Programs & Examples On #Escalation

How to run single test method with phpunit?

Here's the more generic answer:

If you are sure the method name is unique you can only filter by method name (this works for me)

phpunit --filter {TestMethodName}

However it is safer to specify the file path/reference as well

phpunit --filter {TestMethodName} {FilePath}

Example:

phpunit --filter testSaveAndDrop reference/to/escalation/EscalationGroupTest.php

Quick note: I've noticed that if I have a function named testSave and another function named testSaveAndDrop using command phpunit --filter testSave will also run testSaveAndDrop and any other function that starts with testSave*, it's weird!!

How to use mongoose findOne

Found the problem, need to use function(err,obj) instead:

Auth.findOne({nick: 'noname'}, function(err,obj) { console.log(obj); });

onclick="javascript:history.go(-1)" not working in Chrome

Why not get rid of the inline javascript and do something like this instead?

Inline javascript is considered bad practice as it is outdated.

Notes

Why use addEventListener?

addEventListener is the way to register an event listener as specified in W3C DOM. Its benefits are as follows:

It allows adding more than a single handler for an event. This is particularly useful for DHTML libraries or Mozilla extensions that need to work well even if other libraries/extensions are used. It gives you finer-grained control of the phase when the listener gets activated (capturing vs. bubbling) It works on any DOM element, not just HTML elements.

<a id="back" href="www.mypage.com"> Link </a>

document.getElementById("back").addEventListener("click", window.history.back, false);

On jsfiddle

How to remove pip package after deleting it manually

packages installed using pip can be uninstalled completely using

pip uninstall <package>

refrence link

pip uninstall is likely to fail if the package is installed using python setup.py install as they do not leave behind metadata to determine what files were installed.

packages still show up in pip list if their paths(.pth file) still exist in your site-packages or dist-packages folder. You'll need to remove them as well in case you're removing using rm -rf

How to deny access to a file in .htaccess

Place the below line in your .htaccess file and replace the file name as you wish

RewriteRule ^(test\.php) - [F,L,NC]

Hibernate: hbm2ddl.auto=update in production?

Check out LiquiBase XML for keeping a changelog of updates. I had never used it until this year, but I found that it's very easy to learn and make DB revision control/migration/change management very foolproof. I work on a Groovy/Grails project, and Grails uses Hibernate underneath for all its ORM (called "GORM"). We use Liquibase to manage all SQL schema changes, which we do fairly often as our app evolves with new features.

Basically, you keep an XML file of changesets that you continue to add to as your application evolves. This file is kept in git (or whatever you are using) with the rest of your project. When your app is deployed, Liquibase checks it's changelog table in the DB you are connecting to so it will know what has already been applied, then it intelligently just applies whatever changesets have not been applied yet from the file. It works absolutely great in practice, and if you use it for all your schema changes, then you can be 100% confident that code you checkout and deploy will always be able to connect to a fully compatible database schema.

The awesome thing is that I can take a totally blank slate mysql database on my laptop, fire up the app, and right away the schema is set up for me. It also makes it easy to test schema changes by applying these to a local-dev or staging db first.

The easiest way to get started with it would probably be to take your existing DB and then use Liquibase to generate an initial baseline.xml file. Then in the future you can just append to it and let liquibase take over managing schema changes.

http://www.liquibase.org/

How to shuffle an ArrayList

Use this method and pass your array in parameter

Collections.shuffle(arrayList);

This method return void so it will not give you a new list but as we know that array is passed as a reference type in Java so it will shuffle your array and save shuffled values in it. That's why you don't need any return type.

You can now use arraylist which is shuffled.

What's the difference between dependencies, devDependencies and peerDependencies in npm package.json file?

A simple explanation that made it more clear to me is:

When you deploy your app, modules in dependencies need to be installed or your app won't work. Modules in devDependencies don't need to be installed on the production server since you're not developing on that machine. link

Windows batch: formatted date into variable

I really liked Joey's method, but I thought I'd expand upon it a bit.

In this approach, you can run the code multiple times and not worry about the old date value "sticking around" because it's already defined.

Each time you run this batch file, it will output an ISO 8601 compatible combined date and time representation.

FOR /F "skip=1" %%D IN ('WMIC OS GET LocalDateTime') DO (SET LIDATE=%%D & GOTO :GOT_LIDATE)
:GOT_LIDATE
SET DATETIME=%LIDATE:~0,4%-%LIDATE:~4,2%-%LIDATE:~6,2%T%LIDATE:~8,2%:%LIDATE:~10,2%:%LIDATE:~12,2%
ECHO %DATETIME%

In this version, you'll have to be careful not to copy/paste the same code to multiple places in the file because that would cause duplicate labels. You could either have a separate label for each copy, or just put this code into its own batch file and call it from your source file wherever necessary.

How to append strings using sprintf?

int length = 0;
length += sprintf(Buffer+length, "Hello World");
length += sprintf(Buffer+length, "Good Morning");
length += sprintf(Buffer+length, "Good Afternoon");

Here is a version with some resistance to errors. It is useful if you do not care when errors happen so long as you can continue along your merry way when they do.

int bytes_added( int result_of_sprintf )
{
    return (result_of_sprintf > 0) ? result_of_sprintf : 0;
}

int length = 0;
length += bytes_added(sprintf(Buffer+length, "Hello World"));
length += bytes_added(sprintf(Buffer+length, "Good Morning"));
length += bytes_added(sprintf(Buffer+length, "Good Afternoon"));

How to check if a radiobutton is checked in a radiogroup in Android?

I used the following and it worked for me. I used a boolean validation function where if any Radio Button in a Radio Group is checked, the validation function returns true and a submission is made. if returned false, no submission is made and a toast to "Select Gender" is shown:

  1. MainActivity.java

    public class MainActivity extends AppCompatActivity {
        private RadioGroup genderRadioGroup;
    
        @Override
        protected void onCreate(Bundle savedInstanceState) {
        super.onCreate(savedInstanceState);
        setContentView(R.layout.activity_main);
    
        //Initialize Radio Group And Submit Button
        genderRadioGroup=findViewById(R.id.gender_radiogroup);
        AppCompatButton submit = findViewById(R.id.btnSubmit);
    
        //Submit Radio Group using Submit Button
        submit.setOnClickListener(new View.OnClickListener() {
            @Override
            public void onClick(View v) {
                //Check Gender radio Group For Selected Radio Button
                if(genderRadioGroup.getCheckedRadioButtonId()==-1){//No Radio Button Is Checked
                    Toast.makeText(getApplicationContext(), "Please Select Gender", Toast.LENGTH_LONG).show();
                }else{//Radio Button Is Checked
                    RadioButton selectedRadioButton = findViewById(genderRadioGroup.getCheckedRadioButtonId());
                    gender = selectedRadioButton == null ? "" : selectedRadioButton.getText().toString().trim();
                }
                //Validate
                if (validateInputs()) {
                    //code to proceed when Radio button is checked
                }
            }
        }
        //Validation - No process is initialized if no Radio button is checked
        private boolean validateInputs() {
            if (genderRadioGroup.getCheckedRadioButtonId()==-1) {
                return false;
            }
            return true;
        }
    }
    
  2. In activity_main.xml:

    <LinearLayout
            android:layout_width="match_parent"
            android:layout_height="wrap_content"
            android:orientation="horizontal">
    
        <TextView
                android:layout_width="wrap_content"
                android:layout_height="wrap_content"
                android:text="@string/gender"/>
    
        <RadioGroup
                android:id="@+id/gender_radiogroup"
                android:layout_width="wrap_content"
                android:layout_height="wrap_content"
                android:orientation="horizontal">
    
            <RadioButton
                    android:id="@+id/male"
                    android:layout_width="wrap_content"
                    android:layout_height="wrap_content"
                    android:text="@string/male"/>
    
            <RadioButton
                    android:id="@+id/female"
                    android:layout_width="wrap_content"
                    android:layout_height="wrap_content"
                    android:text="@string/female""/>
    
        </RadioGroup>
    
        <android.support.v7.widget.AppCompatButton
            android:id="@+id/btnSubmit"
            android:layout_width="match_parent"
            android:layout_height="wrap_content"
            android:text="@string/submit"/>
    
    </LinearLayout>
    

If no gender radio button is selected, then the code to proceed will not run.

I hope this helps.

How do I hide anchor text without hiding the anchor?

Another option is to hide based on bootstraps "sr-only" class. If you wrap the text in a span with the class "sr-only" then the text will not be displayed, but screen readers will still have access to it. So you would have:

<li><a href="somehwere"><span class="sr-only">Link text</span></a></li>

If you are not using bootstrap, still keep the above, but also add the below css to define the "sr-only" class:

.sr-only {position: absolute;  width: 1px;  height: 1px;  padding: 0;  margin: -1px;  overflow: hidden;  clip: rect(0 0 0 0);  border: 0; }

Enable the display of line numbers in Visual Studio

Type 'line numbers' into the Quick Launch textbox (top right VS 2015), and it'll take you right where you need to be (tick Line Numbers checkbox).

Converting float to char*

typedef union{
    float a;
    char b[4];
} my_union_t;

You can access to float data value byte by byte and send it through 8-bit output buffer (e.g. USART) without casting.

How to find Control in TemplateField of GridView?

You can use this code to find HyperLink in GridView. Use of e.Row.Cells[0].Controls[0] to find First position of control in GridView.

protected void AspGrid_RowDataBound(object sender, GridViewRowEventArgs e)
{    
  if(e.Row.RowType == DataControlRowType.DataRow)
    {
        DataRowView v = (DataRowView)e.Row.DataItem;           

        if (e.Row.Cells.Count > 0 && e.Row.Cells[0] != null && e.Row.Cells[0].Controls.Count > 0)
        {
            HyperLink link = e.Row.Cells[0].Controls[0] as HyperLink;
            if (link != null)
            {                    
                    link.Text = "Edit";
            }               
        }       

    }
}

window.onunload is not working properly in Chrome browser. Can any one help me?

This works :

var unloadEvent = function (e) {
    var confirmationMessage = "Warning: Leaving this page will result in any unsaved data being lost. Are you sure you wish to continue?";
    (e || window.event).returnValue = confirmationMessage; //Gecko + IE
    return confirmationMessage; //Webkit, Safari, Chrome etc.
};
window.addEventListener("beforeunload", unloadEvent);

Update some specific field of an entity in android Room

We need the primary key of that particular model that you want to update. For example:

 private fun update(Name: String?, Brand: String?) {
    val deviceEntity = remoteDao?.getRemoteId(Id)
    if (deviceEntity == null)
        remoteDao?.insertDevice(DeviceEntity(DeviceModel = DeviceName, DeviceBrand = DeviceBrand))
    else
        DeviceDao?.updateDevice(DeviceEntity(deviceEntity.id,remoteDeviceModel = DeviceName, DeviceBrand = DeviceBrand))
}

In this function, I am checking whether a particular entry exists in the database if exists pull the primary key which is id over here and perform update function.

This is the for fetching and update records:

@Query("SELECT * FROM ${DeviceDatabase.DEVICE_TABLE_NAME} WHERE ${DeviceDatabase.COLUMN_DEVICE_ID} = :DeviceId LIMIT 1")

fun getRemoteDeviceId(DeviceId: String?): DeviceEntity


@Update(onConflict = OnConflictStrategy.REPLACE)
fun updatDevice(item: DeviceEntity): Int

Open an html page in default browser with VBA?

I find the most simple is

shell "explorer.exe URL"

This also works to open local folders.

Print new output on same line

Lets take an example where you want to print numbers from 0 to n in the same line. You can do this with the help of following code.

n=int(raw_input())
i=0
while(i<n):
    print i,
    i = i+1

At input, n = 5

Output : 0 1 2 3 4 

Sharing a variable between multiple different threads

Both T1 and T2 can refer to a class containing this variable.
You can then make this variable volatile, and this means that
Changes to that variable are immediately visible in both threads.

See this article for more info.

Volatile variables share the visibility features of synchronized but none of the atomicity features. This means that threads will automatically see the most up-to-date value for volatile variables. They can be used to provide thread safety, but only in a very restricted set of cases: those that do not impose constraints between multiple variables or between a variable's current value and its future values.

And note the pros/cons of using volatile vs more complex means of sharing state.

Mysql Compare two datetime fields

Do you want to order it?

Select * From temp where mydate > '2009-06-29 04:00:44' ORDER BY mydate;

How to concatenate two strings to build a complete path

I was working around with my shell script which need to do some path joining stuff like you do.

The thing is, both path like

/data/foo/bar

/data/foo/bar/ 

are valid.

If I want to append a file to this path like

/data/foo/bar/myfile

there was no native method (like os.path.join() in python) in shell to handle such situation.

But I did found a trick

For example , the base path was store in a shell variable

BASE=~/mydir

and the last file name you wanna join was

FILE=myfile

Then you can assign your new path like this

NEW_PATH=$(realpath ${BASE})/FILE

and then you`ll get

$ echo $NEW_PATH

/path/to/your/home/mydir/myfile

the reason is quiet simple, the "realpath" command would always trim the terminating slash for you if necessary

C# cannot convert method to non delegate type

Because getTitle is not a string, it returns a reference or delegate to a method (if you like), if you don't explicitly call the method.

Call your method this way:

string t= obj.getTitle() ; //obj.getTitle()  says return the title string object

However, this would work:

Func<string> method = obj.getTitle; // this compiles to a delegate and points to the method

string s = method();//call the delegate or using this syntax `method.Invoke();`

How do you make div elements display inline?

As mentioned, display:inline is probably what you want. Some browsers also support inline-blocks.

http://www.quirksmode.org/css/display.html#inlineblock

How to export private key from a keystore of self-signed certificate

public static void main(String[] args) {

try {
        String keystorePass = "20174";
        String keyPass = "rav@789";
        String alias = "TyaGi!";
        InputStream keystoreStream = new FileInputStream("D:/keyFile.jks");
        KeyStore keystore = KeyStore.getInstance("JCEKS");
        keystore.load(keystoreStream, keystorePass.toCharArray());
        Key key = keystore.getKey(alias, keyPass.toCharArray());

        byte[] bt = key.getEncoded();
        String s = new String(bt);
        System.out.println("------>"+s);      
        String str12 = Base64.encodeBase64String(bt);

        System.out.println("Fetched Key From JKS : " + str12);

    } catch (KeyStoreException | IOException | NoSuchAlgorithmException | CertificateException | UnrecoverableKeyException ex) {
        System.out.println(ex);

    }
}

How to Lazy Load div background images

I know it's not related to the image load but here what I did in one of the job interview test.

HTML

<div id="news-feed">Scroll to see News (Newest First)</div>

CSS

article {
   margin-top: 500px;
   opacity: 0;
   border: 2px solid #864488;
   padding: 5px 10px 10px 5px;
   background-image: -webkit-gradient(
   linear,
   left top,
   left bottom,
   color-stop(0, #DCD3E8),
   color-stop(1, #BCA3CC)
   );
   background-image: -o-linear-gradient(bottom, #DCD3E8 0%, #BCA3CC 100%);
   background-image: -moz-linear-gradient(bottom, #DCD3E8 0%, #BCA3CC 100%);
   background-image: -webkit-linear-gradient(bottom, #DCD3E8 0%, #BCA3CC 100%);
   background-image: -ms-linear-gradient(bottom, #DCD3E8 0%, #BCA3CC 100%);
   background-image: linear-gradient(to bottom, #DCD3E8 0%, #BCA3CC 100%);
   color: gray;
   font-family: arial;    
}

article h4 {
   font-family: "Times New Roman";
   margin: 5px 1px;
}

.main-news {
   border: 5px double gray;
   padding: 15px;
}

JavaScript

var newsData,
    SortData = '',
    i = 1;

$.getJSON("http://www.stellarbiotechnologies.com/media/press-releases/json", function(data) {

   newsData = data.news;

   function SortByDate(x,y) {
     return ((x.published == y.published) ? 0 : ((x.published < y.published) ? 1 : -1 ));
   }

   var sortedNewsData = newsData.sort(SortByDate);

   $.each( sortedNewsData, function( key, val ) {
     SortData += '<article id="article' + i + '"><h4>Published on: ' + val.published + '</h4><div  class="main-news">' + val.title + '</div></article>';
     i++;    
   });

   $('#news-feed').append(SortData);
});

$(window).scroll(function() {

   var $window = $(window),
       wH = $window.height(),
       wS = $window.scrollTop() + 1

   for (var j=0; j<$('article').length;j++) {
      var eT = $('#article' + j ).offset().top,
          eH = $('#article' + j ).outerHeight();

          if (wS > ((eT + eH) - (wH))) {
             $('#article' + j ).animate({'opacity': '1'}, 500);
          }
    }

});

I am sorting the data by Date and then doing lazy load on window scroll function.

I hope it helps :)

Demo

How to make a 3-level collapsing menu in Bootstrap?

Bootstrap 3 dropped native support for nested collapsing menus, but there's a way to re-enable it with a 3rd party script. It's called SmartMenus. It means adding three new resources to your page, but it seamlessly supports Bootstrap 3.x with multiple levels of menus for nested <ul>/<li> elements with class="dropdown-menu". It automatically displays the proper caret indicator as well.

<head>
   ...
   <script src=".../jquery.smartmenus.min.js"></script>
   <script src=".../jquery.smartmenus.bootstrap.min.js"></script>
   ...
   <link rel="stylesheet" href=".../jquery.smartmenus.bootstrap.min.css"/>
   ...
</head>

Here's a demo page: http://vadikom.github.io/smartmenus/src/demo/bootstrap-navbar-fixed-top.html

Two color borders

You could use

<html>
<head>
<title>Two Colors</title>
<style type="text/css">

.two-colors {
background: none repeat scroll 0% 0% rgb(245, 245, 245); border-color: rgba(111,111,111,0.2) transparent;
 padding: 4px; outline: 1px solid green;
}

</style>

<style type="text/css">
      body {
        padding-top: 20px;
        padding-bottom: 40px;
        background-color:yellow;        
      }
    </style>

</head>
<body>
<a target="_blank" href="people.htm">
  <img class="two-colors" src="people.jpg" alt="Klematis" width="213" height="120" />
  </a>

</body>
</html>

How do I deal with "signed/unsigned mismatch" warnings (C4018)?

I can also propose following solution for C++11.

for (auto p = 0U; p < sys.size(); p++) {

}

(C++ is not smart enough for auto p = 0, so I have to put p = 0U....)

How to convert Map keys to array?

I need something similiar with angular reactive form:

let myMap = new Map().set(0, {status: 'VALID'}).set(1, {status: 'INVALID'});
let mapToArray = Array.from(myMap.values());
let isValid = mapToArray.every(x => x.status === 'VALID');

Extract parameter value from url using regular expressions

Not tested but this should work:

/\?v=([a-z0-9\-]+)\&?/i

AVD Manager - No system image installed for this target

Open your Android SDK Manager and ensure that you download/install a system image for the API level you are developing with.

Java Class that implements Map and keeps insertion order?

You can maintain a Map (for fast lookup) and List (for order) but a LinkedHashMap may be the simplest. You can also try a SortedMap e.g. TreeMap, which an have any order you specify.

How do I catch an Ajax query post error?

you attach the .onerror handler to the ajax object, why people insist on posting JQuery for responses when vanila works cross platform...

quickie example:

ajax = new XMLHttpRequest();
ajax.open( "POST", "/url/to/handler.php", true );
ajax.onerror = function(){
    alert("Oops! Something went wrong...");
}
ajax.send(someWebFormToken );

How to allow download of .json file with ASP.NET

Solution is you need to add json file extension type in MIME Types

Method 1

Go to IIS, Select your application and Find MIME Types

enter image description here

Click on Add from Right panel

File Name Extension = .json

MIME Type = application/json

enter image description here

After adding .json file type in MIME Types, Restart IIS and try to access json file


Method 2

Go to web.config of that application and add this lines in it

 <system.webServer>
   <staticContent>
     <mimeMap fileExtension=".json" mimeType="application/json" />
   </staticContent>
 </system.webServer>

setting multiple column using one update

Just add parameters, split by comma:

UPDATE tablename SET column1 = "value1", column2 = "value2" ....

See also: mySQL manual on UPDATE

Session 'app' error while installing APK

Clean and Rebuild is working fine for this problem and it is good also than other solutions.

How do I sort an observable collection?

Make a new class SortedObservableCollection, derive it from ObservableCollection and implement IComparable<Pair<ushort, string>>.

How do I implement interfaces in python?

interface supports Python 2.7 and Python 3.4+.

To install interface you have to

pip install python-interface

Example Code:

from interface import implements, Interface

class MyInterface(Interface):

    def method1(self, x):
        pass

    def method2(self, x, y):
        pass


class MyClass(implements(MyInterface)):

    def method1(self, x):
        return x * 2

    def method2(self, x, y):
        return x + y

How to Store Historical Data

Just wanted to add an option that I started using because I use Azure SQL and the multiple table thing was way too cumbersome for me. I added an insert/update/delete trigger on my table and then converted the before/after change to json using the "FOR JSON AUTO" feature.

 SET @beforeJson = (SELECT * FROM DELETED FOR JSON AUTO)
SET @afterJson = (SELECT * FROM INSERTED FOR JSON AUTO)

That returns a JSON representation fo the record before/after the change. I then store those values in a history table with a timestamp of when the change occurred (I also store the ID for current record of concern). Using the serialization process, I can control how data is backfilled in the case of changes to schema.

I learned about this from this link here

How do I set path while saving a cookie value in JavaScript?

simply: document.cookie="name=value;path=/";

There is a negative point to it

Now, the cookie will be available to all directories on the domain it is set from. If the website is just one of many at that domain, it’s best not to do this because everyone else will also have access to your cookie information.

how to put focus on TextBox when the form load?

Set theActiveControl property of the form and you should be fine.

this.ActiveControl = yourtextboxname;

How can I delete one element from an array by value

If you also want to make this deletion operation chainable, so you can delete some item and keep on chaining operations on the resulting array, use tap:

[2, 4, 6, 3, 8].tap { |ary| ary.delete(3) }.count #=> 4

How can I use String substring in Swift 4? 'substring(to:)' is deprecated: Please use String slicing subscript with a 'partial range from' operator

I have written a string extension for replacement of 'String: subString:'

extension String {
    
    func sliceByCharacter(from: Character, to: Character) -> String? {
        let fromIndex = self.index(self.index(of: from)!, offsetBy: 1)
        let toIndex = self.index(self.index(of: to)!, offsetBy: -1)
        return String(self[fromIndex...toIndex])
    }
    
    func sliceByString(from:String, to:String) -> String? {
        //From - startIndex
        var range = self.range(of: from)
        let subString = String(self[range!.upperBound...])
        
        //To - endIndex
        range = subString.range(of: to)
        return String(subString[..<range!.lowerBound])
    }
    
}

Usage : "Date(1511508780012+0530)".sliceByString(from: "(", to: "+")

Example Result : "1511508780012"

PS: Optionals are forced to unwrap. Please add Type safety check wherever necessary.

In javascript, how do you search an array for a substring match

People here are making this waaay too difficult. Just do the following...

myArray.findIndex(element => element.includes("substring"))

findIndex() is an ES6 higher order method that iterates through the elements of an array and returns the index of the first element that matches some criteria (provided as a function). In this case I used ES6 syntax to declare the higher order function. element is the parameter of the function (which could be any name) and the fat arrow declares what follows as an anonymous function (which does not need to be wrapped in curly braces unless it takes up more than one line).

Within findIndex() I used the very simple includes() method to check if the current element includes the substring that you want.

Post values from a multiple select

try this : here select is your select element

let select = document.getElementsByClassName('lstSelected')[0],
    options = select.options,
    len = options.length,
    data='',
    i=0;
while (i<len){
    if (options[i].selected)
        data+= "&" + select.name + '=' + options[i].value;
    i++;
}
return data;

Data is in the form of query string i.e.name=value&name=anotherValue

How do I delay a function call for 5 seconds?

var rotator = function(){
  widget.Rotator.rotate();
  setTimeout(rotator,5000);
};
rotator();

Or:

setInterval(
  function(){ widget.Rotator.rotate() },
  5000
);

Or:

setInterval(
  widget.Rotator.rotate.bind(widget.Rotator),
  5000
);

How to get the indices list of all NaN value in numpy array?

Since x!=x returns the same boolean array with np.isnan(x) (because np.nan!=np.nan would return True), you could also write:

np.argwhere(x!=x)

However, I still recommend writing np.argwhere(np.isnan(x)) since it is more readable. I just try to provide another way to write the code in this answer.

Is <div style="width: ;height: ;background: "> CSS?

For example :

_x000D_
_x000D_
<div style="height:100px; width:100px; background:#000000"></div>
_x000D_
_x000D_
_x000D_

here.

you give css to div of height and width having 100px and background as black.

PS : try to avoid inline-css you can make external CSS and import in your html file.

you can refer here for CSS

hope this helps.

Maven Installation OSX Error Unsupported major.minor version 51.0

A dynamic $HOME/.zshrc solution, if you're like me ie. Linux @ work; MBP/A @ home

if [[ $(uname) == "Darwin" ]]; then export OSX=1; fi
if [[ $(uname) ==  "Linux" ]]; then export LINUX=1; fi

if [[ -n $OSX ]]; then
        export JAVA_HOME=$(/usr/libexec/java_home)
else
        export JAVA_HOME=/usr/lib/jvm/default-java
fi

Limit Decimal Places in Android EditText

This implementation of InputFilter solves the problem.

import android.text.SpannableStringBuilder;
import android.text.Spanned;
import android.text.method.DigitsKeyListener;

public class MoneyValueFilter extends DigitsKeyListener {
    public MoneyValueFilter() {
        super(false, true);
    }

    private int digits = 2;

    public void setDigits(int d) {
        digits = d;
    }

    @Override
    public CharSequence filter(CharSequence source, int start, int end,
            Spanned dest, int dstart, int dend) {
        CharSequence out = super.filter(source, start, end, dest, dstart, dend);

        // if changed, replace the source
        if (out != null) {
            source = out;
            start = 0;
            end = out.length();
        }

        int len = end - start;

        // if deleting, source is empty
        // and deleting can't break anything
        if (len == 0) {
            return source;
        }

        int dlen = dest.length();

        // Find the position of the decimal .
        for (int i = 0; i < dstart; i++) {
            if (dest.charAt(i) == '.') {
                // being here means, that a number has
                // been inserted after the dot
                // check if the amount of digits is right
                return (dlen-(i+1) + len > digits) ? 
                    "" :
                    new SpannableStringBuilder(source, start, end);
            }
        }

        for (int i = start; i < end; ++i) {
            if (source.charAt(i) == '.') {
                // being here means, dot has been inserted
                // check if the amount of digits is right
                if ((dlen-dend) + (end-(i + 1)) > digits)
                    return "";
                else
                    break;  // return new SpannableStringBuilder(source, start, end);
            }
        }

        // if the dot is after the inserted part,
        // nothing can break
        return new SpannableStringBuilder(source, start, end);
    }
}

To use:

editCoin.setFilters(new InputFilter[] {new MoneyValueFilter(2)});

What exactly is std::atomic?

Each instantiation and full specialization of std::atomic<> represents a type that different threads can simultaneously operate on (their instances), without raising undefined behavior:

Objects of atomic types are the only C++ objects that are free from data races; that is, if one thread writes to an atomic object while another thread reads from it, the behavior is well-defined.

In addition, accesses to atomic objects may establish inter-thread synchronization and order non-atomic memory accesses as specified by std::memory_order.

std::atomic<> wraps operations that, in pre-C++ 11 times, had to be performed using (for example) interlocked functions with MSVC or atomic bultins in case of GCC.

Also, std::atomic<> gives you more control by allowing various memory orders that specify synchronization and ordering constraints. If you want to read more about C++ 11 atomics and memory model, these links may be useful:

Note that, for typical use cases, you would probably use overloaded arithmetic operators or another set of them:

std::atomic<long> value(0);
value++; //This is an atomic op
value += 5; //And so is this

Because operator syntax does not allow you to specify the memory order, these operations will be performed with std::memory_order_seq_cst, as this is the default order for all atomic operations in C++ 11. It guarantees sequential consistency (total global ordering) between all atomic operations.

In some cases, however, this may not be required (and nothing comes for free), so you may want to use more explicit form:

std::atomic<long> value {0};
value.fetch_add(1, std::memory_order_relaxed); // Atomic, but there are no synchronization or ordering constraints
value.fetch_add(5, std::memory_order_release); // Atomic, performs 'release' operation

Now, your example:

a = a + 12;

will not evaluate to a single atomic op: it will result in a.load() (which is atomic itself), then addition between this value and 12 and a.store() (also atomic) of final result. As I noted earlier, std::memory_order_seq_cst will be used here.

However, if you write a += 12, it will be an atomic operation (as I noted before) and is roughly equivalent to a.fetch_add(12, std::memory_order_seq_cst).

As for your comment:

A regular int has atomic loads and stores. Whats the point of wrapping it with atomic<>?

Your statement is only true for architectures that provide such guarantee of atomicity for stores and/or loads. There are architectures that do not do this. Also, it is usually required that operations must be performed on word-/dword-aligned address to be atomic std::atomic<> is something that is guaranteed to be atomic on every platform, without additional requirements. Moreover, it allows you to write code like this:

void* sharedData = nullptr;
std::atomic<int> ready_flag = 0;

// Thread 1
void produce()
{
    sharedData = generateData();
    ready_flag.store(1, std::memory_order_release);
}

// Thread 2
void consume()
{
    while (ready_flag.load(std::memory_order_acquire) == 0)
    {
        std::this_thread::yield();
    }

    assert(sharedData != nullptr); // will never trigger
    processData(sharedData);
}

Note that assertion condition will always be true (and thus, will never trigger), so you can always be sure that data is ready after while loop exits. That is because:

  • store() to the flag is performed after sharedData is set (we assume that generateData() always returns something useful, in particular, never returns NULL) and uses std::memory_order_release order:

memory_order_release

A store operation with this memory order performs the release operation: no reads or writes in the current thread can be reordered after this store. All writes in the current thread are visible in other threads that acquire the same atomic variable

  • sharedData is used after while loop exits, and thus after load() from flag will return a non-zero value. load() uses std::memory_order_acquire order:

std::memory_order_acquire

A load operation with this memory order performs the acquire operation on the affected memory location: no reads or writes in the current thread can be reordered before this load. All writes in other threads that release the same atomic variable are visible in the current thread.

This gives you precise control over the synchronization and allows you to explicitly specify how your code may/may not/will/will not behave. This would not be possible if only guarantee was the atomicity itself. Especially when it comes to very interesting sync models like the release-consume ordering.

Efficient method to generate UUID String in JAVA (UUID.randomUUID().toString() without the dashes)

I used JUG (Java UUID Generator) to generate unique ID. It is unique across JVMs. Pretty good to use. Here is the code for your reference:

private static final SecureRandom secureRandom = new SecureRandom();
private static final UUIDGenerator generator = UUIDGenerator.getInstance();

public synchronized static String generateUniqueId() {
  UUID uuid = generator.generateRandomBasedUUID(secureRandom);

  return uuid.toString().replaceAll("-", "").toUpperCase();
}

You could download the library from: https://github.com/cowtowncoder/java-uuid-generator

"NoClassDefFoundError: Could not initialize class" error

I recently ran into this error on Windows 10. It turned out that windows was looking for .dll files necessary for my project and couldn't find them because it looks for them in the system path, PATH, rather than the CLASSPATH or -Djava.library.path

How to do an array of hashmaps?

Java doesn't want you to make an array of HashMaps, but it will let you make an array of Objects. So, just write up a class declaration as a shell around your HashMap, and make an array of that class. This lets you store some extra data about the HashMaps if you so choose--which can be a benefit, given that you already have a somewhat complex data structure.

What this looks like:

private static someClass[] arr = new someClass[someNum];

and

public class someClass {

private static int dataFoo;
private static int dataBar;
private static HashMap<String, String> yourArray;

...

}

How can I zoom an HTML element in Firefox and Opera?

Zoom and transform scale are not the same thing. They are applied at different times. Zoom is applied before the rendering happens, transform - after. The result of this is if you take a div with width/height = 100% nested inside of another div, with fixed size, if you apply zoom, everything inside your inner zoom will shrink, or grow, but if you apply transform your entire inner div will shrink (even though width/height is set to 100%, they are not going to be 100% after transformation).

Add CSS class to a div in code behind

Button1.CssClass += " newClass";

This will not erase your original classes for that control. Try this, it should work.

How can I safely create a nested directory?

I saw Heikki Toivonen and A-B-B's answers and thought of this variation.

import os
import errno

def make_sure_path_exists(path):
    try:
        os.makedirs(path)
    except OSError as exception:
        if exception.errno != errno.EEXIST or not os.path.isdir(path):
            raise

What is the difference between % and %% in a cmd file?

(Explanation in more details can be found in an archived Microsoft KB article.)

Three things to know:

  1. The percent sign is used in batch files to represent command line parameters: %1, %2, ...
  2. Two percent signs with any characters in between them are interpreted as a variable:

    echo %myvar%

  3. Two percent signs without anything in between (in a batch file) are treated like a single percent sign in a command (not a batch file): %%f

Why's that?

For example, if we execute your (simplified) command line

FOR /f %f in ('dir /b .') DO somecommand %f

in a batch file, rule 2 would try to interpret

%f in ('dir /b .') DO somecommand %

as a variable. In order to prevent that, you have to apply rule 3 and escape the % with an second %:

FOR /f %%f in ('dir /b .') DO somecommand %%f

Which HTTP methods match up to which CRUD methods?

Generally speaking, this is the pattern I use:

  • HTTP GET - SELECT/Request
  • HTTP PUT - UPDATE
  • HTTP POST - INSERT/Create
  • HTTP DELETE - DELETE

How to change root logging level programmatically for logback

I seem to be having success doing

org.jboss.logmanager.Logger logger = org.jboss.logmanager.Logger.getLogger("");
logger.setLevel(java.util.logging.Level.ALL);

Then to get detailed logging from netty, the following has done it

org.slf4j.impl.SimpleLogger.setLevel(org.slf4j.impl.SimpleLogger.TRACE);

Return content with IHttpActionResult for non-OK response

You can use this:

return Content(HttpStatusCode.BadRequest, "Any object");

Display image at 50% of its "native" size

This should work:

img {
    max-width: 50%;
    height: auto;
}

window.onload vs <body onload=""/>

It is a accepted standard to have content, layout and behavior separate. So window.onload() will be more suitable to use than <body onload=""> though both do the same work.

Convert a binary NodeJS Buffer to JavaScript ArrayBuffer

Instances of Buffer are also instances of Uint8Array in node.js 4.x and higher. Thus, the most efficient solution is to access the buf.buffer property directly, as per https://stackoverflow.com/a/31394257/1375574. The Buffer constructor also takes an ArrayBufferView argument if you need to go the other direction.

Note that this will not create a copy, which means that writes to any ArrayBufferView will write through to the original Buffer instance.


In older versions, node.js has both ArrayBuffer as part of v8, but the Buffer class provides a more flexible API. In order to read or write to an ArrayBuffer, you only need to create a view and copy across.

From Buffer to ArrayBuffer:

function toArrayBuffer(buf) {
    var ab = new ArrayBuffer(buf.length);
    var view = new Uint8Array(ab);
    for (var i = 0; i < buf.length; ++i) {
        view[i] = buf[i];
    }
    return ab;
}

From ArrayBuffer to Buffer:

function toBuffer(ab) {
    var buf = Buffer.alloc(ab.byteLength);
    var view = new Uint8Array(ab);
    for (var i = 0; i < buf.length; ++i) {
        buf[i] = view[i];
    }
    return buf;
}

How to show PIL Image in ipython notebook

A cleaner Python3 version that use standard numpy, matplotlib and PIL. Merging the answer for opening from URL.

import matplotlib.pyplot as plt
from PIL import Image
import numpy as np

pil_im = Image.open('image.jpg')
## Uncomment to open from URL
#import requests
#r = requests.get('https://www.vegvesen.no/public/webkamera/kamera?id=131206')
#pil_im = Image.open(BytesIO(r.content))
im_array = np.asarray(pil_im)
plt.imshow(im_array)
plt.show()

socket.error:[errno 99] cannot assign requested address and namespace in python

This error will also appear if you try to connect to an exposed port from within a Docker container, when nothing is actively serving the port.

On a host where nothing is listening/bound to that port you'd get a No connection could be made because the target machine actively refused it error instead when making a request to a local URL that is not served, eg: localhost:5000. However, if you start a container that binds to the port, but there is no server running inside of it actually serving the port, any requests to that port on localhost will result in:

  • [Errno 99] Cannot assign requested address (if called from within the container), or
  • [Errno 0] Error (if called from outside of the container).

You can reproduce this error and the behaviour described above as follows:

Start a dummy container (note: this will pull the python image if not found locally):

docker run --name serv1 -p 5000:5000 -dit python

Then for [Errno 0] Error enter a Python console on host, while for [Errno 99] Cannot assign requested address access a Python console on the container by calling:

docker exec -it -u 0 serv1 python

And then in either case call:

import urllib.request
urllib.request.urlopen('https://localhost:5000')

I concluded with treating either of these errors as equivalent to No connection could be made because the target machine actively refused it rather than trying to fix their cause - although please advise if that's a bad idea.


I've spent over a day figuring this one out, given that all resources and answers I could find on the [Errno 99] Cannot assign requested address point in the direction of binding to an occupied port, connecting to an invalid IP, sysctl conflicts, docker network issues, TIME_WAIT being incorrect, and many more things. Therefore I wanted to leave this answer here, despite not being a direct answer to the question at hand, given that it can be a common cause for the error described in this question.

FB OpenGraph og:image not pulling images (possibly https?)

Similar symptoms (Facebook et al not correctly fetching og:image and other assets over https) can occur when the site's https certificate is not fully compliant.

Your site's https cert may seem valid (green key in the browser and all), but it will not scrape correctly if it's missing an intermediate or chain certificate. This can lead to many wasted hours checking and rechecking all the various caches and meta tags.

Might not have been your problem, but could be other's with similar symptoms (like mine). There's many ways to check your cert - the one I happened to use: https://www.sslshopper.com/ssl-checker.html

How to read an http input stream

Spring has an util class for that:

import org.springframework.util.FileCopyUtils;

InputStream is = connection.getInputStream();
ByteArrayOutputStream bos = new ByteArrayOutputStream();
FileCopyUtils.copy(is, bos);
String data = new String(bos.toByteArray());

MySQL query String contains

In addition to the answer from @WoLpH.

When using the LIKE keyword you also have the ability to limit which direction the string matches. For example:

If you were looking for a string that starts with your $needle:

... WHERE column LIKE '{$needle}%'

If you were looking for a string that ends with the $needle:

... WHERE column LIKE '%{$needle}'

How do I time a method's execution in Java?

I implemented a simple timer, And I think it's really useful:

public class Timer{
    private static long start_time;

    public static double tic(){
        return start_time = System.nanoTime();
    }

    public static double toc(){
        return (System.nanoTime()-start_time)/1000000000.0;
    }

}

That way you can time one or more actions:

Timer.tic();
// Code 1
System.out.println("Code 1 runtime: "+Timer.toc()+" seconds.");
// Code 2
System.out.println("(Code 1 + Code 2) runtime: "+Timer.toc()+"seconds");
Timer.tic();
// Code 3
System.out.println("Code 3 runtime: "+Timer.toc()+" seconds.");

How to turn off the Eclipse code formatter for certain sections of Java code?

The phantom comments, adding // where you want new lines, are great!

  1. The @formatter: off adds a reference from the code to the editor. The code should, in my opinion, never have such references.

  2. The phantom comments (//) will work regardless of the formatting tool used. Regardless of Eclipse or InteliJ or whatever editor you use. This even works with the very nice Google Java Format

  3. The phantom comments (//) will work all over your application. If you also have Javascript and perhaps use something like JSBeautifier. You can have similar code style also in the Javascript.

  4. Actually, you probably DO want formatting right? You want to remove mixed tab/space and trailing spaces. You want to indent the lines according to the code standard. What you DONT want is a long line. That, and only that, is what the phantom comment gives you!

How do I change a single value in a data.frame?

Suppose your dataframe is df and you want to change gender from 2 to 1 in participant id 5 then you should determine the row by writing "==" as you can see

 df["rowName", "columnName"] <- value
 df[df$serial.id==5, "gender"] <- 1

JAX-WS and BASIC authentication, when user names and passwords are in a database

I was face-off a similar situation, I need to provide to my WS: Username, Password and WSS Password Type.

I was initially using the "Http Basic Auth" (as @ahoge), I tried to use the @Philipp-Dev 's ref. too. I didn't get a success solution.

After a little deep search at google, I found this post:

https://stackoverflow.com/a/3117841/1223901

And there was my problem solution

I hope this can help to anyone else, like helps to me.

Rgds, iVieL

A 'for' loop to iterate over an enum in Java

    for (Direction  d : Direction.values()) {
       //your code here   
    }

Passing an array using an HTML form hidden element

Either serialize:

$postvalue=array("a","b","c");
<input type="hidden" name="result" value="<?php echo serialize($postvalue); ?>">

on receive: unserialize($_POST['result'])

Or implode:

$postvalue=array("a","b","c");
<input type="hidden" name="result" value="<?php echo implode(',', $postvalue); ?>">

On receive: explode(',', $_POST['result'])

How to select a dropdown value in Selenium WebDriver using Java

As discussed above, we need to implement Select Class in Selenium and further we can use various available methods like :- enter image description here

Erasing elements from a vector

Depending on why you are doing this, using a std::set might be a better idea than std::vector.

It allows each element to occur only once. If you add it multiple times, there will only be one instance to erase anyway. This will make the erase operation trivial. The erase operation will also have lower time complexity than on the vector, however, adding elements is slower on the set so it might not be much of an advantage.

This of course won't work if you are interested in how many times an element has been added to your vector or the order the elements were added.

Multi-statement Table Valued Function vs Inline Table Valued Function

Your examples, I think, answer the question very well. The first function can be done as a single select, and is a good reason to use the inline style. The second could probably be done as a single statement (using a sub-query to get the max date), but some coders may find it easier to read or more natural to do it in multiple statements as you have done. Some functions just plain can't get done in one statement, and so require the multi-statement version.

I suggest using the simplest (inline) whenever possible, and using multi-statements when necessary (obviously) or when personal preference/readability makes it wirth the extra typing.

How to initialize a nested struct?

If you don't want to go with separate struct definition for nested struct and you don't like second method suggested by @OneOfOne you can use this third method:

package main
import "fmt"
type Configuration struct {
    Val   string
    Proxy struct {
        Address string
        Port    string
    }
}

func main() {
    c := &Configuration{
        Val: "test",
    }

    c.Proxy.Address = `127.0.0.1`
    c.Proxy.Port = `8080`
}

You can check it here: https://play.golang.org/p/WoSYCxzCF2

Determine number of pages in a PDF file

I have used pdflib for this.

    p = new pdflib();

    /* Open the input PDF */
    indoc = p.open_pdi_document("myTestFile.pdf", "");
    pageCount = (int) p.pcos_get_number(indoc, "length:pages");

load external URL into modal jquery ui dialog

Modals always load the content into an element on the page, which more often than not is a div. Think of this div as the iframe equivalent when it comes to jQuery UI Dialogs. Now it depends on your requirements whether you want static content that resides within the page or you want to fetch the content from some other location. You may use this code and see if it works for you:

<!DOCTYPE html PUBLIC "-//W3C//DTD XHTML 1.0 Strict//EN" "http://www.w3.org/TR/xhtml1/DTD/xhtml1-strict.dtd">
<html xmlns="http://www.w3.org/1999/xhtml" xml:lang="en" lang="en">

<head>
<title>test</title>
<meta http-equiv="content-type" content="text/html;charset=utf-8" />

<link rel="stylesheet" type="text/css" media="screen" href="css/jquery-ui-1.8.23.custom.css"/>

</head>

<body>

    <p>First open a modal <a href="http://ibm.com" class="example"> dialog</a></p>
    <div id="dialog"></div>
</body>

<!--jQuery-->
<script src="http://code.jquery.com/jquery-latest.pack.js"></script>
<script src="js/jquery-ui-1.8.23.custom.min.js"></script>

<script type="text/javascript">

$(function(){
//modal window start
$(".example").unbind('click');
$(".example").bind('click',function(){
    showDialog();
    var titletext=$(this).attr("title");
    var openpage=$(this).attr("href");
    $("#dialog").dialog( "option", "title", titletext );
    $("#dialog").dialog( "option", "resizable", false );
    $("#dialog").dialog( "option", "buttons", { 
        "Close": function() { 
            $(this).dialog("close");
            $(this).dialog("destroy");
        } 
    });
    $("#dialog").load(openpage);
    return false;
});

//modal window end

//Modal Window Initiation start

function showDialog(){
    $("#dialog").dialog({
        height: 400,
        width: 500,
        modal: true 
    }
</script>

</html>

There are, however, a few things which you should keep in mind. You will not be able to load remote URL's on your local system, you need to upload to a server if you want to load remote URL. Even then, you may only load URL's which belong to the same domain; e.g. if you upload this file to 'www.example.com' you may only access files hosted on 'www.example.com'. For loading external links this might help. All this information you will find in the link as suggested by @Robin.

How to filter input type="file" dialog by specific file type?

Add a custom attribute to <input type="file" file-accept="jpg gif jpeg png bmp"> and read the filenames within javascript that matches the extension provided by the attribute file-accept. This will be kind of bogus, as a text file with any of the above extension will erroneously deteted as image.

POST JSON to API using Rails and HTTParty

I solved this by adding .to_json and some heading information

@result = HTTParty.post(@urlstring_to_post.to_str, 
    :body => { :subject => 'This is the screen name', 
               :issue_type => 'Application Problem', 
               :status => 'Open', 
               :priority => 'Normal', 
               :description => 'This is the description for the problem'
             }.to_json,
    :headers => { 'Content-Type' => 'application/json' } )

Linq select objects in list where exists IN (A,B,C)

Try with Contains function;

Determines whether a sequence contains a specified element.

var allowedStatus = new[]{ "A", "B", "C" };
var filteredOrders = orders.Order.Where(o => allowedStatus.Contains(o.StatusCode));

How to increase image size of pandas.DataFrame.plot in jupyter notebook?

Try this:

import matplotlib as plt

after importing the file we can use matplotlib library but remember to use it as plt

df.plt(kind='line',figsize=(10,5))

after that the plot will be done and size increased. In figsize the 10 is for breadth and 5 is for height. Also other attributes can be added to the plot too.

How to loop through each and every row, column and cells in a GridView and get its value

foreach (DataGridViewRow row in dataGridView1.Rows)
        {
            for (int i = 0; i < dataGridView1.Columns.Count; i++)
            {
                String header = dataGridView1.Columns[i].HeaderText;
                //String cellText = row.Cells[i].Text;
                DataGridViewColumn column = dataGridView1.Columns[i]; // column[1] selects the required column 
                column.AutoSizeMode = DataGridViewAutoSizeColumnMode.AllCells; // sets the AutoSizeMode of column defined in previous line
                int colWidth = column.Width; // store columns width after auto resize           
                colWidth += 50; // add 30 pixels to what 'colWidth' already is
                this.dataGridView1.Columns[i].Width = colWidth; // set the columns width to the value stored in 'colWidth'
            }
        }

How to send value attribute from radio button in PHP

When you select a radio button and click on a submit button, you need to handle the submission of any selected values in your php code using $_POST[] For example: if your radio button is:

<input type="radio" name="rdb" value="male"/>

then in your php code you need to use:

$rdb_value = $_POST['rdb'];

How do I pass a variable to the layout using Laravel' Blade templating?

For future Google'rs that use Laravel 5, you can now also use it with includes,

@include('views.otherView', ['variable' => 1])

Using PHP Replace SPACES in URLS with %20

Use urlencode() rather than trying to implement your own. Be lazy.

How to create two columns on a web page?

i recommend to look this article

http://www.456bereastreet.com/lab/developing_with_web_standards/csslayout/2-col/

see 4. Place the columns side by side special

To make the two columns (#main and #sidebar) display side by side we float them, one to the left and the other to the right. We also specify the widths of the columns.

    #main {
    float:left;
    width:500px;
    background:#9c9;
    }
    #sidebar {
    float:right;
    width:250px;
   background:#c9c;
   }

Note that the sum of the widths should be equal to the width given to #wrap in Step 3.

Java int to String - Integer.toString(i) vs new Integer(i).toString()

Integer.toString calls the static method in the class Integer. It does not need an instance of Integer.

If you call new Integer(i) you create an instance of type Integer, which is a full Java object encapsulating the value of your int. Then you call the toString method on it to ask it to return a string representation of itself.

If all you want is to print an int, you'd use the first one because it's lighter, faster and doesn't use extra memory (aside from the returned string).

If you want an object representing an integer value—to put it inside a collection for example—you'd use the second one, since it gives you a full-fledged object to do all sort of things that you cannot do with a bare int.

NVIDIA NVML Driver/library version mismatch

Mostly reboot would fix the issue on Ubuntu 18.04.

The “Failed to initialize NVML: Driver/library version mismatch?” error generally means the CUDA Driver is still running an older release that is incompatible with the CUDA toolkit version currently in use. Rebooting the compute nodes will generally resolve this issue.

Getting the array length of a 2D array in Java

Consider

public static void main(String[] args) {

    int[][] foo = new int[][] {
        new int[] { 1, 2, 3 },
        new int[] { 1, 2, 3, 4},
    };

    System.out.println(foo.length); //2
    System.out.println(foo[0].length); //3
    System.out.println(foo[1].length); //4
}

Column lengths differ per row. If you're backing some data by a fixed size 2D array, then provide getters to the fixed values in a wrapper class.

Could not load file or assembly 'Newtonsoft.Json' or one of its dependencies. Manifest definition does not match the assembly reference

I got the same problem with dotnet core and managed to fix it by clearing the NuGet cache.

Open the powershell and enter the following command.

dotnet nuget locals all --clear

Then I closed Visual Studio, opened it again and entered the following command into the Package Manager Console:

Update-Package

NuGet should now restore all packages and popultes the nuget cache again.

After that I was able to build and start my dotnet core webapi in a Linux container.

CSS Always On Top

Assuming that your markup looks like:

<div id="header" style="position: fixed;"></div>
<div id="content" style="position: relative;"></div>

Now both elements are positioned; in which case, the element at the bottom (in source order) will cover element above it (in source order).

Add a z-index on header; 1 should be sufficient.

How to uncheck a radio button?

function clearForm(){
  $('#frm input[type="text"]').each(function(){
      $(this).val("");  
  });
  $('#frm input[type="radio":checked]').each(function(){
      $(this).attr('checked', false);  
  });
 }

The correct selector is: #frm input[type="radio"]:checked not #frm input[type="radio":checked]

VBA procedure to import csv file into access

Your file seems quite small (297 lines) so you can read and write them quite quickly. You refer to Excel CSV, which does not exists, and you show space delimited data in your example. Furthermore, Access is limited to 255 columns, and a CSV is not, so there is no guarantee this will work

Sub StripHeaderAndFooter()
Dim fs As Object ''FileSystemObject
Dim tsIn As Object, tsOut As Object ''TextStream
Dim sFileIn As String, sFileOut As String
Dim aryFile As Variant

    sFileIn = "z:\docs\FileName.csv"
    sFileOut = "z:\docs\FileOut.csv"

    Set fs = CreateObject("Scripting.FileSystemObject")
    Set tsIn = fs.OpenTextFile(sFileIn, 1) ''ForReading

    sTmp = tsIn.ReadAll

    Set tsOut = fs.CreateTextFile(sFileOut, True) ''Overwrite
    aryFile = Split(sTmp, vbCrLf)

    ''Start at line 3 and end at last line -1
    For i = 3 To UBound(aryFile) - 1
        tsOut.WriteLine aryFile(i)
    Next

    tsOut.Close

    DoCmd.TransferText acImportDelim, , "NewCSV", sFileOut, False
End Sub

Edit re various comments

It is possible to import a text file manually into MS Access and this will allow you to choose you own cell delimiters and text delimiters. You need to choose External data from the menu, select your file and step through the wizard.

About importing and linking data and database objects -- Applies to: Microsoft Office Access 2003

Introduction to importing and exporting data -- Applies to: Microsoft Access 2010

Once you get the import working using the wizards, you can save an import specification and use it for you next DoCmd.TransferText as outlined by @Olivier Jacot-Descombes. This will allow you to have non-standard delimiters such as semi colon and single-quoted text.

CKEditor, Image Upload (filebrowserUploadUrl)

I've recently needed an answer to this as well, and it took me several hours to figure it out, so I decided to resurrect this question with some more up-to-date information and a full answer.

Eventually I stumbled upon this tutorial that explained it to me pretty well. For stackoverflow sake, I will reiterate the tutorial here in case it is removed. I will also include some changes that I made to the tutorial that make this a more flexible solution.


Getting Started

Let's start with any of the releases of ckeditor, (Basic, standard, full, custom) the only requirement is that you have the addon image and filebrowser

(As of writing this, all packages include these 2 addons except for the basic one, but it can be added to the basic one)

After you upload necessary ckeditor files, make sure your installation is working.

Make sure you link your ckeditor.js file script <script src="ckeditor/ckeditor.js"></script> and then initialize it like so:

$(document).ready(function() {
    CKEDITOR.replace( 'editor1' );
});
<textarea name="editor1"></textarea>

CKEditor Configuration

Now we have to tell CKEditor that we want to enable uploading. You can do this by going into your ckeditor folder, and editing `config.js'. We need to add this line:

config.filebrowserUploadUrl = '/uploader/upload.php'; somewhere inside the main function E.G

CKEDITOR.editorConfig = function( config ) {
    // Define changes to default configuration here. For example:
    // config.language = 'fr';
    // config.uiColor = '#AADC6E';

    config.filebrowserUploadUrl = '/uploader/upload.php';
};

NOTE: This URL is from your project root. No matter where you load this file from, it will start at your site index. Meaning, if your URL is example.com, this URL leads to http://example.com/uploader/upload.php

After this, CKEditor configuration is done! That was easy eh?

In fact, if you go and test your image uploading again now, you will get an upload option, though it won't quite work yet.

enter image description here


Server Configuration

Now you'll notice in the step before this one that it ends with an upload.php file. This is the part that stumped me, I figured there would be some default that can go with this but as far as I know there is not. Luckily, I found one that works, and I made some changes to it to allow more customization.

So let's go to the path that you supplied in the last step, for continuity in this tutorial I am going to use /uploader/upload.php.

At this location, make a file called (you guessed it) upload.php.

This file is going to handle our file uploads.

I will put in my custom upload class, but it's based on this github that I found and forked.

upload.php:

<?php
// Upload script for CKEditor.
// Use at your own risk, no warranty provided. Be careful about who is able to access this file
// The upload folder shouldn't be able to upload any kind of script, just in case.
// If you're not sure, hire a professional that takes care of adjusting the server configuration as well as this script for you.
// (I am not such professional)

// Configuration Options: Change these to alter the way files being written works
$overwriteFiles = false;

//THESE SETTINGS ONLY MATTER IF $overwriteFiles is FALSE

    //Seperator between the name of the file and the generated ending.
    $keepFilesSeperator = "-"; 

    //Use "number" or "random". "number" adds a number, "random" adds a randomly generated string.
    $keepFilesAddonType = "random"; 

    //Only usable when $keepFilesAddonType is "number", this specifies where the number starts iterating from.
    $keepFilesNumberStart = 1; 

    //Only usable when $keepFilesAddonType is "random", this specifies the length of the string.
    $keepFilesRandomLength = 4; 

//END FILE OVERWRITE FALSE SETTINGS

// Step 1: change the true for whatever condition you use in your environment to verify that the user
// is logged in and is allowed to use the script
if (true) {
    echo("You're not allowed to upload files");
    die(0);
}

// Step 2: Put here the full absolute path of the folder where you want to save the files:
// You must set the proper permissions on that folder (I think that it's 644, but don't trust me on this one)
// ALWAYS put the final slash (/)
$basePath = "/home/user/public_html/example/pages/projects/uploader/files/";

// Step 3: Put here the Url that should be used for the upload folder (it the URL to access the folder that you have set in $basePath
// you can use a relative url "/images/", or a path including the host "http://example.com/images/"
// ALWAYS put the final slash (/)
$baseUrl = "http://example.com/pages/projects/uploader/files/";

// Done. Now test it!



// No need to modify anything below this line
//----------------------------------------------------

// ------------------------
// Input parameters: optional means that you can ignore it, and required means that you
// must use it to provide the data back to CKEditor.
// ------------------------

// Optional: instance name (might be used to adjust the server folders for example)
$CKEditor = $_GET['CKEditor'] ;

// Required: Function number as indicated by CKEditor.
$funcNum = $_GET['CKEditorFuncNum'] ;

// Optional: To provide localized messages
$langCode = $_GET['langCode'] ;

// ------------------------
// Data processing
// ------------------------

// The returned url of the uploaded file
$url = '' ;

// Optional message to show to the user (file renamed, invalid file, not authenticated...)
$message = '';

// in CKEditor the file is sent as 'upload'
if (isset($_FILES['upload'])) {
    // Be careful about all the data that it's sent!!!
    // Check that the user is authenticated, that the file isn't too big,
    // that it matches the kind of allowed resources...
    $name = $_FILES['upload']['name'];

    //If overwriteFiles is true, files will be overwritten automatically.
    if(!$overwriteFiles) 
    {
        $ext = ".".pathinfo($name, PATHINFO_EXTENSION);
        // Check if file exists, if it does loop through numbers until it doesn't.
        // reassign name at the end, if it does exist.
        if(file_exists($basePath.$name)) 
        {
            if($keepFilesAddonType == "number") {
                $operator = $keepFilesNumberStart;
            } else if($keepFilesAddonType == "random") {
                $operator = bin2hex(openssl_random_pseudo_bytes($keepFilesRandomLength/2));
            }
            //loop until file does not exist, every loop changes the operator to a different value.
            while(file_exists($basePath.$name.$keepFilesSeperator.$operator)) 
            {
                if($keepFilesAddonType == "number") {
                    $operator++;
                } else if($keepFilesAddonType == "random") {
                    $operator = bin2hex(openssl_random_pseudo_bytes($keepFilesRandomLength/2));
                }
            }
            $name = rtrim($name, $ext).$keepFilesSeperator.$operator.$ext;
        }
    }
    move_uploaded_file($_FILES["upload"]["tmp_name"], $basePath . $name);

    // Build the url that should be used for this file   
    $url = $baseUrl . $name ;

    // Usually you don't need any message when everything is OK.
//    $message = 'new file uploaded';   
}
else
{
    $message = 'No file has been sent';
}
// ------------------------
// Write output
// ------------------------
// We are in an iframe, so we must talk to the object in window.parent
echo "<script type='text/javascript'> window.parent.CKEDITOR.tools.callFunction($funcNum, '$url', '$message')</script>";

?>

The changes that I made to this class allow you to enable/disable file overwriting and gives you some options for when you don't want to overwrite files. The original class always overwrites with no options.

By default this class is set to keep all files, without overwriting. You can play around with those settings to better suit your needs.

If you'll notice, there is a section of code that is just an if(true) statement, which is always true obviously

if (true) {
    echo("You're not allowed to upload files");
    die(0);
}

This is for security. This is where you should check if the user uploading is logged in/allowed to upload. If you're not worried about that, you can just remove these lines of code or set it to if(false) (NOT RECOMMENDED)

You will also need to edit the $basePath and the $baseUrl variables to fit your servers needs, or else it will not work. Everything below that can be left alone unless you want to play around.

This class does not offer file protection, you may want to work with it some to make it more safe, so people can't upload scripts or viruses to your server.


I hope that this little tutorial helped someone, as I worked far too long on trying to get this to work for myself, and I hope I can save someone else some time.

There is also some neat troubleshooting steps on that tutorial which I linked above, that may be able to help you find what's going wrong if something is.

enter image description here

Making text background transparent but not text itself

For a fully transparent background use:

background: transparent;

Otherwise for a semi-transparent color fill use:

background: rgba(255,255,255,0.5); // or hsla(0, 0%, 100%, 0.5)

where the values are:

background: rgba(red,green,blue,opacity); // or hsla(hue, saturation, lightness, opacity)

You can also use rgba values for gradient backgrounds.

To get transparency on an image background simply reduce the opacity of the image in an image editor of you choice beforehand.

Pick any kind of file via an Intent in Android

The other answers are not incorrect. However, now there are more options for opening files. For example, if you want the app to have long term, permanent acess to a file, you can use ACTION_OPEN_DOCUMENT instead. Refer to the official documentation: Open files using storage access framework. Also refer to this answer.

How to read multiple text files into a single RDD?

TRY THIS Interface used to write a DataFrame to external storage systems (e.g. file systems, key-value stores, etc). Use DataFrame.write() to access this.

New in version 1.4.

csv(path, mode=None, compression=None, sep=None, quote=None, escape=None, header=None, nullValue=None, escapeQuotes=None, quoteAll=None, dateFormat=None, timestampFormat=None) Saves the content of the DataFrame in CSV format at the specified path.

Parameters: path – the path in any Hadoop supported file system mode – specifies the behavior of the save operation when data already exists.

append: Append contents of this DataFrame to existing data. overwrite: Overwrite existing data. ignore: Silently ignore this operation if data already exists. error (default case): Throw an exception if data already exists. compression – compression codec to use when saving to file. This can be one of the known case-insensitive shorten names (none, bzip2, gzip, lz4, snappy and deflate). sep – sets the single character as a separator for each field and value. If None is set, it uses the default value, ,. quote – sets the single character used for escaping quoted values where the separator can be part of the value. If None is set, it uses the default value, ". If you would like to turn off quotations, you need to set an empty string. escape – sets the single character used for escaping quotes inside an already quoted value. If None is set, it uses the default value, \ escapeQuotes – A flag indicating whether values containing quotes should always be enclosed in quotes. If None is set, it uses the default value true, escaping all values containing a quote character. quoteAll – A flag indicating whether all values should always be enclosed in quotes. If None is set, it uses the default value false, only escaping values containing a quote character. header – writes the names of columns as the first line. If None is set, it uses the default value, false. nullValue – sets the string representation of a null value. If None is set, it uses the default value, empty string. dateFormat – sets the string that indicates a date format. Custom date formats follow the formats at java.text.SimpleDateFormat. This applies to date type. If None is set, it uses the default value value, yyyy-MM-dd. timestampFormat – sets the string that indicates a timestamp format. Custom date formats follow the formats at java.text.SimpleDateFormat. This applies to timestamp type. If None is set, it uses the default value value, yyyy-MM-dd'T'HH:mm:ss.SSSZZ.

CSS Resize/Zoom-In effect on Image while keeping Dimensions

You could achieve that simply by wrapping the image by a <div> and adding overflow: hidden to that element:

<div class="img-wrapper">
    <img src="..." />
</div>
.img-wrapper {
    display: inline-block; /* change the default display type to inline-block */
    overflow: hidden;      /* hide the overflow */
}

WORKING DEMO.


Also it's worth noting that <img> element (like the other inline elements) sits on its baseline by default. And there would be a 4~5px gap at the bottom of the image.

That vertical gap belongs to the reserved space of descenders like: g j p q y. You could fix the alignment issue by adding vertical-align property to the image with a value other than baseline.

Additionally for a better user experience, you could add transition to the images.

Thus we'll end up with the following:

.img-wrapper img {
    transition: all .2s ease;
    vertical-align: middle;
}

UPDATED DEMO.

MySQL - Make an existing Field Unique

Just write this query in your db phpmyadmin.

ALTER TABLE TableName ADD UNIQUE (FieldName)

Eg: ALTER TABLE user ADD UNIQUE (email)

How to write asynchronous functions for Node.js

You seem to be confusing asynchronous IO with asynchronous functions. node.js uses asynchronous non-blocking IO because non blocking IO is better. The best way to understand it is to go watch some videos by ryan dahl.

How do I write asynchronous functions for Node?

Just write normal functions, the only difference is that they are not executed immediately but passed around as callbacks.

How should I implement error event handling correctly

Generally API's give you a callback with an err as the first argument. For example

database.query('something', function(err, result) {
  if (err) handle(err);
  doSomething(result);
});

Is a common pattern.

Another common pattern is on('error'). For example

process.on('uncaughtException', function (err) {
  console.log('Caught exception: ' + err);
});

Edit:

var async_function = function(val, callback){
    process.nextTick(function(){
        callback(val);
    });
};

The above function when called as

async_function(42, function(val) {
  console.log(val)
});
console.log(43);

Will print 42 to the console asynchronously. In particular process.nextTick fires after the current eventloop callstack is empty. That call stack is empty after async_function and console.log(43) have run. So we print 43 followed by 42.

You should probably do some reading on the event loop.

How to view the roles and permissions granted to any database user in Azure SQL server instance?

Building on @tmullaney 's answer, you can also left join in the sys.objects view to get insight when explicit permissions have been granted on objects. Make sure to use the LEFT join:

SELECT DISTINCT pr.principal_id, pr.name AS [UserName], pr.type_desc AS [User_or_Role], pr.authentication_type_desc AS [Auth_Type], pe.state_desc,
    pe.permission_name, pe.class_desc, o.[name] AS 'Object' 
    FROM sys.database_principals AS pr 
    JOIN sys.database_permissions AS pe ON pe.grantee_principal_id = pr.principal_id
    LEFT JOIN sys.objects AS o on (o.object_id = pe.major_id)

Combine two ActiveRecord::Relation objects

I've been able to accomplish this, even in many odd situations, by using Rails' built-in Arel.

User.where(
  User.arel_table[:first_name].eq('Tobias').or(
    User.arel_table[:last_name].eq('Fünke')
  )
)

This merges both ActiveRecord relations by using Arel's or.


Merge, as was suggested here, didn't work for me. It dropped the 2nd set of relation objects from the results.

HTML/JavaScript: Simple form validation on submit

The simplest validation is as follows:

_x000D_
_x000D_
<form name="ff1" method="post">
  <input type="email" name="email" id="fremail" placeholder="[email protected]" />
  <input type="text" pattern="[a-z0-9. -]+" title="Please enter only alphanumeric characters." name="title" id="frtitle" placeholder="Title" />
  <input type="url" name="url" id="frurl" placeholder="http://yourwebsite.com/" />
  <input type="submit" name="Submit" value="Continue" />
</form>
_x000D_
_x000D_
_x000D_

It uses HTML5 attributes (like as pattern).

JavaScript: none.

How to send json data in POST request using C#

You can use either HttpClient or RestSharp. Since I do not know what your code is, here is an example using HttpClient:

using (var client = new HttpClient())
{
    // This would be the like http://www.uber.com
    client.BaseAddress = new Uri("Base Address/URL Address");

    // serialize your json using newtonsoft json serializer then add it to the StringContent
    var content = new StringContent(YourJson, Encoding.UTF8, "application/json") 

    // method address would be like api/callUber:SomePort for example
    var result = await client.PostAsync("Method Address", content);
    string resultContent = await result.Content.ReadAsStringAsync();   
}

.setAttribute("disabled", false); changes editable attribute to false

A disabled element is, (self-explaining) disabled and thereby logically not editable, so:

set the disabled attribute [...] changes the editable attribute too

Is an intended and well-defined behaviour.

The real problem here seems to be you're trying to set disabled to false via setAttribute() which doesn't do what you're expecting. an element is disabled if the disabled-attribute is set, independent of it's value (so, disabled="true", disabled="disabled" and disabled="false" all do the same: the element gets disabled). you should instead remove the complete attribute:

element.removeAttribute("disabled");

or set that property directly:

element.disabled = false;

Printing to the console in Google Apps Script?

Updated for 2020

In February of 2020, Google announced a major upgrade to the built-in Google Apps Script IDE, and it now supports console.log(). So, you can now use both:

  1. Logger.log()
  2. console.log()

Happy coding!

DateTimeFormat in TypeScript

This should work...

var displayDate = new Date().toLocaleDateString();

alert(displayDate);

But I suspect you are trying it on something else, for example:

var displayDate = Date.now.toLocaleDateString(); // No!

alert(displayDate);

HTML <input type='file'> File Selection Event

That's the way I did it with pure JS:

_x000D_
_x000D_
var files = document.getElementById('filePoster');_x000D_
var submit = document.getElementById('submitFiles');_x000D_
var warning = document.getElementById('warning');_x000D_
files.addEventListener("change", function () {_x000D_
  if (files.files.length > 10) {_x000D_
    submit.disabled = true;_x000D_
    warning.classList += "warn"_x000D_
    return;_x000D_
  }_x000D_
  submit.disabled = false;_x000D_
});
_x000D_
#warning {_x000D_
    text-align: center;_x000D_
}_x000D_
_x000D_
#warning.warn {_x000D_
 color: red;_x000D_
 transform: scale(1.5);_x000D_
 transition: 1s all;_x000D_
}
_x000D_
<section id="shortcode-5" class="shortcode-5 pb-50">_x000D_
    <p id="warning">Please do not upload more than 10 images at once.</p>_x000D_
    <form class="imagePoster" enctype="multipart/form-data" action="/gallery/imagePoster" method="post">_x000D_
        <div class="input-group">_x000D_
       <input id="filePoster" type="file" class="form-control" name="photo" required="required" multiple="multiple" />_x000D_
     <button id="submitFiles" class="btn btn-primary" type="submit" name="button">Submit</button>_x000D_
        </div>_x000D_
    </form>_x000D_
</section>
_x000D_
_x000D_
_x000D_

Count number of vector values in range with R

There are also the %<% and %<=% comparison operators in the TeachingDemos package which allow you to do this like:

sum( 2 %<% x %<% 5 )
sum( 2 %<=% x %<=% 5 )

which gives the same results as:

sum( 2 < x & x < 5 )
sum( 2 <= x & x <= 5 )

Which is better is probably more a matter of personal preference.

How to run PowerShell in CMD

I'd like to add the following to Shay Levy's correct answer: You can make your life easier if you create a little batch script run.cmd to launch your powershell script:

@echo off & setlocal
set batchPath=%~dp0
powershell.exe -noexit -file "%batchPath%SQLExecutor.ps1" "MY-PC"

Put it in the same path as SQLExecutor.ps1 and from now on you can run it by simply double-clicking on run.cmd.


Note:

  • If you require command line arguments inside the run.cmd batch, simply pass them as %1 ... %9 (or use %* to pass all parameters) to the powershell script, i.e.
    powershell.exe -noexit -file "%batchPath%SQLExecutor.ps1" %*

  • The variable batchPath contains the executing path of the batch file itself (this is what the expression %~dp0 is used for). So you just put the powershell script in the same path as the calling batch file.

Open a selected file (image, pdf, ...) programmatically from my Android Application?

You can try this

File file = new File(filePath);
MimeTypeMap map = MimeTypeMap.getSingleton();
String ext = MimeTypeMap.getFileExtensionFromUrl(file.getName());
String type = map.getMimeTypeFromExtension(ext);

if (type == null)
    type = "*/*";

Intent intent = new Intent(Intent.ACTION_VIEW);
Uri data = Uri.fromFile(file);

intent.setDataAndType(data, type);

startActivity(intent);

C#: HttpClient with POST parameters

A cleaner alternative would be to use a Dictionary to handle parameters. They are key-value pairs after all.

private static readonly HttpClient httpclient;

static MyClassName()
{
    // HttpClient is intended to be instantiated once and re-used throughout the life of an application. 
    // Instantiating an HttpClient class for every request will exhaust the number of sockets available under heavy loads. 
    // This will result in SocketException errors.
    // https://docs.microsoft.com/en-us/dotnet/api/system.net.http.httpclient?view=netframework-4.7.1
    httpclient = new HttpClient();    
} 

var url = "http://myserver/method";
var parameters = new Dictionary<string, string> { { "param1", "1" }, { "param2", "2" } };
var encodedContent = new FormUrlEncodedContent (parameters);

var response = await httpclient.PostAsync (url, encodedContent).ConfigureAwait (false);
if (response.StatusCode == HttpStatusCode.OK) {
    // Do something with response. Example get content:
    // var responseContent = await response.Content.ReadAsStringAsync ().ConfigureAwait (false);
}

Also dont forget to Dispose() httpclient, if you dont use the keyword using

As stated in the Remarks section of the HttpClient class in the Microsoft docs, HttpClient should be instantiated once and re-used.

Edit:

You may want to look into response.EnsureSuccessStatusCode(); instead of if (response.StatusCode == HttpStatusCode.OK).

You may want to keep your httpclient and dont Dispose() it. See: Do HttpClient and HttpClientHandler have to be disposed?

Edit:

Do not worry about using .ConfigureAwait(false) in .NET Core. For more details look at https://blog.stephencleary.com/2017/03/aspnetcore-synchronization-context.html

What is std::move(), and when should it be used?

1. "What is it?"

While std::move() is technically a function - I would say it isn't really a function. It's sort of a converter between ways the compiler considers an expression's value.

2. "What does it do?"

The first thing to note is that std::move() doesn't actually move anything. It changes an expression from being an lvalue (such as a named variable) to being an xvalue. An xvalue tells the compiler:

You can plunder me, move anything I'm holding and use it elsewhere (since I'm going to be destroyed soon anyway)".

in other words, when you use std::move(x), you're allowing the compiler to cannibalize x. Thus if x has, say, its own buffer in memory - after std::move()ing the compiler can have another object own it instead.

You can also move from a prvalue (such as a temporary you're passing around), but this is rarely useful.

3. "When should it be used?"

Another way to ask this question is "What would I cannibalize an existing object's resources for?" well, if you're writing application code, you would probably not be messing around a lot with temporary objects created by the compiler. So mainly you would do this in places like constructors, operator methods, standard-library-algorithm-like functions etc. where objects get created and destroyed automagically a lot. Of course, that's just a rule of thumb.

A typical use is 'moving' resources from one object to another instead of copying. @Guillaume links to this page which has a straightforward short example: swapping two objects with less copying.

template <class T>
swap(T& a, T& b) {
    T tmp(a);   // we now have two copies of a
    a = b;      // we now have two copies of b (+ discarded a copy of a)
    b = tmp;    // we now have two copies of tmp (+ discarded a copy of b)
}

using move allows you to swap the resources instead of copying them around:

template <class T>
swap(T& a, T& b) {
    T tmp(std::move(a));
    a = std::move(b);   
    b = std::move(tmp);
}

Think of what happens when T is, say, vector<int> of size n. In the first version you read and write 3*n elements, in the second version you basically read and write just the 3 pointers to the vectors' buffers, plus the 3 buffers' sizes. Of course, class T needs to know how to do the moving; your class should have a move-assignment operator and a move-constructor for class T for this to work.

Uninstalling Android ADT

If running on windows vista or later,
remember to run eclipse under a user with proper file permissions.
try to use the 'Run as Administrator' option.

TypeScript hashmap/dictionary interface

The most simple and the correct way is to use Record type Record<string, string>

const myVar : Record<string, string> = {
   key1: 'val1',
   key2: 'val2',
}

C# Set collection?

I know this is an old thread, but I was running into the same problem and found HashSet to be very unreliable because given the same seed, GetHashCode() returned different codes. So, I thought, why not just use a List and hide the add method like this

public class UniqueList<T> : List<T>
{
    public new void Add(T obj)
    {
        if(!Contains(obj))
        {
            base.Add(obj);
        }
    }
}

Because List uses the Equals method solely to determine equality, you can define the Equals method on your T type to make sure you get the desired results.

How can I display a messagebox in ASP.NET?

just try this, it works fine in my browser:

your response writing code should be

Response.Write("<script>alert('login successful');</script>");

Hope this works

What is the default database path for MongoDB?

The Windows x64 installer shows the a path in the installer UI/wizard.

You can confirm which path it used later, by opening your mongod.cfg file. My mongod.cfg was located here C:\Program Files\MongoDB\Server\4.0\bin\mongod.cfg (change for your version of MongoDB!

When I opened my mongd.cfg I found this line, showing the default db path:

dbPath: C:\Program Files\MongoDB\Server\4.0\data

However, this caused an error when trying to run mongod, which was still expecting to find C:\data\db:

2019-05-05T09:32:36.084-0700 I STORAGE [initandlisten] exception in initAndListen: NonExistentPath: Data directory C:\data\db\ not found., terminating

You could pass mongod a --dbpath=... parameter. In my case:

mongod --dbpath="C:\Program Files\MongoDB\Server\4.0\data"

socket connect() vs bind()

Too Long; Don't Read: The difference is whether the source (local) or the destination address/port is being set. In short, bind() set the source and connect() set the destination. Regardless of TCP or UDP.

bind()

bind() set the socket's local (source) address. This is the address where packets are received. Packets sent by the socket carry this as the source address, so the other host will know where to send back its packets.

If receive is not needed the socket source address is useless. Protocols like TCP require receiving enabled in order to send properly, as the destination host send back a confirmation when one or more packets have arrived (i.e. acknowledgement).

connect()

  • TCP has a "connected" state. connect() triggers the TCP code to try to establish a connection to the other side.
  • UDP has no "connected" state. connect() only set a default address to where packets are sent when no address is specified. When connect() is not used, sendto() or sendmsg() must be used containing the destination address.

When connect() or a send function is called, and no address is bound, Linux automatically bind the socket to a random port. For technical details, take a look at inet_autobind() in Linux kernel source code.

Side notes

  • listen() is TCP only.
  • In AF_INET family, the socket's source or destination address (struct sockaddr_in) is composed by an IP address (see IP header), and TCP or UDP port (see TCP and UDP header).

Dynamic tabs with user-click chosen components

there is component ready to use (rc5 compatible) ng2-steps which uses Compiler to inject component to step container and service for wiring everything together (data sync)

    import { Directive , Input, OnInit, Compiler , ViewContainerRef } from '@angular/core';

import { StepsService } from './ng2-steps';

@Directive({
  selector:'[ng2-step]'
})
export class StepDirective implements OnInit{

  @Input('content') content:any;
  @Input('index') index:string;
  public instance;

  constructor(
    private compiler:Compiler,
    private viewContainerRef:ViewContainerRef,
    private sds:StepsService
  ){}

  ngOnInit(){
    //Magic!
    this.compiler.compileComponentAsync(this.content).then((cmpFactory)=>{
      const injector = this.viewContainerRef.injector;
      this.viewContainerRef.createComponent(cmpFactory, 0,  injector);
    });
  }

}

How to get Latitude and Longitude of the mobile device in android?

Above solutions is also correct, but some time if location is null then it crash the app or not working properly. The best way to get Latitude and Longitude of android is:

 Geocoder geocoder;
     String bestProvider;
     List<Address> user = null;
     double lat;
     double lng;

    LocationManager lm = (LocationManager) activity.getSystemService(Context.LOCATION_SERVICE);

     Criteria criteria = new Criteria();
     bestProvider = lm.getBestProvider(criteria, false);
     Location location = lm.getLastKnownLocation(bestProvider);

     if (location == null){
         Toast.makeText(activity,"Location Not found",Toast.LENGTH_LONG).show();
      }else{
        geocoder = new Geocoder(activity);
        try {
            user = geocoder.getFromLocation(location.getLatitude(), location.getLongitude(), 1);
        lat=(double)user.get(0).getLatitude();
        lng=(double)user.get(0).getLongitude();
        System.out.println(" DDD lat: " +lat+",  longitude: "+lng);

        }catch (Exception e) {
                e.printStackTrace();
        }
    }

SoapFault exception: Could not connect to host

The problem was solved.The problem is the cache

ini_set('soap.wsdl_cache_enabled',0);
ini_set('soap.wsdl_cache_ttl',0);

How to increment an iterator by 2?

std::advance( iter, 2 );

This method will work for iterators that are not random-access iterators but it can still be specialized by the implementation to be no less efficient than iter += 2 when used with random-access iterators.

How do you run a command for each line of a file?

You can also use AWK which can give you more flexibility to handle the file

awk '{ print "chmod 755 "$0"" | "/bin/sh"}' file.txt

if your file has a field separator like:

field1,field2,field3

To get only the first field you do

awk -F, '{ print "chmod 755 "$1"" | "/bin/sh"}' file.txt

You can check more details on GNU Documentation https://www.gnu.org/software/gawk/manual/html_node/Very-Simple.html#Very-Simple

What's the safest way to iterate through the keys of a Perl hash?

A few miscellaneous thoughts on this topic:

  1. There is nothing unsafe about any of the hash iterators themselves. What is unsafe is modifying the keys of a hash while you're iterating over it. (It's perfectly safe to modify the values.) The only potential side-effect I can think of is that values returns aliases which means that modifying them will modify the contents of the hash. This is by design but may not be what you want in some circumstances.
  2. John's accepted answer is good with one exception: the documentation is clear that it is not safe to add keys while iterating over a hash. It may work for some data sets but will fail for others depending on the hash order.
  3. As already noted, it is safe to delete the last key returned by each. This is not true for keys as each is an iterator while keys returns a list.

Elasticsearch error: cluster_block_exception [FORBIDDEN/12/index read-only / allow delete (api)], flood stage disk watermark exceeded

Only changing the settings with the following command did not work in my environment:

curl -XPUT -H "Content-Type: application/json" http://localhost:9200/_all/_settings -d '{"index.blocks.read_only_allow_delete": null}'

I had to also ran the Force Merge API command:

curl -X POST "localhost:9200/my-index-000001/_forcemerge?pretty"

ref: Force Merge API

Efficiently checking if arbitrary object is NaN in Python / numpy / pandas?

pandas.isnull() (also pd.isna(), in newer versions) checks for missing values in both numeric and string/object arrays. From the documentation, it checks for:

NaN in numeric arrays, None/NaN in object arrays

Quick example:

import pandas as pd
import numpy as np
s = pd.Series(['apple', np.nan, 'banana'])
pd.isnull(s)
Out[9]: 
0    False
1     True
2    False
dtype: bool

The idea of using numpy.nan to represent missing values is something that pandas introduced, which is why pandas has the tools to deal with it.

Datetimes too (if you use pd.NaT you won't need to specify the dtype)

In [24]: s = Series([Timestamp('20130101'),np.nan,Timestamp('20130102 9:30')],dtype='M8[ns]')

In [25]: s
Out[25]: 
0   2013-01-01 00:00:00
1                   NaT
2   2013-01-02 09:30:00
dtype: datetime64[ns]``

In [26]: pd.isnull(s)
Out[26]: 
0    False
1     True
2    False
dtype: bool

Go: panic: runtime error: invalid memory address or nil pointer dereference

According to the docs for func (*Client) Do:

"An error is returned if caused by client policy (such as CheckRedirect), or if there was an HTTP protocol error. A non-2xx response doesn't cause an error.

When err is nil, resp always contains a non-nil resp.Body."

Then looking at this code:

res, err := client.Do(req)
defer res.Body.Close()

if err != nil {
    return nil, err
}

I'm guessing that err is not nil. You're accessing the .Close() method on res.Body before you check for the err.

The defer only defers the function call. The field and method are accessed immediately.


So instead, try checking the error immediately.

res, err := client.Do(req)

if err != nil {
    return nil, err
}
defer res.Body.Close()

gcc error: wrong ELF class: ELFCLASS64

It turns out the compiler version I was using did not match the compiled version done with the coreset.o.

One was 32bit the other was 64bit. I'll leave this up in case anyone else runs into a similar problem.

How do I write a correct micro-benchmark in Java?

Tips about writing micro benchmarks from the creators of Java HotSpot:

Rule 0: Read a reputable paper on JVMs and micro-benchmarking. A good one is Brian Goetz, 2005. Do not expect too much from micro-benchmarks; they measure only a limited range of JVM performance characteristics.

Rule 1: Always include a warmup phase which runs your test kernel all the way through, enough to trigger all initializations and compilations before timing phase(s). (Fewer iterations is OK on the warmup phase. The rule of thumb is several tens of thousands of inner loop iterations.)

Rule 2: Always run with -XX:+PrintCompilation, -verbose:gc, etc., so you can verify that the compiler and other parts of the JVM are not doing unexpected work during your timing phase.

Rule 2.1: Print messages at the beginning and end of timing and warmup phases, so you can verify that there is no output from Rule 2 during the timing phase.

Rule 3: Be aware of the difference between -client and -server, and OSR and regular compilations. The -XX:+PrintCompilation flag reports OSR compilations with an at-sign to denote the non-initial entry point, for example: Trouble$1::run @ 2 (41 bytes). Prefer server to client, and regular to OSR, if you are after best performance.

Rule 4: Be aware of initialization effects. Do not print for the first time during your timing phase, since printing loads and initializes classes. Do not load new classes outside of the warmup phase (or final reporting phase), unless you are testing class loading specifically (and in that case load only the test classes). Rule 2 is your first line of defense against such effects.

Rule 5: Be aware of deoptimization and recompilation effects. Do not take any code path for the first time in the timing phase, because the compiler may junk and recompile the code, based on an earlier optimistic assumption that the path was not going to be used at all. Rule 2 is your first line of defense against such effects.

Rule 6: Use appropriate tools to read the compiler's mind, and expect to be surprised by the code it produces. Inspect the code yourself before forming theories about what makes something faster or slower.

Rule 7: Reduce noise in your measurements. Run your benchmark on a quiet machine, and run it several times, discarding outliers. Use -Xbatch to serialize the compiler with the application, and consider setting -XX:CICompilerCount=1 to prevent the compiler from running in parallel with itself. Try your best to reduce GC overhead, set Xmx(large enough) equals Xms and use UseEpsilonGC if it is available.

Rule 8: Use a library for your benchmark as it is probably more efficient and was already debugged for this sole purpose. Such as JMH, Caliper or Bill and Paul's Excellent UCSD Benchmarks for Java.

Get value of a merged cell of an excel from its cell address in vba

Even if it is really discouraged to use merge cells in Excel (use Center Across Selection for instance if needed), the cell that "contains" the value is the one on the top left (at least, that's a way to express it).

Hence, you can get the value of merged cells in range B4:B11 in several ways:

  • Range("B4").Value
  • Range("B4:B11").Cells(1).Value
  • Range("B4:B11").Cells(1,1).Value

You can also note that all the other cells have no value in them. While debugging, you can see that the value is empty.

Also note that Range("B4:B11").Value won't work (raises an execution error number 13 if you try to Debug.Print it) because it returns an array.

Select and display only duplicate records in MySQL

Get a list of all duplicate rows from table:

Select * from TABLE1 where PRIMARY_KEY_COLUMN NOT IN ( SELECT PRIMARY_KEY_COLUMN
FROM TABLE1 
GROUP BY DUP_COLUMN_NAME having (count(*) >= 1))

How to convert array to SimpleXML

You can use Mustache Template Engine and make a Template like:

{{#RECEIVER}}
<RECEIVER>
    <COMPANY>{{{COMPANY}}}</COMPANY>
    <CONTACT>{{{CONTACT}}}</CONTACT>
    <ADDRESS>{{{ADDRESS}}}</ADDRESS>
    <ZIP>{{ZIP}}</ZIP>
    <CITY>{{{CITY}}}</CITY>
</RECEIVER>
{{/RECEIVER}}
{{#DOC}}
<DOC>
    <TEXT>{{{TEXT}}}</TEXT>
    <NUMBER>{{{NUMBER}}}</NUMBER>
</DOC>
{{/DOC}}

Use it like this in PHP:

require_once( __DIR__ .'/../controls/Mustache/Autoloader.php' );
Mustache_Autoloader::register();
$oMustache = new Mustache_Engine();
$sTemplate = implode( '', file( __DIR__ ."/xml.tpl" ));
$return = $oMustache->render($sTemplate, $res);
echo($return);

set font size in jquery

Try:

$("#"+styleTarget).css({ 'font-size': $(this).val() });

By putting the value in quotes, it becomes a string, and "+$(this).val()+"px is definitely not close to a font value. There are a couple of ways of setting the style properties of an element:

Using a map:

$("#elem").css({
    fontSize: 20
});

Using key and value parameters:

All of these are valid.

$("#elem").css("fontSize", 20);
$("#elem").css("fontSize", "20px");
$("#elem").css("font-size", "20");
$("#elem").css("font-size", "20px");

You can replace "fontSize" with "font-size" but it will have to be quoted then.

Making an iframe responsive

Try using this code to make it responsive

iframe, object, embed {
    max-width: 100%;
}

Case insensitive regular expression without re.compile?

You can also perform case insensitive searches using search/match without the IGNORECASE flag (tested in Python 2.7.3):

re.search(r'(?i)test', 'TeSt').group()    ## returns 'TeSt'
re.match(r'(?i)test', 'TeSt').group()     ## returns 'TeSt'

Angular2 http.get() ,map(), subscribe() and observable pattern - basic understanding

import { HttpClientModule } from '@angular/common/http';

The HttpClient API was introduced in the version 4.3.0. It is an evolution of the existing HTTP API and has it's own package @angular/common/http. One of the most notable changes is that now the response object is a JSON by default, so there's no need to parse it with map method anymore .Straight away we can use like below

http.get('friends.json').subscribe(result => this.result =result);

Improve subplot size/spacing with many subplots in matplotlib

import matplotlib.pyplot as plt

fig = plt.figure(figsize=(10,60))
plt.subplots_adjust( ... )

The plt.subplots_adjust method:

def subplots_adjust(*args, **kwargs):
    """
    call signature::

      subplots_adjust(left=None, bottom=None, right=None, top=None,
                      wspace=None, hspace=None)

    Tune the subplot layout via the
    :class:`matplotlib.figure.SubplotParams` mechanism.  The parameter
    meanings (and suggested defaults) are::

      left  = 0.125  # the left side of the subplots of the figure
      right = 0.9    # the right side of the subplots of the figure
      bottom = 0.1   # the bottom of the subplots of the figure
      top = 0.9      # the top of the subplots of the figure
      wspace = 0.2   # the amount of width reserved for blank space between subplots
      hspace = 0.2   # the amount of height reserved for white space between subplots

    The actual defaults are controlled by the rc file
    """
    fig = gcf()
    fig.subplots_adjust(*args, **kwargs)
    draw_if_interactive()

or

fig = plt.figure(figsize=(10,60))
fig.subplots_adjust( ... )

The size of the picture matters.

"I've tried messing with hspace, but increasing it only seems to make all of the graphs smaller without resolving the overlap problem."

Thus to make more white space and keep the sub plot size the total image needs to be bigger.

New self vs. new static

If the method of this code is not static, you can get a work-around in 5.2 by using get_class($this).

class A {
    public function create1() {
        $class = get_class($this);
        return new $class();
    }
    public function create2() {
        return new static();
    }
}

class B extends A {

}

$b = new B();
var_dump(get_class($b->create1()), get_class($b->create2()));

The results:

string(1) "B"
string(1) "B"

oracle plsql: how to parse XML and insert into table

You can load an XML document into an XMLType, then query it, e.g.:

DECLARE
  x XMLType := XMLType(
    '<?xml version="1.0" ?> 
<person>
   <row>
       <name>Tom</name>
       <Address>
           <State>California</State>
           <City>Los angeles</City>
       </Address>
   </row>
   <row>
       <name>Jim</name>
       <Address>
           <State>California</State>
           <City>Los angeles</City>
       </Address>
   </row>
</person>');
BEGIN
  FOR r IN (
    SELECT ExtractValue(Value(p),'/row/name/text()') as name
          ,ExtractValue(Value(p),'/row/Address/State/text()') as state
          ,ExtractValue(Value(p),'/row/Address/City/text()') as city
    FROM   TABLE(XMLSequence(Extract(x,'/person/row'))) p
    ) LOOP
    -- do whatever you want with r.name, r.state, r.city
  END LOOP;
END;

Javascript: open new page in same window

try this it worked for me in ie 7 and ie 8

 $(this).click(function (j) {
            var href = ($(this).attr('href'));
            window.location = href;
            return true;

UTF-8 text is garbled when form is posted as multipart/form-data

I got stuck with this problem and found that it was the order of the call to

request.setCharacterEncoding("UTF-8");

that was causing the problem. It has to be called before any all call to request.getParameter(), so I made a special filter to use at the top of my filter chain.

https://rogerkeays.com/servletrequest-setcharactercoding-ignored

What are Aggregates and PODs and how/why are they special?

How to read:

This article is rather long. If you want to know about both aggregates and PODs (Plain Old Data) take time and read it. If you are interested just in aggregates, read only the first part. If you are interested only in PODs then you must first read the definition, implications, and examples of aggregates and then you may jump to PODs but I would still recommend reading the first part in its entirety. The notion of aggregates is essential for defining PODs. If you find any errors (even minor, including grammar, stylistics, formatting, syntax, etc.) please leave a comment, I'll edit.

This answer applies to C++03. For other C++ standards see:

What are aggregates and why they are special

Formal definition from the C++ standard (C++03 8.5.1 §1):

An aggregate is an array or a class (clause 9) with no user-declared constructors (12.1), no private or protected non-static data members (clause 11), no base classes (clause 10), and no virtual functions (10.3).

So, OK, let's parse this definition. First of all, any array is an aggregate. A class can also be an aggregate if… wait! nothing is said about structs or unions, can't they be aggregates? Yes, they can. In C++, the term class refers to all classes, structs, and unions. So, a class (or struct, or union) is an aggregate if and only if it satisfies the criteria from the above definitions. What do these criteria imply?

  • This does not mean an aggregate class cannot have constructors, in fact it can have a default constructor and/or a copy constructor as long as they are implicitly declared by the compiler, and not explicitly by the user

  • No private or protected non-static data members. You can have as many private and protected member functions (but not constructors) as well as as many private or protected static data members and member functions as you like and not violate the rules for aggregate classes

  • An aggregate class can have a user-declared/user-defined copy-assignment operator and/or destructor

  • An array is an aggregate even if it is an array of non-aggregate class type.

Now let's look at some examples:

class NotAggregate1
{
  virtual void f() {} //remember? no virtual functions
};

class NotAggregate2
{
  int x; //x is private by default and non-static 
};

class NotAggregate3
{
public:
  NotAggregate3(int) {} //oops, user-defined constructor
};

class Aggregate1
{
public:
  NotAggregate1 member1;   //ok, public member
  Aggregate1& operator=(Aggregate1 const & rhs) {/* */} //ok, copy-assignment  
private:
  void f() {} // ok, just a private function
};

You get the idea. Now let's see how aggregates are special. They, unlike non-aggregate classes, can be initialized with curly braces {}. This initialization syntax is commonly known for arrays, and we just learnt that these are aggregates. So, let's start with them.

Type array_name[n] = {a1, a2, …, am};

if(m == n)
the ith element of the array is initialized with ai
else if(m < n)
the first m elements of the array are initialized with a1, a2, …, am and the other n - m elements are, if possible, value-initialized (see below for the explanation of the term)
else if(m > n)
the compiler will issue an error
else (this is the case when n isn't specified at all like int a[] = {1, 2, 3};)
the size of the array (n) is assumed to be equal to m, so int a[] = {1, 2, 3}; is equivalent to int a[3] = {1, 2, 3};

When an object of scalar type (bool, int, char, double, pointers, etc.) is value-initialized it means it is initialized with 0 for that type (false for bool, 0.0 for double, etc.). When an object of class type with a user-declared default constructor is value-initialized its default constructor is called. If the default constructor is implicitly defined then all nonstatic members are recursively value-initialized. This definition is imprecise and a bit incorrect but it should give you the basic idea. A reference cannot be value-initialized. Value-initialization for a non-aggregate class can fail if, for example, the class has no appropriate default constructor.

Examples of array initialization:

class A
{
public:
  A(int) {} //no default constructor
};
class B
{
public:
  B() {} //default constructor available
};
int main()
{
  A a1[3] = {A(2), A(1), A(14)}; //OK n == m
  A a2[3] = {A(2)}; //ERROR A has no default constructor. Unable to value-initialize a2[1] and a2[2]
  B b1[3] = {B()}; //OK b1[1] and b1[2] are value initialized, in this case with the default-ctor
  int Array1[1000] = {0}; //All elements are initialized with 0;
  int Array2[1000] = {1}; //Attention: only the first element is 1, the rest are 0;
  bool Array3[1000] = {}; //the braces can be empty too. All elements initialized with false
  int Array4[1000]; //no initializer. This is different from an empty {} initializer in that
  //the elements in this case are not value-initialized, but have indeterminate values 
  //(unless, of course, Array4 is a global array)
  int array[2] = {1, 2, 3, 4}; //ERROR, too many initializers
}

Now let's see how aggregate classes can be initialized with braces. Pretty much the same way. Instead of the array elements we will initialize the non-static data members in the order of their appearance in the class definition (they are all public by definition). If there are fewer initializers than members, the rest are value-initialized. If it is impossible to value-initialize one of the members which were not explicitly initialized, we get a compile-time error. If there are more initializers than necessary, we get a compile-time error as well.

struct X
{
  int i1;
  int i2;
};
struct Y
{
  char c;
  X x;
  int i[2];
  float f; 
protected:
  static double d;
private:
  void g(){}      
}; 

Y y = {'a', {10, 20}, {20, 30}};

In the above example y.c is initialized with 'a', y.x.i1 with 10, y.x.i2 with 20, y.i[0] with 20, y.i[1] with 30 and y.f is value-initialized, that is, initialized with 0.0. The protected static member d is not initialized at all, because it is static.

Aggregate unions are different in that you may initialize only their first member with braces. I think that if you are advanced enough in C++ to even consider using unions (their use may be very dangerous and must be thought of carefully), you could look up the rules for unions in the standard yourself :).

Now that we know what's special about aggregates, let's try to understand the restrictions on classes; that is, why they are there. We should understand that memberwise initialization with braces implies that the class is nothing more than the sum of its members. If a user-defined constructor is present, it means that the user needs to do some extra work to initialize the members therefore brace initialization would be incorrect. If virtual functions are present, it means that the objects of this class have (on most implementations) a pointer to the so-called vtable of the class, which is set in the constructor, so brace-initialization would be insufficient. You could figure out the rest of the restrictions in a similar manner as an exercise :).

So enough about the aggregates. Now we can define a stricter set of types, to wit, PODs

What are PODs and why they are special

Formal definition from the C++ standard (C++03 9 §4):

A POD-struct is an aggregate class that has no non-static data members of type non-POD-struct, non-POD-union (or array of such types) or reference, and has no user-defined copy assignment operator and no user-defined destructor. Similarly, a POD-union is an aggregate union that has no non-static data members of type non-POD-struct, non-POD-union (or array of such types) or reference, and has no user-defined copy assignment operator and no user-defined destructor. A POD class is a class that is either a POD-struct or a POD-union.

Wow, this one's tougher to parse, isn't it? :) Let's leave unions out (on the same grounds as above) and rephrase in a bit clearer way:

An aggregate class is called a POD if it has no user-defined copy-assignment operator and destructor and none of its nonstatic members is a non-POD class, array of non-POD, or a reference.

What does this definition imply? (Did I mention POD stands for Plain Old Data?)

  • All POD classes are aggregates, or, to put it the other way around, if a class is not an aggregate then it is sure not a POD
  • Classes, just like structs, can be PODs even though the standard term is POD-struct for both cases
  • Just like in the case of aggregates, it doesn't matter what static members the class has

Examples:

struct POD
{
  int x;
  char y;
  void f() {} //no harm if there's a function
  static std::vector<char> v; //static members do not matter
};

struct AggregateButNotPOD1
{
  int x;
  ~AggregateButNotPOD1() {} //user-defined destructor
};

struct AggregateButNotPOD2
{
  AggregateButNotPOD1 arrOfNonPod[3]; //array of non-POD class
};

POD-classes, POD-unions, scalar types, and arrays of such types are collectively called POD-types.
PODs are special in many ways. I'll provide just some examples.

  • POD-classes are the closest to C structs. Unlike them, PODs can have member functions and arbitrary static members, but neither of these two change the memory layout of the object. So if you want to write a more or less portable dynamic library that can be used from C and even .NET, you should try to make all your exported functions take and return only parameters of POD-types.

  • The lifetime of objects of non-POD class type begins when the constructor has finished and ends when the destructor has finished. For POD classes, the lifetime begins when storage for the object is occupied and finishes when that storage is released or reused.

  • For objects of POD types it is guaranteed by the standard that when you memcpy the contents of your object into an array of char or unsigned char, and then memcpy the contents back into your object, the object will hold its original value. Do note that there is no such guarantee for objects of non-POD types. Also, you can safely copy POD objects with memcpy. The following example assumes T is a POD-type:

    #define N sizeof(T)
    char buf[N];
    T obj; // obj initialized to its original value
    memcpy(buf, &obj, N); // between these two calls to memcpy,
    // obj might be modified
    memcpy(&obj, buf, N); // at this point, each subobject of obj of scalar type
    // holds its original value
    
  • goto statement. As you may know, it is illegal (the compiler should issue an error) to make a jump via goto from a point where some variable was not yet in scope to a point where it is already in scope. This restriction applies only if the variable is of non-POD type. In the following example f() is ill-formed whereas g() is well-formed. Note that Microsoft's compiler is too liberal with this rule—it just issues a warning in both cases.

    int f()
    {
      struct NonPOD {NonPOD() {}};
      goto label;
      NonPOD x;
    label:
      return 0;
    }
    
    int g()
    {
      struct POD {int i; char c;};
      goto label;
      POD x;
    label:
      return 0;
    }
    
  • It is guaranteed that there will be no padding in the beginning of a POD object. In other words, if a POD-class A's first member is of type T, you can safely reinterpret_cast from A* to T* and get the pointer to the first member and vice versa.

The list goes on and on…

Conclusion

It is important to understand what exactly a POD is because many language features, as you see, behave differently for them.

Pandas: Creating DataFrame from Series

Here is how to create a DataFrame where each series is a row.

For a single Series (resulting in a single-row DataFrame):

series = pd.Series([1,2], index=['a','b'])
df = pd.DataFrame([series])

For multiple series with identical indices:

cols = ['a','b']
list_of_series = [pd.Series([1,2],index=cols), pd.Series([3,4],index=cols)]
df = pd.DataFrame(list_of_series, columns=cols)

For multiple series with possibly different indices:

list_of_series = [pd.Series([1,2],index=['a','b']), pd.Series([3,4],index=['a','c'])]
df = pd.concat(list_of_series, axis=1).transpose()

To create a DataFrame where each series is a column, see the answers by others. Alternatively, one can create a DataFrame where each series is a row, as above, and then use df.transpose(). However, the latter approach is inefficient if the columns have different data types.

Check for column name in a SqlDataReader object

Here is a working sample for Jasmin's idea:

var cols = r.GetSchemaTable().Rows.Cast<DataRow>().Select
    (row => row["ColumnName"] as string).ToList(); 

if (cols.Contains("the column name"))
{

}

How to create multiple page app using react

The second part of your question is answered well. Here is the answer for the first part: How to output multiple files with webpack:

    entry: {
            outputone: './source/fileone.jsx',
            outputtwo: './source/filetwo.jsx'
            },
    output: {
            path: path.resolve(__dirname, './wwwroot/js/dist'),
            filename: '[name].js'      
            },

This will generate 2 files: outputone.js und outputtwo.js in the target folder.

Javascript foreach loop on associative array object

There are some straightforward examples already, but I notice from how you've worded your question that you probably come from a PHP background, and you're expecting JavaScript to work the same way -- it does not. A PHP array is very different from a JavaScript Array.

In PHP, an associative array can do most of what a numerically-indexed array can (the array_* functions work, you can count() it, etc.) You simply create an array and start assigning to string-indexes instead of numeric.

In JavaScript, everything is an object (except for primitives: string, numeric, boolean), and arrays are a certain implementation that lets you have numeric indexes. Anything pushed to an array will effect its length, and can be iterated over using Array methods (map, forEach, reduce, filter, find, etc.) However, because everything is an object, you're always free to simply assign properties, because that's something you do to any object. Square-bracket notation is simply another way to access a property, so in your case:

array['Main'] = 'Main Page';

is actually equivalent to:

array.Main = 'Main Page';

From your description, my guess is that you want an 'associative array', but for JavaScript, this is a simple case of using an object as a hashmap. Also, I know it's an example, but avoid non-meaningful names that only describe the variable type (e.g. array), and name based on what it should contain (e.g. pages). Simple objects don't have many good direct ways to iterate, so often we'll turn then into arrays first using Object methods (Object.keys in this case -- there's also entries and values being added to some browsers right now) which we can loop.

// assigning values to corresponding keys
const pages = {
  Main: 'Main page',
  Guide: 'Guide page',
  Articles: 'Articles page',
  Forum: 'Forum board',
};

Object.keys(pages).forEach((page) => console.log(page));

List the queries running on SQL Server

Actually, running EXEC sp_who2 in Query Analyzer / Management Studio gives more info than sp_who.

Beyond that you could set up SQL Profiler to watch all of the in and out traffic to the server. Profiler also let you narrow down exactly what you are watching for.

For SQL Server 2008:

START - All Programs - Microsoft SQL Server 2008 - Performance Tools - SQL Server Profiler

Keep in mind that the profiler is truly a logging and watching app. It will continue to log and watch as long as it is running. It could fill up text files or databases or hard drives, so be careful what you have it watch and for how long.

How to ignore the first line of data when processing CSV data?

I would convert csvreader to list, then pop the first element

import csv        

with open(fileName, 'r') as csvfile:
        csvreader = csv.reader(csvfile)
        data = list(csvreader)               # Convert to list
        data.pop(0)                          # Removes the first row

        for row in data:
            print(row)

How to set Android camera orientation properly?

From other member and my problem:

Camera Rotation issue depend on different Devices and certain Version.

Version 1.6: to fix the Rotation Issue, and it is good for most of devices

if (getResources().getConfiguration().orientation == Configuration.ORIENTATION_PORTRAIT)
        {   
            p.set("orientation", "portrait");
            p.set("rotation",90);
        }
        if (getResources().getConfiguration().orientation == Configuration.ORIENTATION_LANDSCAPE)
        {                               
            p.set("orientation", "landscape");          
            p.set("rotation", 90);
        }

Version 2.1: depend on kind of devices, for example, Cannt fix the issue with XPeria X10, but it is good for X8, and Mini

Camera.Parameters parameters = camera.getParameters();
parameters.set("orientation", "portrait");
camera.setParameters(parameters);

Version 2.2: not for all devices

camera.setDisplayOrientation(90);

http://code.google.com/p/android/issues/detail?id=1193#c42

What is INSTALL_PARSE_FAILED_NO_CERTIFICATES error?

Another way to get this error is to build using ant on macOS and have a Finder icon file (Icon\r) in the source tree of the app. It appears jarsigner can't cope with the carriage return in the filename and, although it will claim the signing is valid if you -verify the APK, it always results in an APK that wont install on a device. Ironically, the Google Drive Finder plugin is a great source of Finder icon files.

The solution is to exclude the offending files (which are useless in the APK anyway) with a specifier like this in the fileset:

    <exclude name="**/Icon&#13;" />

How to convert an array of strings to an array of floats in numpy?

You can use this as well

import numpy as np
x=np.array(['1.1', '2.2', '3.3'])
x=np.asfarray(x,float)

How to add external fonts to android application

Create a folder named fonts in the assets folder and add the snippet from the below link.

Typeface tf = Typeface.createFromAsset(getApplicationContext().getAssets(),"fonts/fontname.ttf");
textview.setTypeface(tf);

Set Font Color, Font Face and Font Size in PHPExcel

I recommend you start reading the documentation (4.6.18. Formatting cells). When applying a lot of formatting it's better to use applyFromArray() According to the documentation this method is also suppose to be faster when you're setting many style properties. There's an annex where you can find all the possible keys for this function.

This will work for you:

$phpExcel = new PHPExcel();

$styleArray = array(
    'font'  => array(
        'bold'  => true,
        'color' => array('rgb' => 'FF0000'),
        'size'  => 15,
        'name'  => 'Verdana'
    ));

$phpExcel->getActiveSheet()->getCell('A1')->setValue('Some text');
$phpExcel->getActiveSheet()->getStyle('A1')->applyFromArray($styleArray);

To apply font style to complete excel document:

 $styleArray = array(
   'font'  => array(
        'bold'  => true,
        'color' => array('rgb' => 'FF0000'),
        'size'  => 15,
        'name'  => 'Verdana'
    ));      
 $phpExcel->getDefaultStyle()
    ->applyFromArray($styleArray);

Get an object attribute

You can do the following:

class User(object):
    fullName = "John Doe"

    def __init__(self, name):
        self.SName = name

    def print_names(self):
        print "Names: full name: '%s', name: '%s'" % (self.fullName, self.SName)

user = User('Test Name')

user.fullName # "John Doe"
user.SName # 'Test Name'
user.print_names() # will print you Names: full name: 'John Doe', name: 'Test Name'

E.g any object attributes could be retrieved using istance.

How do I create a transparent Activity on Android?

In the onCreate function, below the setContentView, add this line:

getWindow().setBackgroundDrawable(new ColorDrawable(Color.TRANSPARENT));

Cannot truncate table because it is being referenced by a FOREIGN KEY constraint?

The only way is to drop foreign keys before doing the truncate. And after truncating the data, you must re-create the indexes.

The following script generates the required SQL for dropping all foreign key constraints.

DECLARE @drop NVARCHAR(MAX) = N'';

SELECT @drop += N'
ALTER TABLE ' + QUOTENAME(cs.name) + '.' + QUOTENAME(ct.name) 
    + ' DROP CONSTRAINT ' + QUOTENAME(fk.name) + ';'
FROM sys.foreign_keys AS fk
INNER JOIN sys.tables AS ct
  ON fk.parent_object_id = ct.[object_id]
INNER JOIN sys.schemas AS cs 
  ON ct.[schema_id] = cs.[schema_id];

SELECT @drop

Next, the following script generates the required SQL for re-creating foreign keys.

DECLARE @create NVARCHAR(MAX) = N'';

SELECT @create += N'
ALTER TABLE ' 
   + QUOTENAME(cs.name) + '.' + QUOTENAME(ct.name) 
   + ' ADD CONSTRAINT ' + QUOTENAME(fk.name) 
   + ' FOREIGN KEY (' + STUFF((SELECT ',' + QUOTENAME(c.name)
   -- get all the columns in the constraint table
    FROM sys.columns AS c 
    INNER JOIN sys.foreign_key_columns AS fkc 
    ON fkc.parent_column_id = c.column_id
    AND fkc.parent_object_id = c.[object_id]
    WHERE fkc.constraint_object_id = fk.[object_id]
    ORDER BY fkc.constraint_column_id 
    FOR XML PATH(N''), TYPE).value(N'.[1]', N'nvarchar(max)'), 1, 1, N'')
  + ') REFERENCES ' + QUOTENAME(rs.name) + '.' + QUOTENAME(rt.name)
  + '(' + STUFF((SELECT ',' + QUOTENAME(c.name)
   -- get all the referenced columns
    FROM sys.columns AS c 
    INNER JOIN sys.foreign_key_columns AS fkc 
    ON fkc.referenced_column_id = c.column_id
    AND fkc.referenced_object_id = c.[object_id]
    WHERE fkc.constraint_object_id = fk.[object_id]
    ORDER BY fkc.constraint_column_id 
    FOR XML PATH(N''), TYPE).value(N'.[1]', N'nvarchar(max)'), 1, 1, N'') + ');'
FROM sys.foreign_keys AS fk
INNER JOIN sys.tables AS rt -- referenced table
  ON fk.referenced_object_id = rt.[object_id]
INNER JOIN sys.schemas AS rs 
  ON rt.[schema_id] = rs.[schema_id]
INNER JOIN sys.tables AS ct -- constraint table
  ON fk.parent_object_id = ct.[object_id]
INNER JOIN sys.schemas AS cs 
  ON ct.[schema_id] = cs.[schema_id]
WHERE rt.is_ms_shipped = 0 AND ct.is_ms_shipped = 0;

SELECT @create

Run the generated script to drop all foreign keys, truncate tables, and then run the generated script to re-create all foreign keys.

The queries are taken from here.

C programming: Dereferencing pointer to incomplete type error

the case above is for a new project. I hit upon this error while editing a fork of a well established library.

the typedef was included in the file I was editing but the struct wasn't.

The end result being that I was attempting to edit the struct in the wrong place.

If you run into this in a similar way look for other places where the struct is edited and try it there.

Find oldest/youngest datetime object in a list

Datetimes are comparable; so you can use max(datetimes_list) and min(datetimes_list)

Expand and collapse with angular js

In html

button ng-click="myMethod()">Videos</button>

In angular

 $scope.myMethod = function () {
         $(".collapse").collapse('hide');    //if you want to hide
         $(".collapse").collapse('toggle');  //if you want toggle
         $(".collapse").collapse('show');    //if you want to show
}

Remove last character from C++ string

If the length is non zero, you can also

str[str.length() - 1] = '\0';

UnicodeEncodeError: 'charmap' codec can't encode characters

if you are using windows try to pass encoding='latin1', encoding='iso-8859-1' or encoding='cp1252' example:

csv_data = pd.read_csv(csvpath,encoding='iso-8859-1')
print(print(soup.encode('iso-8859-1')))

How to check if a character is upper-case in Python?

Use list(str) to break into chars then import string and use string.ascii_uppercase to compare against.

Check the string module: http://docs.python.org/library/string.html

How to alter a column's data type in a PostgreSQL table?

Cool @derek-kromm, Your answer is accepted and correct, But I am wondering if we need to alter more than the column. Here is how we can do.

ALTER TABLE tbl_name 
ALTER COLUMN col_name TYPE varchar (11), 
ALTER COLUMN col_name2 TYPE varchar (11),
ALTER COLUMN col_name3 TYPE varchar (11);

Documentation

Cheers!! Read Simple Write Simple

Correct use of transactions in SQL Server

Easy approach:

CREATE TABLE T
(
    C [nvarchar](100) NOT NULL UNIQUE,
);

SET XACT_ABORT ON -- Turns on rollback if T-SQL statement raises a run-time error.
SELECT * FROM T; -- Check before.
BEGIN TRAN
    INSERT INTO T VALUES ('A');
    INSERT INTO T VALUES ('B');
    INSERT INTO T VALUES ('B');
    INSERT INTO T VALUES ('C');
COMMIT TRAN
SELECT * FROM T; -- Check after.
DELETE T;

Unknown lifecycle phase "mvn". You must specify a valid lifecycle phase or a goal in the format <plugin-prefix>:<goal> or <plugin-group-id>

If you are using debug configuration for maven, use the command

clean install

And skip all the tests.

Android - setOnClickListener vs OnClickListener vs View.OnClickListener

The logic is simple. setOnClickListener belongs to step 2.

  1. You create the button
  2. You create an instance of OnClickListener* like it's done in that example and override the onClick-method.
  3. You assign that OnClickListener to that button using btn.setOnClickListener(myOnClickListener); in your fragments/activities onCreate-method.
  4. When the user clicks the button, the onClick function of the assigned OnClickListener is called.

*If you import android.view.View; you use View.OnClickListener. If you import android.view.View.*; or import android.view.View.OnClickListener; you use OnClickListener as far as I get it.

Another way is to let you activity/fragment inherit from OnClickListener. This way you assign your fragment/activity as the listener for your button and implement onClick as a member-function.

What is the difference between public, private, and protected?

Visibility Scopes with Abstract Examples :: Makes easy Understanding

This visibility of a property or method is defined by pre-fixing declaration of one of three keyword (Public, protected and private)

Public : If a property or method is defined as public, it means it can be both access and manipulated by anything that can refer to object.

  • Abstract eg. Think public visibility scope as "public picnic" that anybody can come to.

Protected : when a property or method visibility is set to protected members can only be access within the class itself and by inherited & inheriting classes. (Inherited:- a class can have all the properties and methods of another class).

  • Think as a protected visibility scope as "Company picnic" where company members and their family members are allowed not the public. It's the most common scope restriction.

Private : When a property or method visibility is set to private, only the class that has the private members can access those methods and properties(Internally within the class), despite of whatever class relation there maybe.

  • with picnic analogy think as a "company picnic where only the company members are allowed" in the picnic. not family neither general public are allowed.

How do I get the SQLSRV extension to work with PHP, since MSSQL is deprecated?

Download Microsoft Drivers for PHP for SQL Server. Extract the files and use one of:

File                             Thread Safe         VC Bulid
php_sqlsrv_53_nts_vc6.dll           No                  VC6
php_sqlsrv_53_nts_vc9.dll           No                  VC9
php_sqlsrv_53_ts_vc6.dll            Yes                 VC6
php_sqlsrv_53_ts_vc9.dll            Yes                 VC9

You can see the Thread Safety status in phpinfo().

Add the correct file to your ext directory and the following line to your php.ini:

extension=php_sqlsrv_53_*_vc*.dll

Use the filename of the file you used.

As Gordon already posted this is the new Extension from Microsoft and uses the sqlsrv_* API instead of mssql_*

Update:
On Linux you do not have the requisite drivers and neither the SQLSERV Extension.
Look at Connect to MS SQL Server from PHP on Linux? for a discussion on this.

In short you need to install FreeTDS and YES you need to use mssql_* functions on linux. see update 2

To simplify things in the long run I would recommend creating a wrapper class with requisite functions which use the appropriate API (sqlsrv_* or mssql_*) based on which extension is loaded.

Update 2: You do not need to use mssql_* functions on linux. You can connect to an ms sql server using PDO + ODBC + FreeTDS. On windows, the best performing method to connect is via PDO + ODBC + SQL Native Client since the PDO + SQLSRV driver can be incredibly slow.

Android SDK manager won't open

http://quantumsupport.blogspot.com/2011/03/android-sdk-managerexe-wont-start.html

Create a new user account, either re-install or just start android.bat and it should work did for me

SQL DELETE with INNER JOIN

if the database is InnoDB you dont need to do joins in deletion. only

DELETE FROM spawnlist WHERE spawnlist.type = "monster";

can be used to delete the all the records that linked with foreign keys in other tables, to do that you have to first linked your tables in design time.

CREATE TABLE IF NOT EXIST spawnlist (
  npc_templateid VARCHAR(20) NOT NULL PRIMARY KEY

)ENGINE=InnoDB;

CREATE TABLE IF NOT EXIST npc (
  idTemplate VARCHAR(20) NOT NULL,

  FOREIGN KEY (idTemplate) REFERENCES spawnlist(npc_templateid) ON DELETE CASCADE

)ENGINE=InnoDB;

if you uses MyISAM you can delete records joining like this

DELETE a,b
FROM `spawnlist` a
JOIN `npc` b
ON a.`npc_templateid` = b.`idTemplate`
WHERE a.`type` = 'monster';

in first line i have initialized the two temp tables for delet the record, in second line i have assigned the existance table to both a and b but here i have linked both tables together with join keyword, and i have matched the primary and foreign key for both tables that make link, in last line i have filtered the record by field to delete.

How to add headers to OkHttp request interceptor?

There is yet an another way to add interceptors in your OkHttp3 (latest version as of now) , that is you add the interceptors to your Okhttp builder

okhttpBuilder.networkInterceptors().add(chain -> {
 //todo add headers etc to your AuthorisedRequest

  return chain.proceed(yourAuthorisedRequest);
});

and finally build your okHttpClient from this builder

OkHttpClient client = builder.build();

PHP DOMDocument loadHTML not encoding UTF-8 correctly

Works finde for me:

$dom = new \DOMDocument;
$dom->loadHTML(utf8_decode($html));
...
return  utf8_encode( $dom->saveHTML());

Get timezone from users browser using moment(timezone).js

var timedifference = new Date().getTimezoneOffset();

This returns the difference from the clients timezone from UTC time. You can then play around with it as you like.

Convert list into a pandas data frame

You need convert list to numpy array and then reshape:

df = pd.DataFrame(np.array(my_list).reshape(3,3), columns = list("abc"))
print (df)
   a  b  c
0  1  2  3
1  4  5  6
2  7  8  9

How can I force a long string without any blank to be wrapped?

for block elements:

_x000D_
_x000D_
<textarea style="width:100px; word-wrap:break-word;">_x000D_
  ACTGATCGAGCTGAAGCGCAGTGCGATGCTTCGATGATGCTGACGATGCTACGATGCGAGCATCTACGATCAGTC_x000D_
</textarea>
_x000D_
_x000D_
_x000D_

for inline elements:

_x000D_
_x000D_
<span style="width:100px; word-wrap:break-word; display:inline-block;"> _x000D_
   ACTGATCGAGCTGAAGCGCAGTGCGATGCTTCGATGATGCTGACGATGCTACGATGCGAGCATCTACGATCAGTC_x000D_
</span>
_x000D_
_x000D_
_x000D_

Global and local variables in R

Variables declared inside a function are local to that function. For instance:

foo <- function() {
    bar <- 1
}
foo()
bar

gives the following error: Error: object 'bar' not found.

If you want to make bar a global variable, you should do:

foo <- function() {
    bar <<- 1
}
foo()
bar

In this case bar is accessible from outside the function.

However, unlike C, C++ or many other languages, brackets do not determine the scope of variables. For instance, in the following code snippet:

if (x > 10) {
    y <- 0
}
else {
    y <- 1
}

y remains accessible after the if-else statement.

As you well say, you can also create nested environments. You can have a look at these two links for understanding how to use them:

  1. http://stat.ethz.ch/R-manual/R-devel/library/base/html/environment.html
  2. http://stat.ethz.ch/R-manual/R-devel/library/base/html/get.html

Here you have a small example:

test.env <- new.env()

assign('var', 100, envir=test.env)
# or simply
test.env$var <- 100

get('var') # var cannot be found since it is not defined in this environment
get('var', envir=test.env) # now it can be found

Compile c++14-code with g++

Follow the instructions at https://gist.github.com/application2000/73fd6f4bf1be6600a2cf9f56315a2d91 to set up the gcc version you need - gcc 5 or gcc 6 - on Ubuntu 14.04. The instructions include configuring update-alternatives to allow you to switch between versions as you need to.

Use grep to report back only line numbers

To count the number of lines matched the pattern:

grep -n "Pattern" in_file.ext | wc -l 

To extract matched pattern

sed -n '/pattern/p' file.est

To display line numbers on which pattern was matched

grep -n "pattern" file.ext | cut -f1 -d:

How to order a data frame by one descending and one ascending column?

Let df be the data frame with 2 fields A and B

Case 1: if your field A and B are numeric

df[order(df[,1],df[,2]),] - sorts fields A and B in ascending order
df[order(df[,1],-df[,2]),] - sorts fields A in ascending and B in descending order
priority is given to A.

Case 2: if field A or B is non numeric say factor or character

In our case if B is character and we want to sort in reverse order
df[order(df[,1],-as.numeric(as.factor(df[,2]))),] -> this sorts field A(numerical) in ascending and field B(character) in descending.
priority is given to A.

The idea is that you can apply -sign in order function ony on numericals. So for sorting character strings in descending order you have to coerce them to numericals.

Using gradle to find dependency tree

You can render the dependency tree with the command gradle dependencies. For more information check the section 11.6.4 Listing project dependencies in the online user guide.

Using LINQ to find item in a List but get "Value cannot be null. Parameter name: source"

The error you receive is from another method than the one you show here. It's a method that takes a parameter with the name "source". In your Visual Studio Options dialog, disable "Just my code", disable "Step over properties and operators" and enable "Enable .NET Framework source stepping". Make sure the .NET symbols can be found. Then the debugger will break inside the .NET method if it isn't your own. then check the stacktrace to find which value is passed that's null, but shouldn't.

What you should look for is a value that becomes null and prevent that. From looking at your code, it may be the itemsal.Add line that breaks.

Edit

Since you seem to have trouble with debugging in general and LINQ especially, let's try to help you out step by step (also note the expanded first section above if you still want to try it the classic way, I wasn't complete the first time around):

  • Narrow down the possible error scenarios by splitting your code;
  • Replace locations that can end up null with something deliberately not null;
  • If all fails, rewrite your LINQ statement as loop and go through it step by step.

Step 1

First make the code a bit more readable by splitting it in manageable pieces:

// in your using-section, add this:
using Roundsman.BAL;

// keep this in your normal location
var nCounts = from sale in sal
              select new
              {
                  SaleID = sale.OrderID,
                  LineItem = GetLineItem(sale.LineItems)
              };

foreach (var item in nCounts)
{
    foreach (var itmss in item.LineItem)
    {
        itemsal.Add(CreateWeeklyStockList(itmss));
    }
}


// add this as method somewhere
WeeklyStockList CreateWeeklyStockList(LineItem lineItem)
{
    string name = itmss.Item.Name.ToString();  // isn't Name already a string?
    string code = itmss.Item.Code.ToString();  // isn't Code already a string?
    string description = itmss.Item.Description.ToString();  // isn't Description already a string?
    int quantity = Convert.ToInt32(itmss.Item.Quantity); // wouldn't (int) or "as int" be enough?

    return new WeeklyStockList(
                 name, 
                 code, 
                 description,
                 quantity, 
                 2, 2, 2, 2, 2, 2, 2, 2, 2
              );
}

// also add this as a method
LineItem GetLineItem(IEnumerable<LineItem> lineItems)
{
    // add a null-check
    if(lineItems == null)
        throw new ArgumentNullException("lineItems", "Argument cannot be null!");

    // your original code
    from sli in lineItems
    group sli by sli.Item into ItemGroup
    select new
    {
        Item = ItemGroup.Key,
        Weeks = ItemGroup.Select(s => s.Week)
    }
}

The code above is from the top of my head, of course, because I cannot know what type of classes you have and thus cannot test the code before posting. Nevertheless, if you edit it until it is correct (if it isn't so out of the box), then you already stand a large chance the actual error becomes a lot clearer. If not, you should at the very least see a different stacktrace this time (which we still eagerly await!).

Step 2

The next step is to meticulously replace each part that can result in a null reference exception. By that I mean that you replace this:

select new
{
    SaleID = sale.OrderID,
    LineItem = GetLineItem(sale.LineItems)
};

with something like this:

select new
{
    SaleID = 123,
    LineItem = GetLineItem(new LineItem(/*ctor params for empty lineitem here*/))
};

This will create rubbish output, but will narrow the problem down even further to your potential offending line. Do the same as above for other places in the LINQ statements that can end up null (just about everything).

Step 3

This step you'll have to do yourself. But if LINQ fails and gives you such headaches and such unreadable or hard-to-debug code, consider what would happen with the next problem you encounter? And what if it fails on a live environment and you have to solve it under time pressure=

The moral: it's always good to learn new techniques, but sometimes it's even better to grab back to something that's clear and understandable. Nothing against LINQ, I love it, but in this particular case, let it rest, fix it with a simple loop and revisit it in half a year or so.

Conclusion

Actually, nothing to conclude. I went a bit further then I'd normally go with the long-extended answer. I just hope it helps you tackling the problem better and gives you some tools understand how you can narrow down hard-to-debug situations, even without advanced debugging techniques (which we haven't discussed).

Get the time difference between two datetimes

It is very simple with moment below code will return diffrence in hour from current time:

moment().diff('2021-02-17T14:03:55.811000Z', "h")

VirtualBox Cannot register the hard disk already exists

I found a solution

File -> Virtual Media Manager -> Removed existing images (note, I removed them only from the registry).

I followed these steps.

http://www.webdesignblog.asia/software/virtualbox-moving-vdi-file-re-linking-guest/#sthash.1QOHeiw5.dpbs

After that I could update the path in the VM settings.

Status bar and navigation bar appear over my view's bounds in iOS 7

I created my view programmatically and this ended up working for me:

- (void) viewDidLayoutSubviews {
    // only works for iOS 7+
    if ([[[UIDevice currentDevice] systemVersion] floatValue] >= 7.0) {
        CGRect viewBounds = self.view.bounds;
        CGFloat topBarOffset = self.topLayoutGuide.length;

        // snaps the view under the status bar (iOS 6 style)
        viewBounds.origin.y = topBarOffset * -1;

        // shrink the bounds of your view to compensate for the offset
        viewBounds.size.height = viewBounds.size.height + (topBarOffset * -1);
        self.view.bounds = viewBounds;
    }
}

Source (in topLayoutGuide section at bottom of pg.39).

How to save all files from source code of a web site?

In Chrome, go to options (Customize and Control, the 3 dots/bars at top right) ---> More Tools ---> save page as

save page as  
filename     : any_name.html 
save as type : webpage complete.

Then you will get any_name.html and any_name folder.

How to change package name in android studio?

First click once on your package and then click setting icon on Android Studio.

Close/Unselect Compact Empty Middle Packages

Then, right click your package and rename it.

Thats all.

enter image description here

How to insert a new line in strings in Android

I use <br> in a CDATA tag. As an example, my strings.xml file contains an item like this:

<item><![CDATA[<b>My name is John</b><br>Nice to meet you]]></item>

and prints

My name is John
Nice to meet you

Why do I get an UnsupportedOperationException when trying to remove an element from a List?

This one has burned me many times. Arrays.asList creates an unmodifiable list. From the Javadoc: Returns a fixed-size list backed by the specified array.

Create a new list with the same content:

newList.addAll(Arrays.asList(newArray));

This will create a little extra garbage, but you will be able to mutate it.

Bad operand type for unary +: 'str'

You say that if int(splitLine[0]) > int(lastUnix): is causing the trouble, but you don't actually show anything which suggests that. I think this line is the problem instead:

print 'Pulled', + stock

Do you see why this line could cause that error message? You want either

>>> stock = "AAAA"
>>> print 'Pulled', stock
Pulled AAAA

or

>>> print 'Pulled ' + stock
Pulled AAAA

not

>>> print 'Pulled', + stock
PulledTraceback (most recent call last):
  File "<ipython-input-5-7c26bb268609>", line 1, in <module>
    print 'Pulled', + stock
TypeError: bad operand type for unary +: 'str'

You're asking Python to apply the + symbol to a string like +23 makes a positive 23, and she's objecting.

How to set character limit on the_content() and the_excerpt() in wordpress

I know this post is a bit old, but thought I would add the functions I use that take into account any filters and any <![CDATA[some stuff]]> content you want to safely exclude.

Simply add to your functions.php file and use anywhere you would like, such as:

content(53);

or

excerpt(27);

Enjoy!

//limit excerpt
function excerpt($limit) {
  $excerpt = explode(' ', get_the_excerpt(), $limit);
  if (count($excerpt)>=$limit) {
    array_pop($excerpt);
    $excerpt = implode(" ",$excerpt).'...';
  } else {
    $excerpt = implode(" ",$excerpt);
  } 
  $excerpt = preg_replace('`\[[^\]]*\]`','',$excerpt);
  return $excerpt;
}

//limit content 
function content($limit) {
  $content = explode(' ', get_the_content(), $limit);
  if (count($content)>=$limit) {
    array_pop($content);
    $content = implode(" ",$content).'...';
  } else {
    $content = implode(" ",$content);
  } 
  $content = preg_replace('/\[.+\]/','', $content);
  $content = apply_filters('the_content', $content); 
  $content = str_replace(']]>', ']]&gt;', $content);
  return $content;
}