetWindowPosFlags uFlags);

    [DllImport("User32.dll")]
    public static extern UIntPtr SetTimer(IntPtr hWnd, UIntPtr nIDEvent, uint uElapse, TimerProc lpTimerFunc);

    [DllImport("User32.dll")]
    public static extern IntPtr SendMessage(IntPtr hWnd, int Msg, IntPtr wParam, IntPtr lParam);

    [DllImport("user32.dll")]
    public static extern IntPtr SetWindowsHookEx(int idHook, HookProc lpfn, IntPtr hInstance, int threadId);

    [DllImport("user32.dll")]
    public static extern int UnhookWindowsHookEx(IntPtr idHook);

    [DllImport("user32.dll")]
    public static extern IntPtr CallNextHookEx(IntPtr idHook, int nCode, IntPtr wParam, IntPtr lParam);

    [DllImport("user32.dll")]
    public static extern int GetWindowTextLength(IntPtr hWnd);

    [DllImport("user32.dll")]
    public static extern int GetWindowText(IntPtr hWnd, StringBuilder text, int maxLength);

    [DllImport("user32.dll")]
    public static extern int EndDialog(IntPtr hDlg, IntPtr nResult);

    [StructLayout(LayoutKind.Sequential)]
    public struct CWPRETSTRUCT
    {
        public IntPtr lResult;
        public IntPtr lParam;
        public IntPtr wParam;
        public uint message;
        public IntPtr hwnd;
    };
    // ReSharper restore InconsistentNaming
}

[Flags]
public enum SetWindowPosFlags : uint
{
    // ReSharper disable InconsistentNaming

    /// <summary>
    ///     If the calling thread and the thread that owns the window are attached to different input queues, the system posts the request to the thread that owns the window. This prevents the calling thread from blocking its execution while other threads process the request.
    /// </summary>
    SWP_ASYNCWINDOWPOS = 0x4000,

    /// <summary>
    ///     Prevents generation of the WM_SYNCPAINT message.
    /// </summary>
    SWP_DEFERERASE = 0x2000,

    /// <summary>
    ///     Draws a frame (defined in the window's class description) around the window.
    /// </summary>
    SWP_DRAWFRAME = 0x0020,

    /// <summary>
    ///     Applies new frame styles set using the SetWindowLong function. Sends a WM_NCCALCSIZE message to the window, even if the window's size is not being changed. If this flag is not specified, WM_NCCALCSIZE is sent only when the window's size is being changed.
    /// </summary>
    SWP_FRAMECHANGED = 0x0020,

    /// <summary>
    ///     Hides the window.
    /// </summary>
    SWP_HIDEWINDOW = 0x0080,

    /// <summary>
    ///     Does not activate the window. If this flag is not set, the window is activated and moved to the top of either the topmost or non-topmost group (depending on the setting of the hWndInsertAfter parameter).
    /// </summary>
    SWP_NOACTIVATE = 0x0010,

    /// <summary>
    ///     Discards the entire contents of the client area. If this flag is not specified, the valid contents of the client area are saved and copied back into the client area after the window is sized or repositioned.
    /// </summary>
    SWP_NOCOPYBITS = 0x0100,

    /// <summary>
    ///     Retains the current position (ignores X and Y parameters).
    /// </summary>
    SWP_NOMOVE = 0x0002,

    /// <summary>
    ///     Does not change the owner window's position in the Z order.
    /// </summary>
    SWP_NOOWNERZORDER = 0x0200,

    /// <summary>
    ///     Does not redraw changes. If this flag is set, no repainting of any kind occurs. This applies to the client area, the nonclient area (including the title bar and scroll bars), and any part of the parent window uncovered as a result of the window being moved. When this flag is set, the application must explicitly invalidate or redraw any parts of the window and parent window that need redrawing.
    /// </summary>
    SWP_NOREDRAW = 0x0008,

    /// <summary>
    ///     Same as the SWP_NOOWNERZORDER flag.
    /// </summary>
    SWP_NOREPOSITION = 0x0200,

    /// <summary>
    ///     Prevents the window from receiving the WM_WINDOWPOSCHANGING message.
    /// </summary>
    SWP_NOSENDCHANGING = 0x0400,

    /// <summary>
    ///     Retains the current size (ignores the cx and cy parameters).
    /// </summary>
    SWP_NOSIZE = 0x0001,

    /// <summary>
    ///     Retains the current Z order (ignores the hWndInsertAfter parameter).
    /// </summary>
    SWP_NOZORDER = 0x0004,

    /// <summary>
    ///     Displays the window.
    /// </summary>
    SWP_SHOWWINDOW = 0x0040,

    // ReSharper restore InconsistentNaming
}

Your countLines(String filename) method throws IOException.

You can't use it in a member declaration. You'll need to perform the operation in a main(String[] args) method.

Your main(String[] args) method will get the IOException thrown to it by countLines and it will need to handle or declare it.

Try this to just throw the IOException from main

public class MyClass {
  private int lineCount;
  public static void main(String[] args) throws IOException {
    lineCount = LineCounter.countLines(sFileName);
  }
}

or this to handle it and wrap it in an unchecked IllegalArgumentException:

public class MyClass {
  private int lineCount;
  private String sFileName  = "myfile";
  public static void main(String[] args) throws IOException {
    try {
      lineCount = LineCounter.countLines(sFileName);
     } catch (IOException e) {
       throw new IllegalArgumentException("Unable to load " + sFileName, e);
     }
  }
}

To access the mysql command in Windows without manually changing directories, do this:

• Go to Control Panel > System > Advanced system settings.
• System Properties will appear.
• Click on the 'Advanced' tab.
• Click 'Environment Variables'.
• Under System Variables, locate 'Path' and click Edit.

• Append the path to your MySQL installation to the end of the exisiting 'Variable value'. Example:

  %systemDrive%\xampp\mysql\bin\ 

  or, if you prefer

  c:\xampp\mysql\bin\ 

• Finally, open a new command prompt to make this change take effect.

Note that MySQL's documentation on Setting Environment Variables has little to say about handling this in Windows.

After hours of searching and looking for answer, finally I made it!!!!! Code is below :))))

HTML:

<form id="fileinfo" enctype="multipart/form-data" method="post" name="fileinfo">
    <label>File to stash:</label>
    <input type="file" name="file" required />
</form>
<input type="button" value="Stash the file!"></input>
<div id="output"></div>

jQuery:

$(function(){
    $('#uploadBTN').on('click', function(){ 
        var fd = new FormData($("#fileinfo"));
        //fd.append("CustomField", "This is some extra data");
        $.ajax({
            url: 'upload.php',  
            type: 'POST',
            data: fd,
            success:function(data){
                $('#output').html(data);
            },
            cache: false,
            contentType: false,
            processData: false
        });
    });
});

In the upload.php file you can access the data passed with $_FILES['file'].

Thanks everyone for trying to help:)

I took the answer from here (with some changes) MDN

In my case I'm using C# OracleCommand with OracleParameter, and I set all the the parameters Size property to max length of each column, then the error solved.

OracleParameter parm1 = new OracleParameter();
param1.OracleDbType = OracleDbType.Varchar2;
param1.Value = "test1";
param1.Size = 8;

OracleParameter parm2 = new OracleParameter();
param2.OracleDbType = OracleDbType.Varchar2;
param2.Value = "test1";
param2.Size = 12;

Udo G. said:

• The eval() can't be used inside a function and must be called inside the global scope otherwise no functions or variables will be accessible (i.e. you can't create a include() utility function or something like that).

He's right, but there's a way to affect the global scope from a function. Improving his example:

function include(file_) {
    with (global) {
        eval(fs.readFileSync(file_) + '');
    };
};

include('somefile_with_some_declarations.js');

// the declarations are now accessible here.

Hope, that helps.

Anticipating that I already had the answer, which is that there is no built-in worksheet function that returns the background color of a cell, I decided to review this article, in case I was wrong. I was amused to notice a citation to the very same MVP article that I used in the course of my ongoing research into colors in Microsoft Excel.

While I agree that, in the purest sense, color is not data, it is meta-data, and it has uses as such. To that end, I shall attempt to develop a function that returns the color of a cell. If I succeed, I plan to put it into an add-in, so that I can use it in any workbook, where it will join a growing legion of other functions that I think Microsoft left out of the product.

Regardless, IMO, the ColorIndex property is virtually useless, since there is essentially no connection between color indexes and the colors that can be selected in the standard foreground and background color pickers. See Color Combinations: Working with Colors in Microsoft Office and the associated binary workbook, Color_Combinations Workbook.

You can use this for header: Important: Put the following on your PHP pages that you want to include the content.

<?php
//at top:
require('header.php'); 
 ?>
 <?php
// at bottom:
require('footer.php');
?>

You can also include a navbar globaly just use this instead:

 <?php
 // At top:
require('header.php'); 
 ?>
  <?php
// At bottom:
require('footer.php');
 ?>
 <?php
 //Wherever navbar goes:
require('navbar.php'); 
?>

In header.php:

 <!DOCTYPE html>
 <html lang="en">
 <head>
    <meta charset="utf-8">
 <meta name="viewport" content="width=device-width, initial-scale=1, shrink-to-fit=no">
 </head>
 <body> 

Do Not close Body or Html tags!
Include html here:

 <?php
 //Or more global php here:

 ?>

Footer.php:

Code here:

<?php
//code

?>

Navbar.php:

<p> Include html code here</p>
<?php
 //Include Navbar PHP code here
 
?>

Benifits:

• Cleaner main php file (index.php) script.
• Change the header or footer. etc to change it on all pages with the include— Good for alerts on all pages etc...
• Time Saving!
• Faster page loads!
• you can have as many files to include as needed!
• server sided!

Thank you guys for the help,

When I asked at first I didn't think it's even possible, but after your answers I googled and found this amazing tutorial:

http://blog.thomaslebrun.net/2011/11/html-5-how-to-customize-the-error-message-for-a-required-field/#.UsNN1BYrh2M

I have an S3 and used this guide from Google:

https://developers.google.com/chrome-developer-tools/docs/remote-debugging

Really easy, works flawlessly.

Function strlen shows the number of character before \0 and using it for std::string may report wrong length.

strlen(str.c_str()); // It may return wrong length.

In C++, a string can contain \0 within the characters but C-style-zero-terminated strings can not but at the end. If the std::string has a \0 before the last character then strlen reports a length less than the actual length.

Try to use .length() or .size(), I prefer second one since another standard containers have it.

str.size()

You want .children() instead (documentation here):

$(this).closest('tr').children('td.two').text();

I just had the exact same error, and solved it by restarting xcode.

For me the issue occurred after an svn update, the file in question was added to the projects folder, but it never appeared in xcode(9.3.1) – until I restarted it.

You can set the draggable attribute to false in either the markup or JavaScript code.

// As a jQuery method: $('#myImage').attr('draggable', false);_x000D_
document.getElementById('myImage').setAttribute('draggable', false);

<img id="myImage" src="http://placehold.it/150x150">

Try this when i tried giving muted , check this demo in codpen

    <video width="320" height="240" controls autoplay muted id="videoId">
  <source src="http://techslides.com/demos/sample-videos/small.mp4" type="video/mp4">
  Your browser does not support the video tag.
</video>

script

function toggleMute() {

  var video=document.getElementById("videoId");

  if(video.muted){
    video.muted = false;
  } else {
    debugger;
    video.muted = true;
    video.play()
  }

}

$(document).ready(function(){
  setTimeout(toggleMute,3000);
})

edited attribute content

autoplay muted playsinline

https://developers.google.com/web/updates/2017/09/autoplay-policy-changes