Programs & Examples On #Pcdata

DocumentBuilder db = DocumentBuilderFactory.newInstance().newDocumentBuilder();
Document document = db.parse(new ByteArrayInputStream(xmlString.getBytes("UTF-8"))); //remove the parameter UTF-8 if you don't want to specify the Encoding type.

this works well for me even though the XML structure is complex.

And please make sure your xmlString is valid for XML, notice the escape character should be added "\" at the front.

The main problem might not come from the attributes.

The very main difference between PCDATA and CDATA is

PCDATA - Basically used for ELEMENTS while

CDATA - Used for Attributes of XML i.e ATTLIST

...

[.]{1}

or

[.]{2}

?

You need to stringify the json, not calling toString

var buf = Buffer.from(JSON.stringify(obj));

And for converting string to json obj :

var temp = JSON.parse(buf.toString());

These links explain it with examples

http://dotnetperls.com/openfiledialog

http://www.geekpedia.com/tutorial67_Using-OpenFileDialog-to-open-files.html

private void button1_Click(object sender, EventArgs e)
{
    int size = -1;
    DialogResult result = openFileDialog1.ShowDialog(); // Show the dialog.
    if (result == DialogResult.OK) // Test result.
    {
       string file = openFileDialog1.FileName;
       try
       {
          string text = File.ReadAllText(file);
          size = text.Length;
       }
       catch (IOException)
       {
       }
    }
    Console.WriteLine(size); // <-- Shows file size in debugging mode.
    Console.WriteLine(result); // <-- For debugging use.
}

In Java, when the “==” operator is used to compare 2 objects, it checks to see if the objects refer to the same place in memory. EX:

String obj1 = new String("xyz");
String obj2 = new String("xyz");
if(obj1 == obj2)
   System.out.println("obj1==obj2 is TRUE");
else
  System.out.println("obj1==obj2 is FALSE");

Even though the strings have the same exact characters (“xyz”), The code above will actually output: obj1==obj2 is FALSE

Java String class actually overrides the default equals() implementation in the Object class – and it overrides the method so that it checks only the values of the strings, not their locations in memory. This means that if you call the equals() method to compare 2 String objects, then as long as the actual sequence of characters is equal, both objects are considered equal.

String obj1 = new String("xyz");
String obj2 = new String("xyz");
if(obj1.equals(obj2))
   System.out.printlln("obj1==obj2 is TRUE");
else
  System.out.println("obj1==obj2 is FALSE");

This code will output the following:

obj1==obj2 is TRUE

Quick fix that works for me. Navigate to the root directory of your folder from command line (cmd). then once you are on your root directory, type:

code . 

Then, press enter. Note the ".", don't forget it. Now try to debug and see if you get the same error.

Based on the answer described here, using subprocess is another option.

Something like this:

subprocess.call("mv %s %s" % (source_files, destination_folder), shell=True)

I am curious to know the pro's and con's of this method compared to shutil. Since in my case I am already using subprocess for other reasons and it seems to work I am inclined to stick with it.

Is it system dependent maybe?

You can also simply create ONLY a UIView in Interface builder and drag & drop the ImageView and UILabel (to make it look like your desired header) and then use that.

Once your UIView looks like the way you want it too, you can programmatically initialize it from the XIB and add to your UITableView. In other words, you dont have to design the ENTIRE table in IB. Just the headerView (this way the header view can be reused in other tables as well)

For example I have a custom UIView for one of my table headers. The view is managed by a xib file called "CustomHeaderView" and it is loaded into the table header using the following code in my UITableViewController subclass:

-(UIView *) customHeaderView {
    if (!customHeaderView) {
        [[NSBundle mainBundle] loadNibNamed:@"CustomHeaderView" owner:self options:nil];
    }

    return customHeaderView;
}

- (void)viewDidLoad
{
    [super viewDidLoad];

    // Set the CustomerHeaderView as the tables header view 
    self.tableView.tableHeaderView = self.customHeaderView;
}

You can always use the plot() function like so:

import matplotlib.pyplot as plt

import numpy as np

x = np.arange(10)
ys = [i+x+(i*x)**2 for i in range(10)]
plt.figure()
for y in ys:
    plt.plot(x, y, 'o')
plt.show()

Try below code it works fine for me. You can choose both Ascending as well as descending order

import java.util.Collections;
import java.util.Comparator;
import java.util.HashMap;
import java.util.LinkedHashMap;
import java.util.LinkedList;
import java.util.List;
import java.util.Map;
import java.util.Map.Entry;

public class SortMapByValue
{
    public static boolean ASC = true;
    public static boolean DESC = false;

    public static void main(String[] args)
    {

        // Creating dummy unsorted map
        Map<String, Integer> unsortMap = new HashMap<String, Integer>();
        unsortMap.put("B", 55);
        unsortMap.put("A", 80);
        unsortMap.put("D", 20);
        unsortMap.put("C", 70);

        System.out.println("Before sorting......");
        printMap(unsortMap);

        System.out.println("After sorting ascending order......");
        Map<String, Integer> sortedMapAsc = sortByComparator(unsortMap, ASC);
        printMap(sortedMapAsc);


        System.out.println("After sorting descindeng order......");
        Map<String, Integer> sortedMapDesc = sortByComparator(unsortMap, DESC);
        printMap(sortedMapDesc);

    }

    private static Map<String, Integer> sortByComparator(Map<String, Integer> unsortMap, final boolean order)
    {

        List<Entry<String, Integer>> list = new LinkedList<Entry<String, Integer>>(unsortMap.entrySet());

        // Sorting the list based on values
        Collections.sort(list, new Comparator<Entry<String, Integer>>()
        {
            public int compare(Entry<String, Integer> o1,
                    Entry<String, Integer> o2)
            {
                if (order)
                {
                    return o1.getValue().compareTo(o2.getValue());
                }
                else
                {
                    return o2.getValue().compareTo(o1.getValue());

                }
            }
        });

        // Maintaining insertion order with the help of LinkedList
        Map<String, Integer> sortedMap = new LinkedHashMap<String, Integer>();
        for (Entry<String, Integer> entry : list)
        {
            sortedMap.put(entry.getKey(), entry.getValue());
        }

        return sortedMap;
    }

    public static void printMap(Map<String, Integer> map)
    {
        for (Entry<String, Integer> entry : map.entrySet())
        {
            System.out.println("Key : " + entry.getKey() + " Value : "+ entry.getValue());
        }
    }
}

Edit: Version 2

Used new java feature like stream for-each etc

Map will be sorted by keys if values are same

 import java.util.*;
 import java.util.Map.Entry;
 import java.util.stream.Collectors;

 public class SortMapByValue

 {
    private static boolean ASC = true;
    private static boolean DESC = false;
    public static void main(String[] args)
    {

        // Creating dummy unsorted map
        Map<String, Integer> unsortMap = new HashMap<>();
        unsortMap.put("B", 55);
        unsortMap.put("A", 20);
        unsortMap.put("D", 20);
        unsortMap.put("C", 70);

        System.out.println("Before sorting......");
        printMap(unsortMap);

        System.out.println("After sorting ascending order......");
        Map<String, Integer> sortedMapAsc = sortByValue(unsortMap, ASC);
        printMap(sortedMapAsc);


        System.out.println("After sorting descending order......");
        Map<String, Integer> sortedMapDesc = sortByValue(unsortMap, DESC);
        printMap(sortedMapDesc);
    }

    private static Map<String, Integer> sortByValue(Map<String, Integer> unsortMap, final boolean order)
    {
        List<Entry<String, Integer>> list = new LinkedList<>(unsortMap.entrySet());

        // Sorting the list based on values
        list.sort((o1, o2) -> order ? o1.getValue().compareTo(o2.getValue()) == 0
                ? o1.getKey().compareTo(o2.getKey())
                : o1.getValue().compareTo(o2.getValue()) : o2.getValue().compareTo(o1.getValue()) == 0
                ? o2.getKey().compareTo(o1.getKey())
                : o2.getValue().compareTo(o1.getValue()));
        return list.stream().collect(Collectors.toMap(Entry::getKey, Entry::getValue, (a, b) -> b, LinkedHashMap::new));

    }

    private static void printMap(Map<String, Integer> map)
    {
        map.forEach((key, value) -> System.out.println("Key : " + key + " Value : " + value));
    }
}

Might be a bit odd or bad practice but this is one way of going about it.

(arg1, arg2, arg3) = (1, 2, 3)

if (arg1 == 1)*(arg2 == 2)*(arg3 == 3):
    print('Example.')

Anything multiplied by 0 == 0. If any of these conditions fail then it evaluates to false.

DateTime start = new DateTime(2003, 12, 25);
DateTime end = new DateTime(2009, 10, 6);
int compMonth = (end.Month + end.Year * 12) - (start.Month + start.Year * 12);
double daysInEndMonth = (end - end.AddMonths(1)).Days;
double months = compMonth + (start.Day - end.Day) / daysInEndMonth;

basicaly 2 blocks of code that do the same thing. maybe it's a bit weird example but it proves the point. SQL Server 2005:

SELECT * INTO #temp FROM master..spt_values
DECLARE @startTime DATETIME

BEGIN TRAN 

SELECT @startTime = GETDATE()
UPDATE #temp
SET number = 0
select DATEDIFF(ms, @startTime, GETDATE())

ROLLBACK 

BEGIN TRAN 
DECLARE @name VARCHAR

DECLARE tempCursor CURSOR
    FOR SELECT name FROM #temp

OPEN tempCursor

FETCH NEXT FROM tempCursor 
INTO @name

SELECT @startTime = GETDATE()
WHILE @@FETCH_STATUS = 0
BEGIN

    UPDATE #temp SET number = 0 WHERE NAME = @name
    FETCH NEXT FROM tempCursor 
    INTO @name

END 
select DATEDIFF(ms, @startTime, GETDATE())
CLOSE tempCursor
DEALLOCATE tempCursor

ROLLBACK 
DROP TABLE #temp

the single update takes 156 ms while the cursor takes 2016 ms.

After set listen_addresses = '*' in postgresql.conf

Edit the pg_hba.conf file and add the following entry at the very end of file:

host    all             all              0.0.0.0/0                       md5
host    all             all              ::/0                            md5

For finding the config files this link might help you.

Instead of typedef struct { ... } pos; you should be doing struct pos { ... };. The issue here is that you are using the pos type name before it is defined. By moving the name to the top of the struct definition, you are able to use that name within the struct definition itself.

Further, the typedef struct { ... } name; pattern is a C-ism, and doesn't have much place in C++.

To answer your question about inline, there is no difference in this case. When a method is defined within the struct/class definition, it is implicitly declared inline. When you explicitly specify inline, the compiler effectively ignores it because the method is already declared inline.

(inline methods will not trigger a linker error if the same method is defined in multiple object files; the linker will simply ignore all but one of them, assuming that they are all the same implementation. This is the only guaranteed change in behavior with inline methods. Nowadays, they do not affect the compiler's decision regarding whether or not to inline functions; they simply facilitate making the function implementation available in all translation units, which gives the compiler the option to inline the function, if it decides it would be beneficial to do so.)

SELECT
FROM
JOINs
WHERE
GROUP By
HAVING
ORDER BY

You could also try wrapping the two div's in two div's with unique ids. Then select the div by $("#div1","#wraper1") and $("#div1","#wraper2")

Here you go:

<div id="wraper1">
<div id="div1">
</div>
<div id="wraper2">
<div id="div1">
</div>

Go to File > Source Control > Go Online, select the files you changed, and finish the process.

For version v2.2.2 and newer

In version v2.2.2 and up, name property no longer exists and it shouldn't be used to define the route. path should be used instead of name and no leading slash is needed on the path. In this case use path: '404' instead of path: '/404':

 {path: '404', component: NotFoundComponent},
 {path: '**', redirectTo: '/404'}

For versions older than v2.2.2

you can use {path: '/*path', redirectTo: ['redirectPathName']}:

{path: '/home/...', name: 'Home', component: HomeComponent}
{path: '/', redirectTo: ['Home']},
{path: '/user/...', name: 'User', component: UserComponent},
{path: '/404', name: 'NotFound', component: NotFoundComponent},

{path: '/*path', redirectTo: ['NotFound']}

if no path matches then redirect to NotFound path

You can configure HttpClient to automatically pass credentials like this:

var myClient = new HttpClient(new HttpClientHandler() { UseDefaultCredentials = true });

You can try this website http://www.decompileandroid.com Just upload the .apk file and rest of it will be done by this site.

To make it more complete, the following answer covers the case that the data set contains duplicate values. The function is written close to the style of std::next_permutation() so that it is easy to follow up.

template< class RandomIt >
bool next_combination(RandomIt first, RandomIt n_first, RandomIt last)
{
  if (first == last || n_first == first || n_first == last)
  {
    return false;
  }

  RandomIt it_left = n_first;
  --it_left;
  RandomIt it_right = n_first;

  bool reset = false;
  while (true)
  {
    auto it = std::upper_bound(it_right, last, *it_left);

    if (it != last)
    {
      std::iter_swap(it_left, it);
      if (reset)
      {
        ++it_left;
        it_right = it;
        ++it_right;
        std::size_t left_len = std::distance(it_left, n_first);
        std::size_t right_len = std::distance(it_right, last);
        if (left_len < right_len)
        {
          std::swap_ranges(it_left, n_first, it_right);
          std::rotate(it_right, it_right+left_len, last);
        }
        else
        {
          std::swap_ranges(it_right, last, it_left);
          std::rotate(it_left, it_left+right_len, n_first);
        }
      }
      return true;
    }
    else
    {
      reset = true;
      if (it_left == first)
      {
        break;
      }
      --it_left;
      it_right = n_first;
    }
  }
  return false;
}

The full data set is represented in the range [first, last). The current combination is represented in the range [first, n_first) and the range [n_first, last) holds the complement set of the current combination.

As a combination is irrelevant to its order, [first, n_first) and [n_first, last) are kept in ascending order to avoid duplication.

The algorithm works by increasing the last value A on the left side by swapping with the first value B on the right side that is greater than A. After the swapping, both sides are still ordered. If no such value B exists on the right side, then we start to consider increasing the second last on the left side until all values on the left side are not less than the right side.

An example of drawing 2 elements from a set by the following code:

  std::vector<int> seq = {1, 1, 2, 2, 3, 4, 5};
  do
  {
    for (int x : seq)
    {
      std::cout << x << " ";
    }
    std::cout << "\n";
  } while (next_combination(seq.begin(), seq.begin()+2, seq.end()));

gives:

1 1 2 2 3 4 5 
1 2 1 2 3 4 5 
1 3 1 2 2 4 5 
1 4 1 2 2 3 5 
1 5 1 2 2 3 4 
2 2 1 1 3 4 5 
2 3 1 1 2 4 5 
2 4 1 1 2 3 5 
2 5 1 1 2 3 4 
3 4 1 1 2 2 5 
3 5 1 1 2 2 4 
4 5 1 1 2 2 3 

It is trivial to retrieve the first two elements as the combination result if needed.

You can use either Windows authentication, if your server is in the domain, or SQL Server authentication. Sa is a system administrator, the root account for SQL Server authentication. But it is a bad practice to use if for connecting to your clients.

You should create your own accounts, and use them to connect to your SQL Server instance. In each connection you set account login, its password and the default database, you want to connect to.

following commands will do the same perfectly

rm -rf vendor

composer install 

NumPy's arrays are more compact than Python lists -- a list of lists as you describe, in Python, would take at least 20 MB or so, while a NumPy 3D array with single-precision floats in the cells would fit in 4 MB. Access in reading and writing items is also faster with NumPy.

Maybe you don't care that much for just a million cells, but you definitely would for a billion cells -- neither approach would fit in a 32-bit architecture, but with 64-bit builds NumPy would get away with 4 GB or so, Python alone would need at least about 12 GB (lots of pointers which double in size) -- a much costlier piece of hardware!

The difference is mostly due to "indirectness" -- a Python list is an array of pointers to Python objects, at least 4 bytes per pointer plus 16 bytes for even the smallest Python object (4 for type pointer, 4 for reference count, 4 for value -- and the memory allocators rounds up to 16). A NumPy array is an array of uniform values -- single-precision numbers takes 4 bytes each, double-precision ones, 8 bytes. Less flexible, but you pay substantially for the flexibility of standard Python lists!

The "directory where postgresql will keep all databases" (and configuration) is called "data directory" and corresponds to what PostgreSQL calls (a little confusingly) a "database cluster", which is not related to distributed computing, it just means a group of databases and related objects managed by a PostgreSQL server.

The location of the data directory depends on the distribution. If you install from source, the default is /usr/local/pgsql/data:

In file system terms, a database cluster will be a single directory under which all data will be stored. We call this the data directory or data area. It is completely up to you where you choose to store your data. There is no default, although locations such as /usr/local/pgsql/data or /var/lib/pgsql/data are popular. (ref)

Besides, an instance of a running PostgreSQL server is associated to one cluster; the location of its data directory can be passed to the server daemon ("postmaster" or "postgres") in the -D command line option, or by the PGDATA environment variable (usually in the scope of the running user, typically postgres). You can usually see the running server with something like this:

[root@server1 ~]# ps auxw |  grep postgres | grep -- -D
postgres  1535  0.0  0.1  39768  1584 ?        S    May17   0:23 /usr/local/pgsql/bin/postgres -D /usr/local/pgsql/data

Note that it is possible, though not very frequent, to run two instances of the same PostgreSQL server (same binaries, different processes) that serve different "clusters" (data directories). Of course, each instance would listen on its own TCP/IP port.

In order to resolve this, Kindly go to the below path

Project-->Properties-->Application-->TargetFramework

and change the Framework to ".NET Framework 4".

Once you do this, the project will close and re-open.

This should solve the error

(but for some reason @Karan Modi's answer does not...)

next right-click the references tab in the solution explorer and choose add reference,

choose "System.Web"

(declaring the namespace directly by "using System.Web;" doesnt seems to be enough...you have to add it to the solution explorer...i cant understand why - which is no surprise because i am a cobol programmer..

// This solution provides a way programatically add a handler to the web service clien w/o the XML config

// See full doc here: http://docs.oracle.com/cd/E17904_01//web.1111/e13734/handlers.htm#i222476

// Create new class that implements SOAPHandler

public class LogMessageHandler implements SOAPHandler<SOAPMessageContext> {

@Override
public Set<QName> getHeaders() {
    return Collections.EMPTY_SET;
}

@Override
public boolean handleMessage(SOAPMessageContext context) {
    SOAPMessage msg = context.getMessage(); //Line 1
    try {
        msg.writeTo(System.out);  //Line 3
    } catch (Exception ex) {
        Logger.getLogger(LogMessageHandler.class.getName()).log(Level.SEVERE, null, ex);
    } 
    return true;
}

@Override
public boolean handleFault(SOAPMessageContext context) {
    return true;
}

@Override
public void close(MessageContext context) {
}
}

// Programatically add your LogMessageHandler

   com.csd.Service service = null;
    URL url = new URL("https://service.demo.com/ResService.svc?wsdl");

    service = new com.csd.Service(url);

    com.csd.IService port = service.getBasicHttpBindingIService();
    BindingProvider bindingProvider = (BindingProvider)port;
    Binding binding = bindingProvider.getBinding();
    List<Handler> handlerChain = binding.getHandlerChain();
    handlerChain.add(new LogMessageHandler());
    binding.setHandlerChain(handlerChain);

Most readable solution is using Static Import. Then you will not need to use AnotherClass.constant.

Write a class with the constant as public static field.

package ConstantPackage;

public class Constant {
    public static int PROTEINS = 1;
}

Then just use Static Import where you need the constant.

import static ConstantPackage.Constant.PROTEINS;

public class StaticImportDemo {

    public static void main(String[]args) {

        int[] myArray = new int[5];
        myArray[PROTEINS] = 0;

    }
}

To know more about Static Import please see this stack overflow question.

For just add an alpha channel to s_img I just use cv2.addWeighted before the line l_img[y_offset:y_offset+s_img.shape[0], x_offset:x_offset+s_img.shape[1]] = s_img

as following:
s_img=cv2.addWeighted(l_img[y_offset:y_offset+s_img.shape[0], x_offset:x_offset+s_img.shape[1]],0.5,s_img,0.5,0)

Use this with WPF:

Cursor = Cursors.Wait;

// Your Heavy work here

Cursor = Cursors.Arrow;

Here's an alternate

req.hostname

Read about it in the Express Docs.

Guido has a good explanation of this here. Here's the most relevant part:

I have never considered Python to be heavily influenced by functional languages, no matter what people say or think. I was much more familiar with imperative languages such as C and Algol 68 and although I had made functions first-class objects, I didn't view Python as a functional programming language. However, earlier on, it was clear that users wanted to do much more with lists and functions.

...

It is also worth noting that even though I didn't envision Python as a functional language, the introduction of closures has been useful in the development of many other advanced programming features. For example, certain aspects of new-style classes, decorators, and other modern features rely upon this capability.

Lastly, even though a number of functional programming features have been introduced over the years, Python still lacks certain features found in “real” functional programming languages. For instance, Python does not perform certain kinds of optimizations (e.g., tail recursion). In general, because Python's extremely dynamic nature, it is impossible to do the kind of compile-time optimization known from functional languages like Haskell or ML. And that's fine.

I pull two things out of this:

1. The language's creator doesn't really consider Python to be a functional language. Therefore, it's possible to see "functional-esque" features, but you're unlikely to see anything that is definitively functional.
2. Python's dynamic nature inhibits some of the optimizations you see in other functional languages. Granted, Lisp is just as dynamic (if not more dynamic) as Python, so this is only a partial explanation.

for Ruby 1.9+ use colon.

gem install sinatra:1.4.4 prawn:0.13.0

Here's a completely working and atomic version of a wildcard delete implemented in Lua. It'll run much faster than the xargs version due to much less network back-and-forth, and it's completely atomic, blocking any other requests against redis until it finishes. If you want to atomically delete keys on Redis 2.6.0 or greater, this is definitely the way to go:

redis-cli -n [some_db] -h [some_host_name] EVAL "return redis.call('DEL', unpack(redis.call('KEYS', ARGV[1] .. '*')))" 0 prefix:

This is a working version of @mcdizzle's idea in his answer to this question. Credit for the idea 100% goes to him.

EDIT: Per Kikito's comment below, if you have more keys to delete than free memory in your Redis server, you'll run into the "too many elements to unpack" error. In that case, do:

for _,k in ipairs(redis.call('keys', ARGV[1])) do 
    redis.call('del', k) 
end

As Kikito suggested.

Maven uses the JAVA_HOME parameter to find which Java version it is supposed to run. I see from your comment that you can't change that in the configuration.

• You can set the JAVA_HOME parameter just before you start maven (and change it back afterwards if need be).
• You could also go into your mvn(non-windows)/mvn.bat/mvn.cmd(windows) and set your java version explicitly there.

Problem happened when I unzipped using Cygwin. Used the Windows XP standard unzip program and it worked.

I came up with this simple and straight-forward (i hope so) code example which should explain itself!

#include <string.h>
#include <stdio.h>
#include <stdlib.h>

/* function header definitions */
char* getString();                     //<- with malloc (good practice)
char * getStringNoMalloc();  //<- without malloc (fails! don't do this!)
void getStringCallByRef(char* reference); //<- callbyref (good practice)

/* the main */
int main(int argc, char*argv[]) {

    //######### calling with malloc
    char * a = getString();
    printf("MALLOC ### a = %s \n", a); 
    free(a);

    //######### calling without malloc
    char * b = getStringNoMalloc();
    printf("NO MALLOC ### b = %s \n", b); //this doesnt work, question to yourself: WHY?
    //HINT: the warning says that a local reference is returned. ??!
    //NO free here!

    //######### call-by-reference
    char c[100];
    getStringCallByRef(c);
    printf("CALLBYREF ### c = %s \n", c);

    return 0;
}

//WITH malloc
char* getString() {

    char * string;
    string = malloc(sizeof(char)*100);

    strcat(string, "bla");
    strcat(string, "/");
    strcat(string, "blub");

    printf("string : '%s'\n", string);

    return string;
}

//WITHOUT malloc (watch how it does not work this time)
char* getStringNoMalloc() {

     char string[100] = {};

     strcat(string, "bla");
     strcat(string, "/");
     strcat(string, "blub");
     //INSIDE this function "string" is OK
     printf("string : '%s'\n", string);

     return string; //but after returning.. it is NULL? :)
}

// ..and the call-by-reference way to do it (prefered)
void getStringCallByRef(char* reference) {

    strcat(reference, "bla");
    strcat(reference, "/");
    strcat(reference, "blub");
    //INSIDE this function "string" is OK
    printf("string : '%s'\n", reference);
    //OUTSIDE it is also OK because we hand over a reference defined in MAIN
    // and not defined in this scope (local), which is destroyed after the function finished
}

When compiling it, you get the [intended] warning:

me@box:~$ gcc -o example.o example.c 
example.c: In function ‘getStringNoMalloc’:
example.c:58:16: warning: function returns address of local variable [-Wreturn-local-addr]
         return string; //but after returning.. it is NULL? :)
            ^~~~~~

...basically what we are discussing here!

running my example yields this output:

me@box:~$ ./example.o 
string : 'bla/blub'
MALLOC ### a = bla/blub 
string : 'bla/blub'
NO MALLOC ### b = (null) 
string : 'bla/blub'
CALLBYREF ### c = bla/blub 

Theory:

This has been answered very nicely by User @phoxis. Basically think about it this way: Everything inbetween { and } is local scope, thus by the C-Standard is "undefined" outside. By using malloc you take memory from the HEAP (programm scope) and not from the STACK (function scope) - thus its 'visible' from outside. The second correct way to do it is call-by-reference. Here you define the var inside the parent-scope, thus it is using the STACK (because the parent scope is the main()).

Summary:

3 Ways to do it, One of them false. C is kind of to clumsy to just have a function return a dynamically sized String. Either you have to malloc and then free it, or you have to call-by-reference. Or use C++ ;)

Use itertools.product!

from itertools import product
for x, y in product(range(10), range(10)):
    #do whatever you want
    break

Here's a link to itertools.product in the python documentation: http://docs.python.org/library/itertools.html#itertools.product

You can also loop over an array comprehension with 2 fors in it, and break whenever you want to.

>>> [(x, y) for y in ['y1', 'y2'] for x in ['x1', 'x2']]
[
    ('x1', 'y1'), ('x2', 'y1'),
    ('x1', 'y2'), ('x2', 'y2')
]

Try to add the suggested code to the TextChanged event:

private void textBox1_TextChanged(object sender, EventArgs e)
{
  textBox1.SelectionStart = textBox1.Text.Length;
  textBox1.ScrollToCaret();
}

You can use this in app.js file .

var apiurl = express.Router();
apiurl.use(function(req, res, next) {
    var fullUrl = req.protocol + '://' + req.get('host') + req.originalUrl;
    next();
});
app.use('/', apiurl);

Trust me, this will work for you:

    npm config set registry http://registry.npmjs.org/  

import numpy as np
array_ = np.array([[1,2,3]])
add_row = np.array([[4,5,6]])

array_ = np.concatenate((array_, add_row), axis=0)

An easy way to upgrade all Perl packages (CPAN modules) is the following way:

cpan upgrade /(.*)/

cpan will recognize the regular expression like this and will update/upgrade all packages installed.

When I trying to my login (which is a bootstrap modal), I used the @sessionattributes annotation. But problem was when the view is a redirect ("redirect:/home"), values I entered to session shows in the url. Some Internet sources suggest to follow http://docs.spring.io/spring/docs/4.3.x/spring-framework-reference/htmlsingle/#mvc-redirecting But I used the HttpSession instead. This session will be there until you close the browsers. Here is sample code

        @RequestMapping(value = "/login")
        @ResponseBody
        public BooleanResponse login(HttpSession session,HttpServletRequest request){
            //HttpServletRequest used to take data to the controller
            String username = request.getParameter("username");
            String password = request.getParameter("password");

           //Here you set your values to the session
           session.setAttribute("username", username);
           session.setAttribute("email", email);

          //your code goes here
}

You don't change specific thing on view side.

<c:out value="${username}"></c:out>
<c:out value="${email}"></c:out>

After login add above codes to anyplace in you web site. If session correctly set, you will see the values there. Make sure you correctly added the jstl tags and El- expressions (Here is link to set jstl tags https://menukablog.wordpress.com/2016/05/10/add-jstl-tab-library-to-you-project-correctly/)

@eOnOe has answered how we can change status bar tint through xml. But we can also change it dynamically in code:

if (Build.VERSION.SDK_INT >= Build.VERSION_CODES.M) {
    View decor = getWindow().getDecorView();
    if (shouldChangeStatusBarTintToDark) {
        decor.setSystemUiVisibility(View.SYSTEM_UI_FLAG_LIGHT_STATUS_BAR);
    } else {
        // We want to change tint color to white again.
        // You can also record the flags in advance so that you can turn UI back completely if
        // you have set other flags before, such as translucent or full screen.
        decor.setSystemUiVisibility(0);
    }
}

Assuming that your List is a list of strings make data an ArrayList<String> and use intent.putStringArrayListExtra("data", data)

Here is a skeleton of the code you need:

1. Declare List

   private List<String> test;
   

2. Init List at appropriate place

   test = new ArrayList<String>();
   

   and add data as appropriate to test.

3. Pass to intent as follows:

   Intent intent = getIntent();  
   intent.putStringArrayListExtra("test", (ArrayList<String>) test);
   

4. Retrieve data as follows:

   ArrayList<String> test = getIntent().getStringArrayListExtra("test");
   

Hope that helps.

Here is a more MSBuild way of doing this.

<Target Name="CopyRoslynFiles" AfterTargets="AfterBuild" Condition="!$(Disable_CopyWebApplication) And '$(OutDir)' != '$(OutputPath)'">
    <ItemGroup>
      <RoslynFiles Include="$(CscToolPath)\*" />
    </ItemGroup>
    <MakeDir Directories="$(WebProjectOutputDir)\bin\roslyn" />
    <Copy SourceFiles="@(RoslynFiles)" DestinationFolder="$(WebProjectOutputDir)\bin\roslyn" SkipUnchangedFiles="true" Retries="$(CopyRetryCount)" RetryDelayMilliseconds="$(CopyRetryDelayMilliseconds)" />
</Target>

But I notice that the roslyn files are also in my bin directory (not in a folder). The app seems to work, though.

I give here 2 ways of coping array, for C and C++ language. memcpy and copy both ar usable on C++ but copy is not usable for C, you have to use memcpy if you are trying to copy array in C.

#include <stdio.h>
#include <iostream>
#include <algorithm> // for using copy (library function)
#include <string.h> // for using memcpy (library function)


int main(){

    int arr[] = {1, 1, 2, 2, 3, 3};
    int brr[100];

    int len = sizeof(arr)/sizeof(*arr); // finding size of arr (array)

    std:: copy(arr, arr+len, brr); // which will work on C++ only (you have to use #include <algorithm>
    memcpy(brr, arr, len*(sizeof(int))); // which will work on both C and C++

    for(int i=0; i<len; i++){ // Printing brr (array).
        std:: cout << brr[i] << " ";
    }

    return 0;
}

No, abstract class can never be instantiated.

I just tried the first answer from Brad Rem and came to this setting in the web.config under BasicHttpBinding:

<system.serviceModel>
    <bindings>
      <basicHttpBinding>
        <binding bypassProxyOnLocal="False" useDefaultWebProxy="false" proxyAddress="http://127.0.0.1:8888" ...
        ...
      </basicHttpBinding>
    </bindings>
    ...
<system.serviceModel>

Hope this helps someone.

ASP.NET build manager is building the website by going through the folders alphabetically, and for each folder it figures out it dependencies and builds the dependencies first and then the selected folder.

In this case the problematic folder which is ~/Controls, is selected to be built at the beginning, from yet an unknown reason, it builds some of the controls there as a separate assembly instead of inside the same assembly as other controls (seems to be connected to the fact that some controls are dependent on other controls in the same folder).

Then the next folder which is built (~/File-Center/Control) is dependent on the root folder ~/ which is dependent on ~/Controls, so the folder ~/Controls is being built again only this time the controls which were separated to their own assembly are now joined to the same assembly as other controls with the separated assembly still being referenced.

So at this point 2 assembly (at least) have the same controls and the build fails.

Although we still don't know why this happened, we were able to work around it by changing the Controls folder name to ZControls, this way it is not built before ~/File-Center/Control, only after and this way it is built as it should.

Python 3.5 adds the math.isclose and cmath.isclose functions as described in PEP 485.

If you're using an earlier version of Python, the equivalent function is given in the documentation.

def isclose(a, b, rel_tol=1e-09, abs_tol=0.0):
    return abs(a-b) <= max(rel_tol * max(abs(a), abs(b)), abs_tol)

rel_tol is a relative tolerance, it is multiplied by the greater of the magnitudes of the two arguments; as the values get larger, so does the allowed difference between them while still considering them equal.

abs_tol is an absolute tolerance that is applied as-is in all cases. If the difference is less than either of those tolerances, the values are considered equal.

Use sed's substitution: sed 's/"//g'

s/X/Y/ replaces X with Y.

g means all occurrences should be replaced, not just the first one.

git rev-parse --show-toplevel

could be enough if executed within a git repo.
From git rev-parse man page:

--show-toplevel

Show the absolute path of the top-level directory.

For older versions (before 1.7.x), the other options are listed in "Is there a way to get the git root directory in one command?":

git rev-parse --git-dir

That would give the path of the .git directory.

The OP mentions:

git rev-parse --show-prefix

which returns the local path under the git repo root. (empty if you are at the git repo root)

Note: for simply checking if one is in a git repo, I find the following command quite expressive:

git rev-parse --is-inside-work-tree

And yes, if you need to check if you are in a .git git-dir folder:

git rev-parse --is-inside-git-dir

For those who are experiencing same problem after controlling there is no suspicious java process which allocate the port, there is no red square on eclipse to terminate any process and also there is no change even you try different port for your spring boot application.

might sound stupid but; restarting eclipse works. :)

You can accomplish this (if I understand what you are trying to do) using dynamic SQL.

The trick is that you need to create a string containing the SQL statement. That's because the tablename has to specified in the actual SQL text, when you execute the statement. The table references and column references can't be supplied as parameters, those have to appear in the SQL text.

So you can use something like this approach:

SET @stmt = 'INSERT INTO @tmpTbl1 SELECT ' + @KeyValue 
    + ' AS fld1 FROM tbl' + @KeyValue

EXEC (@stmt)

First, we create a SQL statement as a string. Given a @KeyValue of 'Foo', that would create a string containing:

'INSERT INTO @tmpTbl1 SELECT Foo AS fld1 FROM tblFoo'

At this point, it's just a string. But we can execute the contents of the string, as a dynamic SQL statement, using EXECUTE (or EXEC for short).

The old-school sp_executesql procedure is an alternative to EXEC, another way to execute dymamic SQL, which also allows you to pass parameters, rather than specifying all values as literals in the text of the statement.

FOLLOWUP

EBarr points out (correctly and importantly) that this approach is susceptible to SQL Injection.

Consider what would happen if @KeyValue contained the string:

'1 AS foo; DROP TABLE students; -- '

The string we would produce as a SQL statement would be:

'INSERT INTO @tmpTbl1 SELECT 1 AS foo; DROP TABLE students; -- AS fld1 ...'

When we EXECUTE that string as a SQL statement:

INSERT INTO @tmpTbl1 SELECT 1 AS foo;
DROP TABLE students;
-- AS fld1 FROM tbl1 AS foo; DROP ...

And it's not just a DROP TABLE that could be injected. Any SQL could be injected, and it might be much more subtle and even more nefarious. (The first attacks can be attempts to retreive information about tables and columns, followed by attempts to retrieve data (email addresses, account numbers, etc.)

One way to address this vulnerability is to validate the contents of @KeyValue, say it should contain only alphabetic and numeric characters (e.g. check for any characters not in those ranges using LIKE '%[^A-Za-z0-9]%'. If an illegal character is found, then reject the value, and exit without executing any SQL.

@xerq pointed correctly, here's some more reference http://www.codingdefined.com/2015/06/nodejs-error-errno-eaiagain.html

i got the same error, i solved it by updating "hosts" file present under this location in windows os

C:\Windows\System32\drivers\etc

Hope it helps!!

There is no separate chromedriver binary for Windows 64 bit. Chromedriver 32 bit binary works for both 32 as well as 64 bit versions of Windows. As of today, you can find the latest version of chromedriver Windows binary at https://chromedriver.storage.googleapis.com/2.25/chromedriver_win32.zip

all_roles.sql

SELECT SUBSTR(TRIM(rtp.role),1,12)          AS ROLE
     , SUBSTR(rp.grantee,1,16)              AS GRANTEE
     , SUBSTR(TRIM(rtp.privilege),1,12)     AS PRIVILEGE
     , SUBSTR(TRIM(rtp.owner),1,12)         AS OWNER
     , SUBSTR(TRIM(rtp.table_name),1,28)    AS TABLE_NAME
     , SUBSTR(TRIM(rtp.column_name),1,20)   AS COLUMN_NAME
     , SUBSTR(rtp.common,1,4)               AS COMMON
     , SUBSTR(rtp.grantable,1,4)            AS GRANTABLE
     , SUBSTR(rp.default_role,1,16)         AS DEFAULT_ROLE
     , SUBSTR(rp.admin_option,1,4)          AS ADMIN_OPTION
  FROM role_tab_privs rtp
  LEFT JOIN dba_role_privs rp
    ON (rtp.role = rp.granted_role)
 WHERE ('&1' IS NULL OR UPPER(rtp.role) LIKE UPPER('%&1%'))
   AND ('&2' IS NULL OR UPPER(rp.grantee) LIKE UPPER('%&2%'))
   AND ('&3' IS NULL OR UPPER(rtp.table_name) LIKE UPPER('%&3%'))
   AND ('&4' IS NULL OR UPPER(rtp.owner) LIKE UPPER('%&4%'))
 ORDER BY 1
        , 2
        , 3
        , 4
;

Usage

SQLPLUS> @all_roles '' '' '' '' '' ''
SQLPLUS> @all_roles 'somerol' '' '' '' '' ''
SQLPLUS> @all_roles 'roler' 'username' '' '' '' ''
SQLPLUS> @all_roles '' '' 'part-of-database-package-name' '' '' ''
etc.

You can use python -m http.server. By default the local server will run on port 8000. If you would like to change this, simply add the port number python -m http.server 1234

If you are using python 2 (instead of 3), the equivalent command is python -m SimpleHTTPServer

There's more to it than this, but you're probably looking for this list:

B   business day frequency
C   custom business day frequency (experimental)
D   calendar day frequency
W   weekly frequency
M   month end frequency
BM  business month end frequency
MS  month start frequency
BMS business month start frequency
Q   quarter end frequency
BQ  business quarter endfrequency
QS  quarter start frequency
BQS business quarter start frequency
A   year end frequency
BA  business year end frequency
AS  year start frequency
BAS business year start frequency
H   hourly frequency
T   minutely frequency
S   secondly frequency
L   milliseconds
U   microseconds

Source: http://pandas.pydata.org/pandas-docs/stable/timeseries.html#offset-aliases

The property event.which is added when using jQuery to avoid browser differences. See docs.

The which property will be undefined if you are not using jQuery.

You can do something like this:

<%

out.print("<p>Hey!</p>");    
out.print("<p>How are you?</p>");

%>

// export in index.js
export { default as Foo } from './Foo';
export { default as Bar } from './Bar';

// then import both
import { Foo, Bar } from 'my/module';

@import url('style.css');

As opposed to the best answer, it is not recommended to aggregate all CSS files into one chunk when using HTTP/2.0

The problem is that Margin is a property, and its type (Thickness) is a value type. That means when you access the property you're getting a copy of the value back.

Even though you can change the value of the Thickness.Left property for a particular value (grr... mutable value types shouldn't exist), it wouldn't change the margin.

Instead, you'll need to set the Margin property to a new value. For instance (coincidentally the same code as Marc wrote):

Thickness margin = MyControl.Margin;
margin.Left = 10;
MyControl.Margin = margin;

As a note for library design, I would have vastly preferred it if Thickness were immutable, but with methods that returned a new value which was a copy of the original, but with one part replaced. Then you could write:

MyControl.Margin = MyControl.Margin.WithLeft(10);

No worrying about odd behaviour of mutable value types, nice and readable, all one expression...

I follow Kelsey's first set of steps to add the installer classes to my service project, but instead of creating an MSI or setup.exe installer I make the service self installing/uninstalling. Here's a bit of sample code from one of my services you can use as a starting point.

public static int Main(string[] args)
{
    if (System.Environment.UserInteractive)
    {
        // we only care about the first two characters
        string arg = args[0].ToLowerInvariant().Substring(0, 2);

        switch (arg)
        {
            case "/i":  // install
                return InstallService();

            case "/u":  // uninstall
                return UninstallService();

            default:  // unknown option
                Console.WriteLine("Argument not recognized: {0}", args[0]);
                Console.WriteLine(string.Empty);
                DisplayUsage();
                return 1;
        }
    }
    else
    {
        // run as a standard service as we weren't started by a user
        ServiceBase.Run(new CSMessageQueueService());
    }

    return 0;
}

private static int InstallService()
{
    var service = new MyService();

    try
    {
        // perform specific install steps for our queue service.
        service.InstallService();

        // install the service with the Windows Service Control Manager (SCM)
        ManagedInstallerClass.InstallHelper(new string[] { Assembly.GetExecutingAssembly().Location });
    }
    catch (Exception ex)
    {
        if (ex.InnerException != null && ex.InnerException.GetType() == typeof(Win32Exception))
        {
            Win32Exception wex = (Win32Exception)ex.InnerException;
            Console.WriteLine("Error(0x{0:X}): Service already installed!", wex.ErrorCode);
            return wex.ErrorCode;
        }
        else
        {
            Console.WriteLine(ex.ToString());
            return -1;
        }
    }

    return 0;
}

private static int UninstallService()
{
    var service = new MyQueueService();

    try
    {
        // perform specific uninstall steps for our queue service
        service.UninstallService();

        // uninstall the service from the Windows Service Control Manager (SCM)
        ManagedInstallerClass.InstallHelper(new string[] { "/u", Assembly.GetExecutingAssembly().Location });
    }
    catch (Exception ex)
    {
        if (ex.InnerException.GetType() == typeof(Win32Exception))
        {
            Win32Exception wex = (Win32Exception)ex.InnerException;
            Console.WriteLine("Error(0x{0:X}): Service not installed!", wex.ErrorCode);
            return wex.ErrorCode;
        }
        else
        {
            Console.WriteLine(ex.ToString());
            return -1;
        }
    }

    return 0;
}

I had a similar problem and it was related to the version. In a python terminal check:

>> import xlrd
>> xlrd.__VERSION__

If you have '0.9.0' you can open almost all files. If you have '0.6.0' which was what I found on Ubuntu, you may have problems with newest Excel files. You can download the latest version of xlrd using the Distutils standard.

I know this is an old question, but I wanted to add ServiceCapture to the list, for those who may come across this.

I've been using ServiceCapture for about 4 years and love it. It's not free, but it is a great tool and not very expensive. If you debug a lot of Flash or AJAX apps it is invaluable.

In vanilla/pure javascript you can check as following -

var field = document.querySelector("input[name='fieldName']");
if(field.readOnly){
 alert("foo");
}

This is already in :

Age from Date of Birth using JQuery

or alternatively u can use Date.parse() as in

var date1 = new Date("10/25/2011");
var date2 = new Date("09/03/2010");
var date3 = new Date(Date.parse(date1) - Date.parse(date2));

You have to put java in lower case and you have to add .class!

java HelloWorld2.class

You can use OpenXml SDK for *.xlsx files. It works very quickly. I made simple C# IDataReader implementation for this sdk. See here. Now you can easy read excel file to DataTable and you can import excel file to sql server database (use SqlBulkCopy). ExcelDataReader reads very fast. On my machine 10000 records less 3 sec and 60000 less 8 sec.

Read to DataTable example:

class Program
{
    static void Main(string[] args)
    {
        var dt = new DataTable();
        using (var reader = new ExcelDataReader(@"data.xlsx"))
            dt.Load(reader);

        Console.WriteLine("done: " + dt.Rows.Count);
        Console.ReadKey();
   }
}

First of all you can assign values to variables/constants just by feeding values into them the same way you do it with placeholders. So this is perfectly legal to do:

import tensorflow as tf
x = tf.Variable(0)
with tf.Session() as sess:
    sess.run(tf.global_variables_initializer())
    print sess.run(x, feed_dict={x: 3})

Regarding your confusion with the tf.assign() operator. In TF nothing is executed before you run it inside of the session. So you always have to do something like this: op_name = tf.some_function_that_create_op(params) and then inside of the session you run sess.run(op_name). Using assign as an example you will do something like this:

import tensorflow as tf
x = tf.Variable(0)
y = tf.assign(x, 1)
with tf.Session() as sess:
    sess.run(tf.global_variables_initializer())
    print sess.run(x)
    print sess.run(y)
    print sess.run(x)

As all have mentioned it is

request.getHeader("referer");

I would like to add some more details about security aspect of referer header in contrast with accepted answer. In Open Web Application Security Project(OWASP) cheat sheets, under Cross-Site Request Forgery (CSRF) Prevention Cheat Sheet it mentions about importance of referer header.

More importantly for this recommended Same Origin check, a number of HTTP request headers can't be set by JavaScript because they are on the 'forbidden' headers list. Only the browsers themselves can set values for these headers, making them more trustworthy because not even an XSS vulnerability can be used to modify them.

The Source Origin check recommended here relies on three of these protected headers: Origin, Referer, and Host, making it a pretty strong CSRF defense all on its own.

You can refer Forbidden header list here. User agent(ie:browser) has the full control over these headers not the user.

// is unconditionally "flooring division", e.g:

>>> 4.0//1.5
2.0

As you see, even though both operands are floats, // still floors -- so you always know securely what it's going to do.

Single / may or may not floor depending on Python release, future imports, and even flags on which Python's run, e.g.:

$ python2.6 -Qold -c 'print 2/3'
0
$ python2.6 -Qnew -c 'print 2/3'
0.666666666667

As you see, single / may floor, or it may return a float, based on completely non-local issues, up to and including the value of the -Q flag...;-).

So, if and when you know you want flooring, always use //, which guarantees it. If and when you know you don't want flooring, slap a float() around other operand and use /. Any other combination, and you're at the mercy of version, imports, and flags!-)

If you have Qt/KDE installed, you can use kdialog, which pops up a Qt dialog window. You can easily specify to display a Yes/No dialog, OK/Cancel, simple text input, password input etc. You then have access to the return values from these dialogs at the shell.

Hi thanx a lot it solved my issue ,

By default vs 2008 will add

 <!--<add verb="*" path="*.asmx" validate="false" type="Microsoft.Web.Script.Services.ScriptHandlerFactory, Microsoft.Web.Extensions, Version=1.0.61025.0, Culture=neutral, PublicKeyToken=31bf3856ad364e35" />
      <add verb="GET" path="ScriptResource.axd" type="Microsoft.Web.Handlers.ScriptResourceHandler" validate="false" />-->

Need to correct Default config(Above) to below code FIX

 <add verb="*" path="*.asmx" validate="false" type="System.Web.Script.Services.ScriptHandlerFactory, System.Web.Extensions, Version=3.5.0.0, Culture=neutral, PublicKeyToken=31bf3856ad364e35"/>
  <add verb="GET" path="ScriptResource.axd" type="System.Web.Handlers.ScriptResourceHandler" validate="false"/>

Spring has some standard events which you can handle.

To do that, you must create and register a bean that implements the ApplicationListener interface, something like this:

package test.pack.age;

import org.springframework.context.ApplicationContext;
import org.springframework.context.ApplicationEvent;
import org.springframework.context.ApplicationListener;
import org.springframework.context.event.ContextRefreshedEvent;

public class ApplicationListenerBean implements ApplicationListener {

    @Override
    public void onApplicationEvent(ApplicationEvent event) {
        if (event instanceof ContextRefreshedEvent) {
            ApplicationContext applicationContext = ((ContextRefreshedEvent) event).getApplicationContext();
            // now you can do applicationContext.getBean(...)
            // ...
        }
    }
}

You then register this bean within your servlet.xml or applicationContext.xml file:

<bean id="eventListenerBean" class="test.pack.age.ApplicationListenerBean" />

and Spring will notify it when the application context is initialized.

In Spring 3 (if you are using this version), the ApplicationListener class is generic and you can declare the event type that you are interested in, and the event will be filtered accordingly. You can simplify a bit your bean code like this:

public class ApplicationListenerBean implements ApplicationListener<ContextRefreshedEvent> {

    @Override
    public void onApplicationEvent(ContextRefreshedEvent event) {
        ApplicationContext applicationContext = event.getApplicationContext();
        // now you can do applicationContext.getBean(...)
        // ...
    }
}

This detects infinity and also NaN in Visual Studio by checking it is within double limits:

//#include <float.h>
double x, y = -1.1; x = sqrt(y);
if (x >= DBL_MIN && x <= DBL_MAX )
    cout << "DETECTOR-2 of errors FAILS" << endl;
else
    cout << "DETECTOR-2 of errors OK" << endl;

What exactly are the rules for requesting retransmission of lost data?

The receiver does not request the retransmission. The sender waits for an ACK for the byte-range sent to the client and when not received, resends the packets, after a particular interval. This is ARQ (Automatic Repeat reQuest). There are several ways in which this is implemented.

Stop-and-wait ARQ
Go-Back-N ARQ
Selective Repeat ARQ

are detailed in the RFC 3366.

At what time frequency are the retransmission requests performed?

The retransmissions-times and the number of attempts isn't enforced by the standard. It is implemented differently by different operating systems, but the methodology is fixed. (One of the ways to fingerprint OSs perhaps?)

The timeouts are measured in terms of the RTT (Round Trip Time) times. But this isn't needed very often due to Fast-retransmit which kicks in when 3 Duplicate ACKs are received.

Is there an upper bound on the number?

Yes there is. After a certain number of retries, the host is considered to be "down" and the sender gives up and tears down the TCP connection.

Is there functionality for the client to indicate to the server to forget about the whole TCP segment for which part went missing when the IP packet went missing?

The whole point is reliable communication. If you wanted the client to forget about some part, you wouldn't be using TCP in the first place. (UDP perhaps?)

The file format would permit up to 255-character worksheet names, but if the Excel UI doesn't want you exceeding 31 characters, don't try to go beyond 31. App's full of weird undocumented limits and quirks, and feeding it files that are within spec but not within the range of things the testers would have tested usually causes REALLY strange behavior. (Personal favorite example: using the Excel 4.0 bytecode for an if() function, in a file with an Excel 97-style stringtable, disabled the toolbar button for bold in Excel 97.)

Just a small addition to Jeff Bowman's excellent answer, as I found this question when searching for a solution to one of my own problems:

If a call to a method matches more than one mock's when trained calls, the order of the when calls is important, and should be from the most wider to the most specific. Starting from one of Jeff's examples:

when(foo.quux(anyInt(), anyInt())).thenReturn(true);
when(foo.quux(anyInt(), eq(5))).thenReturn(false);

is the order that ensures the (probably) desired result:

foo.quux(3 /*any int*/, 8 /*any other int than 5*/) //returns true
foo.quux(2 /*any int*/, 5) //returns false

If you inverse the when calls then the result would always be true.

I believe the default precision is 38, default scale is zero. However the actual size of an instance of this column, is dynamic. It will take as much space as needed to store the value, or max 21 bytes.

The key function helped me and is very simple:

The key() function simply returns the key of the array element that's currently being pointed to by the internal pointer. It does not move the pointer in any way. If the internal pointer points beyond the end of the elements list or the array is empty, key() returns NULL.

Example:

<?php
    $array = array(
        'fruit1' => 'apple',
        'fruit2' => 'orange',
        'fruit3' => 'grape',
        'fruit4' => 'apple',
        'fruit5' => 'apple');

    // this cycle echoes all associative array
    // key where value equals "apple"
    while ($fruit_name = current($array)) {
        if ($fruit_name == 'apple') {
            echo key($array).'<br />';
        }
        next($array);
    }
?>

The above example will output:

fruit1<br />
fruit4<br />
fruit5<br />

AFAIK it is GRADLE_HOME not GRADLE_USER_HOME (see gradle installation http://www.gradle.org/installation).

On the other hand I played a bit with Gradle support in Idea 13 Cardea and I think the gradle home is not automatically discover by Idea. If so you can file a issue in youtrack.

Also, if you use gradle 1.6+ you can use the Graldle support for setting the build and wrapper. I think idea automatically discover the wrapper based gradle project.

$ gradle setupBuild --type java-library

$ gradle wrapper

Note: Supported library types: basic, maven, java

Regards

Again, I stress that namespace, svc name and contract must be correctly specified in web.config file:

 <service name="NAMESPACE.SvcFileName">
    <endpoint contract="NAMESPACE.IContractName" />
  </service>

Example:

<service name="MyNameSpace.FileService">
<endpoint contract="MyNameSpace.IFileService" />
</service>

(Unrelevant tags ommited in these samples)

The first allocates an object with automatic storage duration, which means it will be destructed automatically upon exit from the scope in which it is defined.

The second allocated an object with dynamic storage duration, which means it will not be destructed until you explicitly use delete to do so.

If you are entering the data manually you may consider removing the values and the zeros on the TIMESTAMP(6).000000 so that it becomes TIMESTAMP. That worked fine with me.

Will this be simpler for handling the day boundary case? :)

TimeSpan start = TimeSpan.Parse("22:00");  // 10 PM
TimeSpan end = TimeSpan.Parse("02:00");    // 2 AM
TimeSpan now = DateTime.Now.TimeOfDay;

bool bMatched = now.TimeOfDay >= start.TimeOfDay &&
                now.TimeOfDay < end.TimeOfDay;
// Handle the boundary case of switching the day across mid-night
if (end < start)
    bMatched = !bMatched;

if(bMatched)
{
    // match found, current time is between start and end
}
else
{
    // otherwise ... 
}

We can force vbscript always run with 32 bit mode by changing "system32" to "sysWOW64" in default value of key "Computer\HKLM\SOFTWARE]\Classes\VBSFile\Shell\Open\Command"

I think I had a similar problem in the past, with another python library. I believe that it was a windows permission issue. Try adding "Users" to your python directory, and give them full access.

To append to this famous question (though a bit too late): You can also do df.groupby('column_name').get_group('column_desired_value').reset_index() to make a new data frame with specified column having a particular value. E.g.

import pandas as pd
df = pd.DataFrame({'A': 'foo bar foo bar foo bar foo foo'.split(),
                   'B': 'one one two three two two one three'.split()})
print("Original dataframe:")
print(df)

b_is_two_dataframe = pd.DataFrame(df.groupby('B').get_group('two').reset_index()).drop('index', axis = 1) 
#NOTE: the final drop is to remove the extra index column returned by groupby object
print('Sub dataframe where B is two:')
print(b_is_two_dataframe)

Run this gives:

Original dataframe:
     A      B
0  foo    one
1  bar    one
2  foo    two
3  bar  three
4  foo    two
5  bar    two
6  foo    one
7  foo  three
Sub dataframe where B is two:
     A    B
0  foo  two
1  foo  two
2  bar  two

Thanks for the info, think I see the problem. This is a bug in hive-go that only shows up when you add a host. The last lines of it are:

app.listen(3001);
console.log("... port %d in %s mode", app.address().port, app.settings.env);

When you add the host on the first line, it is crashing when it calls app.address().port.

The problem is the potentially asynchronous nature of .listen(). Really it should be doing that console.log call inside a callback passed to listen. When you add the host, it tries to do a DNS lookup, which is async. So when that line tries to fetch the address, there isn't one yet because the DNS request is running, so it crashes.

Try this:

app.listen(3001, 'localhost', function() {
  console.log("... port %d in %s mode", app.address().port, app.settings.env);
});

For me, on windows 10, I had unknowingly installed multiple python versions (One from PyCharm IDE and another from Windows store). I uninstalled the one from windows Store and just to be thorough, uninstalled numpy pip uninstall numpy and then installed it again pip install numpy. It worked in the terminal in PyCharm and also in command prompt.

Add the css:

   html,body{
        height:100%;
        }
    .bg-img {
        background: url(image.jpg) no-repeat center top; 
        background-size: cover; 
        height:100%;     
    }

And html is:

<div class="bg-mg"></div>

CSS: stretching background image to 100% width and height of screen?

This feature has been added in dplyr v0.3. You can now pass a named character vector to the by argument in left_join (and other joining functions) to specify which columns to join on in each data frame. With the example given in the original question, the code would be:

left_join(test_data, kantrowitz, by = c("first_name" = "name"))

I had such crash on Samsung devices even though the activity did use Theme.AppCompat. The root cause was related to weird optimizations on Samsung side:

- if one activity of your app has theme not inherited from Theme.AppCompat
- and it has also `android:launchMode="singleTask"`
- then all the activities that are launched from it will share the same Theme

My solution was just removing android:launchMode="singleTask"

Here is a simple example to get the selected value of dropdown in javascript

First we design the UI for dropdown

<div class="col-xs-12">
<select class="form-control" id="language">
    <option>---SELECT---</option>
    <option>JAVA</option>
    <option>C</option>
    <option>C++</option>
    <option>PERL</option>
</select>

Next we need to write script to get the selected item

<script type="text/javascript">
$(document).ready(function () {
    $('#language').change(function () {
        var doc = document.getElementById("language");
        alert("You selected " + doc.options[doc.selectedIndex].value);
    });
});

Now When change the dropdown the selected item will be alert.

Try this

 $(document).ready(function(){
    var form=$("#myForm");
    $("#smt").click(function(){
    $.ajax({
            type:"POST",
            url:form.attr("action"),
            data:$("#myForm input").serialize(),//only input
            success: function(response){
                console.log(response);  
            }
        });
    });
    });

Using this on many coding sites:

• CASE 1: WHEN NUMBER OF INTEGERS IN EACH LINE IS GIVEN

Suppose you are given 3 test cases with each line of 4 integer inputs separated by spaces 1 2 3 4, 5 6 7 8 , 1 1 2 2

        int t=3,i;
        int a[]=new int[4];

        Scanner scanner = new Scanner(System.in);

        while(t>0)  
        {
            for(i=0; i<4; i++){
                a[i]=scanner.nextInt();
                System.out.println(a[i]);
            }   

        //USE THIS ARRAY A[] OF 4 Separated Integers Values for solving your problem
            t--;
        }

• CASE 2: WHEN NUMBER OF INTEGERS in each line is NOT GIVEN

      Scanner scanner = new Scanner(System.in);
  
      String lines=scanner.nextLine();
  
      String[] strs = lines.trim().split("\\s+");
  

  Note that you need to trim() first: trim().split("\\s+") - otherwise, e.g. splitting a b c will emit two empty strings first

      int n=strs.length; //Calculating length gives number of integers
  
      int a[]=new int[n];
  
      for (int i=0; i<n; i++) 
      {
          a[i] = Integer.parseInt(strs[i]); //Converting String_Integer to Integer 
          System.out.println(a[i]);
      }
  

To parse a date, look at Date::Parse in CPAN.

You could do either:

dirname(__DIR__);

Or:

__DIR__ . '/..';

...but in a web server environment you will probably find that you are already working from current file's working directory, so you can probably just use:

'../'

...to reference the directory above. You can replace __DIR__ with dirname(__FILE__) before PHP 5.3.0.

You should also be aware what __DIR__ and __FILE__ refers to:

The full path and filename of the file. If used inside an include, the name of the included file is returned.

So it may not always point to where you want it to.

Entity states

JPA defines the following entity states:

New (Transient)

A newly created object that hasn’t ever been associated with a Hibernate Session (a.k.a Persistence Context) and is not mapped to any database table row is considered to be in the New (Transient) state.

To become persisted we need to either explicitly call the EntityManager#persist method or make use of the transitive persistence mechanism.

Persistent (Managed)

A persistent entity has been associated with a database table row and it’s being managed by the currently running Persistence Context. Any change made to such an entity is going to be detected and propagated to the database (during the Session flush-time).

With Hibernate, we no longer have to execute INSERT/UPDATE/DELETE statements. Hibernate employs a transactional write-behind working style and changes are synchronized at the very last responsible moment, during the current Session flush-time.

Detached

Once the currently running Persistence Context is closed all the previously managed entities become detached. Successive changes will no longer be tracked and no automatic database synchronization is going to happen.

Entity state transitions

You can change the entity state using various methods defined by the EntityManager interface.

To understand the JPA entity state transitions better, consider the following diagram:

When using JPA, to reassociate a detached entity to an active EntityManager, you can use the merge operation.

When using the native Hibernate API, apart from merge, you can reattach a detached entity to an active Hibernate Sessionusing the update methods, as demonstrated by the following diagram:

Merging a detached entity

The merge is going to copy the detached entity state (source) to a managed entity instance (destination).

Consider we have persisted the following Book entity, and now the entity is detached as the EntityManager that was used to persist the entity got closed:

Book _book = doInJPA(entityManager -> {
    Book book = new Book()
    .setIsbn("978-9730228236")
    .setTitle("High-Performance Java Persistence")
    .setAuthor("Vlad Mihalcea");
 
    entityManager.persist(book);
 
    return book;
});

While the entity is in the detached state, we modify it as follows:

_book.setTitle(
    "High-Performance Java Persistence, 2nd edition"
);

Now, we want to propagate the changes to the database, so we can call the merge method:

doInJPA(entityManager -> {
    Book book = entityManager.merge(_book);
 
    LOGGER.info("Merging the Book entity");
 
    assertFalse(book == _book);
});

And Hibernate is going to execute the following SQL statements:

SELECT
    b.id,
    b.author AS author2_0_,
    b.isbn AS isbn3_0_,
    b.title AS title4_0_
FROM
    book b
WHERE
    b.id = 1
 
-- Merging the Book entity
 
UPDATE
    book
SET
    author = 'Vlad Mihalcea',
    isbn = '978-9730228236',
    title = 'High-Performance Java Persistence, 2nd edition'
WHERE
    id = 1

If the merging entity has no equivalent in the current EntityManager, a fresh entity snapshot will be fetched from the database.

Once there is a managed entity, JPA copies the state of the detached entity onto the one that is currently managed, and during the Persistence Context flush, an UPDATE will be generated if the dirty checking mechanism finds that the managed entity has changed.

So, when using merge, the detached object instance will continue to remain detached even after the merge operation.

Reattaching a detached entity

Hibernate, but not JPA supports reattaching through the update method.

A Hibernate Session can only associate one entity object for a given database row. This is because the Persistence Context acts as an in-memory cache (first level cache) and only one value (entity) is associated with a given key (entity type and database identifier).

An entity can be reattached only if there is no other JVM object (matching the same database row) already associated with the current Hibernate Session.

Considering we have persisted the Book entity and that we modified it when the Book entity was in the detached state:

Book _book = doInJPA(entityManager -> {
    Book book = new Book()
    .setIsbn("978-9730228236")
    .setTitle("High-Performance Java Persistence")
    .setAuthor("Vlad Mihalcea");
 
    entityManager.persist(book);
 
    return book;
});
      
_book.setTitle(
    "High-Performance Java Persistence, 2nd edition"
);

We can reattach the detached entity like this:

doInJPA(entityManager -> {
    Session session = entityManager.unwrap(Session.class);
 
    session.update(_book);
 
    LOGGER.info("Updating the Book entity");
});

And Hibernate will execute the following SQL statement:

-- Updating the Book entity
 
UPDATE
    book
SET
    author = 'Vlad Mihalcea',
    isbn = '978-9730228236',
    title = 'High-Performance Java Persistence, 2nd edition'
WHERE
    id = 1

The update method requires you to unwrap the EntityManager to a Hibernate Session.

Unlike merge, the provided detached entity is going to be reassociated with the current Persistence Context and an UPDATE is scheduled during flush whether the entity has modified or not.

To prevent this, you can use the @SelectBeforeUpdate Hibernate annotation which will trigger a SELECT statement that fetched loaded state which is then used by the dirty checking mechanism.

@Entity(name = "Book")
@Table(name = "book")
@SelectBeforeUpdate
public class Book {
 
    //Code omitted for brevity
}

Beware of the NonUniqueObjectException

One problem that can occur with update is if the Persistence Context already contains an entity reference with the same id and of the same type as in the following example:

Book _book = doInJPA(entityManager -> {
    Book book = new Book()
    .setIsbn("978-9730228236")
    .setTitle("High-Performance Java Persistence")
    .setAuthor("Vlad Mihalcea");
 
    Session session = entityManager.unwrap(Session.class);
    session.saveOrUpdate(book);
 
    return book;
});
 
_book.setTitle(
    "High-Performance Java Persistence, 2nd edition"
);
 
try {
    doInJPA(entityManager -> {
        Book book = entityManager.find(
            Book.class,
            _book.getId()
        );
 
        Session session = entityManager.unwrap(Session.class);
        session.saveOrUpdate(_book);
    });
} catch (NonUniqueObjectException e) {
    LOGGER.error(
        "The Persistence Context cannot hold " +
        "two representations of the same entity",
        e
    );
}

Now, when executing the test case above, Hibernate is going to throw a NonUniqueObjectException because the second EntityManager already contains a Book entity with the same identifier as the one we pass to update, and the Persistence Context cannot hold two representations of the same entity.

org.hibernate.NonUniqueObjectException:
    A different object with the same identifier value was already associated with the session : [com.vladmihalcea.book.hpjp.hibernate.pc.Book#1]
    at org.hibernate.engine.internal.StatefulPersistenceContext.checkUniqueness(StatefulPersistenceContext.java:651)
    at org.hibernate.event.internal.DefaultSaveOrUpdateEventListener.performUpdate(DefaultSaveOrUpdateEventListener.java:284)
    at org.hibernate.event.internal.DefaultSaveOrUpdateEventListener.entityIsDetached(DefaultSaveOrUpdateEventListener.java:227)
    at org.hibernate.event.internal.DefaultSaveOrUpdateEventListener.performSaveOrUpdate(DefaultSaveOrUpdateEventListener.java:92)
    at org.hibernate.event.internal.DefaultSaveOrUpdateEventListener.onSaveOrUpdate(DefaultSaveOrUpdateEventListener.java:73)
    at org.hibernate.internal.SessionImpl.fireSaveOrUpdate(SessionImpl.java:682)
    at org.hibernate.internal.SessionImpl.saveOrUpdate(SessionImpl.java:674)

Conclusion

The merge method is to be preferred if you are using optimistic locking as it allows you to prevent lost updates.

The update is good for batch updates as it can prevent the additional SELECT statement generated by the merge operation, therefore reducing the batch update execution time.

when all else fails I just

<center> content </center>

I know its not "up to standards" any more, but if it works it works

In Laravel 5.1+, you can use the value() instead of pluck.

To get first occurence, You can either use

DB::table('users')->value('name');

or use,

DB::table('users')->where('id', 1)->pluck('name')->first();

ArrayList<String> a = new ArrayList<String>();
a.add( "test" );
@SuppressWarnings( "unused")
Object[] array = a.toArray();

It depends on what you want to achieve if you need to manipulate the array later it would cost more effort than keeping the string in the ArrayList. You have also random access with an ArrayList by list.get( index );

The above mentioned comments are very useful but they are a bit difficult to implement. Below steps you can try, I also tried it and it worked:

1. Download that file from your notebook in PY file format (You can find that option in File tab).
2. Now copy that downloaded file into the working directory of Jupyter Notebook
3. You are now ready to use it. Just import .PY File into the ipynb file

If you have C++11 you can make use of auto.

for (auto it = my_vector.rbegin(); it != my_vector.rend(); ++it)
{
}

Randall, here are the VB expressions I found to work in SSRS to obtain the first and last days of any month, using the current month as a reference:

First day of last month:

=dateadd("m",-1,dateserial(year(Today),month(Today),1)) 

First day of this month:

=dateadd("m",0,dateserial(year(Today),month(Today),1)) 

First day of next month:

=dateadd("m",1,dateserial(year(Today),month(Today),1)) 

Last day of last month:

=dateadd("m",0,dateserial(year(Today),month(Today),0))

Last day of this month:

=dateadd("m",1,dateserial(year(Today),month(Today),0))

Last day of next month:

=dateadd("m",2,dateserial(year(Today),month(Today),0))

The MSDN documentation for the VisualBasic DateSerial(year,month,day) function explains that the function accepts values outside the expected range for the year, month, and day parameters. This allows you to specify useful date-relative values. For instance, a value of 0 for Day means "the last day of the preceding month". It makes sense: that's the day before day 1 of the current month.

For Google travelers: this stupidly unhelpful error message is also presented when you make a type and double up the + regex operator:

Okay:

\w+

Not okay:

\w++

Allowing the execution flow to leave main by returning a value or allowing execution to reach the end of the function is the way a program should terminate except under unrecoverable circumstances. Returning a value is optional in C++, but I typically prefer to return EXIT_SUCCESS found in cstdlib (a platform-specific value that indicates the program executed successfully).

#include <cstdlib>

int main(int argc, char *argv[]) {
  ...
  return EXIT_SUCCESS;
}

If, however, your program reaches an unrecoverable state, it should throw an exception. It's important to realise the implications of doing so, however. There are no widely-accepted best practices for deciding what should or should not be an exception, but there are some general rules you need to be aware of.

For example, throwing an exception from a destructor is nearly always a terrible idea because the object being destroyed might have been destroyed because an exception had already been thrown. If a second exception is thrown, terminate is called and your program will halt without any further clean-up having been performed. You can use uncaught_exception to determine if it's safe, but it's generally better practice to never allow exceptions to leave a destructor.

While it's generally always possible for functions you call but didn't write to throw exceptions (for example, new will throw std::bad_alloc if it can't allocate enough memory), it's often difficult for beginner programmers to keep track of or even know about all of the special rules surrounding exceptions in C++. For this reason, I recommend only using them in situations where there's no sensible way for your program to continue execution.

#include <stdexcept>
#include <cstdlib>
#include <iostream>

int foo(int i) {
  if (i != 5) {
    throw std::runtime_error("foo: i is not 5!");
  }
  return i * 2;
}

int main(int argc, char *argv[]) {
  try {
    foo(3);
  }
  catch (const std::exception &e) {
    std::cout << e.what() << std::endl;
    return EXIT_FAILURE;
  }
  return EXIT_SUCCESS;
}

exit is a hold-over from C and may result in objects with automatic storage to not be cleaned up properly. abort and terminate effectively causes the program to commit suicide and definitely won't clean up resources.

Whatever you do, don't use exceptions, exit, or abort/terminate as a crutch to get around writing a properly structured program. Save them for exceptional situations.

@JustGoscha's answer is spot on, but that's a lot to type when I want access, so I added this to the bottom of my app.js. Then all I have to type is x = getSrv('$http') to get the http service.

// @if DEBUG
function getSrv(name, element) {
    element = element || '*[ng-app]';
    return angular.element(element).injector().get(name);
}
// @endif

It adds it to the global scope but only in debug mode. I put it inside the @if DEBUG so that I don't end up with it in the production code. I use this method to remove debug code from prouduction builds.

You should remove your component manually, that is...

[name].component.ts
[name].component.html  // if you've used templateUrl in your component
[name].component.spec.ts  // if you've created test file
[name].component.[css or scss]  // if you've used styleUrls in your component

If you have all that files in a folder, delete the folder directly.

Then you need to go to the module which use that component and delete

import { [component_name] } from ...

and the component on the declarations array

That's all. Hope that helps

Try Like This: For SQL SERVER 2008+

SELECT c.name AS ColName, t.name AS TableName
FROM sys.columns c
    JOIN sys.tables t ON c.object_id = t.object_id
WHERE c.name LIKE '%MyColumnaName%'

Or

SELECT COLUMN_NAME, TABLE_NAME 
FROM INFORMATION_SCHEMA.COLUMNS 
WHERE COLUMN_NAME LIKE '%MyName%'

Or Something Like This:

SELECT name  
FROM sys.tables 
WHERE OBJECT_ID IN ( SELECT id 
              FROM syscolumns 
              WHERE name like '%COlName%' )

It's not magic.

The behavior of this code in C is described in section 6.7.8.21 of the C specification (online draft of C spec): for the elements that don't have a specified value, the compiler initializes pointers to NULL and arithmetic types to zero (and recursively applies this to aggregates).

The behavior of this code in C++ is described in section 8.5.1.7 of the C++ specification (online draft of C++ spec): the compiler aggregate-initializes the elements that don't have a specified value.

Also, note that in C++ (but not C), you can use an empty initializer list, causing the compiler to aggregate-initialize all of the elements of the array:

char array[100] = {};

As for what sort of code the compiler might generate when you do this, take a look at this question: Strange assembly from array 0-initialization

From Save MySQL query results into a text or CSV file:

MySQL provides an easy mechanism for writing the results of a select statement into a text file on the server. Using extended options of the INTO OUTFILE nomenclature, it is possible to create a comma separated value (CSV) which can be imported into a spreadsheet application such as OpenOffice or Excel or any other application which accepts data in CSV format.

Given a query such as

SELECT order_id,product_name,qty FROM orders

which returns three columns of data, the results can be placed into the file /tmp/orders.txt using the query:

SELECT order_id,product_name,qty FROM orders
INTO OUTFILE '/tmp/orders.txt'

This will create a tab-separated file, each row on its own line. To alter this behavior, it is possible to add modifiers to the query:

SELECT order_id,product_name,qty FROM orders
INTO OUTFILE '/tmp/orders.csv'
FIELDS TERMINATED BY ','
ENCLOSED BY '"'
LINES TERMINATED BY '\n'

In this example, each field will be enclosed in double quotes, the fields will be separated by commas, and each row will be output on a new line separated by a newline (\n). Sample output of this command would look like:

"1","Tech-Recipes sock puppet","14.95" "2","Tech-Recipes chef's hat","18.95"

Keep in mind that the output file must not already exist and that the user MySQL is running as has write permissions to the directory MySQL is attempting to write the file to.

Syntax

   SELECT Your_Column_Name
    FROM Your_Table_Name
    INTO OUTFILE 'Filename.csv'
    FIELDS TERMINATED BY ','
    ENCLOSED BY '"'
    LINES TERMINATED BY '\n'

Or you could try to grab the output via the client:

You could try executing the query from the your local client and redirect the output to a local file destination:

mysql -user -pass -e "select cols from table where cols not null" > /tmp/output

Hint: If you don't specify an absoulte path but use something like INTO OUTFILE 'output.csv' or INTO OUTFILE './output.csv', it will store the output file to the directory specified by show variables like 'datadir';.

I've been loving Memory Validator, from a company called Software Verification.

There are two options to debug or get output of your react native application when using

Emulator or Real Device

For First Using Emulator: use

react-native log-android or react-native log-ios

to get the log output

on real device.shake your device

so the menu will come from where you select remote debug and it will open this screen in your browser. so you can see your log output in console tab.

Currently I'm using this solution:

$firstDay = new \DateTime('first day of this month');
$lastDay = new \DateTime('last day of this month');

The only issue I came upon is that strange time is being set. I needed correct range for our search interface and I ended up with this:

$firstDay = new \DateTime('first day of this month 00:00:00');
$lastDay = new \DateTime('first day of next month 00:00:00');

Well the first can be achieved with the document.ready function in jquery

$(document).ready(function(){...});

The changing image can be achieved with any number of plugins

• http://malsup.com/jquery/cycle/
• http://www.matto1990.com/jquery/slideshow/

If you wish you can check if images are loaded with the complete property. I know that at least the malsup jquery cycle slideshow makes use of this function internally.

bootstrap 3 has a class to align the text within a div

<div class="text-right">

will align the text on the right

<div class="pull-right">

will pull to the right all the content not only the text

I am going to add another answer here, because I have come up with a different approach to my previous one, and that is to use locale facets.

The basics are here

Essentially what you do is:

1. Create a class that derives from std::locale::facet. The slight downside is that you will need a compilation unit somewhere to hold its id. Let's call it MyPrettyVectorPrinter. You'd probably give it a better name, and also create ones for pair and map.
2. In your stream function, you check std::has_facet< MyPrettyVectorPrinter >
3. If that returns true, extract it with std::use_facet< MyPrettyVectorPrinter >( os.getloc() )
4. Your facet objects will have values for the delimiters and you can read them. If the facet isn't found, your print function (operator<<) provides default ones. Note you can do the same thing for reading a vector.

I like this method because you can use a default print whilst still being able to use a custom override.

The downsides are needing a library for your facet if used in multiple projects (so can't just be headers-only) and also the fact that you need to beware about the expense of creating a new locale object.

I have written this as a new solution rather than modify my other one because I believe both approaches can be correct and you take your pick.

Simple reinstall xcode-select

sudo rm -rf /Library/Developer/CommandLineTools
xcode-select --install

public class GenerateEncryptedPassword {

    public static void main(String[] args){

        Scanner sc= new Scanner(System.in);    
        System.out.println("Please enter the password that needs to be encrypted :");
        String input = sc.next();

        try {
            String encryptedPassword= AESencrp.encrypt(input);
            System.out.println("Encrypted password generated is :"+encryptedPassword);
        } catch (Exception ex) {
            Logger.getLogger(GenerateEncryptedPassword.class.getName()).log(Level.SEVERE, null, ex);
        }
    }
}

I have a similar request from a client who wants to have the header, page numbers, and html footer removed. In this case, the client is presenting an HTML page that can double as a formal certificate. The added URL, page, and, header, are irrelevant and lead to a less-than-pleasing final product. In some ways, it just looks cheap.

Media=Print has not been able to disable these browser defaults. The only workaround is to tell the user to click the "Gear" button and toggle those items on/off. Seriously, I had no idea I could do that for 20 years (and we think the typical user will have a clue to click the toggle button?).

If CSS supports Media=Print, it should support the ability to control the entire end-user print experience. I appreciate that the browsers provide the added fields, but, why not allow CSS to control the overall print experience-if that is what's desired. A 90% solution could be 100% with three more fields! A simple:

#BrowserPrintDefaults{display:none} 

would suffice.

Again, it's not a matter whether or not the end-user wants to print it out or not (maybe your client is very private and doesn't want printed URLs floating around. Or maybe a executive team uses a private collaboration sites?). Glad to defend the end-user, but if somebody is seeking an answer, don't respond saying it's the right of the end-user to show or hide. Sometimes it's the right of the client paying the bills.

I am combining the solutions from answers of @FredFoo and @Renaud. My solution is able to apply @Renaud's preprocessing on the text corpus of @FredFoo and then display pairwise similarities where the similarity is greater than 0. I ran this code on Windows by installing python and pip first. pip is installed as part of python but you may have to explicitly do it by re-running the installation package, choosing modify and then choosing pip. I use the command line to execute my python code saved in a file "similarity.py". I had to execute the following commands:

>set PYTHONPATH=%PYTHONPATH%;C:\_location_of_python_lib_
>python -m pip install sklearn
>python -m pip install nltk
>py similarity.py

The code for similarity.py is as follows:

from sklearn.feature_extraction.text import TfidfVectorizer
import nltk, string
import numpy as np
nltk.download('punkt') # if necessary...

stemmer = nltk.stem.porter.PorterStemmer()
remove_punctuation_map = dict((ord(char), None) for char in string.punctuation)

def stem_tokens(tokens):
    return [stemmer.stem(item) for item in tokens]

def normalize(text):
    return stem_tokens(nltk.word_tokenize(text.lower().translate(remove_punctuation_map)))

corpus = ["I'd like an apple", 
           "An apple a day keeps the doctor away", 
           "Never compare an apple to an orange", 
           "I prefer scikit-learn to Orange", 
           "The scikit-learn docs are Orange and Blue"]  

vect = TfidfVectorizer(tokenizer=normalize, stop_words='english')
tfidf = vect.fit_transform(corpus)   
                                                                                                                                                                                                                    
pairwise_similarity = tfidf * tfidf.T

#view the pairwise similarities 
print(pairwise_similarity)

#check how a string is normalized
print(normalize("The scikit-learn docs are Orange and Blue"))

We can also add checks like this:

function parseData(data) {
    if (!data) return {};
    if (typeof data === 'object') return data;
    if (typeof data === 'string') return JSON.parse(data);

    return {};
}

long visitors =1000;

int convVisitors =(int)visitors;

HTML

<!DOCTYPE html>
<html>
    <head>
        <title>Center</title>        
    </head>
    <body>
        <div id="main_body">
          some text
        </div>
    </body>
</html>

CSS

body
{
   width: 100%;
   Height: 100%;
}
#main_body
{
    background: #ff3333;
    width: 200px;
    position: absolute;
}?

JS ( jQuery )

$(function(){
    var windowHeight = $(window).height();
    var windowWidth = $(window).width();
    var main = $("#main_body");    
    $("#main_body").css({ top: ((windowHeight / 2) - (main.height() / 2)) + "px",
                          left:((windowWidth / 2) - (main.width() / 2)) + "px" });
});

See example here

In addition to what Allan did, adding missing classes, I followed @emdog4's solution and added the Core Data library by going to Build Phases in Xcode and under the 'Link Binary with Libraries' clicking on the + and selecting the 'CoreData.framework'. This sorted out my error

The answer is to use a JSONArray as well, and to dive "deep" into the tree structure:

JSONArray arr = new JSONArray();
arr.put (...); // a new JSONObject()
arr.put (...); // a new JSONObject()

JSONObject json = new JSONObject();
json.put ("aoColumnDefs",arr);

Maybe your mobile view port is not set. Add following meta tag inside <head></head> to allow menu to work on mobiles.

<meta name=viewport content="width=device-width, initial-scale=1">

Using max(date) didn't solve my problem as there is no assurance that other columns will be from the same row as the max(date) is. Instead of that this one solved my problem and sorted group by in a correct order and values of other columns are from the same row as the max date is:

SELECT model, date 
FROM (SELECT * FROM doc ORDER BY date DESC) as sortedTable
GROUP BY model

I submit that it is better to leave your data stacked as it is:

df = pandas.DataFrame(data, columns=['R_Number', 'C_Number', 'Avg', 'Std'])

# Possibly also this if these can always be the indexes:
# df = df.set_index(['R_Number', 'C_Number'])

Then it's a bit more intuitive to say

df.set_index(['R_Number', 'C_Number']).Avg.unstack(level=1)

This way it is implicit that you're seeking to reshape the averages, or the standard deviations. Whereas, just using pivot, it's purely based on column convention as to what semantic entity it is that you are reshaping.

Out of all the code samples I've used to get the height of the status bar, the only one that actually appears to work in the onCreate method of an Activity is this:

public int getStatusBarHeight() {
    int result = 0;
    int resourceId = getResources().getIdentifier("status_bar_height", "dimen", "android");
    if (resourceId > 0) {
        result = getResources().getDimensionPixelSize(resourceId);
    }
    return result;
}

Apparently the actual height of the status bar is kept as an Android resource. The above code can be added to a ContextWrapper class (e.g. an Activity).

Found at http://mrtn.me/blog/2012/03/17/get-the-height-of-the-status-bar-in-android/

Sometimes "Nothing to be done for all" error can be caused by spaces before command in makefile rule instead of tab. Please ensure that you use tabs instead of spaces inside of your rules.

all:
<\t>$(CC) $(CFLAGS) ...

instead of

all:
    $(CC) $(CFLAGS) ...

Please see the GNU make manual for the rule syntax description: https://www.gnu.org/software/make/manual/make.html#Rule-Syntax

The jQuery UI sortable feature includes a serialize method to do this. It's quite simple, really. Here's a quick example that sends the data to the specified URL as soon as an element has changes position.

$('#element').sortable({
    axis: 'y',
    update: function (event, ui) {
        var data = $(this).sortable('serialize');

        // POST to server using $.post or $.ajax
        $.ajax({
            data: data,
            type: 'POST',
            url: '/your/url/here'
        });
    }
});

What this does is that it creates an array of the elements using the elements id. So, I usually do something like this:

<ul id="sortable">
   <li id="item-1"></li>
   <li id="item-2"></li>
   ...
</ul>

When you use the serialize option, it will create a POST query string like this: item[]=1&item[]=2 etc. So if you make use - for example - your database IDs in the id attribute, you can then simply iterate through the POSTed array and update the elements' positions accordingly.

For example, in PHP:

$i = 0;

foreach ($_POST['item'] as $value) {
    // Execute statement:
    // UPDATE [Table] SET [Position] = $i WHERE [EntityId] = $value
    $i++;
}

Example on jsFiddle.

The <footer> tag seems like a good candidate:

<footer>&copy; 2011 Some copyright message</footer>

Query in Parado's answer is correct, if you want to use MySql too instead GETDATE() you must use (because you've tagged this question with Sql server and Mysql):

select * from tab
where DateCol between adddate(now(),-7) and now() 

You have to do two things:

• be sure to have imported right appcompat-v7 library in your project structure -> dependencies
• change the theme in the preview window to not an AppCompat theme. Try with Holo.light or Holo.dark for example.

With ES8 you could also use padStart or padEnd for this. eg.

var str = 'cat';
var num = 23;
var size = str.length * num;
"".padStart(size, str) // outputs: 'catcatcatcatcatcatcatcatcatcatcatcatcatcatcatcatcatcatcatcatcatcatcat'

I find the simple solution

pylab.ticklabel_format(axis='y',style='sci',scilimits=(1,4))

I found a solution in case you have installed Eclipse(Luna) with the SVN Client JavaHL(JNI) 1.8.13 and Tortoise:

Open Eclipse: First try to add the project / maven module to Version Control (Project -> Context Menu -> Team -> Add to Version Control)

You will see the following Eclipse error message:

org.apache.subversion.javahl.ClientException: Entry already exists svn: 'PathToYouProject' is already under version control

After that you have to open your workspace directory in your explorer, select your project and resolve it via Tortoise (Project -> Context Menu -> TortoiseSVN -> Resolve)

You will see the following message dialog: "File list is empty"

Press cancel and refresh the project in Eclipse. Your project should be under version control again.

Unfortunately it is not possible to resolve more the one project at the same time ... you don't have to delete anything but depending on the size of your project it could be a little bit laborious.

Just searched for the docs, and found this:

Containment Operator: The in operator performs containment test. It returns true if the left operand is contained in the right:

{# returns true #}

{{ 1 in [1, 2, 3] }}

{{ 'cd' in 'abcde' }}

The error "only length-1 arrays can be converted to Python scalars" is raised when the function expects a single value but you pass an array instead.

If you look at the call signature of np.int, you'll see that it accepts a single value, not an array. In general, if you want to apply a function that accepts a single element to every element in an array, you can use np.vectorize:

import numpy as np
import matplotlib.pyplot as plt

def f(x):
    return np.int(x)
f2 = np.vectorize(f)
x = np.arange(1, 15.1, 0.1)
plt.plot(x, f2(x))
plt.show()

You can skip the definition of f(x) and just pass np.int to the vectorize function: f2 = np.vectorize(np.int).

Note that np.vectorize is just a convenience function and basically a for loop. That will be inefficient over large arrays. Whenever you have the possibility, use truly vectorized functions or methods (like astype(int) as @FFT suggests).

Try this, it works for both node and the browser.

isNode = (typeof exports !== 'undefined') &&
(typeof module !== 'undefined') &&
(typeof module.exports !== 'undefined') &&
(typeof navigator === 'undefined' || typeof navigator.appName === 'undefined') ? true : false,
asyncIt = (isNode ? function (func) {
  process.nextTick(function () {
    func();
  });
} : function (func) {
  setTimeout(func, 5);
});

A better way: custom template filter: https://docs.djangoproject.com/en/dev/howto/custom-template-tags/

such as get my_list[x] in templates:

in template

{% load index %}
{{ my_list|index:x }}

templatetags/index.py

from django import template
register = template.Library()

@register.filter
def index(indexable, i):
    return indexable[i]

if my_list = [['a','b','c'], ['d','e','f']], you can use {{ my_list|index:x|index:y }} in template to get my_list[x][y]

It works fine with "for"

{{ my_list|index:forloop.counter0 }}

Tested and works well ^_^

I had this problem as well. My issue was this file:

/usr/ssl/certs/ca-bundle.crt

is by default just an empty file. So even if it exists, youll still get the error as it doesnt contain any certificates. You can generate them like this:

p11-kit extract --overwrite --format pem-bundle /usr/ssl/certs/ca-bundle.crt

https://github.com/msys2/MSYS2-packages/blob/master/ca-certificates/ca-certificates.install

If you're just needing the path of the MDB currently open in the Access UI, I'd suggest writing a function that parses CurrentDB.Name and then stores the result in a Static variable inside the function. Something like this:

Public Function CurrentPath() As String
  Dim strCurrentDBName As String
  Static strPath As String
  Dim i As Integer

  If Len(strPath) = 0 Then
     strCurrentDBName = CurrentDb.Name
     For i = Len(strCurrentDBName) To 1 Step -1
       If Mid(strCurrentDBName, i, 1) = "\" Then
          strPath = Left(strCurrentDBName, i)
          Exit For
       End If
    Next
  End If
  CurrentPath = strPath
End Function

This has the advantage that it only loops through the name one time.

Of course, it only works with the file that's open in the user interface.

Another way to write this would be to use the functions provided at the link inside the function above, thus:

Public Function CurrentPath() As String
  Static strPath As String

  If Len(strPath) = 0 Then
     strPath = FolderFromPath(CurrentDB.Name)
  End If
  CurrentPath = strPath
End Function

This makes retrieving the current path very efficient while utilizing code that can be used for finding the path for any filename/path.

In Jenkins 2.60.3 there is a way to delete build artifacts (not the archived artifacts) in order to save hard drive space on the build machine. In the General section, check "Discard old builds" with strategy "Log Rotation" and then go into its Advanced options. Two more options will appear related to keeping build artifacts for the job based on number of days or builds.

The settings that work for me are to enter 1 for "Max # of builds to keep with artifacts" and then to have a post-build action to archive the artifacts. This way, all artifacts from all builds will be archived, all information from builds will be saved, but only the last build will keep its own artifacts.

Discard old builds options

You can create a hidden textbox with a value of 0. Put the onLoad() code in a if block that checks to make sure the hidden text box value is 0. if it is execute the code and set the textbox value to 1.

Xcopy exit code 4 means "Initialization error occurred. There is not enough memory or disk space, or you entered an invalid drive name or invalid syntax on the command line."

It looks like Visual Studio is supplying invalid arguments to xcopy. Check your post-build event command via Project > Right Click > Properties > Build Events > Post Build Event.

Note that if the $(ProjectDir) or similar macro terms have spaces in the resulting paths when expanded, then they will need to be wrapped in double quotes. For example:

xcopy "$(ProjectDir)Library\dsoframer.ocx" "$(TargetDir)" /Y /E /D1

For PyTorch v1.0 and possibly above:

>>> import torch
>>> var = torch.tensor([[1,0], [0,1]])

# Using .size function, returns a torch.Size object.
>>> var.size()
torch.Size([2, 2])
>>> type(var.size())
<class 'torch.Size'>

# Similarly, using .shape
>>> var.shape
torch.Size([2, 2])
>>> type(var.shape)
<class 'torch.Size'>

You can cast any torch.Size object to a native Python list:

>>> list(var.size())
[2, 2]
>>> type(list(var.size()))
<class 'list'>

In PyTorch v0.3 and 0.4:

Simply list(var.size()), e.g.:

>>> import torch
>>> from torch.autograd import Variable
>>> from torch import IntTensor
>>> var = Variable(IntTensor([[1,0],[0,1]]))

>>> var
Variable containing:
 1  0
 0  1
[torch.IntTensor of size 2x2]

>>> var.size()
torch.Size([2, 2])

>>> list(var.size())
[2, 2]

Try that:

export PATH=/usr/local/bin:$PATH

You can use the below lines

$('#GridName').data('kendoGrid').dataSource.read();
$('#GridName').data('kendoGrid').refresh();

For a auto refresh feature have a look here

Query Analyzer buffers messages. The PRINT and RAISERROR statements both use this buffer, but the RAISERROR statement has a WITH NOWAIT option. To print a message immediately use the following:

RAISERROR ('Your message', 0, 1) WITH NOWAIT

RAISERROR will only display 400 characters of your message and uses a syntax similar to the C printf function for formatting text.

Please note that the use of RAISERROR with the WITH NOWAIT option will flush the message buffer, so all previously buffered information will be output also.

if you use an assignment operator but use it in wrong way or in wrong place, then you'll get this types of errors!

suppose if you type:
p+1=p; you will get the error!!

you will get the same error for this:
if(ch>='a' && ch='z')
as you see can see that I i tried to assign in if() statement!!!
how silly I am!!! right??
ha ha
actually i forgot to give less then(<) sign
if(ch>='a' && ch<='z')
and got the error!!

I used the answer by @Spenhouet and added more "replacements"-possibilities than "*". For example "?". Just add your needs to the dict in replaceHelper.

/**
 * @param {string} str
 * @param {string} rule
 * checks match a string to a rule
 * Rule allows * as zero to unlimited numbers and ? as zero to one character
 * @returns {boolean}
 */
function matchRule(str, rule) {
  const escapeRegex = (str) => str.replace(/([.*+?^=!:${}()|\[\]\/\\])/g, "\\$1");
  return new RegExp("^" + replaceHelper(rule, {"*": "\\d*", "?": ".?"}, escapeRegex) + "$").test(str);
}

function replaceHelper(input, replace_dict, last_map) {
  if (Object.keys(replace_dict).length === 0) {
    return last_map(input);
  }
  const split_by = Object.keys(replace_dict)[0];
  const replace_with = replace_dict[split_by];
  delete replace_dict[split_by];
  return input.split(split_by).map((next_input) => replaceHelper(next_input, replace_dict, last_map)).join(replace_with);
}

If they are in the same controller class, it would be:

foreach ( $characters as $character) {
    $num += $this->getFactorial($index) * $index;
    $index ++;
}

Otherwise you need to create a new instance of the class, and call the method, ie:

$controller = new MyController();
foreach ( $characters as $character) {
    $num += $controller->getFactorial($index) * $index;
    $index ++;
}

You will get better performance in production if you set config.assets.compile to false in production.rb and precompile your assets. You can precompile with this rake task:

bundle exec rake assets:precompile

If you are using Capistrano, version 2.8.0 has a recipe to handle this at deploy time. For more info, see the "In Production" section of the Asset Pipeline Guide: http://guides.rubyonrails.org/asset_pipeline.html

Here is an example for VueJS

index.page

<template>
  <div>
    <div ref="topScroll" class="top-scroll" @scroll.passive="handleScroll">
      <div
        :style="{
          width: `${contentWidth}px`,
          height: '12px'
        }"
      />
    </div>
    <div ref="content" class="content" @scroll.passive="handleScroll">
      <div
        :style="{
          width: `${contentWidth}px`
        }"
      >
        Lorem ipsum dolor sit amet, ipsum dictum vulputate molestie id magna,
        nunc laoreet maecenas, molestie ipsum donec lectus ut et sit, aut ut ut
        viverra vivamus mollis in, integer diam purus penatibus. Augue consequat
        quis phasellus non, congue tristique ac arcu cras ligula congue, elit
        hendrerit lectus faucibus arcu ligula a, id hendrerit dolor nec nec
        placerat. Vel ornare tincidunt tincidunt, erat amet mollis quisque, odio
        cursus gravida libero aliquam duis, dolor sed nulla dignissim praesent
        erat, voluptatem pede aliquam. Ut et tellus mi fermentum varius, feugiat
        nullam nunc ultrices, ullamcorper pede, nunc vestibulum, scelerisque
        nunc lectus integer. Nec id scelerisque vestibulum, elit sit, cursus
        neque varius. Fusce in, nunc donec, volutpat mauris wisi sem, non
        sapien. Pellentesque nisl, lectus eros hendrerit dui. In metus aptent
        consectetuer, sociosqu massa mus fermentum mauris dis, donec erat nunc
        orci.
      </div>
    </div>
  </div>
</template>

<script>
export default {
  data() {
    return {
      contentWidth: 1000
    }
  },
  methods: {
    handleScroll(event) {
      if (event.target._prevClass === 'content') {
        this.$refs.topScroll.scrollLeft = this.$refs.content.scrollLeft
      } else {
        this.$refs.content.scrollLeft = this.$refs.topScroll.scrollLeft
      }
    }
  }
}
</script>

<style lang="scss" scoped>
.top-scroll,
.content {
  overflow: auto;
  max-width: 100%;
}
.top-scroll {
  margin-top: 50px;
}
</style>

TAKE NOTE on the height: 12px.. I made it 12px so it will be noticed on Mac Users as well. But w/ windows, 0.1px is good enough

Pattern module in not available from django 1.8. So you need to remove pattern from your import and do something similar to the following:

from django.conf.urls import include, url
from django.contrib import admin

admin.autodiscover()

urlpatterns = [                 
    # here we are not using pattern module like in previous django versions
    url(r'^admin/', include(admin.site.urls)),
]

You can set this at boot by adding the "elevator" parameter to the kernel cmdline (such as in grub.cfg)

Example:

elevator=deadline

This will make "deadline" the default I/O scheduler for all block devices.

If you'd like to query or change the scheduler after the system has booted, or would like to use a different scheduler for a specific block device, I recommend installing and use the tool ioschedset to make this easy.

https://github.com/kata198/ioschedset

If you're on Archlinux it's available in aur:

https://aur.archlinux.org/packages/ioschedset

Some example usage:

# Get i/o scheduler for all block devices
[username@hostname ~]$ io-get-sched
sda:    bfq
sr0:    bfq

# Query available I/O schedulers
[username@hostname ~]$ io-set-sched --list
mq-deadline kyber bfq none

# Set sda to use "kyber"
[username@hostname ~]$ io-set-sched kyber /dev/sda
Must be root to set IO Scheduler. Rerunning under sudo...

[sudo] password for username:
+ Successfully set sda to 'kyber'!

# Get i/o scheduler for all block devices to assert change
[username@hostname ~]$ io-get-sched
sda:    kyber
sr0:    bfq

# Set all block devices to use 'deadline' i/o scheduler
[username@hostname ~]$ io-set-sched deadline
Must be root to set IO Scheduler. Rerunning under sudo...

+ Successfully set sda to 'deadline'!
+ Successfully set sr0 to 'deadline'!

# Get the current block scheduler just for sda
[username@hostname ~]$ io-get-sched sda
sda:    mq-deadline

Usage should be self-explanatory. The tools are standalone and only require bash.

Hope this helps!

EDIT: Disclaimer, these are scripts I wrote.

This approach from Microsoft works very well and provides the option to compare one list to another and switch them to get the difference in each. If you are comparing classes simply add your objects to two separate lists and then run the comparison.

http://msdn.microsoft.com/en-us/library/bb397894.aspx

I committed the container into a docker image. Then I recreate another container using this docker image and the problem was gone.

Another easy option to show Dialog is to use stacked_services package

 _dialogService.showDialog(
      title: "Title",
      description: "Dialog message Tex",
         );
     });

Check the localhost_yyyy_mm_dd.log OR localhost.yyyy-mm-dd.log logs that Tomcat creates, these typically store that type of info. I wouldn't expect the full stacktrace to be dumped to standard out.

I found that the easiest way is:

1. Add an Icon file into your WinForms project.
2. Change the icon files' build action into Embedded Resource

3. In the Main Form Load function:

   Icon = LoadIcon("< the file name of that icon file >");

It's not possible to save content to the website using only client-side scripting such as JavaScript and jQuery, but by submitting the data in an AJAX POST request you could perform the other half very easily on the server-side.

However, I would not recommend having raw content such as scripts so easily writeable to your hosting as this could easily be exploited. If you want to learn more about AJAX POST requests, you can read the jQuery API page:

http://api.jquery.com/jQuery.post/

And here are some things you ought to be aware of if you still want to save raw script files on your hosting. You have to be very careful with security if you are handling files like this!

File uploading (most of this applies if sending plain text too if javascript can choose the name of the file) http://www.developershome.com/wap/wapUpload/wap_upload.asp?page=security https://www.owasp.org/index.php/Unrestricted_File_Upload

another method:

@echo off

for /f "useback delims=" %%_ in (%0) do (
  if "%%_"=="___ATAD___" set $=
  if defined $ echo(%%_
  if "%%_"=="___DATA___" set $=1
)
pause
goto :eof

___DATA___
<?xml version="1.0" encoding="utf-8" ?>
 <root>
   <data id="1">
      hello world
   </data>
 </root>
___ATAD___


rem # 
rem # 

hi this is my suggestion

 .......
var t = Task.Run(async () => await Task.Delay(TimeSpan.FromSeconds(Consts.FiveHundred)).ConfigureAwait(false));
                //just to wait task is done
                t.Wait();

keep in mind put the "wait" otherwise the Delay run without affect application

cast(str_column as int)

From: Language manual UDFs - type conversion functions

That actually depends on what you're looking for.

• If you want to test whether a sequence is actually a ndarray, a isinstance(..., np.ndarray) is probably the easiest. Make sure you don't reload numpy in the background as the module may be different, but otherwise, you should be OK. MaskedArrays, matrix, recarray are all subclasses of ndarray, so you should be set.
• If you want to test whether a scalar is a numpy scalar, things get a bit more complicated. You could check whether it has a shape and a dtype attribute. You can compare its dtype to the basic dtypes, whose list you can find in np.core.numerictypes.genericTypeRank. Note that the elements of this list are strings, so you'd have to do a tested.dtype is np.dtype(an_element_of_the_list)...

You could put your items into a set. Set lookups are very efficient.

Try:

s = set(a)
if 7 in s:
  # do stuff

edit In a comment you say that you'd like to get the index of the element. Unfortunately, sets have no notion of element position. An alternative is to pre-sort your list and then use binary search every time you need to find an element.

var str = "123, 124, 234,252";
var arr = str.split(",");
for(var i=0;i<arr.length;i++) {
    arr[i] = ++arr[i];
}

Array.prototype.map() index:

One can access the index Array.prototype.map() via the second argument of the callback function. Here is an example:

const array = [1, 2, 3, 4];_x000D_
_x000D_
_x000D_
const map = array.map((x, index) => {_x000D_
  console.log(index);_x000D_
  return x + index;_x000D_
});_x000D_
_x000D_
console.log(map);

Other arguments of Array.prototype.map():

• The third argument of the callback function exposes the array on which map was called upon
• The second argument of Array.map() is a object which will be the this value for the callback function. Keep in mind that you have to use the regular function keyword in order to declare the callback since an arrow function doesn't have its own binding to the this keyword.

For example:

const array = [1, 2, 3, 4];_x000D_
_x000D_
const thisObj = {prop1: 1}_x000D_
_x000D_
_x000D_
const map = array.map( function (x, index, array) {_x000D_
  console.log(array);_x000D_
  console.log(this)_x000D_
}, thisObj);

A foreign key with a cascade delete means that if a record in the parent table is deleted, then the corresponding records in the child table will automatically be deleted. This is called a cascade delete.

You are saying in a opposite way, this is not that when you delete from child table then records will be deleted from parent table.

UPDATE 1:

ON DELETE CASCADE option is to specify whether you want rows deleted in a child table when corresponding rows are deleted in the parent table. If you do not specify cascading deletes, the default behaviour of the database server prevents you from deleting data in a table if other tables reference it.

If you specify this option, later when you delete a row in the parent table, the database server also deletes any rows associated with that row (foreign keys) in a child table. The principal advantage to the cascading-deletes feature is that it allows you to reduce the quantity of SQL statements you need to perform delete actions.

So it's all about what will happen when you delete rows from Parent table not from child table.

So in your case when user removes entries from CATs table then rows will be deleted from books table. :)

Hope this helps you :)

The accepted answer offers a solution which requires changing of the underlying data frame. This is not necessary. One can also simply factorise within the aes() call directly or create a vector for that instead.

This is certainly not much different than user Drew Steen's answer, but with the important difference of not changing the original data frame.

level_order <- c('virginica', 'versicolor', 'setosa') #this vector might be useful for other plots/analyses

ggplot(iris, aes(x = factor(Species, level = level_order), y = Petal.Width)) + geom_col()

or

level_order <- factor(iris$Species, level = c('virginica', 'versicolor', 'setosa'))

ggplot(iris, aes(x = level_order, y = Petal.Width)) + geom_col()

or
directly in the aes() call without a pre-created vector:

ggplot(iris, aes(x = factor(Species, level = c('virginica', 'versicolor', 'setosa')), y = Petal.Width)) + geom_col()

Regex for minimum 8 char, one alpha, one numeric and one special char:

/^(?=.*[A-Za-z])(?=.*\d)(?=.*[!@#$%^&*])[A-Za-z\d!@#$%^&*]{8,}$/

To Summarize all of these, just keep one thing in your mind that everything except footer should have min-height: 100% or little less.

a['Names'].str.contains('Mel') will return an indicator vector of boolean values of size len(BabyDataSet)

Therefore, you can use

mel_count=a['Names'].str.contains('Mel').sum()
if mel_count>0:
    print ("There are {m} Mels".format(m=mel_count))

Or any(), if you don't care how many records match your query

if a['Names'].str.contains('Mel').any():
    print ("Mel is there")

Case Preservation

URLs are case-preserving, between client and server. But portions of URLs may or may not be case-sensitive, depending on the server, for a couple of reasons.

Case Sensitivity

The following bold parts of URLs may be case-sensitive, depending on the site and/or server configuration.

    http:// www. example.com /abc/def.ghi?jkl=mno#pqr

    user @ example.com

Rationale

Case-sensitivity in URLs can have several uses. Mainly:

1. Native compatibility with case-sensitive filesystems.
2. More compact data encoding within URLs, such as for serialization, hashing, IDs, permalinks, and URL shorteners.

As a developer, I believe the above can often be handled in better ways, but I also understand there are cases where a situation may not permit this.

For example, imagine an existing product that requires a lot of data placed in the "GET" URL, yet it must be compatible with the maximum URL lengths of all major servers, browsers, and caching/proxy mechanisms. To fit even a moderate-length command string (under 1,024 characters for some older browsers), you'd need to use every unique URL-safe character you could (which is basically what base64url encoding is).

In an Ideal World

Whether or not URLs should be case-sensitive is debatable. I personally believe they should not be, for simplicity (though it may create longer URLs, we have percent-escapes to easily handle cases where we must ensure preservation of exact characters, and there are ways to transfer data other than right in the URL).

Many seem to agree based on the fact that case-insensitive URLs are explicitly enabled for many popular sites and services, in order to increase usability. The most prominent example is the username portion of email addresses. Most email providers will ignore case and sometimes even dots and other symbols (like "[email protected]" being the same as "[email protected]"). Even though email usernames are case-sensitive by default, according to spec.

However, the fact is that despite what I or others might want, this is the state of how things currently work. And while an eventual worldwide transition to a case-insensitive URL standard is certainly possible, it would likely take quite a long time since case-sensitivity is currently used extensively around the web for various purposes.

Best Practices

As far as best practices go, as a user you can reasonably stick to lowercase for most situations and expect things to work. The main exceptions would be URLs that use case-based encoding or document paths with direct filesystem equivalents. However, such complex URLs are typically copy-pasted (or simply clicked) rather than manually typed.

As a web developer, you should consider keeping URLs as case-insensitive as possible. Though there are clearly some difficult-to-avoid situations, depending on context, as noted above.

just change the access permission, where the particular package is going to install.

In my case windows10:

• goto "C:\Program Files (x86)\Python37"
• right click on Python37 folder and click on properties
• goto Security tab and allow full control by clicking edit button.
• again open new cmd terminal and try to install the package again.

I had a similar problem. I created a new repository, NOT IN THE DIRECTORY THAT I WANTED TO MAKE A REPOSITORY. I then copied the files created to the directory I wanted to make a repository. Then open an existing repository using the directory I just copied the files to.

NOTE: I did use github desktop to make and open exiting repository.

Try This:

namespace SplashScreen
{
    public partial class frmSplashScreen : Form
    {
        public frmSplashScreen()
        {
            InitializeComponent();
        }

        public int LeftTime { get; set; }

        private void frmSplashScreen_Load(object sender, EventArgs e)
        {
            LeftTime = 20;
            timer1.Start();
        }

        private void timer1_Tick(object sender, EventArgs e)
        {
            if (LeftTime > 0)
            {
                LeftTime--;
            }
            else
            {
                timer1.Stop();
                new frmHomeScreen().Show();
                this.Hide();
            }
        }
    }
}

if your using default toolbar then you can add this line of code

Objects.requireNonNull(getSupportActionBar()).setDisplayShowTitleEnabled(false);

I share my solution (assuming everything is already configured to connect to google bucket in flask)

from google.cloud import storage

@app.route('/upload/', methods=['POST'])
def upload():
    if request.method == 'POST':
        # FileStorage object wrapper
        file = request.files["file"]                    
        if file:
            os.environ["GOOGLE_APPLICATION_CREDENTIALS"] = app.config['GOOGLE_APPLICATION_CREDENTIALS']
            bucket_name = "bucket_name" 
            storage_client = storage.Client()
            bucket = storage_client.bucket(bucket_name)
            # Upload file to Google Bucket
            blob = bucket.blob(file.filename) 
            blob.upload_from_string(file.read())

My post

Direct to Google Bucket in flask

btnDisplay.setOnClickListener(new OnClickListener() {

    @Override
    public void onClick(View v) {

            // get selected radio button from radioGroup
        int selectedId = radioSexGroup.getCheckedRadioButtonId();

        // find the radiobutton by returned id
            radioSexButton = (RadioButton) findViewById(selectedId);

        Toast.makeText(MyAndroidAppActivity.this,
            radioSexButton.getText(), Toast.LENGTH_SHORT).show();

    }

});

You want xdebug I think. Install it on the server, turn it on, pump the output through kcachegrind (for linux) or wincachegrind (for windows) and it'll show you a few pretty charts that detail the exact timings, counts and memory usage (but you'll need another extension for that).

It rocks, seriously :D

Just Remove the extension .txt from Dockerfile and run the command

docker build -t image-name 

It will work for sure.

Currently working with Entity Framework Core 3.1.3. None of the above solutions fixed my issue.

However, installing the package Microsoft.EntityFrameworkCore.Proxies on my project fixed the issue. Now I can access the UseLazyLoadingProxies() method call when setting my DBContext options.

Hope this helps someone. See the following article:

Lazy Loading in EF Core

A lot of correct answers here. However, one item is missing and I wasn't able to run the emulator from the command line without it.

export JAVA_HOME=$(/usr/libexec/java_home)
export PATH=$PATH:$JAVA_HOME/bin

export ANDROID_HOME=$HOME/Library/Android/sdk
export PATH=$PATH:$ANDROID_HOME/emulator       # can't run emulator without it
export PATH=$PATH:$ANDROID_HOME/tools
export PATH=$PATH:$ANDROID_HOME/platform-tools

So it's a compilation of the answers above plus a solution for this problem.

And if you use zsh (instead of bash) the file to edit is ~/.zshrc.

You were just missing an image tag to change the "src" attribute of:

    <html>
<body>
<form>
<input type="text" value="" id="imagename">
<input type="button" onclick="document.getElementById('img1').src =          'http://webpage.com/images/' + document.getElementById('imagename').value +'.png'"     value="GO">
<br/>
<img id="img1" src="defaultimage.png" />
</form>
</body>
</html>

I have resolved it , this way

import java.text.DateFormat;
import java.text.ParseException;
import java.text.SimpleDateFormat;
import java.util.Date;
import java.util.Locale;

public class DateParser {

    public static void main(String args[]) throws Exception {

        DateParser dateParser = new DateParser();

        String str = dateParser.getparsedDate("2012-11-17T00:00:00.000-05:00");
        System.out.println(str);
    }


    private String getparsedDate(String date) throws Exception {
        DateFormat sdf = new SimpleDateFormat("yyyy-MM-dd'T'HH:mm:ss.SSS", Locale.US);
        String s1 = date;
        String s2 = null;
        Date d;
        try {
            d = sdf.parse(s1);
            s2 = (new SimpleDateFormat("MM/yyyy")).format(d);

        } catch (ParseException e) {

            e.printStackTrace();
        }

        return s2;

    }

}

In cell A1, enter the time.
In cell B2, enter =A1+1/24

ok i had the same problem and i fix it like this by removing [] from [{"key":"value"}]:

1. in your php file make shure that you print like this

echo json_encode(array_shift($your_variable));

2. in your success function do this

 success: function (data) {
    var result = $.parseJSON(data);
      ('.yourclass').append(result['your_key1']);
      ('.yourclass').append(result['your_key2']);
       ..
    }

and also you can loop it if you want

Ok the first issue with the div tag was easy enough: I just added a style="display:none;" to it and then before showing the dialog I added this in my dialog script:

$("#dialog").css("display", "inherit");

But for the post version I'm still out of luck.

Try this :

public void addTeacherToClassRoom(classroom myClassRoom, String TeacherName)
{
    myClassRoom.setTeacherName(TeacherName);
}