Programs & Examples On #Teradata

Teradata is a Relational Database Management System (RDBMS), capable of supporting many concurrent users from various client platforms. Teradata is compatible with the ANSI standard and built completely on parallel architecture.

What is ROWS UNBOUNDED PRECEDING used for in Teradata?

ROWS UNBOUNDED PRECEDING is no Teradata-specific syntax, it's Standard SQL. Together with the ORDER BY it defines the window on which the result is calculated.

Logically a Windowed Aggregate Function is newly calculated for each row within the PARTITION based on all ROWS between a starting row and an ending row.

Starting and ending rows might be fixed or relative to the current row based on the following keywords:

  • CURRENT ROW, the current row
  • UNBOUNDED PRECEDING, all rows before the current row -> fixed
  • UNBOUNDED FOLLOWING, all rows after the current row -> fixed
  • x PRECEDING, x rows before the current row -> relative
  • y FOLLOWING, y rows after the current row -> relative

Possible kinds of calculation include:

  • Both starting and ending row are fixed, the window consists of all rows of a partition, e.g. a Group Sum, i.e. aggregate plus detail rows
  • One end is fixed, the other relative to current row, the number of rows increases or decreases, e.g. a Running Total, Remaining Sum
  • Starting and ending row are relative to current row, the number of rows within a window is fixed, e.g. a Moving Average over n rows

So SUM(x) OVER (ORDER BY col ROWS UNBOUNDED PRECEDING) results in a Cumulative Sum or Running Total

11 -> 11
 2 -> 11 +  2                = 13
 3 -> 13 +  3 (or 11+2+3)    = 16
44 -> 16 + 44 (or 11+2+3+44) = 60

MAX() and MAX() OVER PARTITION BY produces error 3504 in Teradata Query

SELECT employee_number, course_code, MAX(course_completion_date) AS max_date
FROM employee_course_completion
WHERE course_code IN ('M910303', 'M91301R', 'M91301P')
GROUP BY employee_number, course_code

SQL SELECT multi-columns INTO multi-variable

SELECT @variable1 = col1, @variable2 = col2
FROM table1

Find which rows have different values for a given column in Teradata SQL

Join the table with itself and give it two different aliases (A and B in the following example). This allows to compare different rows of the same table.

SELECT DISTINCT A.Id
FROM
    Address A
    INNER JOIN Address B
        ON A.Id = B.Id AND A.[Adress Code] < B.[Adress Code]
WHERE
    A.Address <> B.Address

The "less than" comparison < ensures that you get 2 different addresses and you don't get the same 2 address codes twice. Using "not equal" <> instead, would yield the codes as (1, 2) and (2, 1); each one of them for the A alias and the B alias in turn.

The join clause is responsible for the pairing of the rows where as the where-clause tests additional conditions.


The query above works with any address codes. If you want to compare addresses with specific address codes, you can change the query to

SELECT A.Id
FROM
    Address A
    INNER JOIN Address B
        ON A.Id = B.Id
WHERE                     
    A.[Adress Code] = 1 AND
    B.[Adress Code] = 2 AND
    A.Address <> B.Address

I imagine that this might be useful to find customers having a billing address (Adress Code = 1 as an example) differing from the delivery address (Adress Code = 2) .

Disable a Button

The button can be Disabled in Swift 4 by the code

@IBAction func yourButtonMethodname(sender: UIButon) {
 yourButton.isEnabled = false 
}

Could not open input file: composer.phar

Use this :

php -r "readfile('https://getcomposer.org/installer');" | php

This will install composer to the current directory so that you can use php composer.phar

How can I get the list of files in a directory using C or C++?

One function is enough, you don't need to use any 3rd-party library (for Windows).

#include <Windows.h>

vector<string> get_all_files_names_within_folder(string folder)
{
    vector<string> names;
    string search_path = folder + "/*.*";
    WIN32_FIND_DATA fd; 
    HANDLE hFind = ::FindFirstFile(search_path.c_str(), &fd); 
    if(hFind != INVALID_HANDLE_VALUE) { 
        do { 
            // read all (real) files in current folder
            // , delete '!' read other 2 default folder . and ..
            if(! (fd.dwFileAttributes & FILE_ATTRIBUTE_DIRECTORY) ) {
                names.push_back(fd.cFileName);
            }
        }while(::FindNextFile(hFind, &fd)); 
        ::FindClose(hFind); 
    } 
    return names;
}

PS: as mentioned by @Sebastian, you could change *.* to *.ext in order to get only the EXT-files (i.e. of a specific type) in that directory.

Is there a concise way to iterate over a stream with indices in Java 8?

This question (Stream Way to get index of first element matching boolean) has marked the current question as a duplicate, so I can not answer it there; I am answering it here.

Here is a generic solution to get the matching index that does not require an external library.

If you have a list.

public static <T> int indexOf(List<T> items, Predicate<T> matches) {
        return IntStream.range(0, items.size())
                .filter(index -> matches.test(items.get(index)))
                .findFirst().orElse(-1);
}

And call it like this:

int index = indexOf(myList, item->item.getId()==100);

And if using a collection, try this one.

   public static <T> int indexOf(Collection<T> items, Predicate<T> matches) {
        int index = -1;
        Iterator<T> it = items.iterator();
        while (it.hasNext()) {
            index++;
            if (matches.test(it.next())) {
                return index;
            }
        }
        return -1;
    }

how to redirect to external url from c# controller

Try this:

return Redirect("http://www.website.com");

Get Table and Index storage size in sql server

This query here will list the total size that a table takes up - clustered index, heap and all nonclustered indices:

SELECT 
    s.Name AS SchemaName,
    t.NAME AS TableName,
    p.rows AS RowCounts,
    SUM(a.total_pages) * 8 AS TotalSpaceKB, 
    SUM(a.used_pages) * 8 AS UsedSpaceKB, 
    (SUM(a.total_pages) - SUM(a.used_pages)) * 8 AS UnusedSpaceKB
FROM 
    sys.tables t
INNER JOIN 
    sys.schemas s ON s.schema_id = t.schema_id
INNER JOIN      
    sys.indexes i ON t.OBJECT_ID = i.object_id
INNER JOIN 
    sys.partitions p ON i.object_id = p.OBJECT_ID AND i.index_id = p.index_id
INNER JOIN 
    sys.allocation_units a ON p.partition_id = a.container_id
WHERE 
    t.NAME NOT LIKE 'dt%'    -- filter out system tables for diagramming
    AND t.is_ms_shipped = 0
    AND i.OBJECT_ID > 255 
GROUP BY 
    t.Name, s.Name, p.Rows
ORDER BY 
    s.Name, t.Name

If you want to separate table space from index space, you need to use AND i.index_id IN (0,1) for the table space (index_id = 0 is the heap space, index_id = 1 is the size of the clustered index = data pages) and AND i.index_id > 1 for the index-only space

How to scroll up or down the page to an anchor using jQuery?

I stumbled upon this example on https://css-tricks.com/snippets/jquery/smooth-scrolling/ explaining every line of code. I found this to be the best option.

https://css-tricks.com/snippets/jquery/smooth-scrolling/

You can go native:

window.scroll({
  top: 2500, 
  left: 0, 
  behavior: 'smooth' 
});

window.scrollBy({ 
  top: 100, // could be negative value
  left: 0, 
  behavior: 'smooth' 
});

document.querySelector('.hello').scrollIntoView({ 
  behavior: 'smooth' 
});

or with jquery:

$('a[href*="#"]').not('[href="#"]').not('[href="#0"]').click(function(event) {

    if (
        location.pathname.replace(/^\//, '') == this.pathname.replace(/^\//, '') 
        && location.hostname == this.hostname
       ) {

      var target = $(this.hash);
      target = target.length ? target : $('[name=' + this.hash.slice(1) + ']');

      if (target.length) {
        event.preventDefault();
        $('html, body').animate({
          scrollTop: target.offset().top
        }, 1000);
      }
    }
  });

Is there a Wikipedia API?

JWPL - Java-based Wikipedia Library -- An application programming interface for Wikipedia

http://code.google.com/p/jwpl/

Pass parameter to EventHandler

Timer.Elapsed expects method of specific signature (with arguments object and EventArgs). If you want to use your PlayMusicEvent method with additional argument evaluated during event registration, you can use lambda expression as an adapter:

myTimer.Elapsed += new ElapsedEventHandler((sender, e) => PlayMusicEvent(sender, e, musicNote));

Edit: you can also use shorter version:

myTimer.Elapsed += (sender, e) => PlayMusicEvent(sender, e, musicNote);

Use of ~ (tilde) in R programming Language

The thing on the right of <- is a formula object. It is often used to denote a statistical model, where the thing on the left of the ~ is the response and the things on the right of the ~ are the explanatory variables. So in English you'd say something like "Species depends on Sepal Length, Sepal Width, Petal Length and Petal Width".

The myFormula <- part of that line stores the formula in an object called myFormula so you can use it in other parts of your R code.


Other common uses of formula objects in R

The lattice package uses them to specify the variables to plot.
The ggplot2 package uses them to specify panels for plotting.
The dplyr package uses them for non-standard evaulation.

How to set portrait and landscape media queries in css?

iPad Media Queries (All generations - including iPad mini)

Thanks to Apple's work in creating a consistent experience for users, and easy time for developers, all 5 different iPads (iPads 1-5 and iPad mini) can be targeted with just one CSS media query. The next few lines of code should work perfect for a responsive design.

iPad in portrait & landscape

@media only screen 
and (min-device-width : 768px) 
and (max-device-width : 1024px)  { /* STYLES GO HERE */}

iPad in landscape

@media only screen 
and (min-device-width : 768px) 
and (max-device-width : 1024px) 
and (orientation : landscape) { /* STYLES GO HERE */}

iPad in portrait

@media only screen 
and (min-device-width : 768px) 
and (max-device-width : 1024px) 
and (orientation : portrait) { /* STYLES GO HERE */ }

iPad 3 & 4 Media Queries

If you're looking to target only 3rd and 4th generation Retina iPads (or tablets with similar resolution) to add @2x graphics, or other features for the tablet's Retina display, use the following media queries.

Retina iPad in portrait & landscape

@media only screen 
and (min-device-width : 768px) 
and (max-device-width : 1024px)
and (-webkit-min-device-pixel-ratio: 2) { /* STYLES GO HERE */}

Retina iPad in landscape

@media only screen 
and (min-device-width : 768px) 
and (max-device-width : 1024px) 
and (orientation : landscape)
and (-webkit-min-device-pixel-ratio: 2) { /* STYLES GO HERE */}

Retina iPad in portrait

@media only screen 
and (min-device-width : 768px) 
and (max-device-width : 1024px) 
and (orientation : portrait)
and (-webkit-min-device-pixel-ratio: 2) { /* STYLES GO HERE */ }

iPad 1 & 2 Media Queries

If you're looking to supply different graphics or choose different typography for the lower resolution iPad display, the media queries below will work like a charm in your responsive design!

iPad 1 & 2 in portrait & landscape

@media only screen 
and (min-device-width : 768px) 
and (max-device-width : 1024px) 
and (-webkit-min-device-pixel-ratio: 1){ /* STYLES GO HERE */}

iPad 1 & 2 in landscape

@media only screen 
and (min-device-width : 768px) 
and (max-device-width : 1024px) 
and (orientation : landscape)
and (-webkit-min-device-pixel-ratio: 1)  { /* STYLES GO HERE */}

iPad 1 & 2 in portrait

@media only screen 
and (min-device-width : 768px) 
and (max-device-width : 1024px) 
and (orientation : portrait) 
and (-webkit-min-device-pixel-ratio: 1) { /* STYLES GO HERE */ }

Source: http://stephen.io/mediaqueries/

How to check if std::map contains a key without doing insert?

Use my_map.count( key ); it can only return 0 or 1, which is essentially the Boolean result you want.

Alternately my_map.find( key ) != my_map.end() works too.

Python send UDP packet

Your code works as is for me. I'm verifying this by using netcat on Linux.

Using netcat, I can do nc -ul 127.0.0.1 5005 which will listen for packets at:

  • IP: 127.0.0.1
  • Port: 5005
  • Protocol: UDP

That being said, here's the output that I see when I run your script, while having netcat running.

[9:34am][wlynch@watermelon ~] nc -ul 127.0.0.1 5005
Hello, World!

Difference between Visibility.Collapsed and Visibility.Hidden

Even though a bit old thread, for those who still looking for the differences:

Aside from layout (space) taken in Hidden and not taken in Collapsed, there is another difference.

If we have custom controls inside this 'Collapsed' main control, the next time we set it to Visible, it will "load" all custom controls. It will not pre-load when window is started.

As for 'Hidden', it will load all custom controls + main control which we set as hidden when the "window" is started.

WCF gives an unsecured or incorrectly secured fault error

In my case the server time was not correct. So I changed the server Datetime settings to Set time automatically and it resolved the issue.

How to get an object's property's value by property name?

Try this :

$obj = @{
    SomeProp = "Hello"
}

Write-Host "Property Value is $($obj."SomeProp")"

Java Desktop application: SWT vs. Swing

One thing to consider: Screenreaders

For some reasons, some Swing components do not work well when using a screenreader (and the Java AccessBridge for Windows). Know that different screenreaders result in different behaviour. And in my experience the SWT-Tree performs a lot better than the Swing-Tree in combination with a screenreader. Thus our application ended up in using both SWT and Swing components.

For distributing and loading the proper SWT-library, you might find this link usefull: http://www.chrisnewland.com/select-correct-swt-jar-for-your-os-and-jvm-at-runtime-191

How to require a controller in an angularjs directive

I got lucky and answered this in a comment to the question, but I'm posting a full answer for the sake of completeness and so we can mark this question as "Answered".


It depends on what you want to accomplish by sharing a controller; you can either share the same controller (though have different instances), or you can share the same controller instance.

Share a Controller

Two directives can use the same controller by passing the same method to two directives, like so:

app.controller( 'MyCtrl', function ( $scope ) {
  // do stuff...
});

app.directive( 'directiveOne', function () {
  return {
    controller: 'MyCtrl'
  };
});

app.directive( 'directiveTwo', function () {
  return {
    controller: 'MyCtrl'
  };
});

Each directive will get its own instance of the controller, but this allows you to share the logic between as many components as you want.

Require a Controller

If you want to share the same instance of a controller, then you use require.

require ensures the presence of another directive and then includes its controller as a parameter to the link function. So if you have two directives on one element, your directive can require the presence of the other directive and gain access to its controller methods. A common use case for this is to require ngModel.

^require, with the addition of the caret, checks elements above directive in addition to the current element to try to find the other directive. This allows you to create complex components where "sub-components" can communicate with the parent component through its controller to great effect. Examples could include tabs, where each pane can communicate with the overall tabs to handle switching; an accordion set could ensure only one is open at a time; etc.

In either event, you have to use the two directives together for this to work. require is a way of communicating between components.

Check out the Guide page of directives for more info: http://docs.angularjs.org/guide/directive

filtering NSArray into a new NSArray in Objective-C

If you are OS X 10.6/iOS 4.0 or later, you're probably better off with blocks than NSPredicate. See -[NSArray indexesOfObjectsPassingTest:] or write your own category to add a handy -select: or -filter: method (example).

Want somebody else to write that category, test it, etc.? Check out BlocksKit (array docs). And there are many more examples to be found by, say, searching for e.g. "nsarray block category select".

How to use android emulator for testing bluetooth application?

Download Androidx86 from this This is an iso file, so you'd
need something like VMWare or VirtualBox to run it When creating the virtual machine, you need to set the type of guest OS as Linux instead of Other.

After creating the virtual machine set the network adapter to 'Bridged'. · Start the VM and select 'Live CD VESA' at boot.

Now you need to find out the IP of this VM. Go to terminal in VM (use Alt+F1 & Alt+F7 to toggle) and use the netcfg command to find this.

Now you need open a command prompt and go to your android install folder (on host). This is usually C:\Program Files\Android\android-sdk\platform-tools>.

Type adb connect IP_ADDRESS. There done! Now you need to add Bluetooth. Plug in your USB Bluetooth dongle/Bluetooth device.

In VirtualBox screen, go to Devices>USB devices. Select your dongle.

Done! now your Android VM has Bluetooth. Try powering on Bluetooth and discovering/paring with other devices.

Now all that remains is to go to Eclipse and run your program. The Android AVD manager should show the VM as a device on the list.

Alternatively, Under settings of the virtual machine, Goto serialports -> Port 1 check Enable serial port select a port number then select port mode as disconnected click ok. now, start virtual machine. Under Devices -> USB Devices -> you can find your laptop bluetooth listed. You can simply check the option and start testing the android bluetooth application .

Source

How do I execute a command and get the output of the command within C++ using POSIX?

Two possible approaches:

  1. I don't think popen() is part of the C++ standard (it's part of POSIX from memory), but it's available on every UNIX I've worked with (and you seem to be targeting UNIX since your command is ./some_command).

  2. On the off-chance that there is no popen(), you can use system("./some_command >/tmp/some_command.out");, then use the normal I/O functions to process the output file.

What does the red exclamation point icon in Eclipse mean?

I also faced a similar problem when i tried to import Source file and JAR file from one machine to another machine. The path of the JAR was different on new machine compared to old machine. I resolved it as belows

  1. Right click on the "Project name"
  2. Select "Build path"
  3. Then select "Configure Build Path"
  4. Click on "Libraries"
  5. Remove all the libraries which were referring to old path

Then, the exclamation symbol on the "Project name" was removed.

Change Name of Import in Java, or import two classes with the same name

Actually it is possible to create a shortcut so you can use shorter names in your code by doing something like this:

package com.mycompany.installer;
public abstract class ConfigurationReader {
    private static class Implementation extends com.mycompany.installer.implementation.ConfigurationReader {}
    public abstract String getLoaderVirtualClassPath();
    public static QueryServiceConfigurationReader getInstance() {
        return new Implementation();
    }
}

In that way you only need to specify the long name once, and you can have as many specially named classes you want.

Another thing I like about this pattern is that you can name the implementing class the same as the abstract base class, and just place it in a different namespace. That is unrelated to the import/renaming pattern though.

Python: count repeated elements in the list

Use Counter

>>> from collections import Counter
>>> MyList = ["a", "b", "a", "c", "c", "a", "c"]
>>> c = Counter(MyList)
>>> c
Counter({'a': 3, 'c': 3, 'b': 1})

How to create a library project in Android Studio and an application project that uses the library project

You can add a new module to any application as Blundell says on his answer and then reference it from any other application.

If you want to move the module to any place on your computer just move the module folder (modules are completely independent), then you will have to reference the module.

To reference this module you should:

  • On build.gradle file of your app add:

    dependencies {
    ...
    compile project(':myandroidlib')
    }
    
  • On settings.gradle file add the following:

     include ':app', ':myandroidlib'
     project(':myandroidlib').projectDir = new File(PATH_TO_YOUR_MODULE)
    

Equivalent of *Nix 'which' command in PowerShell?

Use:

function Which([string] $cmd) {
  $path = (($Env:Path).Split(";") | Select -uniq | Where { $_.Length } | Where { Test-Path $_ } | Get-ChildItem -filter $cmd).FullName
  if ($path) { $path.ToString() }
}

# Check if Chocolatey is installed
if (Which('cinst.bat')) {
  Write-Host "yes"
} else {
  Write-Host "no"
}

Or this version, calling the original where command.

This version also works better, because it is not limited to bat files:

function which([string] $cmd) {
  $where = iex $(Join-Path $env:SystemRoot "System32\where.exe $cmd 2>&1")
  $first = $($where -split '[\r\n]')
  if ($first.getType().BaseType.Name -eq 'Array') {
    $first = $first[0]
  }
  if (Test-Path $first) {
    $first
  }
}

# Check if Curl is installed
if (which('curl')) {
  echo 'yes'
} else {
  echo 'no'
}

How to round a numpy array?

If you want the output to be

array([1.6e-01, 9.9e-01, 3.6e-04])

the problem is not really a missing feature of NumPy, but rather that this sort of rounding is not a standard thing to do. You can make your own rounding function which achieves this like so:

def my_round(value, N):
    exponent = np.ceil(np.log10(value))
    return 10**exponent*np.round(value*10**(-exponent), N)

For a general solution handling 0 and negative values as well, you can do something like this:

def my_round(value, N):
    value = np.asarray(value).copy()
    zero_mask = (value == 0)
    value[zero_mask] = 1.0
    sign_mask = (value < 0)
    value[sign_mask] *= -1
    exponent = np.ceil(np.log10(value))
    result = 10**exponent*np.round(value*10**(-exponent), N)
    result[sign_mask] *= -1
    result[zero_mask] = 0.0
    return result

How to get two or more commands together into a batch file

set "PathName=X:\Web Content Mgmt\Completed Filtering\2013_Folder"
set "comd=dir /b /s *.zip"
cd /d "%PathName%"
%comd%

how to create a list of lists

First of all do not use list as a variable name- that is a builtin function.

I'm not super clear of what you're asking (a little more context would help), but maybe this is helpful-

my_list = []
my_list.append(np.genfromtxt('temp.txt', usecols=3, dtype=[('floatname','float')], skip_header=1))
my_list.append(np.genfromtxt('temp2.txt', usecols=3, dtype=[('floatname','float')], skip_header=1))

That will create a list (a type of mutable array in python) called my_list with the output of the np.getfromtext() method in the first 2 indexes.

The first can be referenced with my_list[0] and the second with my_list[1]

What is the difference between private and protected members of C++ classes?

Protected members can only be accessed by descendants of the class, and by code in the same module. Private members can only be accessed by the class they're declared in, and by code in the same module.

Of course friend functions throw this out the window, but oh well.

How to use Python to login to a webpage and retrieve cookies for later usage?

Here's a version using the excellent requests library:

from requests import session

payload = {
    'action': 'login',
    'username': USERNAME,
    'password': PASSWORD
}

with session() as c:
    c.post('http://example.com/login.php', data=payload)
    response = c.get('http://example.com/protected_page.php')
    print(response.headers)
    print(response.text)

ASP.NET Forms Authentication failed for the request. Reason: The ticket supplied has expired

I was getting this same error, in our case it was caused by a load balancer. We hade to make sure that the persistance was set to Source IP. Otherwise the login form was opened by one server, and processed by the other, which would fail to set the authentication cookie correctly. Maybe this helps someone else

Replacing spaces with underscores in JavaScript?

You can try this

 var str = 'hello     world  !!';
 str = str.replace(/\s+/g, '-');

It will even replace multiple spaces with single '-'.

How to clear Tkinter Canvas?

Items drawn to the canvas are persistent. create_rectangle returns an item id that you need to keep track of. If you don't remove old items your program will eventually slow down.

From Fredrik Lundh's An Introduction to Tkinter:

Note that items added to the canvas are kept until you remove them. If you want to change the drawing, you can either use methods like coords, itemconfig, and move to modify the items, or use delete to remove them.

Python/Json:Expecting property name enclosed in double quotes

x = x.replace("'", '"')
j = json.loads(x)

Although this is the correct solution, but it may lead to quite a headache if there a JSON like this -

{'status': 'success', 'data': {'equity': {'enabled': True, 'net': 66706.14510000008, 'available': {'adhoc_margin': 0, 'cash': 1277252.56, 'opening_balance': 1277252.56, 'live_balance': 66706.14510000008, 'collateral': 249823.93, 'intraday_payin': 15000}, 'utilised': {'debits': 1475370.3449, 'exposure': 607729.3129, 'm2m_realised': 0, 'm2m_unrealised': -9033, 'option_premium': 0, 'payout': 0, 'span': 858608.032, 'holding_sales': 0, 'turnover': 0, 'liquid_collateral': 0, 'stock_collateral': 249823.93}}, 'commodity': {'enabled': True, 'net': 0, 'available': {'adhoc_margin': 0, 'cash': 0, 'opening_balance': 0, 'live_balance': 0, 'collateral': 0, 'intraday_payin': 0}, 'utilised': {'debits': 0, 'exposure': 0, 'm2m_realised': 0, 'm2m_unrealised': 0, 'option_premium': 0, 'payout': 0, 'span': 0, 'holding_sales': 0, 'turnover': 0, 'liquid_collateral': 0, 'stock_collateral': 0}}}}

Noticed that "True" value? Use this to make things are double checked for Booleans. This will cover those cases -

x = x.replace("'", '"').replace("True", '"True"').replace("False", '"False"').replace("null", '"null"')
j = json.loads(x)

Also, make sure you do not make

x = json.loads(x)

It has to be another variable.

install / uninstall APKs programmatically (PackageManager vs Intents)

If you're using Kotlin, API 14+, and just wish to show uninstall dialog for your app:

startActivity(Intent(Intent.ACTION_UNINSTALL_PACKAGE).apply {
    data = Uri.parse("package:$packageName")
})

You can change packageName to any other package name if you want to prompt the user to uninstall another app on the device

How to use SortedMap interface in Java?

You can use TreeMap which internally implements the SortedMap below is the example

Sorting by ascending ordering :

  Map<Float, String> ascsortedMAP = new TreeMap<Float, String>();

  ascsortedMAP.put(8f, "name8");
  ascsortedMAP.put(5f, "name5");
  ascsortedMAP.put(15f, "name15");
  ascsortedMAP.put(35f, "name35");
  ascsortedMAP.put(44f, "name44");
  ascsortedMAP.put(7f, "name7");
  ascsortedMAP.put(6f, "name6");

  for (Entry<Float, String> mapData : ascsortedMAP.entrySet()) {
    System.out.println("Key : " + mapData.getKey() + "Value : " + mapData.getValue());
  }

Sorting by descending ordering :

If you always want this create the map to use descending order in general, if you only need it once create a TreeMap with descending order and put all the data from the original map in.

  // Create the map and provide the comparator as a argument
  Map<Float, String> dscsortedMAP = new TreeMap<Float, String>(new Comparator<Float>() {
    @Override
    public int compare(Float o1, Float o2) {
      return o2.compareTo(o1);
    }
  });
  dscsortedMAP.putAll(ascsortedMAP);

for further information about SortedMAP read http://examples.javacodegeeks.com/core-java/util/treemap/java-sorted-map-example/

How to get old Value with onchange() event in text box

Maybe you can store the previous value of the textbox into a hidden textbox. Then you can get the first value from hidden and the last value from textbox itself. An alternative related to this, at onfocus event of your textbox set the value of your textbox to an hidden field and at onchange event read the previous value.

How to install easy_install in Python 2.7.1 on Windows 7

for 32-bit Python, the installer is here. after you run the installer, you will have easy_install.exe in your \Python27\Scripts directory

if you are looking for 64-bit installers, this is an excellent resource:

http://www.lfd.uci.edu/~gohlke/pythonlibs/

the author has installers for both Setuptools and Distribute. Either one will give you easy_install.exe

intelliJ IDEA 13 error: please select Android SDK

My Problem: "please select Android SDK", But everything is okey :( -> I think one of IntelliJ file was crashed (after blue screen of death)

My resolution:

File -> Settings -> Android SDK -> Android SDK Location Edit -> Next, Next (Android SDK is up to date.), Finished

... and crashed file was repaired!

count number of characters in nvarchar column

Use the LEN function:

Returns the number of characters of the specified string expression, excluding trailing blanks.

reading from app.config file

ConfigurationSettings.AppSettings is obsolete, you should use ConfigurationManager.AppSettings instead (you will need to add a reference to System.Configuration)

int value = Int32.Parse(ConfigurationManager.AppSettings["StartingMonthColumn"]);

If you still have problems reading in your app settings then check that your app.config file is named correctly. Specifically, it should be named according to the executing assembly i.e. MyApp.exe.config, and should reside in the same directory as MyApp.exe.

How to add row of data to Jtable from values received from jtextfield and comboboxes

String[] tblHead={"Item Name","Price","Qty","Discount"};
DefaultTableModel dtm=new DefaultTableModel(tblHead,0);
JTable tbl=new JTable(dtm);
String[] item={"A","B","C","D"};
dtm.addRow(item);

Here;this is the solution.

using c# .net libraries to check for IMAP messages from gmail servers

There is no .NET framework support for IMAP. You'll need to use some 3rd party component.

Try Mail.dll email component, it's very affordable and easy to use, it also supports SSL:

using(Imap imap = new Imap())
{
    imap.ConnectSSL("imap.company.com");
    imap.Login("user", "password");

    imap.SelectInbox();
    List<long> uids = imap.Search(Flag.Unseen);
    foreach (long uid in uids)
    {
        string eml = imap.GetMessageByUID(uid);
        IMail message = new MailBuilder()
            .CreateFromEml(eml);

        Console.WriteLine(message.Subject);
        Console.WriteLine(message.Text);
    }
    imap.Close(true);
}

Please note that this is a commercial product I've created.

You can download it here: https://www.limilabs.com/mail.

How do I fill arrays in Java?

int[] a = {1, 2, 3, 4, 5, 6, 7, 8, 9, 10};

How can I print to the same line?

In Linux, there is different escape sequences for control terminal. For example, there is special escape sequence for erase whole line: \33[2K and for move cursor to previous line: \33[1A. So all you need is to print this every time you need to refresh the line. Here is the code which prints Line 1 (second variant):

System.out.println("Line 1 (first variant)");
System.out.print("\33[1A\33[2K");
System.out.println("Line 1 (second variant)");

There are codes for cursor navigation, clearing screen and so on.

I think there are some libraries which helps with it (ncurses?).

Not able to access adb in OS X through Terminal, "command not found"

Or the alternative solution could be

  1. Make sure you already install for android SDK. Usually it is located under /Users/your-user-name/Library/Android/sdk
  2. If the SDK is there then run this command. ./platform-tools/adb install your-apk-location

  3. From there you can generate the APK file That's the only sample to check if adb command is there

Setting state on componentDidMount()

It is not an anti-pattern to call setState in componentDidMount. In fact, ReactJS provides an example of this in their documentation:

You should populate data with AJAX calls in the componentDidMount lifecycle method. This is so you can use setState to update your component when the data is retrieved.

Example From Doc

componentDidMount() {
    fetch("https://api.example.com/items")
      .then(res => res.json())
      .then(
        (result) => {
          this.setState({
            isLoaded: true,
            items: result.items
          });
        },
        // Note: it's important to handle errors here
        // instead of a catch() block so that we don't swallow
        // exceptions from actual bugs in components.
        (error) => {
          this.setState({
            isLoaded: true,
            error
          });
        }
      )
  }

String.Format for Hex

If we have built in functions to convert your integer values to COLOR then why to worry.

string hexValue = string.Format("{0:X}", intColor);

Color brushes = System.Drawing.ColorTranslator.FromHtml("#"+hexValue);

wait process until all subprocess finish?

subprocess.call

Automatically waits , you can also use:

p1.wait()

What is the height of Navigation Bar in iOS 7?

I got this answer from the book Programming iOS 7, section Bar Position and Bar Metrics

If a navigation bar or toolbar — or a search bar (discussed earlier in this chapter) — is to occupy the top of the screen, the iOS 7 convention is that its height should be increased to underlap the transparent status bar. To make this possible, iOS 7 introduces the notion of a bar position.

UIBarPositionTopAttached

Specifies that the bar is at the top of the screen, as well as its containing view. Bars with this position draw their background extended upwards, allowing their background content to show through the status bar. Available in iOS 7.0 and later.

Python function overloading

This type of behaviour is typically solved (in OOP languages) using polymorphism. Each type of bullet would be responsible for knowing how it travels. For instance:

class Bullet(object):
    def __init__(self):
        self.curve = None
        self.speed = None
        self.acceleration = None
        self.sprite_image = None

class RegularBullet(Bullet):
    def __init__(self):
        super(RegularBullet, self).__init__()
        self.speed = 10

class Grenade(Bullet):
    def __init__(self):
        super(Grenade, self).__init__()
        self.speed = 4
        self.curve = 3.5

add_bullet(Grendade())

def add_bullet(bullet):
    c_function(bullet.speed, bullet.curve, bullet.acceleration, bullet.sprite, bullet.x, bullet.y)


void c_function(double speed, double curve, double accel, char[] sprite, ...) {
    if (speed != null && ...) regular_bullet(...)
    else if (...) curved_bullet(...)
    //..etc..
}

Pass as many arguments to the c_function that exist, and then do the job of determining which c function to call based on the values in the initial c function. So, Python should only ever be calling the one c function. That one c function looks at the arguments, and then can delegate to other c functions appropriately.

You're essentially just using each subclass as a different data container, but by defining all the potential arguments on the base class, the subclasses are free to ignore the ones they do nothing with.

When a new type of bullet comes along, you can simply define one more property on the base, change the one python function so that it passes the extra property, and the one c_function that examines the arguments and delegates appropriately. It doesn't sound too bad I guess.

How to format numbers as currency string?

function getMoney(A){
    var a = new Number(A);
    var b = a.toFixed(2); //get 12345678.90
    a = parseInt(a); // get 12345678
    b = (b-a).toPrecision(2); //get 0.90
    b = parseFloat(b).toFixed(2); //in case we get 0.0, we pad it out to 0.00
    a = a.toLocaleString();//put in commas - IE also puts in .00, so we'll get 12,345,678.00
    //if IE (our number ends in .00)
    if(a < 1 && a.lastIndexOf('.00') == (a.length - 3))
    {
        a=a.substr(0, a.length-3); //delete the .00
    }
    return a+b.substr(1);//remove the 0 from b, then return a + b = 12,345,678.90
}
alert(getMoney(12345678.9));

This works in FF and IE

Create a 3D matrix

Create a 3D matrix

A = zeros(20, 10, 3);   %# Creates a 20x10x3 matrix

Add a 3rd dimension to a matrix

B = zeros(4,4);  
C = zeros(size(B,1), size(B,2), 4);  %# New matrix with B's size, and 3rd dimension of size 4
C(:,:,1) = B;                        %# Copy the content of B into C's first set of values

zeros is just one way of making a new matrix. Another could be A(1:20,1:10,1:3) = 0 for a 3D matrix. To confirm the size of your matrices you can run: size(A) which gives 20 10 3.

There is no explicit bound on the number of dimensions a matrix may have.

Rails 4: before_filter vs. before_action

It is just syntax difference, in rails app there is CRUD, and seven actions basically by name index, new, create, show, update, edit, destroy.

Rails 4 make it developer friendly to change syntax before filter to before action.

before_action call method before the actions which we declare, like

before_action :set_event, only: [:show, :update, :destroy, :edit]

set_event is a method which will call always before show, update, edit and destroy.

SQL Server default character encoding

The default character encoding for a SQL Server database is iso_1, which is ISO 8859-1. Note that the character encoding depends on the data type of a column. You can get an idea of what character encodings are used for the columns in a database as well as the collations using this SQL:

select data_type, character_set_catalog, character_set_schema, character_set_name, collation_catalog, collation_schema, collation_name, count(*) count
from information_schema.columns
group by data_type, character_set_catalog, character_set_schema, character_set_name, collation_catalog, collation_schema, collation_name;

If it's using the default, the character_set_name should be iso_1 for the char and varchar data types. Since nchar and nvarchar store Unicode data in UCS-2 format, the character_set_name for those data types is UNICODE.

PHP String to Float

you can follow this link to know more about How to convert a string/number into number/float/decimal in PHP. HERE IS WHAT THIS LINK SAYS...

Method 1: Using number_format() Function. The number_format() function is used to convert a string into a number. It returns the formatted number on success otherwise it gives E_WARNING on failure.

$num = "1000.314"; 

//Convert string in number using  
//number_format(), function 
echo number_format($num), "\n"; 

//Convert string in number using  
//number_format(), function 
echo number_format($num, 2); 

Method 2: Using type casting: Typecasting can directly convert a string into a float, double, or integer primitive type. This is the best way to convert a string into a number without any function.

// Number in string format 
$num = "1000.314"; 

// Type cast using int 
echo (int)$num, "\n"; 

// Type cast using float 
echo (float)$num, "\n"; 

// Type cast using double 
echo (double)$num; 

Method 3: Using intval() and floatval() Function. The intval() and floatval() functions can also be used to convert the string into its corresponding integer and float values respectively.

// Number in string format 
$num = "1000.314"; 

// intval() function to convert  
// string into integer 
echo intval($num), "\n"; 

// floatval() function to convert 
// string to float 
echo floatval($num); 

Method 4: By adding 0 or by performing mathematical operations. The string number can also be converted into an integer or float by adding 0 with the string. In PHP, performing mathematical operations, the string is converted to an integer or float implicitly.

// Number into string format 
$num = "1000.314"; 

// Performing mathematical operation  
// to implicitly type conversion 
echo $num + 0, "\n"; 

// Performing mathematical operation  
// to implicitly type conversion 
echo $num + 0.0, "\n"; 

// Performing mathematical operation  
// to implicitly type conversion 
echo $num + 0.1;

Removing elements with Array.map in JavaScript

following statement cleans object using map function.

var arraytoclean = [{v:65, toberemoved:"gronf"}, {v:12, toberemoved:null}, {v:4}];
arraytoclean.map((x,i)=>x.toberemoved=undefined);
console.dir(arraytoclean);

What is the difference between user and kernel modes in operating systems?

Other answers already explained the difference between user and kernel mode. If you really want to get into detail you should get a copy of Windows Internals, an excellent book written by Mark Russinovich and David Solomon describing the architecture and inside details of the various Windows operating systems.

In JPA 2, using a CriteriaQuery, how to count results

With Spring Data Jpa, we can use this method:

    /*
     * (non-Javadoc)
     * @see org.springframework.data.jpa.repository.JpaSpecificationExecutor#count(org.springframework.data.jpa.domain.Specification)
     */
    @Override
    public long count(@Nullable Specification<T> spec) {
        return executeCountQuery(getCountQuery(spec, getDomainClass()));
    }

Twitter Bootstrap Datepicker within modal window

for me it only worked with !important in css

.datepicker {z-index: 1151 !important;}

Eclipse JUnit - possible causes of seeing "initializationError" in Eclipse window

For me, it was due to the "return type" of the test method. It should be "void"

Get resultset from oracle stored procedure

In SQL Plus:

SQL> var r refcursor
SQL> set autoprint on
SQL> exec :r := function_returning_refcursor();

Replace the last line with a call to your procedure / function and the contents of the refcursor will be displayed

<code> vs <pre> vs <samp> for inline and block code snippets

For normal inlined <code> use:

<code>...</code>

and for each and every place where blocked <code> is needed use

<code style="display:block; white-space:pre-wrap">...</code>

Alternatively, define a <codenza> tag for break lining block <code> (no classes)

<script>
</script>
<style>
  codenza, code {}     /*  noop mnemonic aide that codenza mimes code tag  */
  codenza {display:block;white-space:pre-wrap}
</style>`

Testing: (NB: the following is a scURIple utilizing a data: URI protocol/scheme, therefore the %0A nl format codes are essential in preserving such when cut and pasted into the URL bar for testing - so view-source: (ctrl-U) looks good preceed every line below with %0A)

data:text/html;charset=utf-8,<html >
<script>document.write(window.navigator.userAgent)</script>
<script></script>
<style>
  codenza, code {}     /*  noop mnemonic aide that codenza mimes code tag  */
  codenza {display:block;white-space:pre-wrap}
</style>
<p>First using the usual &lt;code> tag
<code>
  %0A     function x(arghhh){ 
  %0A          return "a very long line of text that will extend the code beyond the boundaries of the margins, guaranteed for the most part, well maybe without you as a warrantee (except in abnormally conditioned perverse environs in which case a warranty is useless)"
  %0A     }
</code>
and then 
<p>with the tag blocked using pre-wrapped lines
<code style=display:block;white-space:pre-wrap> 
  %0A     function x(arghhh){ 
  %0A          return "a very long line of text that will extend the code beyond the boundaries of the margins, guaranteed for the most part, well maybe without you as a warrantee (except in abnormally conditioned perverse environs in which case a warranty is useless)"
  %0A     }
</code>
<br>using an ersatz tag
<codenza>
  %0A     function x(arghhh){ 
  %0A          return "a very long line of text that will extend the code beyond the boundaries of the margins, guaranteed for the most part, well maybe without you as a warrantee (except in abnormally conditioned perverse environs in which case a warranty is useless)"
 %0A     }
</codenza>
</html>

Converting XML to JSON using Python?

My answer addresses the specific (and somewhat common) case where you don't really need to convert the entire xml to json, but what you need is to traverse/access specific parts of the xml, and you need it to be fast, and simple (using json/dict-like operations).

Approach

For this, it is important to note that parsing an xml to etree using lxml is super fast. The slow part in most of the other answers is the second pass: traversing the etree structure (usually in python-land), converting it to json.

Which leads me to the approach I found best for this case: parsing the xml using lxml, and then wrapping the etree nodes (lazily), providing them with a dict-like interface.

Code

Here's the code:

from collections import Mapping
import lxml.etree

class ETreeDictWrapper(Mapping):

    def __init__(self, elem, attr_prefix = '@', list_tags = ()):
        self.elem = elem
        self.attr_prefix = attr_prefix
        self.list_tags = list_tags

    def _wrap(self, e):
        if isinstance(e, basestring):
            return e
        if len(e) == 0 and len(e.attrib) == 0:
            return e.text
        return type(self)(
            e,
            attr_prefix = self.attr_prefix,
            list_tags = self.list_tags,
        )

    def __getitem__(self, key):
        if key.startswith(self.attr_prefix):
            return self.elem.attrib[key[len(self.attr_prefix):]]
        else:
            subelems = [ e for e in self.elem.iterchildren() if e.tag == key ]
            if len(subelems) > 1 or key in self.list_tags:
                return [ self._wrap(x) for x in subelems ]
            elif len(subelems) == 1:
                return self._wrap(subelems[0])
            else:
                raise KeyError(key)

    def __iter__(self):
        return iter(set( k.tag for k in self.elem) |
                    set( self.attr_prefix + k for k in self.elem.attrib ))

    def __len__(self):
        return len(self.elem) + len(self.elem.attrib)

    # defining __contains__ is not necessary, but improves speed
    def __contains__(self, key):
        if key.startswith(self.attr_prefix):
            return key[len(self.attr_prefix):] in self.elem.attrib
        else:
            return any( e.tag == key for e in self.elem.iterchildren() )


def xml_to_dictlike(xmlstr, attr_prefix = '@', list_tags = ()):
    t = lxml.etree.fromstring(xmlstr)
    return ETreeDictWrapper(
        t,
        attr_prefix = '@',
        list_tags = set(list_tags),
    )

This implementation is not complete, e.g., it doesn't cleanly support cases where an element has both text and attributes, or both text and children (only because I didn't need it when I wrote it...) It should be easy to improve it, though.

Speed

In my specific use case, where I needed to only process specific elements of the xml, this approach gave a suprising and striking speedup by a factor of 70 (!) compared to using @Martin Blech's xmltodict and then traversing the dict directly.

Bonus

As a bonus, since our structure is already dict-like, we get another alternative implementation of xml2json for free. We just need to pass our dict-like structure to json.dumps. Something like:

def xml_to_json(xmlstr, **kwargs):
    x = xml_to_dictlike(xmlstr, **kwargs)
    return json.dumps(x)

If your xml includes attributes, you'd need to use some alphanumeric attr_prefix (e.g. "ATTR_"), to ensure the keys are valid json keys.

I haven't benchmarked this part.

Copying text outside of Vim with set mouse=a enabled

Another OSX-Mac option is to uncheck View->Allow Mouse Reporting (or press ?-R to toggle it.) This allows you to toggle between mouse interaction and mouse selecting, which might be useful when selecting and copy/pasting a few bits because you don't have to hold a modifier key to do it.

Note for Multiline with line numbers:

I usually have line numbers enabled so this will also copy the line numbers if you select multiple lines. If you want to copy multiple lines without the line numbers disable the numbers with :set nonu and then you can :set nu to re-enable them after you're done copying.

How does Git handle symbolic links?

You can find out what Git does with a file by seeing what it does when you add it to the index. The index is like a pre-commit. With the index committed, you can use git checkout to bring everything that was in the index back into the working directory. So, what does Git do when you add a symbolic link to the index?

To find out, first, make a symbolic link:

$ ln -s /path/referenced/by/symlink symlink

Git doesn't know about this file yet. git ls-files lets you inspect your index (-s prints stat-like output):

$ git ls-files -s ./symlink
[nothing]

Now, add the contents of the symbolic link to the Git object store by adding it to the index. When you add a file to the index, Git stores its contents in the Git object store.

$ git add ./symlink

So, what was added?

$ git ls-files -s ./symlink
120000 1596f9db1b9610f238b78dd168ae33faa2dec15c 0       symlink

The hash is a reference to the packed object that was created in the Git object store. You can examine this object if you look in .git/objects/15/96f9db1b9610f238b78dd168ae33faa2dec15c in the root of your repository. This is the file that Git stores in the repository, that you can later check out. If you examine this file, you'll see it is very small. It does not store the contents of the linked file. To confirm this, print the contents of the packed repository object with git cat-file:

$ git cat-file -p 1596f9db1b9610f238b78dd168ae33faa2dec15c
/path/referenced/by/symlink

(Note 120000 is the mode listed in ls-files output. It would be something like 100644 for a regular file.)

But what does Git do with this object when you check it out from the repository and into your filesystem? It depends on the core.symlinks config. From man git-config:

core.symlinks

If false, symbolic links are checked out as small plain files that contain the link text.

So, with a symbolic link in the repository, upon checkout you either get a text file with a reference to a full filesystem path, or a proper symbolic link, depending on the value of the core.symlinks config.

Either way, the data referenced by the symlink is not stored in the repository.

rails 3 validation on uniqueness on multiple attributes

Dont work for me, need to put scope in plural

validates_uniqueness_of :teacher_id, :scopes => [:semester_id, :class_id]

Best way to convert an ArrayList to a string

It's an O(n) algorithm either way (unless you did some multi-threaded solution where you broke the list into multiple sublists, but I don't think that is what you are asking for).

Just use a StringBuilder as below:

StringBuilder sb = new StringBuilder();

for (Object obj : list) {
  sb.append(obj.toString());
  sb.append("\t");
}

String finalString = sb.toString();

The StringBuilder will be a lot faster than string concatenation because you won't be re-instantiating a String object on each concatenation.

How to get a particular date format ('dd-MMM-yyyy') in SELECT query SQL Server 2008 R2

SELECT Convert(varchar(10),CONVERT(date,'columnname',105),105) as "end";

OR

SELECT CONVERT(VARCHAR(10), CAST(event_enddate AS DATE), 105) AS [end];

will return the particular date in the format of 'dd-mm-yyyy'

The result would be like this..

04-07-2016

How to read a config file using python

Since your config file is a normal text file, just read it using the open function:

file = open("abc.txt", 'r')
content = file.read()
paths = content.split("\n") #split it into lines
for path in paths:
    print path.split(" = ")[1]

This will print your paths. You can also store them using dictionaries or lists.

path_list = []
path_dict = {}
for path in paths:
    p = path.split(" = ")
    path_list.append(p)[1]
    path_dict[p[0]] = p[1]

More on reading/writing file here. Hope this helps!

SQLite select where empty?

You can do this with the following:

int counter = 0;
String sql = "SELECT projectName,Owner " + "FROM Project WHERE Owner= ?";
PreparedStatement prep = conn.prepareStatement(sql);
prep.setString(1, "");
ResultSet rs = prep.executeQuery();
while (rs.next()) {
    counter++;
}
System.out.println(counter);

This will give you the no of rows where the column value is null or blank.

Operator overloading in Java

Operator overloading is used in Java for the concatenation of the String type:

String concat = "one" + "two";

However, you cannot define your own operator overloads.

sort csv by column

import operator
sortedlist = sorted(reader, key=operator.itemgetter(3), reverse=True)

or use lambda

sortedlist = sorted(reader, key=lambda row: row[3], reverse=True)

CSS text-decoration underline color

You can't change the color of the line (you can't specify different foreground colors for the same element, and the text and its decoration form a single element). However there are some tricks:

a:link, a:visited {text-decoration: none; color: red; border-bottom: 1px solid #006699; }
a:hover, a:active {text-decoration: none; color: red; border-bottom: 1px solid #1177FF; }

Also you can make some cool effects this way:

a:link {text-decoration: none; color: red; border-bottom: 1px dashed #006699; }

Hope it helps.

What is special about /dev/tty?

The 'c' means it's a character device. tty is a special file representing the 'controlling terminal' for the current process.

Character Devices

Unix supports 'device files', which aren't really files at all, but file-like access points to hardware devices. A 'character' device is one which is interfaced byte-by-byte (as opposed to buffered IO).

TTY

/dev/tty is a special file, representing the terminal for the current process. So, when you echo 1 > /dev/tty, your message ('1') will appear on your screen. Likewise, when you cat /dev/tty, your subsequent input gets duplicated (until you press Ctrl-C).

/dev/tty doesn't 'contain' anything as such, but you can read from it and write to it (for what it's worth). I can't think of a good use for it, but there are similar files which are very useful for simple IO operations (e.g. /dev/ttyS0 is normally your serial port)

This quote is from http://tldp.org/HOWTO/Text-Terminal-HOWTO-7.html#ss7.3 :

/dev/tty stands for the controlling terminal (if any) for the current process. To find out which tty's are attached to which processes use the "ps -a" command at the shell prompt (command line). Look at the "tty" column. For the shell process you're in, /dev/tty is the terminal you are now using. Type "tty" at the shell prompt to see what it is (see manual pg. tty(1)). /dev/tty is something like a link to the actually terminal device name with some additional features for C-programmers: see the manual page tty(4).

Here is the man page: http://linux.die.net/man/4/tty

What is the best way to dump entire objects to a log in C#?

Following is another version that does the same thing (and handle nested properties), which I think is simpler (no dependencies on external libraries and can be modified easily to do things other than logging):

public class ObjectDumper
{
    public static string Dump(object obj)
    {
        return new ObjectDumper().DumpObject(obj);
    }

    StringBuilder _dumpBuilder = new StringBuilder();

    string DumpObject(object obj)
    {
        DumpObject(obj, 0);
        return _dumpBuilder.ToString();
    }

    void DumpObject(object obj, int nestingLevel = 0)
    {
        var nestingSpaces = "".PadLeft(nestingLevel * 4);

        if (obj == null)
        {
            _dumpBuilder.AppendFormat("{0}null\n", nestingSpaces);
        }
        else if (obj is string || obj.GetType().IsPrimitive)
        {
            _dumpBuilder.AppendFormat("{0}{1}\n", nestingSpaces, obj);
        }
        else if (ImplementsDictionary(obj.GetType()))
        {
            using (var e = ((dynamic)obj).GetEnumerator())
            {
                var enumerator = (IEnumerator)e;
                while (enumerator.MoveNext())
                {
                    dynamic p = enumerator.Current;

                    var key = p.Key;
                    var value = p.Value;
                    _dumpBuilder.AppendFormat("{0}{1} ({2})\n", nestingSpaces, key, value != null ? value.GetType().ToString() : "<null>");
                    DumpObject(value, nestingLevel + 1);
                }
            }
        }
        else if (obj is IEnumerable)
        {
            foreach (dynamic p in obj as IEnumerable)
            {
                DumpObject(p, nestingLevel);
            }
        }
        else
        {
            foreach (PropertyDescriptor descriptor in TypeDescriptor.GetProperties(obj))
            {
                string name = descriptor.Name;
                object value = descriptor.GetValue(obj);

                _dumpBuilder.AppendFormat("{0}{1} ({2})\n", nestingSpaces, name, value != null ? value.GetType().ToString() : "<null>");
                DumpObject(value, nestingLevel + 1);
            }
        }
    }

    bool ImplementsDictionary(Type t)
    {
        return t.GetInterfaces().Any(i => i.Name.Contains("IDictionary"));
    }
}

how to pass value from one php page to another using session

Use something like this:

page1.php

<?php
session_start();
$_SESSION['myValue']=3; // You can set the value however you like.
?>

Any other PHP page:

<?php
session_start();
echo $_SESSION['myValue'];
?>

A few notes to keep in mind though: You need to call session_start() BEFORE any output, HTML, echos - even whitespace.

You can keep changing the value in the session - but it will only be able to be used after the first page - meaning if you set it in page 1, you will not be able to use it until you get to another page or refresh the page.

The setting of the variable itself can be done in one of a number of ways:

$_SESSION['myValue']=1;
$_SESSION['myValue']=$var;
$_SESSION['myValue']=$_GET['YourFormElement'];

And if you want to check if the variable is set before getting a potential error, use something like this:

if(!empty($_SESSION['myValue'])
{
    echo $_SESSION['myValue'];
}
else
{
    echo "Session not set yet.";
}

How to Set user name and Password of phpmyadmin

You can simply open the phpmyadmin page from your browser, then open any existing database -> go to Privileges tab, click on your root user and then a popup window will appear, you can set your password there.. Hope this Helps.

Request Permission for Camera and Library in iOS 10 - Info.plist

I wrote an extension that takes into account all possible cases:

  • If access is allowed, then the code onAccessHasBeenGranted will be run.
  • If access is not determined, then requestAuthorization(_:) will be called.
  • If the user has denied your app photo library access, then the user will be shown a window offering to go to settings and allow access. In this window, the "Cancel" and "Settings" buttons will be available to him. When he presses the "settings" button, your application settings will open.

Usage example:

PHPhotoLibrary.execute(controller: self, onAccessHasBeenGranted: {
    // access granted... 
})

Extension code:

import Photos
import UIKit

public extension PHPhotoLibrary {

   static func execute(controller: UIViewController,
                       onAccessHasBeenGranted: @escaping () -> Void,
                       onAccessHasBeenDenied: (() -> Void)? = nil) {

      let onDeniedOrRestricted = onAccessHasBeenDenied ?? {
         let alert = UIAlertController(
            title: "We were unable to load your album groups. Sorry!",
            message: "You can enable access in Privacy Settings",
            preferredStyle: .alert)
         alert.addAction(UIAlertAction(title: "Cancel", style: .cancel, handler: nil))
         alert.addAction(UIAlertAction(title: "Settings", style: .default, handler: { _ in
            if let settingsURL = URL(string: UIApplication.openSettingsURLString) {
               UIApplication.shared.open(settingsURL)
            }
         }))
         controller.present(alert, animated: true)
      }

      let status = PHPhotoLibrary.authorizationStatus()
      switch status {
      case .notDetermined:
         onNotDetermined(onDeniedOrRestricted, onAccessHasBeenGranted)
      case .denied, .restricted:
         onDeniedOrRestricted()
      case .authorized:
         onAccessHasBeenGranted()
      @unknown default:
         fatalError("PHPhotoLibrary::execute - \"Unknown case\"")
      }
   }

}

private func onNotDetermined(_ onDeniedOrRestricted: @escaping (()->Void), _ onAuthorized: @escaping (()->Void)) {
   PHPhotoLibrary.requestAuthorization({ status in
      switch status {
      case .notDetermined:
         onNotDetermined(onDeniedOrRestricted, onAuthorized)
      case .denied, .restricted:
         onDeniedOrRestricted()
      case .authorized:
         onAuthorized()
      @unknown default:
         fatalError("PHPhotoLibrary::execute - \"Unknown case\"")
      }
   })
}

Iframe transparent background

I've used this creating an IFrame through Javascript and it worked for me:

// IFrame points to the IFrame element, obviously
IFrame.src = 'about: blank';
IFrame.style.backgroundColor = "transparent";
IFrame.frameBorder = "0";
IFrame.allowTransparency="true";

Not sure if it makes any difference, but I set those properties before adding the IFrame to the DOM. After adding it to the DOM, I set its src to the real URL.

ReactJS: setTimeout() not working?

You did syntax declaration error, use proper setTimeout declaration

message:() => { 
  setTimeout(() => {this.setState({opened:false})},3000); 
  return 'Thanks for your time, have a nice day ! 
}

Find the similarity metric between two strings

There is a built in.

from difflib import SequenceMatcher

def similar(a, b):
    return SequenceMatcher(None, a, b).ratio()

Using it:

>>> similar("Apple","Appel")
0.8
>>> similar("Apple","Mango")
0.0

jQuery UI Dialog OnBeforeUnload

This works for me:

_x000D_
_x000D_
window.addEventListener("beforeunload", function(event) {_x000D_
  event.returnValue = "You may have unsaved Data";_x000D_
});
_x000D_
_x000D_
_x000D_

How to add a hook to the application context initialization event?

Spring has some standard events which you can handle.

To do that, you must create and register a bean that implements the ApplicationListener interface, something like this:

package test.pack.age;

import org.springframework.context.ApplicationContext;
import org.springframework.context.ApplicationEvent;
import org.springframework.context.ApplicationListener;
import org.springframework.context.event.ContextRefreshedEvent;

public class ApplicationListenerBean implements ApplicationListener {

    @Override
    public void onApplicationEvent(ApplicationEvent event) {
        if (event instanceof ContextRefreshedEvent) {
            ApplicationContext applicationContext = ((ContextRefreshedEvent) event).getApplicationContext();
            // now you can do applicationContext.getBean(...)
            // ...
        }
    }
}

You then register this bean within your servlet.xml or applicationContext.xml file:

<bean id="eventListenerBean" class="test.pack.age.ApplicationListenerBean" />

and Spring will notify it when the application context is initialized.

In Spring 3 (if you are using this version), the ApplicationListener class is generic and you can declare the event type that you are interested in, and the event will be filtered accordingly. You can simplify a bit your bean code like this:

public class ApplicationListenerBean implements ApplicationListener<ContextRefreshedEvent> {

    @Override
    public void onApplicationEvent(ContextRefreshedEvent event) {
        ApplicationContext applicationContext = event.getApplicationContext();
        // now you can do applicationContext.getBean(...)
        // ...
    }
}

wordpress contactform7 textarea cols and rows change in smaller screens

In the documentaion http://contactform7.com/text-fields/#textarea

[textarea* message id:contact-message 10x2 placeholder "Your Message"]

The above will generate a textarea with cols="10" and rows="2"

<textarea name="message" cols="10" rows="2" class="wpcf7-form-control wpcf7-textarea wpcf7-validates-as-required" id="contact-message" aria-required="true" aria-invalid="false" placeholder="Your Message"></textarea>

PreparedStatement with Statement.RETURN_GENERATED_KEYS

You mean something like this?

long key = -1L;

PreparedStatement preparedStatement = connection.prepareStatement(YOUR_SQL_HERE, PreparedStatement.RETURN_GENERATED_KEYS);
preparedStatement.setXXX(index, VALUE);
preparedStatement.executeUpdate();

ResultSet rs = preparedStatement.getGeneratedKeys();

if (rs.next()) {
    key = rs.getLong(1);
}

"The file "MyApp.app" couldn't be opened because you don't have permission to view it" when running app in Xcode 6 Beta 4

I had this issue when my appdelegate class was not linked against my main app target but a separate static framework. Linking it directly against the target app fixed the issue.

Web API Put Request generates an Http 405 Method Not Allowed error

This simple problem can cause a real headache!

I can see your controller EDIT (PUT) method expects 2 parameters: a) an int id, and b) a department object.

It is the default code when you generate this from VS > add controller with read/write options. However, you have to remember to consume this service using the two parameters, otherwise you will get the error 405.

In my case, I did not need the id parameter for PUT, so I just dropped it from the header... after a few hours of not noticing it there! If you keep it there, then the name must also be retained as id, unless you go on to make necessary changes to your configurations.

Copy entire contents of a directory to another using php

Like said elsewhere, copy only works with a single file for source and not a pattern. If you want to copy by pattern, use glob to determine the files, then run copy. This will not copy subdirectories though, nor will it create the destination directory.

function copyToDir($pattern, $dir)
{
    foreach (glob($pattern) as $file) {
        if(!is_dir($file) && is_readable($file)) {
            $dest = realpath($dir . DIRECTORY_SEPARATOR) . basename($file);
            copy($file, $dest);
        }
    }    
}
copyToDir('./test/foo/*.txt', './test/bar'); // copies all txt files

Installing tensorflow with anaconda in windows

To install TF on windows, follow the below-mentioned steps:

conda create --name tensorflow python=3.5
activate tensorflow
conda install jupyter
conda install scipy
pip install tensorflow-gpu

Use pip install tensorflow in place of pip install tensorflow-gpu, in case if you want to install CPU only version of TF.

Note: This installation has been tested with Anaconda Python 3.5 (64 bit). I have also tried the same installation steps with (a) Anaconda Python 3.6 (32 bit), (b) Anaconda Python 3.6 (64 bit), and (c) Anaconda Python 3.5 (32 bit), but all of them (i.e. (a), (b) and (c) ) failed.

Redirection of standard and error output appending to the same log file

Andy gave me some good pointers, but I wanted to do it in an even cleaner way. Not to mention that with the 2>&1 >> method PowerShell complained to me about the log file being accessed by another process, i.e. both stderr and stdout trying to lock the file for access, I guess. So here's how I worked it around.

First let's generate a nice filename, but that's really just for being pedantic:

$name = "sync_common"
$currdate = get-date -f yyyy-MM-dd
$logfile = "c:\scripts\$name\log\$name-$currdate.txt"

And here's where the trick begins:

start-transcript -append -path $logfile

write-output "starting sync"
robocopy /mir /copyall S:\common \\10.0.0.2\common 2>&1 | Write-Output
some_other.exe /exeparams 2>&1 | Write-Output
...
write-output "ending sync"

stop-transcript

With start-transcript and stop-transcript you can redirect ALL output of PowerShell commands to a single file, but it doesn't work correctly with external commands. So let's just redirect all the output of those to the stdout of PS and let transcript do the rest.

In fact, I have no idea why the MS engineers say they haven't fixed this yet "due to the high cost and technical complexities involved" when it can be worked around in such a simple way.

Either way, running every single command with start-process is a huge clutter IMHO, but with this method, all you gotta do is append the 2>&1 | Write-Output code to each line which runs external commands.

how to remove untracked files in Git?

Those are untracked files. This means git isn't tracking them. It's only listing them because they're not in the git ignore file. Since they're not being tracked by git, git reset won't touch them.

If you want to blow away all untracked files, the simplest way is git clean -f (use git clean -n instead if you want to see what it would destroy without actually deleting anything). Otherwise, you can just delete the files you don't want by hand.

HashMap(key: String, value: ArrayList) returns an Object instead of ArrayList?

Using generics (as in the above answers) is your best bet here. I've just double checked and:

test.put("test", arraylistone); 
ArrayList current = new ArrayList();
current = (ArrayList) test.get("test");

will work as well, through I wouldn't recommend it as the generics ensure that only the correct data is added, rather than trying to do the handling at retrieval time.

How to define Gradle's home in IDEA?

Installed on a Mac via Homebrew, the path

/usr/local/opt/gradle/libexec

is preferable to

/usr/local/Cellar/gradle/X.X/libexec

since the former will survive version upgrades.

How to test whether a service is running from the command line

You could use wmic with the /locale option

call wmic /locale:ms_409 service where (name="wsearch") get state /value | findstr State=Running
if %ErrorLevel% EQU 0 (
    echo Running
) else (
    echo Not running
)

Can CSS force a line break after each word in an element?

An alternative solution is described on Separate sentence to one word per line, by applying display:table-caption; to the element

How do I check if an element is really visible with JavaScript?

You can use the clientHeight or clientWidth properties

function isViewable(element){
  return (element.clientHeight > 0);
}

Algorithm to return all combinations of k elements from n

In C++ the following routine will produce all combinations of length distance(first,k) between the range [first,last):

#include <algorithm>

template <typename Iterator>
bool next_combination(const Iterator first, Iterator k, const Iterator last)
{
   /* Credits: Mark Nelson http://marknelson.us */
   if ((first == last) || (first == k) || (last == k))
      return false;
   Iterator i1 = first;
   Iterator i2 = last;
   ++i1;
   if (last == i1)
      return false;
   i1 = last;
   --i1;
   i1 = k;
   --i2;
   while (first != i1)
   {
      if (*--i1 < *i2)
      {
         Iterator j = k;
         while (!(*i1 < *j)) ++j;
         std::iter_swap(i1,j);
         ++i1;
         ++j;
         i2 = k;
         std::rotate(i1,j,last);
         while (last != j)
         {
            ++j;
            ++i2;
         }
         std::rotate(k,i2,last);
         return true;
      }
   }
   std::rotate(first,k,last);
   return false;
}

It can be used like this:

#include <string>
#include <iostream>

int main()
{
    std::string s = "12345";
    std::size_t comb_size = 3;
    do
    {
        std::cout << std::string(s.begin(), s.begin() + comb_size) << std::endl;
    } while (next_combination(s.begin(), s.begin() + comb_size, s.end()));

    return 0;
}

This will print the following:

123
124
125
134
135
145
234
235
245
345

Flutter - Layout a Grid

A simple example loading images into the tiles.

import 'package:flutter/material.dart';

void main() {
  runApp( MyApp());
}

class MyApp extends StatelessWidget {
  @override
  Widget build(BuildContext context) {
    return Container(

      color: Colors.white30,
      child: GridView.count(
          crossAxisCount: 4,
          childAspectRatio: 1.0,
          padding: const EdgeInsets.all(4.0),
          mainAxisSpacing: 4.0,
          crossAxisSpacing: 4.0,
          children: <String>[
            'http://www.for-example.org/img/main/forexamplelogo.png',
            'http://www.for-example.org/img/main/forexamplelogo.png',
            'http://www.for-example.org/img/main/forexamplelogo.png',
            'http://www.for-example.org/img/main/forexamplelogo.png',
            'http://www.for-example.org/img/main/forexamplelogo.png',
            'http://www.for-example.org/img/main/forexamplelogo.png',
            'http://www.for-example.org/img/main/forexamplelogo.png',
            'http://www.for-example.org/img/main/forexamplelogo.png',
            'http://www.for-example.org/img/main/forexamplelogo.png',
            'http://www.for-example.org/img/main/forexamplelogo.png',
            'http://www.for-example.org/img/main/forexamplelogo.png',
          ].map((String url) {
            return GridTile(
                child: Image.network(url, fit: BoxFit.cover));
          }).toList()),
    );
  }
}

The Flutter Gallery app contains a real world example, which can be found here.

enter image description here

Get current date, given a timezone in PHP?

Set the default time zone first and get the date then, the date will be in the time zone you specify :

<?php 
 date_default_timezone_set('America/New_York');
 $date= date('m-d-Y') ;
 ?>

http://php.net/manual/en/function.date-default-timezone-set.php

Looping through a Scripting.Dictionary using index/item number

Using d.Keys()(i) method is a very bad idea, because on each call it will re-create a new array (you will have significant speed reduction).

Here is an analogue of Scripting.Dictionary called "Hash Table" class from @TheTrick, that support such enumerator: http://www.cyberforum.ru/blogs/354370/blog2905.html

Dim oDict As clsTrickHashTable

Sub aaa()
    Set oDict = New clsTrickHashTable

    oDict.Add "a", "aaa"
    oDict.Add "b", "bbb"

    For i = 0 To oDict.Count - 1
        Debug.Print oDict.Keys(i) & " - " & oDict.Items(i)
    Next
End Sub

Laravel 5.4 ‘cross-env’ Is Not Recognized as an Internal or External Command

I think this log entry Local package.json exists, but node_modules missing, did you mean to install? has gave me the solution.

npm install && npm run dev

Convert decimal to hexadecimal in UNIX shell script

In zsh you can do this sort of thing:

% typeset -i 16 y
% print $(( [#8] x = 32, y = 32 ))
8#40
% print $x $y
8#40 16#20
% setopt c_bases
% print $y
0x20

Example taken from zsh docs page about Arithmetic Evaluation.

I believe Bash has similar capabilities.

How to increment a number by 2 in a PHP For Loop

<?php    
     $x = 1;

     for($x = 1; $x < 8; $x++) {
       $x = $x + 2;
       echo $x;
     };
?>

Difference between "read commited" and "repeatable read"

My observation on initial accepted solution.

Under RR (default mysql) - If a tx is open and a SELECT has been fired, another tx can NOT delete any row belonging to previous READ result set until previous tx is committed (in fact delete statement in the new tx will just hang), however the next tx can delete all rows from the table without any trouble. Btw, a next READ in previous tx will still see the old data until it is committed.

How to export the Html Tables data into PDF using Jspdf

Try to put

doc.fromHTML($('#target').get(0), 15, 15, {
    'width': 170,'elementHandlers': specialElementHandlers
});

instead of

doc.fromHTML($('#target').html(), 15, 15, {
    'width': 170,'elementHandlers': specialElementHandlers
});

How to convert an Object {} to an Array [] of key-value pairs in JavaScript

We can change Number to String type for Key like below:

_x000D_
_x000D_
var obj = {"1":5,"2":7,"3":0,"4":0,"5":0,"6":0,"7":0,"8":0,"9":0,"10":0,"11":0,"12":0}_x000D_
var result = Object.keys(obj).map(function(key) {_x000D_
  return [String(key), obj[key]];_x000D_
});_x000D_
    _x000D_
console.log(result);
_x000D_
_x000D_
_x000D_

How can I split a string into segments of n characters?

Here's a way to do it without regular expressions or explicit loops, although it's stretching the definition of a one liner a bit:

const input = 'abcdefghijlkm';

// Change `3` to the desired split length.
const output = input.split('').reduce((s, c) => {let l = s.length-1; (s[l] && s[l].length < 3) ? s[l] += c : s.push(c); return s;}, []);

console.log(output);  // output: [ 'abc', 'def', 'ghi', 'jlk', 'm' ]

It works by splitting the string into an array of individual characters, then using Array.reduce to iterate over each character. Normally reduce would return a single value, but in this case the single value happens to be an array, and as we pass over each character we append it to the last item in that array. Once the last item in the array reaches the target length, we append a new array item.

Check if object value exists within a Javascript array of objects and if not add a new object to array

I think that, this is the shortest way of addressing this problem. Here I have used ES6 arrow function with .filter to check the existence of newly adding username.

var arr = [{
    id: 1,
    username: 'fred'
}, {
    id: 2,
    username: 'bill'
}, {
    id: 3,
    username: 'ted'
}];

function add(name) {
    var id = arr.length + 1;        
            if (arr.filter(item=> item.username == name).length == 0){
            arr.push({ id: id, username: name });
        }
}

add('ted');
console.log(arr);

Link to Fiddle

Why are there no ++ and --? operators in Python?

as i understood it so you won't think the value in memory is changed. in c when you do x++ the value of x in memory changes. but in python all numbers are immutable hence the address that x pointed as still has x not x+1. when you write x++ you would think that x change what really happens is that x refrence is changed to a location in memory where x+1 is stored or recreate this location if doe's not exists.

Loading DLLs at runtime in C#

Activator.CreateInstance() returns an object, which doesn't have an Output method.

It looks like you come from dynamic programming languages? C# is definetly not that, and what you are trying to do will be difficult.

Since you are loading a specific dll from a specific location, maybe you just want to add it as a reference to your console application?

If you absolutely want to load the assembly via Assembly.Load, you will have to go via reflection to call any members on c

Something like type.GetMethod("Output").Invoke(c, null); should do it.

Comparison between Corona, Phonegap, Titanium

From what I've gathered, here are some differences between the two:

  • PhoneGap basically generates native wrappers for what are still web apps. It spits out a WhateverYourPlatformIs project, you build it, and deploy. If we're talking about the iPhone (which is where I spend my time), it doesn't seem much different from creating a web app launcher (a shortcut that gets its own Springboard icon, so you can launch it like (like) a native app). The "app" itself is still html/js/etc., and runs inside a hosted browser control. What PhoneGap provides beyond that is a bridge between JavaScript and native device APIs. So, you write JavaScript against PhoneGap APIs, and PhoneGap then makes the appropriate corresponding native call. In that respect, it is different from deploying a plain old web app.

  • Titanium source gets compiled down to native bits. That is, your html/js/etc. aren't simply attached to a project and then hosted inside a web browser control - they're turned into native apps. That means, for example, that your app's interface will be composed of native UI components. There are ways of getting native look-and-feel without having a native app, but... well... what a nightmare that usually turns out to be.

The two are similar in that you write all your stuff using typical web technologies (html/js/css/blah blah blah), and that you get access to native functionality through custom JavaScript APIs.

But, again, PhoneGap apps (PhonGapps? I don't know... is that a stupid name? It's easier to say - I know that much) start their lives as web apps and end their lives as web apps. On the iPhone, your html/js/etc. is just executed inside a UIWebView control, and the PhoneGap JavaScript APIs your js calls are routed to native APIs.

Titanium apps become native apps - they're just developed using web dev tech.

What does this actually mean?

  1. A Titanium app will look like a "real" app because, ultimately, it is a "real" app.

  2. A PhoneGap app will look like a web app being hosted in a browser control because, ultimately, it is a web app being hosted in a browser control.

Which is right for you?

  • If you want to write native apps using web dev skills, Titanium is your best bet.

  • If you want to write an app using web dev skills that you could realistically deploy to multiple platforms (iPhone, Android, Blackberry, and whatever else they decide to include), and if you want access to a subset of native platform features (GPS, accelerometer, etc.) through a unified JavaScript API, PhoneGap is probably what you want.

You might be asking: Why would I want to write a PhoneGapp (I've decided to use the name) rather than a web app that's hosted on the web? Can't I still access some native device features that way, but also have the convenience of true web deployment rather than forcing the user to download my "native" app and install it?

The answer is: Because you can submit your PhoneGapp to the App Store and charge for it. You also get that launcher icon, which makes it harder for the user to forget about your app (I'm far more likely to forget about a bookmark than an app icon).

You could certainly charge for access to your web-hosted web app, but how many people are really going to go through the process to do that? With the App Store, I pick an app, tap the "Buy" button, enter a password, and I'm done. It installs. Seconds later, I'm using it. If I had to use someone else's one-off mobile web transaction interface, which likely means having to tap out my name, address, phone number, CC number, and other things I don't want to tap out, I almost certainly wouldn't go through with it. Also, I trust Apple - I'm confident Steve Jobs isn't going to log my info and then charge a bunch of naughty magazine subscriptions to my CC for kicks.

Anyway, except for the fact that web dev tech is involved, PhoneGap and Titanium are very different - to the point of being only superficially comparable.

I hate web apps, by the by, and if you read iTunes App Store reviews, users are pretty good at spotting them. I won't name any names, but I have a couple "apps" on my phone that look and run like garbage, and it's because they're web apps that are hosted inside UIWebView instances. If I wanted to use a web app, I'd open Safari and, you know, navigate to one. I bought an iPhone because I want things that are iPhone-y. I have no problem using, say, a snazzy Google web app inside Safari, but I'd feel cheated if Google just snuck a bookmark onto Springboard by presenting a web app as a native one.

Have to go now. My girlfriend has that could-you-please-stop-using-that-computer-for-three-seconds look on her face.

Sending E-mail using C#

Use the namespace System.Net.Mail. Here is a link to the MSDN page

You can send emails using SmtpClient class.

I paraphrased the code sample, so checkout MSDNfor details.

MailMessage message = new MailMessage(
   "[email protected]",
   "[email protected]",
   "Subject goes here",
   "Body goes here");

SmtpClient client = new SmtpClient(server);
client.Send(message);

The best way to send many emails would be to put something like this in forloop and send away!

Can you test google analytics on a localhost address?

I just want to add to what's been said so far, it may save a lot of headache, you don't need to wait 24 hour to see if it works, yes the total overview take 24 hour, but in Reporting tab, there is a link on left side to Real-Time result and it will show if anyone currently visiting your site, also I didn't have to set 'cookieDomain': 'none' for it to work on localhost, my setting is on 'auto' and it works just fine (I'm using MVC 5), on top of that I've added the script at the end of head tag as google stated in this page:

Paste your snippet (unaltered, in its entirety) into every web page you want to track. Paste it immediately before the closing </head> tag.

here is more info on how to check to see if analytics works properly.

Microsoft.ReportViewer.Common Version=12.0.0.0

Issue

Parser Error Message: Could not load file or assembly 'Microsoft.ReportViewer.WebForms / Winforms, Version=12.0.0.0, Culture=neutral, PublicKeyToken=89845dcd8080cc91' or one of its dependencies. The system cannot find the file specified.

Cause

Microsoft ReportViewer runtime and SQL CLR Types for SQL Server 2014 is required to run and is missing from the server hosting Internet Information Services (IIS) or your application.

Resolution

Install the following packages on the IIS server and then restart the system:

Download Microsoft ReportViewer runtime

Download Microsoft SQL CLR types for SQL Server 2014

Once restarted connect to Web service / Your app again and verify that the error has been resolved.

Or you cant follow this link to read more.

DevTools failed to load SourceMap: Could not load content for chrome-extension

That's because Chrome added support for source maps.

Go to the developer tools (F12 in the browser), then select the three dots in the upper right corner, and go to Settings.

Then, look for Sources, and disable the options: "Enable javascript source maps" "Enable CSS source maps"

If you do that, that would get rid of the warnings. It has nothing to do with your code. Check the developer tools in other pages and you will see the same warning.

Python class returning value

the worked proposition for me is __call__ on class who create list of little numbers:

import itertools
    
class SmallNumbers:
    def __init__(self, how_much):
        self.how_much = int(how_much)
        self.work_list = ['0', '1', '2', '3', '4', '5', '6', '7', '8', '9']
        self.generated_list = ['0', '1', '2', '3', '4', '5', '6', '7', '8', '9']
        start = 10
        end = 100
        for cmb in range(2, len(str(self.how_much)) + 1):
            self.ListOfCombinations(is_upper_then=start, is_under_then=end, combinations=cmb)
            start *= 10
            end *= 10

    def __call__(self, number, *args, **kwargs):
        return self.generated_list[number]

    def ListOfCombinations(self, is_upper_then, is_under_then, combinations):
        multi_work_list = eval(str('self.work_list,') * combinations)
        nbr = 0
        for subset in itertools.product(*multi_work_list):
            if is_upper_then <= nbr < is_under_then:
                self.generated_list.append(''.join(subset))
                if self.how_much == nbr:
                    break
            nbr += 1

and to run it:

if __name__ == '__main__':
        sm = SmallNumbers(56)
        print(sm.generated_list)
        print(sm.generated_list[34], sm.generated_list[27], sm.generated_list[10])
        print('The Best', sm(15), sm(55), sm(49), sm(0))

result

['0', '1', '2', '3', '4', '5', '6', '7', '8', '9', '10', '11', '12', '13', '14', '15', '16', '17', '18', '19', '20', '21', '22', '23', '24', '25', '26', '27', '28', '29', '30', '31', '32', '33', '34', '35', '36', '37', '38', '39', '40', '41', '42', '43', '44', '45', '46', '47', '48', '49', '50', '51', '52', '53', '54', '55', '56']
34 27 10
The Best 15 55 49 0

Can't execute jar- file: "no main manifest attribute"

I had the same issue today. My problem was solved my moving META-INF to the resources folder.

Trigger an event on `click` and `enter`

$('#usersSearch').keyup(function() { // handle keyup event on search input field

    var key = e.which || e.keyCode;  // store browser agnostic keycode

    if(key == 13) 
        $(this).closest('form').submit(); // submit parent form
}

How to create a Multidimensional ArrayList in Java?

Wouldn't List<ArrayList<String>> 2dlist = new ArrayList<ArrayList<String>>(); be a better (more efficient) implementation?

grep a tab in UNIX

A good choice is to use 'sed as grep' (as explained in this classical sed tutorial).

sed -n 's/pattern/&/p' file

Examples (works in bash, sh, ksh, csh,..):

[~]$ cat testfile
12 3
1 4 abc
xa      c
        a       c\2
1 23

[~]$ sed -n 's/\t/&/p' testfile 
xa      c
        a       c\2

[~]$ sed -n 's/\ta\t/&/p' testfile
        a       c\2

Scroll to element on click in Angular 4

You could do it like this:

<button (click)="scroll(target)"></button>
<div #target>Your target</div>

and then in your component:

scroll(el: HTMLElement) {
    el.scrollIntoView();
}

Edit: I see comments stating that this no longer works due to the element being undefined. I created a StackBlitz example in Angular 7 and it still works. Can someone please provide an example where it does not work?

How can one pull the (private) data of one's own Android app?

On MacOSX, by combining the answers from Calaf and Ollie Ford, the following worked for me.

On the command line (be sure adb is in your path, mine was at ~/Library/Android/sdk/platform-tools/adb) and with your android device plugged in and in USB debugging mode, run:

 adb backup -f backup com.mypackage.myapp

Your android device will ask you for permission to backup your data. Select "BACKUP MY DATA"

Wait a few moments.

The file backup will appear in the directory where you ran adb.

Now run:

dd if=backup bs=1 skip=24 | python -c "import zlib,sys;sys.stdout.write(zlib.decompress(sys.stdin.read()))" > backup.tar

Now you'll you have a backup.tar file you can untar like this:

 tar xvf backup.tar

And see all the files stored by your application.

How do I search for names with apostrophe in SQL Server?

That's:

SELECT * FROM Header 
WHERE (userID LIKE '%''%')

file_get_contents() how to fix error "Failed to open stream", "No such file"

You may try using this

<?php
$json = json_decode(file_get_contents('./prod.api.pvp.net/api/lol/euw/v1.1/game/by-summoner/20986461/recent?api_key=*key*'));
print_r($json);
?>

The "./" allows to search url from current directory. You may use

chdir($_SERVER["DOCUMENT_ROOT"]);

to change current working directory to root of your website if path is relative from root directory.

C++ Get name of type in template

If you'd like a pretty_name, Logan Capaldo's solution can't deal with complex data structure: REGISTER_PARSE_TYPE(map<int,int>) and typeid(map<int,int>).name() gives me a result of St3mapIiiSt4lessIiESaISt4pairIKiiEEE

There is another interesting answer using unordered_map or map comes from https://en.cppreference.com/w/cpp/types/type_index.

#include <iostream>
#include <unordered_map>
#include <map>
#include <typeindex>
using namespace std;
unordered_map<type_index,string> types_map_;

int main(){
    types_map_[typeid(int)]="int";
    types_map_[typeid(float)]="float";
    types_map_[typeid(map<int,int>)]="map<int,int>";

    map<int,int> mp;
    cout<<types_map_[typeid(map<int,int>)]<<endl;
    cout<<types_map_[typeid(mp)]<<endl;
    return 0;
}

Cannot create SSPI context

Here is my case. I had a remote machine that hosted SQL Server. From my local machine, I was trying to access the SQL instance via some C# code and I was getting this error. My password for the user account on my machine/domain had expired. I fixed it with the following:

  1. Opened the remote machine, which prompted me for a password change
  2. I changed my password within this prompt and logged into the remote machine
  3. I "locked" my local machine (using windows + L key so I didn't have to completely sign off) so that I could get back to the sign-on page
  4. I signed back onto my local machine with the new password

Everything then worked fine.

How to convert a string or integer to binary in Ruby?

I am almost a decade late but if someone still come here and want to find the code without using inbuilt function like to_S then I might be helpful.

find the binary

def find_binary(number)
  binary = []  
  until(number == 0)
    binary << number%2
    number = number/2
  end
  puts binary.reverse.join
end

Difference between ${} and $() in Bash

The syntax is token-level, so the meaning of the dollar sign depends on the token it's in. The expression $(command) is a modern synonym for `command` which stands for command substitution; it means run command and put its output here. So

echo "Today is $(date). A fine day."

will run the date command and include its output in the argument to echo. The parentheses are unrelated to the syntax for running a command in a subshell, although they have something in common (the command substitution also runs in a separate subshell).

By contrast, ${variable} is just a disambiguation mechanism, so you can say ${var}text when you mean the contents of the variable var, followed by text (as opposed to $vartext which means the contents of the variable vartext).

The while loop expects a single argument which should evaluate to true or false (or actually multiple, where the last one's truth value is examined -- thanks Jonathan Leffler for pointing this out); when it's false, the loop is no longer executed. The for loop iterates over a list of items and binds each to a loop variable in turn; the syntax you refer to is one (rather generalized) way to express a loop over a range of arithmetic values.

A for loop like that can be rephrased as a while loop. The expression

for ((init; check; step)); do
    body
done

is equivalent to

init
while check; do
    body
    step
done

It makes sense to keep all the loop control in one place for legibility; but as you can see when it's expressed like this, the for loop does quite a bit more than the while loop.

Of course, this syntax is Bash-specific; classic Bourne shell only has

for variable in token1 token2 ...; do

(Somewhat more elegantly, you could avoid the echo in the first example as long as you are sure that your argument string doesn't contain any % format codes:

date +'Today is %c. A fine day.'

Avoiding a process where you can is an important consideration, even though it doesn't make a lot of difference in this isolated example.)

Is it possible to set a custom font for entire of application?

I would like to improve weston's answer for API 21 Android 5.0.

Cause

Under API 21, most of the text styles include fontFamily setting, like:

<style name="TextAppearance.Material">
     <item name="fontFamily">@string/font_family_body_1_material</item>
</style>

Which applys the default Roboto Regular font:

<string name="font_family_body_1_material">sans-serif</string>

The original answer fails to apply monospace font, because android:fontFamily has greater priority to android:typeface attribute (reference). Using Theme.Holo.* is a valid workaround, because there is no android:fontFamily settings inside.

Solution

Since Android 5.0 put system typeface in static variable Typeface.sSystemFontMap (reference), we can use the same reflection technique to replace it:

protected static void replaceFont(String staticTypefaceFieldName,
        final Typeface newTypeface) {
    if (isVersionGreaterOrEqualToLollipop()) {
        Map<String, Typeface> newMap = new HashMap<String, Typeface>();
        newMap.put("sans-serif", newTypeface);
        try {
            final Field staticField = Typeface.class
                    .getDeclaredField("sSystemFontMap");
            staticField.setAccessible(true);
            staticField.set(null, newMap);
        } catch (NoSuchFieldException e) {
            e.printStackTrace();
        } catch (IllegalAccessException e) {
            e.printStackTrace();
        }
    } else {
        try {
            final Field staticField = Typeface.class
                    .getDeclaredField(staticTypefaceFieldName);
            staticField.setAccessible(true);
            staticField.set(null, newTypeface);
        } catch (NoSuchFieldException e) {
            e.printStackTrace();
        } catch (IllegalAccessException e) {
            e.printStackTrace();
        }
    }
}

Write output to a text file in PowerShell

The simplest way is to just redirect the output, like so:

Compare-Object $(Get-Content c:\user\documents\List1.txt) $(Get-Content c:\user\documents\List2.txt) > c:\user\documents\diff_output.txt

> will cause the output file to be overwritten if it already exists.
>> will append new text to the end of the output file if it already exists.

How to print the data in byte array as characters?

How about Arrays.toString(byteArray)?

Here's some compilable code:

byte[] byteArray = new byte[] { -1, -128, 1, 127 };
System.out.println(Arrays.toString(byteArray));

Output:

[-1, -128, 1, 127]

Why re-invent the wheel...

How to preview an image before and after upload?

meVeekay's answer was good and am just making it more improvised by doing 2 things.

  1. Check whether browser supports HTML5 FileReader() or not.

  2. Allow only image file to be upload by checking its extension.

HTML :

<div id="wrapper">
    <input id="fileUpload" type="file" />
    <br />
    <div id="image-holder"></div>
</div> 

jQuery :

$("#fileUpload").on('change', function () {

    var imgPath = $(this)[0].value;
    var extn = imgPath.substring(imgPath.lastIndexOf('.') + 1).toLowerCase();

    if (extn == "gif" || extn == "png" || extn == "jpg" || extn == "jpeg") {
        if (typeof (FileReader) != "undefined") {

            var image_holder = $("#image-holder");
            image_holder.empty();

            var reader = new FileReader();
            reader.onload = function (e) {
                $("<img />", {
                    "src": e.target.result,
                        "class": "thumb-image"
                }).appendTo(image_holder);

            }
            image_holder.show();
            reader.readAsDataURL($(this)[0].files[0]);
        } else {
            alert("This browser does not support FileReader.");
        }
    } else {
        alert("Pls select only images");
    }
});

For detail understanding of FileReader()

Check this Article : Using FileReader() preview image before uploading.

Batch files - number of command line arguments

Googling a bit gives you the following result from wikibooks:

set argC=0
for %%x in (%*) do Set /A argC+=1

echo %argC%

Seems like cmd.exe has evolved a bit from the old DOS days :)

if statement checks for null but still throws a NullPointerException

Change Below line

if (str == null | str.length() == 0) {

into

if (str == null || str.isEmpty()) {

now your code will run corectlly. Make sure str.isEmpty() comes after str == null because calling isEmpty() on null will cause NullPointerException. Because of Java uses Short-circuit evaluation when str == null is true it will not evaluate str.isEmpty()

HashMap: One Key, multiple Values

Write a new class that holds all the values that you need and use the new class's object as the value in your HashMap

HashMap<String, MyObject>

class MyObject {
public String value1;
public int value2;
public List<String> value3;
}

Custom events in jQuery?

Take a look at this:

(reprinted from the expired blog page http://jamiethompson.co.uk/web/2008/06/17/publish-subscribe-with-jquery/ based on the archived version at http://web.archive.org/web/20130120010146/http://jamiethompson.co.uk/web/2008/06/17/publish-subscribe-with-jquery/)


Publish / Subscribe With jQuery

June 17th, 2008

With a view to writing a jQuery UI integrated with the offline functionality of Google Gears i’ve been toying with some code to poll for network connection status using jQuery.

The Network Detection Object

The basic premise is very simple. We create an instance of a network detection object which will poll a URL at regular intervals. Should these HTTP requests fail we can assume that network connectivity has been lost, or the server is simply unreachable at the current time.

$.networkDetection = function(url,interval){
    var url = url;
    var interval = interval;
    online = false;
    this.StartPolling = function(){
        this.StopPolling();
        this.timer = setInterval(poll, interval);
    };
    this.StopPolling = function(){
        clearInterval(this.timer);
    };
    this.setPollInterval= function(i) {
        interval = i;
    };
    this.getOnlineStatus = function(){
        return online;
    };
    function poll() {
        $.ajax({
            type: "POST",
            url: url,
            dataType: "text",
            error: function(){
                online = false;
                $(document).trigger('status.networkDetection',[false]);
            },
            success: function(){
                online = true;
                $(document).trigger('status.networkDetection',[true]);
            }
        });
    };
};

You can view the demo here. Set your browser to work offline and see what happens…. no, it’s not very exciting.

Trigger and Bind

What is exciting though (or at least what is exciting me) is the method by which the status gets relayed through the application. I’ve stumbled upon a largely un-discussed method of implementing a pub/sub system using jQuery’s trigger and bind methods.

The demo code is more obtuse than it need to be. The network detection object publishes ’status ‘events to the document which actively listens for them and in turn publishes ‘notify’ events to all subscribers (more on those later). The reasoning behind this is that in a real world application there would probably be some more logic controlling when and how the ‘notify’ events are published.

$(document).bind("status.networkDetection", function(e, status){
    // subscribers can be namespaced with multiple classes
    subscribers = $('.subscriber.networkDetection');
    // publish notify.networkDetection even to subscribers
    subscribers.trigger("notify.networkDetection", [status])
    /*
    other logic based on network connectivity could go here
    use google gears offline storage etc
    maybe trigger some other events
    */
});

Because of jQuery’s DOM centric approach events are published to (triggered on) DOM elements. This can be the window or document object for general events or you can generate a jQuery object using a selector. The approach i’ve taken with the demo is to create an almost namespaced approach to defining subscribers.

DOM elements which are to be subscribers are classed simply with “subscriber” and “networkDetection”. We can then publish events only to these elements (of which there is only one in the demo) by triggering a notify event on $(“.subscriber.networkDetection”)

The #notifier div which is part of the .subscriber.networkDetection group of subscribers then has an anonymous function bound to it, effectively acting as a listener.

$('#notifier').bind("notify.networkDetection",function(e, online){
    // the following simply demonstrates
    notifier = $(this);
    if(online){
        if (!notifier.hasClass("online")){
            $(this)
                .addClass("online")
                .removeClass("offline")
                .text("ONLINE");
        }
    }else{
        if (!notifier.hasClass("offline")){
            $(this)
                .addClass("offline")
                .removeClass("online")
                .text("OFFLINE");
        }
    };
});

So, there you go. It’s all pretty verbose and my example isn’t at all exciting. It also doesn’t showcase anything interesting you could do with these methods, but if anyone’s at all interested to dig through the source feel free. All the code is inline in the head of the demo page

pycharm convert tabs to spaces automatically

ctrl + shift + A => open pop window to select options, select to spaces to convert all tabs as space, or to tab to convert all spaces as tab.

How to unapply a migration in ASP.NET Core with EF Core

Use:

CLI

> dotnet ef database update <previous-migration-name>

Package Manager Console

PM> Update-Database <previous-migration-name>

Example:

PM> Update-Database MyInitialMigration

Then try to remove last migration.

Removing migration without database update doesn't work because you applied changes to database.

If using PMC, Try: PM> update-database 0 This will wipe the database and allow you to remove the Migration Snapshot on your Solution

Change background color of iframe issue

An <iframe> background can be changed like this:

<iframe allowtransparency="true" style="background: #FFFFFF;" 
    src="http://zingaya.com/widget/9d043c064dc241068881f045f9d8c151" 
    frameborder="0" height="184" width="100%">
</iframe>

I don't think it's possible to change the background of the page that you have loaded in the iframe.

How do I properly set the Datetimeindex for a Pandas datetime object in a dataframe?

You are not creating datetime index properly,

format = '%Y-%m-%d %H:%M:%S'
df['Datetime'] = pd.to_datetime(df['date'] + ' ' + df['time'], format=format)
df = df.set_index(pd.DatetimeIndex(df['Datetime']))

Hashset vs Treeset

If you aren't inserting enough elements to result in frequent rehashings (or collisions, if your HashSet can't resize), a HashSet certainly gives you the benefit of constant time access. But on sets with lots of growth or shrinkage, you may actually get better performance with Treesets, depending on the implementation.

Amortized time can be close to O(1) with a functional red-black tree, if memory serves me. Okasaki's book would have a better explanation than I can pull off. (Or see his publication list)

Why does Java have an "unreachable statement" compiler error?

If the reason for allowing if (aBooleanVariable) return; someMoreCode; is to allow flags, then the fact that if (true) return; someMoreCode; does not generate a compile time error seems like inconsistency in the policy of generating CodeNotReachable exception, since the compiler 'knows' that true is not a flag (not a variable).

Two other ways which might be interesting, but don't apply to switching off part of a method's code as well as if (true) return:

Now, instead of saying if (true) return; you might want to say assert false and add -ea OR -ea package OR -ea className to the jvm arguments. The good point is that this allows for some granularity and requires adding an extra parameter to the jvm invocation so there is no need of setting a DEBUG flag in the code, but by added argument at runtime, which is useful when the target is not the developer machine and recompiling & transferring bytecode takes time.

There is also the System.exit(0) way, but this might be an overkill, if you put it in Java in a JSP then it will terminate the server.

Apart from that Java is by-design a 'nanny' language, I would rather use something native like C/C++ for more control.

load scripts asynchronously

One reason why your scripts could be loading so slowly is if you were running all of your scripts while loading the page, like this:

callMyFunctions();

instead of:

$(window).load(function() {
      callMyFunctions();
});

This second bit of script waits until the browser has completely loaded all of your Javascript code before it starts executing any of your scripts, making it appear to the user that the page has loaded faster.

If you're looking to enhance the user's experience by decreasing the loading time, I wouldn't go for the "loading screen" option. In my opinion that would be much more annoying than just having the page load more slowly.

Plot multiple columns on the same graph in R

The easiest is to convert your data to a "tall" format.

s <- 
"A       B        C       G       Xax
0.451   0.333   0.034   0.173   0.22        
0.491   0.270   0.033   0.207   0.34    
0.389   0.249   0.084   0.271   0.54    
0.425   0.819   0.077   0.281   0.34
0.457   0.429   0.053   0.386   0.53    
0.436   0.524   0.049   0.249   0.12    
0.423   0.270   0.093   0.279   0.61    
0.463   0.315   0.019   0.204   0.23
"
d <- read.delim(textConnection(s), sep="")

library(ggplot2)
library(reshape2)
d <- melt(d, id.vars="Xax")

# Everything on the same plot
ggplot(d, aes(Xax,value, col=variable)) + 
  geom_point() + 
  stat_smooth() 

# Separate plots
ggplot(d, aes(Xax,value)) + 
  geom_point() + 
  stat_smooth() +
  facet_wrap(~variable)

Content type 'application/x-www-form-urlencoded;charset=UTF-8' not supported for @RequestBody MultiValueMap

@RequestBody MultiValueMap paramMap

in here Remove the @RequestBody Annotaion

@RequestMapping(value = "/signin",method = RequestMethod.POST)
public String createAccount(@RequestBody LogingData user){
    logingService.save(user);
    return "login";
}




@RequestMapping(value = "/signin",method = RequestMethod.POST)
public String createAccount( LogingData user){
    logingService.save(user);
    return "login";
} 

like that

How to convert Javascript datetime to C# datetime?

I think you can use the TimeZoneInfo....to convert the datetime....

    static void Main(string[] args)
    {
        long time = 1310522400000;
        DateTime dt_1970 = new DateTime(1970, 1, 1);
        long tricks_1970 = dt_1970.Ticks;
        long time_tricks = tricks_1970 + time * 10000;
        DateTime dt = new DateTime(time_tricks);

        Console.WriteLine(dt.ToShortDateString()); // result : 7/13
        dt = TimeZoneInfo.ConvertTimeToUtc(dt);

        Console.WriteLine(dt.ToShortDateString());  // result : 7/12
        Console.Read();
    }

Open a webpage in the default browser

or sometimes it's very easy just type Process.Start("http://www.example.com/")

then change the http://www.example.com/")

How to "properly" create a custom object in JavaScript?

Creating an object

The easiest way to create an object in JavaScript is to use the following syntax :

_x000D_
_x000D_
var test = {_x000D_
  a : 5,_x000D_
  b : 10,_x000D_
  f : function(c) {_x000D_
    return this.a + this.b + c;_x000D_
  }_x000D_
}_x000D_
_x000D_
console.log(test);_x000D_
console.log(test.f(3));
_x000D_
_x000D_
_x000D_

This works great for storing data in a structured way.

For more complex use cases, however, it's often better to create instances of functions :

_x000D_
_x000D_
function Test(a, b) {_x000D_
  this.a = a;_x000D_
  this.b = b;_x000D_
  this.f = function(c) {_x000D_
return this.a + this.b + c;_x000D_
  };_x000D_
}_x000D_
_x000D_
var test = new Test(5, 10);_x000D_
console.log(test);_x000D_
console.log(test.f(3));
_x000D_
_x000D_
_x000D_

This allows you to create multiple objects that share the same "blueprint", similar to how you use classes in eg. Java.

This can still be done more efficiently, however, by using a prototype.

Whenever different instances of a function share the same methods or properties, you can move them to that object's prototype. That way, every instance of a function has access to that method or property, but it doesn't need to be duplicated for every instance.

In our case, it makes sense to move the method f to the prototype :

_x000D_
_x000D_
function Test(a, b) {_x000D_
  this.a = a;_x000D_
  this.b = b;_x000D_
}_x000D_
_x000D_
Test.prototype.f = function(c) {_x000D_
  return this.a + this.b + c;_x000D_
};_x000D_
_x000D_
var test = new Test(5, 10);_x000D_
console.log(test);_x000D_
console.log(test.f(3));
_x000D_
_x000D_
_x000D_

Inheritance

A simple but effective way to do inheritance in JavaScript, is to use the following two-liner :

B.prototype = Object.create(A.prototype);
B.prototype.constructor = B;

That is similar to doing this :

B.prototype = new A();

The main difference between both is that the constructor of A is not run when using Object.create, which is more intuitive and more similar to class based inheritance.

You can always choose to optionally run the constructor of A when creating a new instance of B by adding adding it to the constructor of B :

function B(arg1, arg2) {
    A(arg1, arg2); // This is optional
}

If you want to pass all arguments of B to A, you can also use Function.prototype.apply() :

function B() {
    A.apply(this, arguments); // This is optional
}

If you want to mixin another object into the constructor chain of B, you can combine Object.create with Object.assign :

B.prototype = Object.assign(Object.create(A.prototype), mixin.prototype);
B.prototype.constructor = B;

Demo

_x000D_
_x000D_
function A(name) {_x000D_
  this.name = name;_x000D_
}_x000D_
_x000D_
A.prototype = Object.create(Object.prototype);_x000D_
A.prototype.constructor = A;_x000D_
_x000D_
function B() {_x000D_
  A.apply(this, arguments);_x000D_
  this.street = "Downing Street 10";_x000D_
}_x000D_
_x000D_
B.prototype = Object.create(A.prototype);_x000D_
B.prototype.constructor = B;_x000D_
_x000D_
function mixin() {_x000D_
_x000D_
}_x000D_
_x000D_
mixin.prototype = Object.create(Object.prototype);_x000D_
mixin.prototype.constructor = mixin;_x000D_
_x000D_
mixin.prototype.getProperties = function() {_x000D_
  return {_x000D_
    name: this.name,_x000D_
    address: this.street,_x000D_
    year: this.year_x000D_
  };_x000D_
};_x000D_
_x000D_
function C() {_x000D_
  B.apply(this, arguments);_x000D_
  this.year = "2018"_x000D_
}_x000D_
_x000D_
C.prototype = Object.assign(Object.create(B.prototype), mixin.prototype);_x000D_
C.prototype.constructor = C;_x000D_
_x000D_
var instance = new C("Frank");_x000D_
console.log(instance);_x000D_
console.log(instance.getProperties());
_x000D_
_x000D_
_x000D_


Note

Object.create can be safely used in every modern browser, including IE9+. Object.assign does not work in any version of IE nor some mobile browsers. It is recommended to polyfill Object.create and/or Object.assign if you want to use them and support browsers that do not implement them.

You can find a polyfill for Object.create here and one for Object.assign here.

Pandas groupby: How to get a union of strings

You can use the apply method to apply an arbitrary function to the grouped data. So if you want a set, apply set. If you want a list, apply list.

>>> d
   A       B
0  1    This
1  2      is
2  3       a
3  4  random
4  1  string
5  2       !
>>> d.groupby('A')['B'].apply(list)
A
1    [This, string]
2           [is, !]
3               [a]
4          [random]
dtype: object

If you want something else, just write a function that does what you want and then apply that.

How to insert data into SQL Server

string saveStaff = "INSERT into student (stud_id,stud_name) " + " VALUES ('" + SI+ "', '" + SN + "');";
cmd = new SqlCommand(saveStaff,con);
cmd.ExecuteNonQuery();

How to create a stacked bar chart for my DataFrame using seaborn?

You could use pandas plot as @Bharath suggest:

import seaborn as sns
sns.set()
df.set_index('App').T.plot(kind='bar', stacked=True)

Output:

enter image description here

Updated:

from matplotlib.colors import ListedColormap df.set_index('App')\ .reindex_axis(df.set_index('App').sum().sort_values().index, axis=1)\ .T.plot(kind='bar', stacked=True, colormap=ListedColormap(sns.color_palette("GnBu", 10)), figsize=(12,6))

Updated Pandas 0.21.0+ reindex_axis is deprecated, use reindex

from matplotlib.colors import ListedColormap

df.set_index('App')\
  .reindex(df.set_index('App').sum().sort_values().index, axis=1)\
  .T.plot(kind='bar', stacked=True,
          colormap=ListedColormap(sns.color_palette("GnBu", 10)), 
          figsize=(12,6))

Output:

enter image description here

MySQL 1062 - Duplicate entry '0' for key 'PRIMARY'

For me, i forget to add AUTO_INCREMENT to my primary field and inserted data without id.

Check if value exists in dataTable?

You can use LINQ-to-DataSet with Enumerable.Any:

String author = "John Grisham";
bool contains = tbl.AsEnumerable().Any(row => author == row.Field<String>("Author"));

Another approach is to use DataTable.Select:

DataRow[] foundAuthors = tbl.Select("Author = '" + searchAuthor + "'");
if(foundAuthors.Length != 0)
{
    // do something...
}

Q: what if we do not know the columns Headers and we want to find if any cell value PEPSI exist in any rows'c columns? I can loop it all to find out but is there a better way? –

Yes, you can use this query:

DataColumn[] columns = tbl.Columns.Cast<DataColumn>().ToArray();
bool anyFieldContainsPepsi = tbl.AsEnumerable()
    .Any(row => columns.Any(col => row[col].ToString() == "PEPSI"));

Case insensitive string compare in LINQ-to-SQL

If you pass a string that is case-insensitive into LINQ-to-SQL it will get passed into the SQL unchanged and the comparison will happen in the database. If you want to do case-insensitive string comparisons in the database all you need to to do is create a lambda expression that does the comparison and the LINQ-to-SQL provider will translate that expression into a SQL query with your string intact.

For example this LINQ query:

from user in Users
where user.Email == "[email protected]"
select user

gets translated to the following SQL by the LINQ-to-SQL provider:

SELECT [t0].[Email]
FROM [User] AS [t0]
WHERE [t0].[Email] = @p0
-- note that "@p0" is defined as nvarchar(11)
-- and is passed my value of "[email protected]"

As you can see, the string parameter will be compared in SQL which means things ought to work just the way you would expect them to.

Declaring array of objects

Try this-

var arr = [];
arr.push({});

java.lang.NoClassDefFoundError: org/json/JSONObject

The Exception it self says it all java.lang.ClassNotFoundException: org.json.JSONObject

You have not added the necessary jar file which will be having org.json.JSONObject class to your classpath.

You can Download it From Here

SQL: Alias Column Name for Use in CASE Statement

@OMG Ponies - One of my reasons of not using the following code

SELECT t.col1 as a, 
     CASE WHEN t.col1 = 'test' THEN 'yes' END as value 
FROM TABLE t;

can be that the t.col1 is not an actual column in the table. For example, it can be a value from a XML column like

Select XMLColumnName.value('(XMLPathOfTag)[1]', 'varchar(max)') 
as XMLTagAlias from Table

How to create file execute mode permissions in Git on Windows?

The note is firstly you must sure about filemode set to false in config git file, or use this command:

git config core.filemode false

and then you can set 0777 permission with this command:

git update-index --chmod=+x foo.sh

Export DataBase with MySQL Workbench with INSERT statements

If you want to export just single table, or subset of data from some table, you can do it directly from result window:

  1. Click export button: enter image description here

  2. Change Save as type to "SQL Insert statements" enter image description here

How to detect a mobile device with JavaScript?

Determine what the User Agent is for the devices that you need to simulate and then test a variable against that.

for example:

// var userAgent = navigator.userAgent.toLowerCase(); // this would actually get the user agent

var userAgent = "iphone"; /* Simulates User Agent for iPhone */
if (userAgent.indexOf('iphone') != -1) {
   // some code here
}

How to add icon inside EditText view in Android ?

If you want to use Android's default drawable, you can use @android:drawable/ic_menu_search like this:

<EditText android:id="@+id/inputSearch"
    android:layout_width="fill_parent"
    android:layout_height="wrap_content"
    android:drawableLeft="@android:drawable/ic_menu_search"
    android:hint="Search product.."
    android:inputType="textVisiblePassword"/>

Adding and reading from a Config file

Configuration configManager = ConfigurationManager.OpenExeConfiguration(ConfigurationUserLevel.None);
KeyValueConfigurationCollection confCollection = configManager.AppSettings.Settings;

confCollection["YourKey"].Value = "YourNewKey";


configManager.Save(ConfigurationSaveMode.Modified);
ConfigurationManager.RefreshSection(configManager.AppSettings.SectionInformation.Name);

ASP.NET file download from server

Further to Karl Anderson solution, you could put your parameters into session information and then clear them after response.TransmitFile(Server.MapPath( Session(currentSessionItemName)));.

See MSDN page HttpSessionState.Add Method (String, Object) for more information on sessions.

How do I display image in Alert/confirm box in Javascript?

As other have mentioned you can't display an image in an alert. The solution is to show it on the webpage.

If I have my webpage paused in the debugger and I already have an image loaded, I can display it. There is no need to use jQuery; with this native 14 lines of Javascript it will work from code or the debugger command line:

function show(img){
 var _=document.getElementById('_'); 
 if(!_){_=document.createElement('canvas');document.body.appendChild(_);}
 _.id='_';
 _.style.top=0;
 _.style.left=0;
 _.width=img.width;
 _.height=img.height;
 _.style.zIndex=9999; 
 _.style.position='absolute';
 _.getContext('2d').drawImage(img,0,0);
}

Usage:

show( myimage );

initializing a boolean array in java

public static Boolean freq[] = new Boolean[Global.iParameter[2]];

Global.iParameter[2]:

It should be const value

ASP.NET: HTTP Error 500.19 – Internal Server Error 0x8007000d

Kind of late to the party here, but I have just been struggling with the exact same issue (symptoms) and cursing the lack of error detail reporting. It worked fine on IIS 8+ machines but Win 7 got these INSTANT HTTP 500.19 errors. For me it was as silly as having an unsupported configuration element in the config file:

 <applicationInitialization doAppInitAfterRestart="true">
  <add initializationPage="/" />
</applicationInitialization>

So while running old web.config files worked fine, I just diffed them and started chopping away at new blocks until I got the page to start loading. Had I seen this as an answer I would have gone this route immediately as I knew none of the popular solutions were relevant. So there you go :)

Can an abstract class have a constructor?

yes it is. And a constructor of abstract class is called when an instance of a inherited class is created. For example, the following is a valid Java program.

// An abstract class with constructor
abstract class Base {
Base() { System.out.println("Base Constructor Called"); }
abstract void fun();
    }
class Derived extends Base {
Derived() { System.out.println("Derived Constructor Called"); }
void fun() { System.out.println("Derived fun() called"); }
    }

class Main {
public static void main(String args[]) { 
   Derived d = new Derived();
    }

}

This is the output of the above code,

Base Constructor Called Derived Constructor Called

references: enter link description here

Close popup window

For such a seemingly simple thing this can be a royal pain in the butt! I found a solution that works beautifully (class="video-close" is obviously particular to this button and optional)

 <a href="javascript:window.open('','_self').close();" class="video-close">Close this window</a>

convert a char* to std::string

Not sure why no one besides Erik mentioned this, but according to this page, the assignment operator works just fine. No need to use a constructor, .assign(), or .append().

std::string mystring;
mystring = "This is a test!";   // Assign C string to std:string directly
std::cout << mystring << '\n';

Index of element in NumPy array

If you are interested in the indexes, the best choice is np.argsort(a)

a = np.random.randint(0, 100, 10)
sorted_idx = np.argsort(a)

How do I get the difference between two Dates in JavaScript?

function compare()
{
  var end_actual_time    = $('#date3').val();

  start_actual_time = new Date();
  end_actual_time = new Date(end_actual_time);

  var diff = end_actual_time-start_actual_time;

  var diffSeconds = diff/1000;
  var HH = Math.floor(diffSeconds/3600);
  var MM = Math.floor(diffSeconds%3600)/60;

  var formatted = ((HH < 10)?("0" + HH):HH) + ":" + ((MM < 10)?("0" + MM):MM)
  getTime(diffSeconds);
}
function getTime(seconds) {
  var days = Math.floor(leftover / 86400);

  //how many seconds are left
  leftover = leftover - (days * 86400);

  //how many full hours fits in the amount of leftover seconds
  var hours = Math.floor(leftover / 3600);

  //how many seconds are left
  leftover = leftover - (hours * 3600);

  //how many minutes fits in the amount of leftover seconds
  var minutes = leftover / 60;

  //how many seconds are left
  //leftover = leftover - (minutes * 60);
  alert(days + ':' + hours + ':' + minutes);
}

css divide width 100% to 3 column

Just to present an alternative way to fix this problem (if you don't really care about supporting IE):

A soft coded solution would be to use display: table (no support in IE7) along with table-layout: fixed (to ensure equal width columns).

Read more about this here.

How to remove all options from a dropdown using jQuery / JavaScript

Try this

function removeElements(){
    $('#models').html("");
}

Check if a string isn't nil or empty in Lua

Can this code be simplified in one if test instead two?

nil and '' are different values. If you need to test that s is neither, IMO you should just compare against both, because it makes your intent the most clear.

That and a few alternatives, with their generated bytecode:

if not foo or foo == '' then end
     GETGLOBAL       0 -1    ; foo
     TEST            0 0 0
     JMP             3       ; to 7
     GETGLOBAL       0 -1    ; foo
     EQ              0 0 -2  ; - ""
     JMP             0       ; to 7

if foo == nil or foo == '' then end
    GETGLOBAL       0 -1    ; foo
    EQ              1 0 -2  ; - nil
    JMP             3       ; to 7
    GETGLOBAL       0 -1    ; foo
    EQ              0 0 -3  ; - ""
    JMP             0       ; to 7

if (foo or '') == '' then end
   GETGLOBAL       0 -1    ; foo
   TEST            0 0 1
   JMP             1       ; to 5
   LOADK           0 -2    ; ""
   EQ              0 0 -2  ; - ""
   JMP             0       ; to 7

The second is fastest in Lua 5.1 and 5.2 (on my machine anyway), but difference is tiny. I'd go with the first for clarity's sake.

What are the benefits of using C# vs F# or F# vs C#?

General benefits of functional programming over imperative languages:

You can formulate many problems much easier, closer to their definition and more concise in a functional programming language like F# and your code is less error-prone (immutability, more powerful type system, intuitive recurive algorithms). You can code what you mean instead of what the computer wants you to say ;-) You will find many discussions like this when you google it or even search for it at SO.

Special F#-advantages:

  • Asynchronous programming is extremely easy and intuitive with async {}-expressions - Even with ParallelFX, the corresponding C#-code is much bigger

  • Very easy integration of compiler compilers and domain-specific languages

  • Extending the language as you need it: LOP

  • Units of measure

  • More flexible syntax

  • Often shorter and more elegant solutions

Take a look at this document

The advantages of C# are that it's often more accurate to "imperative"-applications (User-interface, imperative algorithms) than a functional programming language, that the .NET-Framework it uses is designed imperatively and that it's more widespread.

Furthermore you can have F# and C# together in one solution, so you can combine the benefits of both languages and use them where they're needed.

In Rails, how do you render JSON using a view?

You should be able to do something like this in your respond_to block:

respond_to do |format|
    format.json 
    render :partial => "users/show.json"
end

which will render the template in app/views/users/_show.json.erb.

"UnboundLocalError: local variable referenced before assignment" after an if statement

The other answers are correct: You don't have a default value. However, you have another problem in your logic:

You read the same file twice. After reading it once, the cursor is at the end of the file. To solve this, you can do two things: Either open/close the file upon each function call:

def temp_sky(lreq, breq):
    with open("/home/path/to/file",'r') as tfile:
        # do your stuff

This hase the disadvantage of having to open the file each time. The better way would be:

tfile.seek(0)

You do this after your for line in tfile: loop. It resets the cursor to the beginning to the next call will start from there again.

How to move a marker in Google Maps API

Just try to create the marker and set the draggable property to true. The code will be something as follows:

Marker = new google.maps.Marker({
    position: latlon,
    map: map,            
    draggable: true,
    title: "Drag me!"
});

I hope this helps!

IE11 prevents ActiveX from running

Try this tag on the pages that use the ActiveX control:

<meta http-equiv="X-UA-Compatible" content="IE=EmulateIE10">

Note: this has to be the very first element in the <head> section.

How to correctly display .csv files within Excel 2013?

Taken from https://superuser.com/questions/238944/how-to-force-excel-to-open-csv-files-with-data-arranged-in-columns

The behavior of Excel when opening CSV files heavily depends on your local settings and the selected list separator under Region and language » Formats » Advanced. By default Excel will assume every CSV was saved with that separator. Which is true as long as the CSV doesn't come from another country!

If your customers are in other countries, they may see other results then you think.

For example, here you see that a German Excel will use semicolon instead of comma like in the U.S.

Regional Settings

Repeat String - Javascript

With ES8 you could also use padStart or padEnd for this. eg.

var str = 'cat';
var num = 23;
var size = str.length * num;
"".padStart(size, str) // outputs: 'catcatcatcatcatcatcatcatcatcatcatcatcatcatcatcatcatcatcatcatcatcatcat'

How do you declare string constants in C?

One advantage (albeit very slight) of defining string constants is that you can concatenate them at compile time:

#define HELLO "hello"
#define WORLD "world"

puts( HELLO WORLD );

Not sure that's really an advantage, but it is a technique that cannot be used with const char *'s.

Bootstrap 3 and Youtube in Modal

_x000D_
_x000D_
$('#videoLink').click(function () {_x000D_
    var src = 'https://www.youtube.com/embed/VI04yNch1hU;autoplay=1';_x000D_
    // $('#introVideo').modal('show'); <-- remove this line_x000D_
    $('#introVideo iframe').attr('src', src);_x000D_
});_x000D_
_x000D_
$('#introVideo button.close').on('hidden.bs.modal', function () {_x000D_
    $('#introVideo iframe').removeAttr('src');_x000D_
});
_x000D_
<script src="https://ajax.googleapis.com/ajax/libs/jquery/2.1.1/jquery.min.js"></script>_x000D_
<link href="https://maxcdn.bootstrapcdn.com/bootstrap/3.3.2/css/bootstrap.min.css" rel="stylesheet">_x000D_
<script src="https://maxcdn.bootstrapcdn.com/bootstrap/3.3.4/js/bootstrap.min.js"></script>_x000D_
_x000D_
<!-- triggering Link -->_x000D_
<a id="videoLink" href="#0" class="video-hp" data-toggle="modal" data-target="#introVideo"><img src="img/someImage.jpg">toggle video</a>_x000D_
_x000D_
<!-- Intro video -->_x000D_
<div class="modal fade" id="introVideo" tabindex="-1" role="dialog" aria-labelledby="introductionVideo" aria-hidden="true">_x000D_
  <div class="modal-dialog modal-lg">_x000D_
    <div class="modal-content">_x000D_
      <div class="modal-header">_x000D_
        <button type="button" class="close" data-dismiss="modal" aria-label="Close"><span aria-hidden="true">&times;</span></button>_x000D_
      </div>_x000D_
      <div class="modal-body">_x000D_
        <div class="embed-responsive embed-responsive-16by9">_x000D_
            <iframe class="embed-responsive-item allowfullscreen"></iframe>_x000D_
        </div>_x000D_
      </div>_x000D_
    </div>_x000D_
  </div>_x000D_
</div>
_x000D_
_x000D_
_x000D_

@JsonProperty annotation on field as well as getter/setter

My observations based on a few tests has been that whichever name differs from the property name is one which takes effect:

For eg. consider a slight modification of your case:

@JsonProperty("fileName")
private String fileName;

@JsonProperty("fileName")
public String getFileName()
{
    return fileName;
}

@JsonProperty("fileName1")
public void setFileName(String fileName)
{
    this.fileName = fileName;
}

Both fileName field, and method getFileName, have the correct property name of fileName and setFileName has a different one fileName1, in this case Jackson will look for a fileName1 attribute in json at the point of deserialization and will create a attribute called fileName1 at the point of serialization.

Now, coming to your case, where all the three @JsonProperty differ from the default propertyname of fileName, it would just pick one of them as the attribute(FILENAME), and had any on of the three differed, it would have thrown an exception:

java.lang.IllegalStateException: Conflicting property name definitions

maven command line how to point to a specific settings.xml for a single command?

You can simply use:

mvn --settings YourOwnSettings.xml clean install

or

mvn -s YourOwnSettings.xml clean install

bootstrap jquery show.bs.modal event won't fire

This happens when code might been executed before and it's not showing up so you can add timeout() for it tp fire.

$(document).on('shown.bs.modal', function (event) {
      setTimeout(function(){
        alert("Hi");
      },1000); 
    });

LINQ Joining in C# with multiple conditions

If you need not equal object condition use cross join sequences:

var query = from obj1 in set1
from obj2 in set2
where obj1.key1 == obj2.key2 && obj1.key3.contains(obj2.key5) [...conditions...]

React onClick and preventDefault() link refresh/redirect?

I've had some troubles with anchor tags and preventDefault in the past and I always forget what I'm doing wrong, so here's what I figured out.

The problem I often have is that I try to access the component's attributes by destructuring them directly as with other React components. This will not work, the page will reload, even with e.preventDefault():

function (e, { href }) {
  e.preventDefault();
  // Do something with href
}
...
<a href="/foobar" onClick={clickHndl}>Go to Foobar</a>

It seems the destructuring causes an error (Cannot read property 'href' of undefined) that is not displayed to the console, probably due to the page complete reload. Since the function is in error, the preventDefault doesn't get called. If the href is #, the error is displayed properly since there's no actual reload.

I understand now that I can only access attributes as a second handler argument on custom React components, not on native HTML tags. So of course, to access an HTML tag attribute in an event, this would be the way:

function (e) {
  e.preventDefault();
  const { href } = e.target;
  // Do something with href
}
...
<a href="/foobar" onClick={clickHndl}>Go to Foobar</a>

I hope this helps other people like me puzzled by not shown errors!

LINQ Aggregate algorithm explained

Everyone has given his explanation. My explanation is like that.

Aggregate method applies a function to each item of a collection. For example, let's have collection { 6, 2, 8, 3 } and the function Add (operator +) it does (((6+2)+8)+3) and returns 19

var numbers = new List<int> { 6, 2, 8, 3 };
int sum = numbers.Aggregate(func: (result, item) => result + item);
// sum: (((6+2)+8)+3) = 19

In this example there is passed named method Add instead of lambda expression.

var numbers = new List<int> { 6, 2, 8, 3 };
int sum = numbers.Aggregate(func: Add);
// sum: (((6+2)+8)+3) = 19

private static int Add(int x, int y) { return x + y; }

Import Script from a Parent Directory

From the docs:

from .. import scriptA

You can do this in packages, but not in scripts you run directly. From the link above:

Note that both explicit and implicit relative imports are based on the name of the current module. Since the name of the main module is always "__main__", modules intended for use as the main module of a Python application should always use absolute imports.

If you create a script that imports A.B.B, you won't receive the ValueError.

Using the "animated circle" in an ImageView while loading stuff

If you would like to not inflate another view just to indicate progress then do the following:

  1. Create ProgressBar in the same XML layout of the list view.
  2. Make it centered
  3. Give it an id
  4. Attach it to your listview instance variable by calling setEmptyView

Android will take care the progress bar's visibility.

For example, in activity_main.xml:

    <?xml version="1.0" encoding="utf-8"?>
<RelativeLayout xmlns:android="http://schemas.android.com/apk/res/android"
    xmlns:tools="http://schemas.android.com/tools"
    android:layout_width="match_parent"
    android:layout_height="match_parent"
    android:orientation="vertical"
    tools:context="com.fcchyd.linkletandroid.MainActivity">

    <ListView
        android:id="@+id/list_view_xml"
        android:layout_width="match_parent"
        android:layout_height="match_parent"
        android:divider="@color/colorDivider"
        android:dividerHeight="1dp" />

   <ProgressBar
        android:id="@+id/loading_progress_xml"
        style="?android:attr/progress"
        android:layout_width="wrap_content"
        android:layout_height="wrap_content"
        android:layout_centerHorizontal="true"
        android:layout_centerVertical="true" />

</RelativeLayout>

And in MainActivity.java:

package com.fcchyd.linkletandroid;

import android.os.Bundle;
import android.support.v7.app.AppCompatActivity;
import android.util.Log;
import android.widget.ArrayAdapter;
import android.widget.ListView;

import java.util.ArrayList;
import java.util.List;

import retrofit2.Call;
import retrofit2.Callback;
import retrofit2.Response;
import retrofit2.Retrofit;
import retrofit2.converter.gson.GsonConverterFactory;

public class MainActivity extends AppCompatActivity {

final String debugLogHeader = "Linklet Debug Message";
Call<Links> call;
List<Link> arraylistLink;
ListView linksListV;

@Override
protected void onCreate(Bundle savedInstanceState) {
    super.onCreate(savedInstanceState);
    setContentView(R.layout.activity_main);

    linksListV = (ListView) findViewById(R.id.list_view_xml);
    linksListV.setEmptyView(findViewById(R.id.loading_progress_xml));
    arraylistLink = new ArrayList<>();

    Retrofit retrofit = new Retrofit.Builder()
            .baseUrl("https://api.links.linklet.ml")
            .addConverterFactory(GsonConverterFactory
                    .create())
            .build();

    HttpsInterface HttpsInterface = retrofit
            .create(HttpsInterface.class);

    call = HttpsInterface.httpGETpageNumber(1);

    call.enqueue(new Callback<Links>() {
        @Override
        public void onResponse(Call<Links> call, Response<Links> response) {
            try {
                arraylistLink = response.body().getLinks();

                String[] simpletTitlesArray = new String[arraylistLink.size()];
                for (int i = 0; i < simpletTitlesArray.length; i++) {
                    simpletTitlesArray[i] = arraylistLink.get(i).getTitle();
                }
                ArrayAdapter<String> simpleAdapter = new ArrayAdapter<>(MainActivity.this, android.R.layout.simple_list_item_1, simpletTitlesArray);
                linksListV.setAdapter(simpleAdapter);
            } catch (Exception e) {
                Log.e("erro", "" + e);
            }
        }

        @Override
        public void onFailure(Call<Links> call, Throwable t) {

        }
    });


}

}

How do I run Python script using arguments in windows command line

  • import sys out of hello function.
  • arguments should be converted to int.
  • String literal that contain ' should be escaped or should be surrouned by ".
  • Did you invoke the program with python hello.py <some-number> <some-number> in command line?

import sys

def hello(a,b):
    print "hello and that's your sum:", a + b

if __name__ == "__main__":
    a = int(sys.argv[1])
    b = int(sys.argv[2])
    hello(a, b)

Error: "Could Not Find Installable ISAM"

I used this to update a excel 12 xlsx file

        System.Data.OleDb.OleDbConnection MyConnection;
        System.Data.OleDb.OleDbCommand myCommand = new System.Data.OleDb.OleDbCommand();
        MyConnection = new System.Data.OleDb.OleDbConnection("provider=Microsoft.ACE.OLEDB.12.0;Data Source='D:\\Programming\\Spreadsheet-Current.xlsx';Extended Properties='Excel 12.0;HDR=YES;';");
        MyConnection.Open();
        myCommand.Connection = MyConnection;
        string sql = "Update [ArticlesV2$] set [ID]='Test' where [ActualPageId]=114";// 
        myCommand.CommandText = sql;
        myCommand.ExecuteNonQuery();
        MyConnection.Close();

Draw a curve with css

You could use an asymmetrical border to make curves with CSS.

border-radius: 50%/100px 100px 0 0;

VIEW DEMO

_x000D_
_x000D_
.box {_x000D_
  width: 500px; _x000D_
  height: 100px;  _x000D_
  border: solid 5px #000;_x000D_
  border-color: #000 transparent transparent transparent;_x000D_
  border-radius: 50%/100px 100px 0 0;_x000D_
}
_x000D_
<div class="box"></div>
_x000D_
_x000D_
_x000D_