Concurrent signal assignment:

library ieee;
use ieee.std_logic_1164.all;

entity foo is
end;
architecture behave of foo is
    signal clk: std_logic := '0';
begin
CLOCK:
clk <=  '1' after 0.5 ns when clk = '0' else
        '0' after 0.5 ns when clk = '1';
end;

ghdl -a foo.vhdl
ghdl -r foo --stop-time=10ns --wave=foo.ghw
ghdl:info: simulation stopped by --stop-time
gtkwave foo.ghw

Simulators simulate processes and it would be transformed into the equivalent process to your process statement. Simulation time implies the use of wait for or after when driving events for sensitivity clauses or sensitivity lists.

Another alternative to your original solution would be to use the escape character \ before the space:

VBoxManage internalcommands sethduuid /home/user/VirtualBox\ VMs/drupal/drupal.vhd

Practical example:

Imagine that you are modelling something like an I2C bus (signals called SCL for clock and SDA for data), where the bus is tri-state and both nets have a weak pull-up. Your testbench should model the pull-up resistor on the PCB with a value of 'H'.

scl <= 'H'; -- Testbench resistor pullup

Your I2C master or slave devices can drive the bus to '1' or '0' or leave it alone by assigning a 'Z'

Assigning a '1' to the SCL net will cause an event to happen, because the value of SCL changed.

• If you have a line of code that relies on (scl'event and scl = '1'), then you'll get a false trigger.

• If you have a line of code that relies on rising_edge(scl), then you won't get a false trigger.

Continuing the example: you assign a '0' to SCL, then assign a 'Z'. The SCL net goes to '0', then back to 'H'.

Here, going from '1' to '0' isn't triggering either case, but going from '0' to 'H' will trigger a rising_edge(scl) condition (correct), but the (scl'event and scl = '1') case will miss it (incorrect).

General Recommenation:

Use rising_edge(clk) and falling_edge(clk) instead of clk'event for all code.

Note Slipstream's response, that base64.b64encode and base64.b64decode need bytes-like object, not string.

>>> import base64
>>> a = '{"name": "John", "age": 42}'
>>> base64.b64encode(a)
Traceback (most recent call last):
  File "<input>", line 1, in <module>
  File "/usr/lib/python3.6/base64.py", line 58, in b64encode
    encoded = binascii.b2a_base64(s, newline=False)
TypeError: a bytes-like object is required, not 'str'

Here is an example of concatenation operator:

architecture EXAMPLE of CONCATENATION is
   signal Z_BUS : bit_vector (3 downto 0);
   signal A_BIT, B_BIT, C_BIT, D_BIT : bit;
begin
   Z_BUS <= A_BIT & B_BIT & C_BIT & D_BIT;
end EXAMPLE;

You can nest your queries:

select * from (
    select bla
    from bla
    where bla
    order by finaldate desc
)
where rownum < 2

filepath.Abs("./")

Abs returns an absolute representation of path. If the path is not absolute it will be joined with the current working directory to turn it into an absolute path.

As stated in the comment, this returns the directory which is currently active.

And to send a largFile

byte[] pdfData = getPDFData();

String fileType = "";

res.setContentType("application/pdf");

httpRes.setContentType("application/.pdf");
httpRes.addHeader("Content-Disposition", "attachment; filename=IDCards.pdf");
httpRes.setStatus(HttpServletResponse.SC_OK);
OutputStream out = res.getOutputStream();
System.out.println(pdfData.length);
         
out.write(pdfData);
System.out.println("sendDone");
out.flush();

The grammar of the language specifies that positional arguments appear before keyword or starred arguments in calls:

argument_list        ::=  positional_arguments ["," starred_and_keywords]
                            ["," keywords_arguments]
                          | starred_and_keywords ["," keywords_arguments]
                          | keywords_arguments

Specifically, a keyword argument looks like this: tag='insider trading!' while a positional argument looks like this: ..., exchange, .... The problem lies in that you appear to have copy/pasted the parameter list, and left some of the default values in place, which makes them look like keyword arguments rather than positional ones. This is fine, except that you then go back to using positional arguments, which is a syntax error.

Also, when an argument has a default value, such as price=None, that means you don't have to provide it. If you don't provide it, it will use the default value instead.

To resolve this error, convert your later positional arguments into keyword arguments, or, if they have default values and you don't need to use them, simply don't specify them at all:

order_id = kite.order_place(self, exchange, tradingsymbol,
    transaction_type, quantity)

# Fully positional:
order_id = kite.order_place(self, exchange, tradingsymbol, transaction_type, quantity, price, product, order_type, validity, disclosed_quantity, trigger_price, squareoff_value, stoploss_value, trailing_stoploss, variety, tag)

# Some positional, some keyword (all keywords at end):

order_id = kite.order_place(self, exchange, tradingsymbol,
    transaction_type, quantity, tag='insider trading!')

On Ubuntu, you would need to install a package called python-dev. Since this package doesn't seem to be installed (locate Python.h didn't find anything) and you can't install it system-wide yourself, we need a different solution.

You can install Python in your home directory -- you don't need any special permissions to do this. If you are allowed to use a web browser and run a gcc, this should work for you. To this end

1. Download the source tarball.

2. Unzip with

   tar xjf Python-2.7.2.tar.bz2
   

3. Build and install with

   cd Python-2.7.2
   ./configure --prefix=/home/username/python --enable-unicode=ucs4
   make
   make install
   

Now, you have a complete Python installation in your home directory. Pass -I /home/username/python/include to gcc when compiling to make it aware of Python.h. Pass -L /home/username/python/lib and -lpython2.7 when linking.

A CRLF is two characters, of course, the CR and the LF. However, `n consists of both. For example:

PS C:\> $x = "Hello
>> World"

PS C:\> $x
Hello
World
PS C:\> $x.contains("`n")
True
PS C:\> $x.contains("`r")
False
PS C:\> $x.replace("o`nW","o There`nThe W")
Hello There
The World
PS C:\>

I think you're running into problems with the `r. I was able to remove the `r from your example, use only `n, and it worked. Of course, I don't know exactly how you generated the original string so I don't know what's in there.

Creating DLL File

1. Open Visual Studio then select File -> New -> Project

2. Select Visual C# -> Class library

3. Compile Project Or Build the solution, to create Dll File

4. Go to the class library folder (Debug Folder)

I use zsh and Android Studio. I use a variable for my Android SDK path and configure in the file ~/.zshrc:

export ANDROID_HOME=/Applications/Android\ Studio.app/sdk
export PATH="$ANDROID_HOME/platform-tools:$ANDROID_HOME/tools:$PATH"

Note: Make sure not to include single or double quotes around the specified path. If you do, it won't work.

If you are generating Notification from a Service that is started in the foreground using

startForeground(NOTIFICATION_ID, notificationBuilder.build());

Then issuing

notificationManager.cancel(NOTIFICATION_ID);

does't work canceling the Notification & notification still appears in the status bar. In this particular case, you will solve these by 2 ways:

1> Using stopForeground( false ) inside service:

stopForeground( false );
notificationManager.cancel(NOTIFICATION_ID);

2> Destroy that service class with calling activity:

Intent i = new Intent(context, Service.class);
i.addFlags(Intent.FLAG_ACTIVITY_NEW_TASK);
i.addFlags(Intent.FLAG_ACTIVITY_CLEAR_TASK);
if(ServiceCallingActivity.activity != null) {
    ServiceCallingActivity.activity.finish();
}
context.stopService(i);

Second way prefer in music player notification more because thay way not only notification remove but remove player also...!!

answers above are good enough to show how to build the library, but how to collect the headers are still tricky. here I share the little script I use to copy the necessary headers.

SOURCE is the first param, which is the tensorflow source(build) direcoty;
DST is the second param, which is the include directory holds the collected headers. (eg. in cmake, include_directories(./collected_headers_here)).

#!/bin/bash

SOURCE=$1
DST=$2
echo "-- target dir is $DST"
echo "-- source dir is $SOURCE"

if [[ -e $DST ]];then
    echo "clean $DST"
    rm -rf $DST
    mkdir $DST
fi


# 1. copy the source code c++ api needs
mkdir -p $DST/tensorflow
cp -r $SOURCE/tensorflow/core $DST/tensorflow
cp -r $SOURCE/tensorflow/cc $DST/tensorflow
cp -r $SOURCE/tensorflow/c $DST/tensorflow

# 2. copy the generated code, put them back to
# the right directories along side the source code
if [[ -e $SOURCE/bazel-genfiles/tensorflow ]];then
    prefix="$SOURCE/bazel-genfiles/tensorflow"
    from=$(expr $(echo -n $prefix | wc -m) + 1)

    # eg. compiled protobuf files
    find $SOURCE/bazel-genfiles/tensorflow -type f | while read line;do
        #echo "procese file --> $line"
        line_len=$(echo -n $line | wc -m)
        filename=$(echo $line | rev | cut -d'/' -f1 | rev )
        filename_len=$(echo -n $filename | wc -m)
        to=$(expr $line_len - $filename_len)

        target_dir=$(echo $line | cut -c$from-$to)
        #echo "[$filename] copy $line $DST/tensorflow/$target_dir"
        cp $line $DST/tensorflow/$target_dir
    done
fi


# 3. copy third party files. Why?
# In the tf source code, you can see #include "third_party/...", so you need it
cp -r $SOURCE/third_party $DST

# 4. these headers are enough for me now.
# if your compiler complains missing headers, maybe you can find it in bazel-tensorflow/external
cp -RLf $SOURCE/bazel-tensorflow/external/eigen_archive/Eigen $DST
cp -RLf $SOURCE/bazel-tensorflow/external/eigen_archive/unsupported $DST
cp -RLf $SOURCE/bazel-tensorflow/external/protobuf_archive/src/google $DST
cp -RLf $SOURCE/bazel-tensorflow/external/com_google_absl/absl $DST

ElementFormDefault has nothing to do with namespace of the types in the schema, it's about the namespaces of the elements in XML documents which comply with the schema.

Here's the relevent section of the spec:

Element Declaration Schema

Component Property  {target namespace}
Representation      If form is present and its ·actual value· is qualified, 
                    or if form is absent and the ·actual value· of 
                    elementFormDefault on the <schema> ancestor is qualified, 
                    then the ·actual value· of the targetNamespace [attribute]
                    of the parent <schema> element information item, or 
                    ·absent· if there is none, otherwise ·absent·.

What that means is that the targetNamespace you've declared at the top of the schema only applies to elements in the schema compliant XML document if either elementFormDefault is "qualified" or the element is declared explicitly in the schema as having form="qualified".

For example: If elementFormDefault is unqualified -

<element name="name" type="string" form="qualified"></element>
<element name="page" type="target:TypePage"></element>

will expect "name" elements to be in the targetNamespace and "page" elements to be in the null namespace.

To save you having to put form="qualified" on every element declaration, stating elementFormDefault="qualified" means that the targetNamespace applies to each element unless overridden by putting form="unqualified" on the element declaration.

I received the same error with RENAME USER and GRANTS aren't covered by the currently accepted solution:

The most reliable way seems to be to run SHOW GRANTS for the old user, find/replace what you want to change regarding the user's name and/or host and run them and then finally DROP USER the old user. Not forgetting to run FLUSH PRIVILEGES (best to run this after adding the new users' grants, test the new user, then drop the old user and flush again for good measure).

    > SHOW GRANTS FOR 'olduser'@'oldhost';
    +-----------------------------------------------------------------------------------+
    | Grants for olduser@oldhost                                                        |
    +-----------------------------------------------------------------------------------+
    | GRANT USAGE ON *.* TO 'olduser'@'oldhost' IDENTIFIED BY PASSWORD '*PASSHASH'      |
    | GRANT SELECT ON `db`.* TO 'olduser'@'oldhost'                                     |
    +-----------------------------------------------------------------------------------+
    2 rows in set (0.000 sec)

    > GRANT USAGE ON *.* TO 'newuser'@'newhost' IDENTIFIED BY PASSWORD '*SAME_PASSHASH';
    Query OK, 0 rows affected (0.006 sec)

    > GRANT SELECT ON `db`.* TO 'newuser'@'newhost';
    Query OK, 0 rows affected (0.007 sec)

    > DROP USER 'olduser'@'oldhost';
    Query OK, 0 rows affected (0.016 sec)

Including the fb:app_id tag in your HTML HEAD will allow the Facebook scraper to associate the Open Graph entity for that URL with an application. This will allow any admins of that app to view Insights about that URL and any social plugins connected with it.

The fb:admins tag is similar, but allows you to just specify each user ID that you would like to give the permission to do the above.

You can include either of these tags or both, depending on how many people you want to admin the Insights, etc. A single as fb:admins is pretty much a minimum requirement. The rest of the Open Graph tags will still be picked up when people share and like your URL, however it may cause problems in the future, so please include one of the above.

fb:admins is specified like this:
<meta property="fb:admins" content="USER_ID"/>
OR
<meta property="fb:admins" content="USER_ID,USER_ID2,USER_ID3"/>

and fb:app_id like this:
<meta property="fb:app_id" content="APPID"/>

Using array_key_exists() on objects is Deprecated in php 7.4

Instead either isset() or property_exists() should be used

reference : php.net

In WC 3.0+ versions the image can get by below code.

$image_url = wp_get_attachment_image_src( get_post_thumbnail_id( $item->get_product_id() ), 'single-post-thumbnail' );
echo $image_url[0]

You may try;

$this->Output(/path/to/file);

So for you, it will be like;

$this->Output(/kuitit/);  //or try ("/kuitit/")

Sorry for bumping an old question. I found this via google.

Its also worth noting that its possible to use more than one selector, thus you can target any form element, and not just one specific type.

eg.

$('#myform input,#myform textarea').first().focus();

This will focus the first input or textarea it finds, and of course you can add other selectors into the mix as well. Handy if you can't be certain of a specific element type being first, or if you want something a bit general/reusable.

If you're using jQuery-UI, you must include the jQuery UI CSS package, otherwise the UI components don't know how to be styled.

If you don't like the jQuery UI styles, then you'll have to recreate all the styles it would have otherwise applied.

Here's an example and some possible fixes.

Minimal, Complete, and Verifiable example (i.e. broken)

Here's a demo in Stack Snippets without jquery-ui.css (doesn't work)

$(function() {_x000D_
  var availableTags = [_x000D_
    "ActionScript", "AppleScript", "Asp", "BASIC", "C", "C++",_x000D_
    "Clojure", "COBOL", "ColdFusion", "Erlang", "Fortran",_x000D_
    "Groovy", "Haskell", "Java", "JavaScript", "Lisp", "Perl",_x000D_
    "PHP", "Python", "Ruby", "Scala", "Scheme"_x000D_
  ];_x000D_
  _x000D_
  $(".autocomplete").autocomplete({_x000D_
    source: availableTags_x000D_
  });_x000D_
});

<link href="//cdnjs.cloudflare.com/ajax/libs/twitter-bootstrap/3.3.2/css/bootstrap.css" rel="stylesheet"/>_x000D_
_x000D_
<script src="//cdnjs.cloudflare.com/ajax/libs/jquery/2.1.3/jquery.js"></script>_x000D_
<script src="//cdnjs.cloudflare.com/ajax/libs/jqueryui/1.11.2/jquery-ui.js"></script>_x000D_
<script src="//cdnjs.cloudflare.com/ajax/libs/twitter-bootstrap/3.3.2/js/bootstrap.js"></script>_x000D_
_x000D_
<div class="container">_x000D_
_x000D_
  <div class="form-group">_x000D_
    <label>Languages</label>_x000D_
    <input class="form-control autocomplete" placeholder="Enter A" />_x000D_
  </div>_x000D_
  _x000D_
  <div class="form-group">_x000D_
    <label >Another Field</label>_x000D_
    <input class="form-control">_x000D_
  </div>_x000D_
_x000D_
</div>

Fix #1 - jQuery-UI Style

Just include jquery-ui.css and everything should work just fine with the latest supported versions of jquery.

$(function() {_x000D_
  var availableTags = [_x000D_
    "ActionScript", "AppleScript", "Asp", "BASIC", "C", "C++",_x000D_
    "Clojure", "COBOL", "ColdFusion", "Erlang", "Fortran",_x000D_
    "Groovy", "Haskell", "Java", "JavaScript", "Lisp", "Perl",_x000D_
    "PHP", "Python", "Ruby", "Scala", "Scheme"_x000D_
  ];_x000D_
  _x000D_
  $(".autocomplete").autocomplete({_x000D_
    source: availableTags_x000D_
  });_x000D_
});

<link href="//cdnjs.cloudflare.com/ajax/libs/jqueryui/1.11.2/jquery-ui.css" rel="stylesheet"/>_x000D_
<link href="//cdnjs.cloudflare.com/ajax/libs/twitter-bootstrap/3.3.2/css/bootstrap.css" rel="stylesheet"/>_x000D_
_x000D_
<script src="//cdnjs.cloudflare.com/ajax/libs/jquery/2.1.3/jquery.js"></script>_x000D_
<script src="//cdnjs.cloudflare.com/ajax/libs/jqueryui/1.11.2/jquery-ui.js"></script>_x000D_
<script src="//cdnjs.cloudflare.com/ajax/libs/twitter-bootstrap/3.3.2/js/bootstrap.js"></script>_x000D_
_x000D_
<div class="container">_x000D_
  <div class="form-group">_x000D_
    <label>Languages</label>_x000D_
    <input class="form-control autocomplete" placeholder="Enter A" />_x000D_
  </div>_x000D_
  _x000D_
  <div class="form-group">_x000D_
    <label >Another Field</label>_x000D_
    <input class="form-control">_x000D_
  </div>_x000D_
</div>

Fix #2 - Bootstrap Theme

There is a project that created a Bootstrap-esque theme for jQuery-UI components called jquery-ui-bootstrap. Just grab the stylesheet from there and you should be all set.

$(function() {_x000D_
  var availableTags = [_x000D_
    "ActionScript", "AppleScript", "Asp", "BASIC", "C", "C++",_x000D_
    "Clojure", "COBOL", "ColdFusion", "Erlang", "Fortran",_x000D_
    "Groovy", "Haskell", "Java", "JavaScript", "Lisp", "Perl",_x000D_
    "PHP", "Python", "Ruby", "Scala", "Scheme"_x000D_
  ];_x000D_
  _x000D_
  $(".autocomplete").autocomplete({_x000D_
    source: availableTags_x000D_
  });_x000D_
});

<link href="https://cdnjs.cloudflare.com/ajax/libs/jquery-ui-bootstrap/0.5pre/css/custom-theme/jquery-ui-1.10.0.custom.css" rel="stylesheet"/>_x000D_
<link href="//cdnjs.cloudflare.com/ajax/libs/twitter-bootstrap/3.3.2/css/bootstrap.css" rel="stylesheet"/>_x000D_
_x000D_
<script src="//cdnjs.cloudflare.com/ajax/libs/jquery/2.1.3/jquery.js"></script>_x000D_
<script src="//cdnjs.cloudflare.com/ajax/libs/jqueryui/1.11.2/jquery-ui.js"></script>_x000D_
<script src="//cdnjs.cloudflare.com/ajax/libs/twitter-bootstrap/3.3.2/js/bootstrap.js"></script>_x000D_
_x000D_
<div class="container">_x000D_
  <div class="form-group">_x000D_
    <label>Languages</label>_x000D_
    <input class="form-control autocomplete" placeholder="Enter A" />_x000D_
  </div>_x000D_
  _x000D_
  <div class="form-group">_x000D_
    <label >Another Field</label>_x000D_
    <input class="form-control">_x000D_
  </div>_x000D_
</div>

Fix #3 - Manual CSS

If you only need the AutoComplete widget from jQuery-UI's library, you should start by doing a custom build so you don't pull in resources you're not using.

After that, you'll need to style it yourself. Just look at some of the other styles that are applied to jquery's autocomplete.css and theme.css to figure out what styles you'll need to manually replace.

You can use bootstrap's dropdowns.less for inspiration.

Here's a sample CSS that fits pretty well with Bootstrap's default theme:

.ui-autocomplete {
    position: absolute;
    z-index: 1000;
    cursor: default;
    padding: 0;
    margin-top: 2px;
    list-style: none;
    background-color: #ffffff;
    border: 1px solid #ccc;
    -webkit-border-radius: 5px;
       -moz-border-radius: 5px;
            border-radius: 5px;
    -webkit-box-shadow: 0 5px 10px rgba(0, 0, 0, 0.2);
       -moz-box-shadow: 0 5px 10px rgba(0, 0, 0, 0.2);
            box-shadow: 0 5px 10px rgba(0, 0, 0, 0.2);
}
.ui-autocomplete > li {
  padding: 3px 20px;
}
.ui-autocomplete > li.ui-state-focus {
  background-color: #DDD;
}
.ui-helper-hidden-accessible {
  display: none;
}

$(function() {_x000D_
  var availableTags = [_x000D_
    "ActionScript", "AppleScript", "Asp", "BASIC", "C", "C++",_x000D_
    "Clojure", "COBOL", "ColdFusion", "Erlang", "Fortran",_x000D_
    "Groovy", "Haskell", "Java", "JavaScript", "Lisp", "Perl",_x000D_
    "PHP", "Python", "Ruby", "Scala", "Scheme"_x000D_
  ];_x000D_
  _x000D_
  $(".autocomplete").autocomplete({_x000D_
    source: availableTags_x000D_
  });_x000D_
});

.ui-autocomplete {_x000D_
    position: absolute;_x000D_
    z-index: 1000;_x000D_
    cursor: default;_x000D_
    padding: 0;_x000D_
    margin-top: 2px;_x000D_
    list-style: none;_x000D_
    background-color: #ffffff;_x000D_
    border: 1px solid #ccc_x000D_
    -webkit-border-radius: 5px;_x000D_
       -moz-border-radius: 5px;_x000D_
            border-radius: 5px;_x000D_
    -webkit-box-shadow: 0 5px 10px rgba(0, 0, 0, 0.2);_x000D_
       -moz-box-shadow: 0 5px 10px rgba(0, 0, 0, 0.2);_x000D_
            box-shadow: 0 5px 10px rgba(0, 0, 0, 0.2);_x000D_
}_x000D_
.ui-autocomplete > li {_x000D_
  padding: 3px 20px;_x000D_
}_x000D_
.ui-autocomplete > li.ui-state-focus {_x000D_
  background-color: #DDD;_x000D_
}_x000D_
.ui-helper-hidden-accessible {_x000D_
  display: none;_x000D_
}

<link href="//cdnjs.cloudflare.com/ajax/libs/twitter-bootstrap/3.3.2/css/bootstrap.css" rel="stylesheet"/>_x000D_
_x000D_
<script src="//cdnjs.cloudflare.com/ajax/libs/jquery/2.1.3/jquery.js"></script>_x000D_
<script src="//cdnjs.cloudflare.com/ajax/libs/jqueryui/1.11.2/jquery-ui.js"></script>_x000D_
<script src="//cdnjs.cloudflare.com/ajax/libs/twitter-bootstrap/3.3.2/js/bootstrap.js"></script>_x000D_
_x000D_
<div class="container">_x000D_
  <div class="form-group ui-widget">_x000D_
    <label>Languages</label>_x000D_
    <input class="form-control autocomplete" placeholder="Enter A" />_x000D_
  </div>_x000D_
  _x000D_
  <div class="form-group ui-widget">_x000D_
    <label >Another Field</label>_x000D_
    <input class="form-control" />_x000D_
  </div>_x000D_
</div>

Tip: Since the dropdown menu hides every time you go to inspect the element (i.e. whenever the input loses focus), for easier debugging of the style, find the control with .ui-autocomplete and remove display: none;.

I was facing a similar issue and found that a few fields like Date were not getting a concrete value, once given the values things worked fine. Please make sure you do not have date or any other field present on the form which needs a concrete value.

While iterating through the loop, you are trying to change the List value in the remove() operation. This will result in ConcurrentModificationException.

Follow the below code, which will achieve what you want and yet will not throw any exceptions

private String toString(List aDrugStrengthList) {
        StringBuilder str = new StringBuilder();
    List removalList = new ArrayList();
    for (DrugStrength aDrugStrength : aDrugStrengthList) {
        if (!aDrugStrength.isValidDrugDescription()) {
            removalList.add(aDrugStrength);
        }
    }
    aDrugStrengthList.removeAll(removalList);
    str.append(aDrugStrengthList);
    if (str.indexOf("]") != -1) {
        str.insert(str.lastIndexOf("]"), "\n          " );
    }
    return str.toString();
}

Probably the simplest way is to use the InputBox method of the Microsoft.VisualBasic.Interaction class:

[void][Reflection.Assembly]::LoadWithPartialName('Microsoft.VisualBasic')

$title = 'Demographics'
$msg   = 'Enter your demographics:'

$text = [Microsoft.VisualBasic.Interaction]::InputBox($msg, $title)

You can discover those things easily by yourself:

def hello(*args, **kwargs):
    print kwargs
    print type(kwargs)
    print dir(kwargs)

hello(what="world")

A header (.h, .hpp, ...) file contains

• Class definitions ( class X { ... }; )
• Inline function definitions ( inline int get_cpus() { ... } )
• Function declarations ( void help(); )
• Object declarations ( extern int debug_enabled; )

A source file (.c, .cpp, .cxx) contains

• Function definitions ( void help() { ... } or void X::f() { ... } )
• Object definitions ( int debug_enabled = 1; )

However, the convention that headers are named with a .h suffix and source files are named with a .cpp suffix is not really required. One can always tell a good compiler how to treat some file, irrespective of its file-name suffix ( -x <file-type> for gcc. Like -x c++ ).

Source files will contain definitions that must be present only once in the whole program. So if you include a source file somewhere and then link the result of compilation of that file and then the one of the source file itself together, then of course you will get linker errors, because you have those definitions now appear twice: Once in the included source file, and then in the file that included it. That's why you had problems with including the .cpp file.

I recommend to uninstall typescript first with the command:

npm uninstall -g typescript

then use the chocolatey package in order to run:

choco install typescript

in PowerShell.

Incase you're running some command with sudo, it won't allow it. Sudo needs a tty.

Took a lot of googling but here is what I do in Python for MySql when I want to delete multiple items from a single table using a list of values.

#create some empty list
values = []
#continue to append the values you want to delete to it
#BUT you must ensure instead of a string it's a single value tuple
values.append(([Your Variable],))
#Then once your array is loaded perform an execute many
cursor.executemany("DELETE FROM YourTable WHERE ID = %s", values)

I know this thread is old, but...

If you're using html encoding (like AntiXSS), the previous answers will not work. The break tags will be rendered as text, rather than applying a carriage return. You can wrap your asp label in a pre tag, and it will display with whatever line breaks are set from the code behind.

Example:

<pre style="width:600px;white-space:pre-wrap;"><asp:Label ID="lblMessage" Runat="server" visible ="true"/></pre>

that depends on what kind of information are you passing to the conditional..

sometimes your result will be null or undefined or '' or 0, for my simple validation i use this if.

( $('#id').val() == '0' || $('#id').val() == '' || $('#id').val() == 'undefined' || $('#id').val() == null )

NOTE: null != 'null'

It's equivalent to

def tag_names
  @tag_names || tags.map { |tag| tag.name }.join(' ')
end

<table width="400px">
  <tr>
  <td width="100px"></td>
  <td width="100px"></td>
  <td width="100px"></td>
  <td width="100px"></td>
  </tr>
</table>

For variable number of columns use %

<table width="100%">
  <tr>
  <td width="(100/x)%"></td>
  </tr>
</table>

where 'x' is number of columns

According to the tkinterbook the code to clear a text element should be:

text.delete(1.0,END)

This worked for me. source

It's different from clearing an entry element, which is done like this:

entry.delete(0,END) #note the 0 instead of 1.0

Here is a way to do it with PHP PEAR

// Pear Mail Library
require_once "Mail.php";

$from = '<[email protected]>'; //change this to your email address
$to = '<[email protected]>'; // change to address
$subject = 'Insert subject here'; // subject of mail
$body = "Hello world! this is the content of the email"; //content of mail

$headers = array(
    'From' => $from,
    'To' => $to,
    'Subject' => $subject
);

$smtp = Mail::factory('smtp', array(
        'host' => 'ssl://smtp.gmail.com',
        'port' => '465',
        'auth' => true,
        'username' => '[email protected]', //your gmail account
        'password' => 'snip' // your password
    ));

// Send the mail
$mail = $smtp->send($to, $headers, $body);

//check mail sent or not
if (PEAR::isError($mail)) {
    echo '<p>'.$mail->getMessage().'</p>';
} else {
    echo '<p>Message successfully sent!</p>';
}

If you use Gmail SMTP remember to enable SMTP in your Gmail account, under settings

EDIT: If you can't find Mail.php on debian/ubuntu you can install php-pear with

sudo apt install php-pear

Then install the mail extention:

sudo pear install mail
sudo pear install Net_SMTP
sudo pear install Auth_SASL
sudo pear install mail_mime

Then you should be able to load it by simply require_once "Mail.php" else it is located here: /usr/share/php/Mail.php

I resolved this by adding following code to the HTML page, since we are using the third party API which is not controlled by us.

<meta http-equiv="Content-Security-Policy" content="upgrade-insecure-requests"> 

Hope this would help, and for a record as well.

I had the same problem and it was really annoying each time with the terminal. I run the command to the terminal and it was fixed

For those try to remove nvm from brew

it may not be enough to just brew uninstall nvm

if you see npm prefix is still /usr/local, run this command

sudo rm -rf /usr/local/{lib/node{,/.npm,_modules},bin,share/man}/{npm*,node*,man1/node*}

You can either loop through the rows with a cursor and append to a field in a temp table, or you could use the COALESCE function to concatenate the fields.

this will also work, if you like

 xcopy  C:\Test\Log "c:\Test\Backup-%date:~4,2%-%date:~7,2%-%date:~10,4%_%time:~0,2%%time:~3,2%" /s /i
 del C:\Test\Log

You can also use btoa instead of base64.encode().

headers.set('Authorization', 'Basic ' + btoa(username + ":" + password));

There's yet another way to do it using Shared Connections, ie: somebody initiates the connection, using a password, and every subsequent connection will multiplex over the same channel, negating the need for re-authentication. ( And its faster too )

# ~/.ssh/config 
ControlMaster auto
ControlPath ~/.ssh/pool/%r@%h

then you just have to log in, and as long as you are logged in, the bash script will be able to open ssh connections.

You can then stop your script from working when somebody has not already opened the channel by:

ssh ... -o KbdInteractiveAuthentication=no ....

use

 $(document).height()

  overflow=auto 

for scrolling

Convert the string to an integer base 16 then to hexadecimal.

print hex(int(string, base=16))

These are built-in functions.

http://docs.python.org/2/library/functions.html#int

Example

>>> string = 'AA'
>>> _int = int(string, base=16)
>>> _hex = hex(_int)
>>> print _int
170
>>> print _hex
0xaa
>>> 

You're missing a space after "p1":

if [ -s "p1" ];

you can use this extension method and call it like this.

DataTable dt =   YourList.ToDataTable();

public static DataTable ToDataTable<T>(this List<T> iList)
        {
            DataTable dataTable = new DataTable();
            PropertyDescriptorCollection propertyDescriptorCollection =
                TypeDescriptor.GetProperties(typeof(T));
            for (int i = 0; i < propertyDescriptorCollection.Count; i++)
            {
                PropertyDescriptor propertyDescriptor = propertyDescriptorCollection[i];
                Type type = propertyDescriptor.PropertyType;

                if (type.IsGenericType && type.GetGenericTypeDefinition() == typeof(Nullable<>))
                    type = Nullable.GetUnderlyingType(type);


                dataTable.Columns.Add(propertyDescriptor.Name, type);
            }
            object[] values = new object[propertyDescriptorCollection.Count];
            foreach (T iListItem in iList)
            {
                for (int i = 0; i < values.Length; i++)
                {
                    values[i] = propertyDescriptorCollection[i].GetValue(iListItem);
                }
                dataTable.Rows.Add(values);
            }
            return dataTable;
        }

I was having the same error from JDBC. Checked everything and my query was fine. Turned out, in where clause I have an argument:

where s.some_column = ?

And the value of the argument I was passing in was null. This also gives the same error which is misleading because when you search the internet you end up that something is wrong with the query structure but it's not in my case. Just thought someone may face the same issue

Create custom TextWatcher subclass:

public class CustomWatcher implements TextWatcher {

    private boolean mWasEdited = false;

    @Override
    public void beforeTextChanged(CharSequence s, int start, int count, int after) {

    }

    @Override
    public void onTextChanged(CharSequence s, int start, int before, int count) {

    }

    @Override
    public void afterTextChanged(Editable s) {

        if (mWasEdited){

            mWasEdited = false;
            return;
        }

        // get entered value (if required)
        String enteredValue  = s.toString();

        String newValue = "new value";

        // don't get trap into infinite loop
        mWasEdited = true;
        // just replace entered value with whatever you want
        s.replace(0, s.length(), newValue);

    }
}

Set listener for your EditText:

mTargetEditText.addTextChangedListener(new CustomWatcher());

By using

$_SERVER['REQUEST_METHOD']

Example

if ($_SERVER['REQUEST_METHOD'] === 'POST') {
     // The request is using the POST method
}

For more details please see the documentation for the $_SERVER variable.

Good question. I've just started a large project at work and part of previous projects was to introduce modularity to our code-base.

I've heard bad things about maven. In fact, it's all I've ever heard about it. I looked at introducing it to solve the dependency nightmare we're currently experiencing. The problem I've seen with Maven is that it is quite rigid in its structure, i.e. you need to conform to its project layout for it to work for you.

I know what most people will say - you don't have to conform to the structure. Indeed that's true but you won't know this until you're over the initial learning curve at which point you've invested too much time to go and throw it all away.

Ant is used a lot these days, and I love it. Taking that into account I stumbled across a little known dependency manager called Apache Ivy. Ivy integrates into Ant very well and it's quick and easy to get basic JAR retrieval setup and working. Another benefit of Ivy is that it's very powerful yet quite transparent; you can transfer builds using mechanisms such as scp or ssh quite easily; 'chain' dependency retrieval over filesystems or remote repositories (Maven repo compatibility is one of its popular features).

That all said, I found it very frustrating to use in the end - the documentation is aplenty, but it's written in bad English which can add to frustration when debugging or attempting to work out what's gone wrong.

I'm going to revisit Apache Ivy at some point during this project and I hope to get it working properly. One thing it did do was allow us as a team to work out what libraries we're dependent on and get a documented list.

Ultimately I think it all comes down to how you work as an individual/team and what you need to resolve your dependency issues.

You might find the following resources relating to Ivy useful:

• Apache Ivy vs Maven 2 comparison
• Apache Ivy FAQ
• Apache Ivy feature list

You should pass a Class...

private void foo(Class<?> t){
    if(t == String.class){ ... }
    else if(t == int.class){ ... }
}

private void bar()
{
   foo(String.class);
}

You are replacing the starting tag and then putting that back in innerHTML, so the code will be invalid. Make all the replacements before you put the code back in the element:

var html = strMessage1.innerHTML;
html = html.replace( /aaaaaa./g,'<a href=\"http://www.google.com/');
html = html.replace( /.bbbbbb/g,'/world\">Helloworld</a>');
strMessage1.innerHTML = html;

Well I don't even understand the culprit of this problem. But in my case the problem is totally different. I've tried running netstat -o or netstat -ab, both show that there is not any app currently listening on port 62434 which is the one my app tries to listen on. So it's really confusing to me.

I just tried thinking of what I had made so that it stopped working (it did work before). Well then I thought of the Internet sharing I made on my Ethernet adapter with a private virtual LAN (using Hyper-v in Windows 10). I just needed to turn off the sharing and it worked just fine again.

Hope this helps someone else having the same issue. And of course if someone could explain this, please add more detail in your own answer or maybe as some comment to my answer.

Can you not use AcceptButton in for the Forms Properties Window? This sets the default behaviour for the Enter key press, but you are still able to use other shortcuts.

The reason you don't have permissions to open file is because you didn't grant other apps to open or view the file on your intent. To grant other apps to open the downloaded file, include the flag(as shown below): FLAG_GRANT_READ_URI_PERMISSION

Intent browserIntent = new Intent(Intent.ACTION_VIEW);
browserIntent.setDataAndType(getUriFromFile(localFile), "application/pdf");
browserIntent.setFlags(Intent.FLAG_GRANT_READ_URI_PERMISSION|
Intent.FLAG_ACTIVITY_NO_HISTORY);
startActivity(browserIntent);

And for function:

getUriFromFile(localFile)

private Uri getUriFromFile(File file){
    if (Build.VERSION.SDK_INT < Build.VERSION_CODES.N) {
        return Uri.fromFile(file);
    }else {
        return FileProvider.getUriForFile(itemView.getContext(), itemView.getContext().getApplicationContext().getPackageName() + ".provider", file);
    }
}

I did it by setting the input field as "text", and catching and manipulating the input keys

first activate a function to catch keys

yourInputElement.addEventListener('keydown', onInputPassword);

the onInputPassword function is like this: (assuming that you have the "password" variable defined somewhere)

onInputPassword( event ) {
  let key = event.key;
  event.preventDefault(); // this is to prevent the key to reach the input field

  if( key == "Enter" ) {
    // here you put a call to the function that will do something with the password
  }
  else if( key == "Backspace" ) {
    if( password ) {
      // remove the last character if any
      yourInputElement.value = yourInputElement.value.slice(0, -1);
      password = password.slice(0, -1);
    }
  }
  else if( (key >= '0' && key <= '9') || (key >= 'A' && key <= 'Z') || (key >= 'a' && key <= 'z') ) {
    // show a fake '*' on input field and store the real password
    yourInputElement.value = yourInputElement.value + "*";
    password += key;
  }
}

so all alphanumeric keys will be added to the password, the 'backspace' key will erase one character, the 'enter' key will terminate, and any other keys will be ignored

don't forget to call removeEventListener('keydown', onInputPassword) somewhere at the end

This is so easy with jquery:

If below is your anchor link:

<a data-toggle="modal" data-id="@book.Id" title="Add this item" class="open-AddBookDialog"></a>

In the show event of your modal you can access to the anchor tag like below

//triggered when modal is shown
$('#modal_id').on('shown.bs.modal', function(event) {

    // The reference tag is your anchor tag here
    var reference_tag = $(event.relatedTarget); 
    var id = reference_tag.data('id')
    // ...
    // ...
})

If you don't want to integrate a framework like Zend, then you can use the trigger_error method to log to the php error log.

How about this way:

List<int> myList = new List<int>(){1, 2, 3, 4}; //or any other type
myList.Sort();
int greatestValue = myList[ myList.Count - 1 ];

You basically let the Sort() method to do the job for you instead of writing your own method. Unless you don't want to sort your collection.

This post asks the same question, but for linux - you may find it helpful. Send a ping to each IP on a subnet

nmap is probably the best tool to use, as it can help identify host OS as well as being faster. It is available for the windows platform on the nmap.org site

This error occurred for me inside Travis when I forgot to add new files to my git repository. Silly mistake, but I can see it being quite common.

In res/drawable folder,

1. Create a new Drawable Resources.

2. Input file name.

A new file will be created inside the res/drawable folder.

Replace this code inside the newly created file and replace ic_action_back with your drawable file name.

<bitmap xmlns:android="http://schemas.android.com/apk/res/android"
    android:src="@drawable/ic_action_back"
    android:tint="@color/color_primary_text" />

Now, you can use it with Resource ID, R.id.filename.

Have you tried: getElementbyId('ID_OF_ID').innerHTML?

In my case I made the mistake of copying *ng-for= from the docs.

https://angular.io/guide/user-input

Correct me if I am wrong. But it seems *ng-for= has been changed to *ngFor=

I confirm some methods proposed here that also worked for me : you have to put your local .json file in your public directory where fetch() is looking for (looking in http://localhost:3000/) for example : I use this fetch() in my src/App.js file:

componentDidMount(){
  fetch('./data/json-data.json')
  .then ( resp1 => resp1.json() )
  .then ( users1 => this.setState( {cards : users1} ) )
}

so I created public/data/json-data.json

and everything was fine then :)

Note that in Entity Framework 6.1 (currently in beta) will support the IndexAttribute to annotate the index properties which will automatically result in a (unique) index in your Code First Migrations.

C90 does not support the boolean data type.

C99 does include it with this include:

#include <stdbool.h>

You can use this code:

var vid = document.getElementById("video1");

function slowPlaySpeed() { 
    vid.playbackRate = 0.5;
} 

function normalPlaySpeed() { 
    vid.playbackRate = 1;
} 

function fastPlaySpeed() { 
    vid.playbackRate = 2;
}

Docs says the order of events related to the onkeyxxx event:

1. onkeydown
2. onkeypress
3. onkeyup

If you use like below code, it fits with also backspace and enter user interactions. After you can do what you want in onKeyPress or onKeyUp events. Code block trigger event.preventDefault function if the value is not number,backspace or enter.

onInputKeyDown = event => {
    const { keyCode } = event;
    if (
      (keyCode >= 48 && keyCode <= 57) ||
      (keyCode >= 96 && keyCode <= 105) ||
      keyCode === 8 || //Backspace key
      keyCode === 13   //Enter key
    ) {
    } else {
      event.preventDefault();
    }
  };

You can compute pairwise cosine similarity on the rows of a sparse matrix directly using sklearn. As of version 0.17 it also supports sparse output:

from sklearn.metrics.pairwise import cosine_similarity
from scipy import sparse

A =  np.array([[0, 1, 0, 0, 1], [0, 0, 1, 1, 1],[1, 1, 0, 1, 0]])
A_sparse = sparse.csr_matrix(A)

similarities = cosine_similarity(A_sparse)
print('pairwise dense output:\n {}\n'.format(similarities))

#also can output sparse matrices
similarities_sparse = cosine_similarity(A_sparse,dense_output=False)
print('pairwise sparse output:\n {}\n'.format(similarities_sparse))

Results:

pairwise dense output:
[[ 1.          0.40824829  0.40824829]
[ 0.40824829  1.          0.33333333]
[ 0.40824829  0.33333333  1.        ]]

pairwise sparse output:
(0, 1)  0.408248290464
(0, 2)  0.408248290464
(0, 0)  1.0
(1, 0)  0.408248290464
(1, 2)  0.333333333333
(1, 1)  1.0
(2, 1)  0.333333333333
(2, 0)  0.408248290464
(2, 2)  1.0

If you want column-wise cosine similarities simply transpose your input matrix beforehand:

A_sparse.transpose()

The getElementById method returns an Element object that you can use to interact with the element. If the element is not found, null is returned. In case of an input element, the value property of the object contains the string in the value attribute.

By using the fact that the && operator short circuits, and that both null and the empty string are considered "falsey" in a boolean context, we can combine the checks for element existence and presence of value data as follows:

var myInput = document.getElementById("customx");
if (myInput && myInput.value) {
  alert("My input has a value!");
}

bool b = list.Contains("Hello", StringComparer.CurrentCultureIgnoreCase);

[EDIT] extension code:

public static bool Contains(this string source, string cont
                                                    , StringComparison compare)
{
    return source.IndexOf(cont, compare) >= 0;
}

This could work :)

Constant initializer allowed by C++ Standard only for integral or enumeration types. See 9.4.2/4 for details:

If a static data member is of const integral or const enumeration type, its declaration in the class definition can specify a constant-initializer which shall be an integral constant expression (5.19). In that case, the member can appear in integral constant expressions. The member shall still be defined in a name- space scope if it is used in the program and the namespace scope definition shall not contain an initializer.

And 9.4.2/7:

Static data members are initialized and destroyed exactly like non-local objects (3.6.2, 3.6.3).

So you should write somewhere in cpp file:

const char* SomeClass::SOMETHING = "sommething";

 ALTER TABLE YourTable ALTER COLUMN YourColumn columnType NULL

Similar to answer above but without the absolute positioning:

<select style="width: 200px; float: left;" onchange="this.nextElementSibling.value=this.value">
    <option></option>
    <option>1</option>
    <option>2</option>
    <option>3</option> 
</select>
<input style="width: 185px; margin-left: -199px; margin-top: 1px; border: none; float: left;"/>

So create a input box and put it over the top of the combobox

Reinstall JDK and set system variable JAVA_HOME on your JDK. (e.g. C:\tools\jdk7)
And add JAVA_HOME variable to your PATH system variable

Type in command line

echo %JAVA_HOME%

and

java -version

To verify whether your installation was done successfully.

This problem generally occurs in Windows when your "Java Runtime Environment" registry entry is missing or mismatched with the installed JDK. The mismatch can be due to multiple JDKs.

Steps to resolve:

1. Open the Run window:

   Press windows+R

2. Open registry window:

   Type regedit and enter.

3. Go to: \HKEY_LOCAL_MACHINE\SOFTWARE\JavaSoft\

4. If Java Runtime Environment is not present inside JavaSoft, then create a new Key and give the name Java Runtime Environment.

5. For Java Runtime Environment create "CurrentVersion" String Key and give appropriate version as value:

6. Create a new subkey of 1.8.

7. For 1.8 create a String Key with name JavaHome with the value of JRE home:

   

Ref: https://mybindirectory.blogspot.com/2019/05/error-could-not-find-javadll.html

Find timestamp from DateTime:

private long ConvertToTimestamp(DateTime value)
{
    TimeZoneInfo NYTimeZone = TimeZoneInfo.FindSystemTimeZoneById("Eastern Standard Time");
    DateTime NyTime = TimeZoneInfo.ConvertTime(value, NYTimeZone);
    TimeZone localZone = TimeZone.CurrentTimeZone;
    System.Globalization.DaylightTime dst = localZone.GetDaylightChanges(NyTime.Year);
    NyTime = NyTime.AddHours(-1);
    DateTime epoch = new DateTime(1970, 1, 1, 0, 0, 0, 0).ToLocalTime();
    TimeSpan span = (NyTime - epoch);
    return (long)Convert.ToDouble(span.TotalSeconds);
}

I had to search a nested sitemap structure for the first leaf item that machtes a given path. I came up with the following code just using .map() .filter() and .reduce. Returns the last item found that matches the path /c.

var sitemap = {
  nodes: [
    {
      items: [{ path: "/a" }, { path: "/b" }]
    },
    {
      items: [{ path: "/c" }, { path: "/d" }]
    },
    {
      items: [{ path: "/c" }, { path: "/d" }]
    }
  ]
};

const item = sitemap.nodes
  .map(n => n.items.filter(i => i.path === "/c"))
  .reduce((last, now) => last.concat(now))
  .reduce((last, now) => now);

Wow, the other answers look complex - so I'm hoping I've not missed something obvious.

You can use OVER/PARTITION BY against aggregates, and they'll then do grouping/aggregating without a GROUP BY clause. So I just modified your query to:

select T2.ID AS T2ID
    ,T2.Name as T2Name
    ,T2.Orders
    ,T1.ID AS T1ID
    ,T1.Name As T1Name
    ,T1Sum.Price
FROM @t2 T2
INNER JOIN (
    SELECT Rel.t2ID
        ,Rel.t1ID
 --       ,MAX(Rel.t1ID)AS t1ID 
-- the MAX returns an arbitrary ID, what i need is: 
      ,ROW_NUMBER()OVER(Partition By Rel.t2ID Order By Price DESC)As PriceList
        ,SUM(Price)OVER(PARTITION BY Rel.t2ID) AS Price
        FROM @t1 T1 
        INNER JOIN @relation Rel ON Rel.t1ID=T1.ID
--        GROUP BY Rel.t2ID
)AS T1Sum ON  T1Sum.t2ID = T2.ID
INNER JOIN @t1 T1 ON T1Sum.t1ID=T1.ID
where t1Sum.PriceList = 1

Which gives the requested result set.

I guess this will help you.

JSONObject jsonObj = new JSONObject(jsonStr);

JSONArray ja_data = jsonObj.getJSONArray("data");
int length = jsonObj.length();
for(int i=0; i<length; i++) {
  JSONObject jsonObj = ja_data.getJSONObject(i);
  Toast.makeText(this, jsonObj.getString("Name"), Toast.LENGTH_LONG).show();

  // getting inner array Ingredients
  JSONArray ja = jsonObj.getJSONArray("Ingredients");
  int len = ja.length();

  ArrayList<String> Ingredients_names = new ArrayList<>();
  for(int j=0; j<len; j++) {
    JSONObject json = ja.getJSONObject(j);
    Ingredients_names.add(json.getString("name"));
  }
}

This is my "one-line" solution:

$.postJSON = function(url, data, func) { $.post(url+(url.indexOf("?") == -1 ? "?" : "&")+"callback=?", data, func, "json"); }

In order to use jsonp, and POST method, this function adds the "callback" GET parameter to the URL. This is the way to use it:

$.postJSON("http://example.com/json.php",{ id : 287 }, function (data) {
   console.log(data.name);
});

The server must be prepared to handle the callback GET parameter and return the json string as:

jsonp000000 ({"name":"John", "age": 25});

in which "jsonp000000" is the callback GET value.

In PHP the implementation would be like:

print_r($_GET['callback']."(".json_encode($myarr).");");

I made some cross-domain tests and it seems to work. Still need more testing though.

I suspect that the problem lies in the fact that you are calling your state setter immediately inside the function component body, which forces React to re-invoke your function again, with the same props, which ends up calling the state setter again, which triggers React to call your function again.... and so on.

const SingInContainer = ({ message, variant}) => {
    const [open, setSnackBarState] = useState(false);
    const handleClose = (reason) => {
        if (reason === 'clickaway') {
          return;
        }
        setSnackBarState(false)

      };

    if (variant) {
        setSnackBarState(true); // HERE BE DRAGONS
    }
    return (
        <div>
        <SnackBar
            open={open}
            handleClose={handleClose}
            variant={variant}
            message={message}
            />
        <SignInForm/>
        </div>
    )
}

Instead, I recommend you just conditionally set the default value for the state property using a ternary, so you end up with:

const SingInContainer = ({ message, variant}) => {
    const [open, setSnackBarState] = useState(variant ? true : false); 
                                  // or useState(!!variant); 
                                  // or useState(Boolean(variant));
    const handleClose = (reason) => {
        if (reason === 'clickaway') {
          return;
        }
        setSnackBarState(false)

      };

    return (
        <div>
        <SnackBar
            open={open}
            handleClose={handleClose}
            variant={variant}
            message={message}
            />
        <SignInForm/>
        </div>
    )
}

Comprehensive Demo

See this CodeSandbox.io demo for a comprehensive demo of it working, plus the broken component you had, and you can toggle between the two.

I resolved this issue by escaping the inner double quotes

projectID=$(cat file.json | jq -r ".resource[] | select(.username==\"$EMAILID\") | .id")

It's a bug or whatever but the removePersistentDomainForName is not working while clearing all the NSUserDefaults values.

So, better option is that to reset the PersistentDomain and that you can do via following way:

NSUserDefaults.standardUserDefaults().setPersistentDomain(["":""], forName: NSBundle.mainBundle().bundleIdentifier!)

Create a breakpoint as you normally would, right click the red dot and select "condition".

Date is not an Integer in VB(A), it is a Double.

You can get a Date's value by passing it to CDbl().

CDbl(Now())      ' 40877.8052662037 

From the documentation:

The 1900 Date System

In the 1900 date system, the first day that is supported is January 1, 1900. When you enter a date, the date is converted into a serial number that represents the number of elapsed days starting with 1 for January 1, 1900. For example, if you enter July 5, 1998, Excel converts the date to the serial number 35981.

So in the 1900 system, 40877.805... represents 40,876 days after January 1, 1900 (29 November 2011), and ~80.5% of one day (~19:19h). There is a setting for 1904-based system in Excel, numbers will be off when this is in use (that's a per-workbook setting).

To get the integer part, use

Int(CDbl(Now())) ' 40877

which would return a LongDouble with no decimal places (i.e. what Floor() would do in other languages).

Using CLng() or Round() would result in rounding, which will return a "day in the future" when called after 12:00 noon, so don't do that.

Update

S3 now offers a fully-managed SFTP Gateway Service for S3 that integrates with IAM and can be administered using aws-cli.

There are theoretical and practical reasons why this isn't a perfect solution, but it does work...

You can install an FTP/SFTP service (such as proftpd) on a linux server, either in EC2 or in your own data center... then mount a bucket into the filesystem where the ftp server is configured to chroot, using s3fs.

I have a client that serves content out of S3, and the content is provided to them by a 3rd party who only supports ftp pushes... so, with some hesitation (due to the impedance mismatch between S3 and an actual filesystem) but lacking the time to write a proper FTP/S3 gateway server software package (which I still intend to do one of these days), I proposed and deployed this solution for them several months ago and they have not reported any problems with the system.

As a bonus, since proftpd can chroot each user into their own home directory and "pretend" (as far as the user can tell) that files owned by the proftpd user are actually owned by the logged in user, this segregates each ftp user into a "subdirectory" of the bucket, and makes the other users' files inaccessible.

There is a problem with the default configuration, however.

Once you start to get a few tens or hundreds of files, the problem will manifest itself when you pull a directory listing, because ProFTPd will attempt to read the .ftpaccess files over, and over, and over again, and for each file in the directory, .ftpaccess is checked to see if the user should be allowed to view it.

You can disable this behavior in ProFTPd, but I would suggest that the most correct configuration is to configure additional options -o enable_noobj_cache -o stat_cache_expire=30 in s3fs:

-o stat_cache_expire (default is no expire)

specify expire time(seconds) for entries in the stat cache

Without this option, you'll make fewer requests to S3, but you also will not always reliably discover changes made to objects if external processes or other instances of s3fs are also modifying the objects in the bucket. The value "30" in my system was selected somewhat arbitrarily.

-o enable_noobj_cache (default is disable)

enable cache entries for the object which does not exist. s3fs always has to check whether file(or sub directory) exists under object(path) when s3fs does some command, since s3fs has recognized a directory which does not exist and has files or subdirectories under itself. It increases ListBucket request and makes performance bad. You can specify this option for performance, s3fs memorizes in stat cache that the object (file or directory) does not exist.

This option allows s3fs to remember that .ftpaccess wasn't there.

Unrelated to the performance issues that can arise with ProFTPd, which are resolved by the above changes, you also need to enable -o enable_content_md5 in s3fs.

-o enable_content_md5 (default is disable)

verifying uploaded data without multipart by content-md5 header. Enable to send "Content-MD5" header when uploading a object without multipart posting. If this option is enabled, it has some influences on a performance of s3fs when uploading small object. Because s3fs always checks MD5 when uploading large object, this option does not affect on large object.

This is an option which never should have been an option -- it should always be enabled, because not doing this bypasses a critical integrity check for only a negligible performance benefit. When an object is uploaded to S3 with a Content-MD5: header, S3 will validate the checksum and reject the object if it's corrupted in transit. However unlikely that might be, it seems short-sighted to disable this safety check.

^{Quotes are from the man page of s3fs. Grammatical errors are in the original text.}

@LiviuT's answer is awesome, but seems to leave lots of folks wondering how to re-access the handler's tear-down function from another $scope or function, if you want to destroy it from a place other than where it was created. @?????? ?????????'s answer works just great, but isn't very idiomatic. (And relies on what's supposed to be a private implementation detail, which could change any time.) And from there, it just gets more complicated...

I think the easy answer here is to simply carry a reference to the tear-down function (offCallMeFn in his example) in the handler itself, and then call it based on some condition; perhaps an arg that you include on the event you $broadcast or $emit. Handlers can thus tear down themselves, whenever you want, wherever you want, carrying around the seeds of their own destruction. Like so:

// Creation of our handler:
var tearDownFunc = $rootScope.$on('demo-event', function(event, booleanParam) {
    var selfDestruct = tearDownFunc;
    if (booleanParam === false) {
        console.log('This is the routine handler here. I can do your normal handling-type stuff.')
    }
    if (booleanParam === true) {
        console.log("5... 4... 3... 2... 1...")
        selfDestruct();
    }
});

// These two functions are purely for demonstration
window.trigger = function(booleanArg) {
    $scope.$emit('demo-event', booleanArg);
}
window.check = function() {
    // shows us where Angular is stashing our handlers, while they exist
    console.log($rootScope.$$listeners['demo-event'])
};

// Interactive Demo:

>> trigger(false);
// "This is the routine handler here. I can do your normal handling-type stuff."

>> check();
// [function] (So, there's a handler registered at this point.)  

>> trigger(true);
// "5... 4... 3... 2... 1..."

>> check();
// [null] (No more handler.)

>> trigger(false);
// undefined (He's dead, Jim.)

Two thoughts:

1. This is a great formula for a run-once handler. Just drop the conditionals and run selfDestruct as soon as it has completed its suicide mission.
2. I wonder about whether the originating scope will ever be properly destroyed and garbage-collected, given that you're carrying references to closured variables. You'd have to use a million of these to even have it be a memory problem, but I'm curious. If anybody has any insight, please share.

Date has the time part, so we only need to extract it from Date

I personally prefer the default format parameter of the Date when date and time needs to be separated instead of using the extra SimpleDateFormat

Date date = new Date()
String datePart = date.format("dd/MM/yyyy")
String timePart = date.format("HH:mm:ss")

println "datePart : " + datePart + "\ttimePart : " + timePart

If you want a breakdown of how many files are in each dir under your current dir:

for i in */ .*/ ; do 
    echo -n $i": " ; 
    (find "$i" -type f | wc -l) ; 
done

That can go all on one line, of course. The parenthesis clarify whose output wc -l is supposed to be watching (find $i -type f in this case).

Based on spacebean's answer, this modification also changes the displayed text when the user selects a different item (just as a <select> would do):

http://www.bootply.com/VxVlaebtnL

HTML:

<div class="container">
  <div class="col-sm-7 pull-right well">
    <form class="form-inline" action="#" method="get">
      <div class="input-group col-sm-8">
        <input class="form-control" type="text" value="" placeholder="Search" name="q">
        <div class="input-group-btn">
          <button type="button" class="btn btn-default dropdown-toggle" data-toggle="dropdown" aria-haspopup="true" aria-expanded="false"><span id="mydropdowndisplay">Choice 1</span> <span class="caret"></span></button>
          <ul class="dropdown-menu" id="mydropdownmenu">
            <li><a href="#">Choice 1</a></li>
            <li><a href="#">Choice 2</a></li>
            <li><a href="#">Choice 3</a></li>
          </ul>
          <input type="hidden" id="mydropwodninput" name="category">
        </div><!-- /btn-group -->
      </div>
    <button class="btn btn-primary col-sm-3 pull-right" type="submit">Search</button>
    </form>
  </div>
</div>

Jquery:

$('#mydropdownmenu > li').click(function(e){
  e.preventDefault();
  var selected = $(this).text();
  $('#mydropwodninput').val(selected);
  $('#mydropdowndisplay').text(selected);
});

To avoid 'Unclosed block: CssSyntaxError' errors being thrown from sass compilers add a ';' to the end of @content.

@mixin placeholder {
   ::-webkit-input-placeholder { @content;}
   :-moz-placeholder           { @content;}
   ::-moz-placeholder          { @content;}
   :-ms-input-placeholder      { @content;}
}

If you want case-insensitive comparison, use lower or upper:

if name.lower() == "jesse":

You can do Your own Animation style as an xml file like this(put it in anim folder):

left to right:

  <set xmlns:android="http://schemas.android.com/apk/res/android"
     android:shareInterpolator="false">
        <translate android:fromXDelta="-100%" android:toXDelta="0%"
         android:fromYDelta="0%" android:toYDelta="0%"
         android:duration="500"/>
  </set>

right to left:

    <set xmlns:android="http://schemas.android.com/apk/res/android"
     android:shareInterpolator="false">
     <translate
        android:fromXDelta="0%" android:toXDelta="100%"
        android:fromYDelta="0%" android:toYDelta="0%"
        android:duration="500" />
   </set>

here You can set Your own values at duration, maybe it depends on the phone model how the animation will look like, try some values out if it looks not good.

and then You can call it in Your activity:

     Intent animActivity = new Intent(this,YourStartAfterAnimActivity.class);
      startActivity(nextActivity);

      overridePendingTransition(R.anim.your_left_to_right, R.anim.your_right_to_left);

This seems much more straight forward to me:

import re

s = 'asdf=5;iwantthis123jasd'
x= re.search('iwantthis',s)
print(s[x.start():x.end()])

The following regular expression in Python works well for detecting URL(s) in the text:

source_text = '''
text1
text2
http://url.com/bla1/blah1/
text3
text4
http://url.com/bla2/blah2/
text5
text6    '''

import re
url_reg  = r'[a-z]*[:.]+\S+'
result   = re.sub(url_reg, '', source_text)
print(result)

Output:

text1
text2

text3
text4

text5
text6

Just write <a href="#"></a>.

If that's what you want, you don't need a server-side control.

when you have Failed to connect to remote VM Connection refused error, restart your eclipse

I am a beginner so here is a beginners answer. The if in the for loop gives i which can then be used however needed such as Numbers[i] in another vector. Most is fluff for examples sake, the for/if really says it all.

int main(){
vector<string>names{"Sara", "Harold", "Frank", "Taylor", "Sasha", "Seymore"};
string req_name;
cout<<"Enter search name: "<<'\n';
cin>>req_name;
    for(int i=0; i<=names.size()-1; ++i) {
        if(names[i]==req_name){
            cout<<"The index number for "<<req_name<<" is "<<i<<'\n';
            return 0;
        }
        else if(names[i]!=req_name && i==names.size()-1) {
            cout<<"That name is not an element in this vector"<<'\n';
        } else {
            continue;
        }
    }

What you can do is in your .config for the app is create the resolve object for the route and in the function pass in $q (promise object) and the name of the service you're depending on, and resolve the promise in the callback function for the $http in the service like so:

ROUTE CONFIG

app.config(function($routeProvider){
    $routeProvider
     .when('/',{
          templateUrl: 'home.html',
          controller: 'homeCtrl',
          resolve:function($q,MyService) {
                //create the defer variable and pass it to our service
                var defer = $q.defer();
                MyService.fetchData(defer);
                //this will only return when the promise
                //has been resolved. MyService is going to
                //do that for us
                return defer.promise;
          }
      })
}

Angular won't render the template or make the controller available until defer.resolve() has been called. We can do that in our service:

SERVICE

app.service('MyService',function($http){
       var MyService = {};
       //our service accepts a promise object which 
       //it will resolve on behalf of the calling function
       MyService.fetchData = function(q) {
             $http({method:'GET',url:'data.php'}).success(function(data){
                 MyService.data = data;
                 //when the following is called it will
                 //release the calling function. in this
                 //case it's the resolve function in our
                 //route config
                 q.resolve();
             }
       }

       return MyService;
});

Now that MyService has the data assigned to it's data property, and the promise in the route resolve object has been resolved, our controller for the route kicks into life, and we can assign the data from the service to our controller object.

CONTROLLER

  app.controller('homeCtrl',function($scope,MyService){
       $scope.servicedata = MyService.data;
  });

Now all our binding in the scope of the controller will be able to use the data which originated from MyService.

Try this:

MessageBox.Show("Some text", "Some title", 
    MessageBoxButtons.OK, MessageBoxIcon.Error);

The text color can be changed using,

<span style='color:green'> message/text </span>

Open the workbook as hidden and then set it as "saved" so that users are not prompted when they close out.

Dim w As Workbooks

Private Sub Workbook_Open()
    Application.ScreenUpdating = False
    Set w = Workbooks
    w.Open Filename:="\\server\PriceList.xlsx", UpdateLinks:=False, ReadOnly:=True 'this is the data file were going to be opening
    ActiveWindow.Visible = False
    ThisWorkbook.Activate
    Application.ScreenUpdating = True
End Sub

Private Sub Workbook_BeforeClose(Cancel As Boolean)
    w.Item(2).Saved = True 'this will suppress the safe prompt for the data file only
End Sub

This is somewhat derivative of the answer posted by Ashok.

By doing it this way though you will not get prompted to save changes back to the Excel file your reading from. This is great if the Excel file your reading from is intended as a data source for validation. For example if the workbook contains product names and price data it can be hidden and you can show an Excel file that represents an invoice with drop downs for product that validates from that price list.

You can then store the price list on a shared location on a network somewhere and make it read-only.

It depends on what filesystem, for example /system and /data are yaffs2 while /sdcard is vfat. This is the output of mount:

rootfs / rootfs ro 0 0
tmpfs /dev tmpfs rw,mode=755 0 0
devpts /dev/pts devpts rw,mode=600 0 0
proc /proc proc rw 0 0
sysfs /sys sysfs rw 0 0
tmpfs /sqlite_stmt_journals tmpfs rw,size=4096k 0 0
none /dev/cpuctl cgroup rw,cpu 0 0
/dev/block/mtdblock0 /system yaffs2 ro 0 0
/dev/block/mtdblock1 /data yaffs2 rw,nosuid,nodev 0 0
/dev/block/mtdblock2 /cache yaffs2 rw,nosuid,nodev 0 0
/dev/block//vold/179:0 /sdcard vfat rw,dirsync,nosuid,nodev,noexec,uid=1000,gid=1015,fmask=0702,dmask=0702,allow_utime=0020,codepage=cp437,iocharset=iso8859-1,shortname=mixed,utf8,errors=remount-ro 0 0

and with respect to other filesystems supported, this is the list

nodev   sysfs
nodev   rootfs
nodev   bdev
nodev   proc
nodev   cgroup
nodev   binfmt_misc
nodev   sockfs
nodev   pipefs
nodev   anon_inodefs
nodev   tmpfs
nodev   inotifyfs
nodev   devpts
nodev   ramfs
         vfat
         msdos
nodev   nfsd
nodev   smbfs
         yaffs
         yaffs2
nodev   rpc_pipefs

Make sure you don't have any syntax errors in your Dockerfile as this can cause this error as well. A correct example is:

RUN apt-get update \
    && apt-get -y install curl \
    another-package

It was a combination of fixing a syntax error and adding apt-get update that solved the problem for me.

If your last field is a single character, you could do this:

a="1:2:3:4:5"

echo ${a: -1}
echo ${a:(-1)}

Check string manipulation in bash.

This answer is late, but I'm posting anyway hoping it will help someone. Like you, I also had difficulty submitting a form that was outside my bootstrap modal, and I didn't want to use ajax because I wanted a whole new page to load, not just part of the current page. After much trial and error here's the jQuery that worked for me:

$(function () {
    $('body').on('click', '.odom-submit', function (e) {
        $(this.form).submit();
        $('#myModal').modal('hide');
    });
});

To make this work I did this in the modal footer

<div class="modal-footer">
    <button class="btn" data-dismiss="modal" aria-hidden="true">Close</button>
    <button class="btn btn-primary odom-submit">Save changes</button>
</div>

Notice the addition to class of odom-submit. You can, of course, name it whatever suits your particular situation.

If you don't have Your own Data Class, then you can design your map as follows

Map<Integer, Object> map=new HashMap<Integer, Object>();

Here don't forget to use "instanceof" operator while retrieving the values from MAP.

If you have your own Data class then then you can design your map as follows

Map<Integer, YourClassName> map=new HashMap<Integer, YourClassName>();

import java.util.Date;
import java.util.HashMap;
import java.util.Map;
import java.util.Set;


public class HashMapTest {
public static void main(String[] args) {
    Map<Integer,Demo> map=new HashMap<Integer, Demo>();
    Demo d1= new Demo(1,"hi",new Date(),1,1);
    Demo d2= new Demo(2,"this",new Date(),2,1);
    Demo d3= new Demo(3,"is",new Date(),3,1);
    Demo d4= new Demo(4,"mytest",new Date(),4,1);
    //adding values to map
    map.put(d1.getKey(), d1);
    map.put(d2.getKey(), d2);
    map.put(d3.getKey(), d3);
    map.put(d4.getKey(), d4);
    //retrieving values from map
    Set<Integer> keySet= map.keySet();
    for(int i:keySet){
        System.out.println(map.get(i));
    }
    //searching key on map
    System.out.println(map.containsKey(d1.getKey()));
    //searching value on map
    System.out.println(map.containsValue(d1));
}

}
class Demo{
    private int key;
    private String message;
    private Date time;
    private int count;
    private int version;

    public Demo(int key,String message, Date time, int count, int version){
        this.key=key;
        this.message = message;
        this.time = time;
        this.count = count;
        this.version = version;
    }
    public String getMessage() {
        return message;
    }
    public Date getTime() {
        return time;
    }
    public int getCount() {
        return count;
    }
    public int getVersion() {
        return version;
    }
    public int getKey() {
        return key;
    }
    @Override
    public String toString() {
        return "Demo [message=" + message + ", time=" + time
                + ", count=" + count + ", version=" + version + "]";
    }

}

A colleague told me about this stored procedure...

USE msdb

EXEC dbo.sp_help_job

For route controller method we have to define only one route. In get or post method we have to define the route separately.

And the resources method is used to creates multiple routes to handle a variety of Restful actions.

Here the Laravel documentation about this.

I got this issue trying some old format code in Swift3,

let swipeRight = UISwipeGestureRecognizer(target: self, action: #selector(self.respond))

changing the action:"respond:" to action: #selector(self.respond) fixed the issue for me.

TCP is a connection oriented protocol, It establishes a path, or a virtual connection all the way through switches routers proxies etc and then starts any communication. Various mechanisms like routing djikstras shortest path algorithm exist to establish the virtual end to end connection. So it finds itself used while browsing HTML and other pages, making payments and web applications in general.

UDP is a connectionless protocol - it simply has a destination and nodes simply pass it along if it comes as best as they can. So packets arriving out of order, along various routes etc are common. So Instant messengers and similar software developers think UDP an ideal solution.

In real life if you want to throw data in the net, without worrying about time taken to reach, order of reaching use UDP. If you want a solid path before you start throwing packets, and want same order and latency for your data packets use TCP - I will use UDP for Torrents and TCP for PayPal!

Target sdk is the version you want to target, and min sdk is the minimum one.

In MainActivity

private static android.support.v4.app.FragmentManager fragmentManager;

@Override
protected void onCreate(Bundle savedInstanceState) {
    super.onCreate(savedInstanceState);
    setContentView(R.layout.activity_main);                     

    fragmentManager = getSupportFragmentManager();                                                                 


    }

public void secondFragment() {

    fragmentManager
            .beginTransaction()
            .setCustomAnimations(R.anim.right_enter, R.anim.left_out)
            .replace(R.id.frameContainer, new secondFragment(), "secondFragmentTag").addToBackStack(null)
            .commit();
}

In FirstFragment call SecondFrgment Like this:

new MainActivity().secondFragment();

Use max():

 
Using itemgetter():

In [53]: lis=[(101, 153), (255, 827), (361, 961)]

In [81]: from operator import itemgetter

In [82]: max(lis,key=itemgetter(1))[0]    #faster solution
Out[82]: 361

using lambda:

In [54]: max(lis,key=lambda item:item[1])
Out[54]: (361, 961)

In [55]: max(lis,key=lambda item:item[1])[0]
Out[55]: 361

timeit comparison:

In [30]: %timeit max(lis,key=itemgetter(1))
1000 loops, best of 3: 232 us per loop

In [31]: %timeit max(lis,key=lambda item:item[1])
1000 loops, best of 3: 556 us per loop

Since you're accessing a web.config you should probably use

using System.Web.Configuration;

WebConfigurationManager.AppSettings["configFile"]

var d = new Date();
var month = d.getMonth() + 1;
var day = d.getDate();
var year = d.getYear();
var today = (day<10?'0':'')+ day + '/' +(month<10?'0':'')+ month + '/' + year;
alert(today);

For this to work you have to really, really loosen your security settings (generally NOT recommended)

You will need to add the website to your "Trusted Zone", then go into the custom settings (scroll about 1/2 way down the page) and change:

ActiveX controls and plugins - Enable (or prompt)... any of the settings that apply to your code (I think the very last one is the one you are hitting) -- "script ActiveX controls marked safe for scripting*"

That all said, unless you have a really, really good reason for doing this - you are opening up a major "hole" in your browsers security... step very carefully... and do not expect that other end users will be willing to do the same.

Use .parentsUntil()

$(".d").parentsUntil(".a");

This image presents both orientation(Landscape/Portrait)

To get MaxX and MaxY, read on.

For Android device screen coordinates, below concept will work.

Display mdisp = getWindowManager().getDefaultDisplay();
Point mdispSize = new Point();
mdisp.getSize(mdispSize);
int maxX = mdispSize.x; 
int maxY = mdispSize.y;

EDIT:- ** **for devices supporting android api level older than 13. Can use below code.

    Display mdisp = getWindowManager().getDefaultDisplay();
    int maxX= mdisp.getWidth();
    int maxY= mdisp.getHeight();

(x,y) :-

1) (0,0) is top left corner.

2) (maxX,0) is top right corner

3) (0,maxY) is bottom left corner

4) (maxX,maxY) is bottom right corner

here maxX and maxY are screen maximum height and width in pixels, which we have retrieved in above given code.

If you are looking to execute a background process via PHP, pipe the command's output to /dev/null and add & to the end of the command.

exec("bg_process > /dev/null &");

Note that you can not utilize the $output parameter of exec() or else PHP will hang (probably until the process completes).

we can use document.forms[0].Controlid

Try to check outline on button's focus:

button:focus {
    outline: blue auto 5px; 
}

If you have it, just set it to none.

Here's a workaround for installing the 64-bit version of the Microsoft Access Database Engine 2010 redistributable on a system with a 32-bit MS Office version installed:

• Check the 64-bit registry key "HKEY_LOCAL_MACHINE\SOFTWARE\Microsoft\Office\14.0\Common\FilesPaths" before installing the 64-bit version of the Microsoft Access Database Engine 2010 redistributable.
• If it does not contain the "mso.dll" registry value, then you will need to rename or delete the value after installing the 64-bit version of the Microsoft Access Database Engine 2010 redistributable on a system with a 32-bit version of MS Office installed.
• Use the "/passive" command line parameter to install the redistributable, e.g. "C:\directory path\AccessDatabaseEngine_x64.exe" /passive
• Delete or rename the "mso.dll" registry value, which contains the path to the 64-bit version of MSO.DLL (and should not be used by 32-bit MS Office versions).

Now you can start a 32-bit MS Office application without the "re-configuring" issue. Note that the "mso.dll" registry value will already be present if a 64-bit version of MS Office is installed. In this case the value should not be deleted or renamed.

Also if you do not want to use the "/passive" command line parameter you can edit the AceRedist.msi file to remove the MS Office architecture check:

• download and install Microsoft Orca: http://msdn.microsoft.com/en-us/library/windows/desktop/aa370557(v=vs.85).aspx
• unzip the AccessDatabaseEngine.exe or AccessDatabaseEngine_x64.exe file
• open the AceRedist.msi file in Orca
• search for two table rows containing the "CheckOfficeArchitecture" action and drop these rows
• save the updated AceRedist.msi file

You can now use this file to install the Microsoft Access Database Engine 2010 redistributable on a system where a "conflicting" version of MS Office is installed (e.g. 64-bit version on system with 32-bit MS Office version) Make sure that you rename the "mso.dll" registry value as explained above (if needed).

http://www.viemu.com/a_vi_vim_graphical_cheat_sheet_tutorial.html

This is the greatest thing ever for learning VIM.

The reason to that might be the 2 lines in eclipse.ini

--launcher.library
C:\Users\UserName\.p2\pool\plugins\org.eclipse.equinox.launcher.win32.win32.x86_64_1.1.400.v20160518-1444

for my case the reason was admin privilages so I had to move the folder from the path specified in ini to my eclipse plugins and change path in ini to :

plugins\org.eclipse.equinox.launcher.win32.win32.x86_64_1.1.400.v20160518-1444

There are two options. The first (and better) one is using the Fetch as Google option in Webmaster Tools that Mike Flynn commented about. Here are detailed instructions:

1. Go to: https://www.google.com/webmasters/tools/ and log in
2. If you haven't already, add and verify the site with the "Add a Site" button
3. Click on the site name for the one you want to manage
4. Click Crawl -> Fetch as Google
5. Optional: if you want to do a specific page only, type in the URL
6. Click Fetch
7. Click Submit to Index
8. Select either "URL" or "URL and its direct links"
9. Click OK and you're done.

With the option above, as long as every page can be reached from some link on the initial page or a page that it links to, Google should recrawl the whole thing. If you want to explicitly tell it a list of pages to crawl on the domain, you can follow the directions to submit a sitemap.

Your second (and generally slower) option is, as seanbreeden pointed out, submitting here: http://www.google.com/addurl/

Update 2019:

1. Login to - Google Search Console
2. Add a site and verify it with the available methods.
3. After verification from the console, click on URL Inspection.
4. In the Search bar on top, enter your website URL or custom URLs for inspection and enter.
5. After Inspection, it'll show an option to Request Indexing
6. Click on it and GoogleBot will add your website in a Queue for crawling.

Some permissions issue for default sample.

I wanted to see how it works, I am creating the first extension, so I downloaded a simpler one.

Downloaded 'Typed URL History' sample from
https://developer.chrome.com/extensions/examples/api/history/showHistory.zip

which can be found at
https://developer.chrome.com/extensions/samples

this worked great, hope it helps

Some time ago I used JAD (JAva Decompiler) to achieve this - I do not think IntelliJ's decompiler was incorporated with exporting in mind. It is more of a tool to help look through classes where sources are not available.

JAD is still available for download, but I do not think anyone maintains it anymore: http://varaneckas.com/jad/

There were numerous plugins for it, namely Jadclipse (you guessed it, a way to use JAD in Eclipse - see decompiled classes where code is not available :)).

There is a bundled collection of Vim plugins for Python development: http://www.vim.org/scripts/script.php?script_id=3770

You could use AJAX to call this controller action. For example if you are using jQuery you might use the $.ajax() method:

<script type="text/javascript">
    $.ajax({
        url: '@Url.Action("NameOfYourAction")',
        type: 'GET',
        cache: false,
        success: function(result) {
            // you could use the result.values dictionary here
        }
    });
</script>

As an update to The Minister's answer, you can now do this with es2015:

function Tuple(...args) {
  args.forEach((val, idx) => 
    Object.defineProperty(this, "item"+idx, { get: () => val })
  )
}


var t = new Tuple("a", 123)
console.log(t.item0) // "a"
t.item0 = "b"
console.log(t.item0) // "a"

https://jsbin.com/fubaluwimo/edit?js,console

I suggest to use Google Guava Throwables class

propagate(Throwable throwable)

Propagates throwable as-is if it is an instance of RuntimeException or Error, or else as a last resort, wraps it in a RuntimeException and then propagates.**

void bar() {
    Stream<A> as = ...
    as.forEach(a -> {
        try {
            a.foo()
        } catch(Exception e) {
            throw Throwables.propagate(e);
        }
    });
}

UPDATE:

Now that it is deprecated use:

void bar() {
    Stream<A> as = ...
    as.forEach(a -> {
        try {
            a.foo()
        } catch(Exception e) {
            Throwables.throwIfUnchecked(e);
            throw new RuntimeException(e);
        }
    });
}

You really just need a single struct, and as mentioned in the comments the correct annotations on the field will yield the desired results. JSON is not some extremely variant data format, it is well defined and any piece of json, no matter how complicated and confusing it might be to you can be represented fairly easily and with 100% accuracy both by a schema and in objects in Go and most other OO programming languages. Here's an example;

package main

import (
    "fmt"
    "encoding/json"
)

type Data struct {
    Votes *Votes `json:"votes"`
    Count string `json:"count,omitempty"`
}

type Votes struct {
    OptionA string `json:"option_A"`
}

func main() {
    s := `{ "votes": { "option_A": "3" } }`
    data := &Data{
        Votes: &Votes{},
    }
    err := json.Unmarshal([]byte(s), data)
    fmt.Println(err)
    fmt.Println(data.Votes)
    s2, _ := json.Marshal(data)
    fmt.Println(string(s2))
    data.Count = "2"
    s3, _ := json.Marshal(data)
    fmt.Println(string(s3))
}

https://play.golang.org/p/ScuxESTW5i

Based on your most recent comment you could address that by using an interface{} to represent data besides the count, making the count a string and having the rest of the blob shoved into the interface{} which will accept essentially anything. That being said, Go is a statically typed language with a fairly strict type system and to reiterate, your comments stating 'it can be anything' are not true. JSON cannot be anything. For any piece of JSON there is schema and a single schema can define many many variations of JSON. I advise you take the time to understand the structure of your data rather than hacking something together under the notion that it cannot be defined when it absolutely can and is probably quite easy for someone who knows what they're doing.

Found the best way to do it for a server which does not support pkill

kill -9 $(ps ax | grep My_pattern| fgrep -v grep | awk '{ print $1 }')

You do not have to loop.

How about simply:

select distinct c1, c2 from t

or

select c1, c2, count(*)
from t
group by c1, c2

I don't know why

cfg_name_unique NOT LIKE '%categories%' 

still returns those two values, but maybe exclude them explicit:

SELECT *
    FROM developer_configurations_cms

    WHERE developer_configurations_cms.cat_id = '1'
    AND developer_configurations_cms.cfg_variables LIKE '%parent_id=2%'
    AND developer_configurations_cms.cfg_name_unique NOT LIKE '%categories%'
    AND developer_configurations_cms.cfg_name_unique NOT IN ('categories_posts', 'categories_news')

First of all, when you put that code in applicationDidFinishLaunching, it might be the case that controllers instantiated from Interface Builder are not yet linked to your application (so "red" and "blue" are still nil).

But to answer your initial question, what you're doing wrong is that you're calling dismissModalViewControllerAnimated: on the wrong controller! It should be like this:

[blue presentModalViewController:red animated:YES];
[red dismissModalViewControllerAnimated:YES];

Usually the "red" controller should decide to dismiss himself at some point (maybe when a "cancel" button is clicked). Then the "red" controller could call the method on self:

[self dismissModalViewControllerAnimated:YES];

If it still doesn't work, it might have something to do with the fact that the controller is presented in an animation fashion, so you might not be allowed to dismiss the controller so soon after presenting it.

You have to roll your own.
You start with a total of 0. Then you consider for every integer in the array, add it to a total. Then when you're out of integers, you have the sum.

If there were no integers, then the total is 0.

It's much cleaner to use CSS. Try padding-left:5em or margin-left:5em as appropriate instead.

Unfortunately, np.polynomial.polynomial.polyfit returns the coefficients in the opposite order of that for np.polyfit and np.polyval (or, as you used np.poly1d). To illustrate:

In [40]: np.polynomial.polynomial.polyfit(x, y, 4)
Out[40]: 
array([  84.29340848, -100.53595376,   44.83281408,   -8.85931101,
          0.65459882])

In [41]: np.polyfit(x, y, 4)
Out[41]: 
array([   0.65459882,   -8.859311  ,   44.83281407, -100.53595375,
         84.29340846])

In general: np.polynomial.polynomial.polyfit returns coefficients [A, B, C] to A + Bx + Cx^2 + ..., while np.polyfit returns: ... + Ax^2 + Bx + C.

So if you want to use this combination of functions, you must reverse the order of coefficients, as in:

ffit = np.polyval(coefs[::-1], x_new)

However, the documentation states clearly to avoid np.polyfit, np.polyval, and np.poly1d, and instead to use only the new(er) package.

You're safest to use only the polynomial package:

import numpy.polynomial.polynomial as poly

coefs = poly.polyfit(x, y, 4)
ffit = poly.polyval(x_new, coefs)
plt.plot(x_new, ffit)

Or, to create the polynomial function:

ffit = poly.Polynomial(coefs)    # instead of np.poly1d
plt.plot(x_new, ffit(x_new))

Combine the SUBSTRING(), LEFT(), and CHARINDEX() functions.

SELECT LEFT(SUBSTRING(YOUR_FIELD,
                      CHARINDEX(';', YOUR_FIELD) + 1, 100),
                      CHARINDEX('[', YOUR_FIELD) - 1)
FROM YOUR_TABLE;

This assumes your field length will never exceed 100, but you can make it smarter to account for that if necessary by employing the LEN() function. I didn't bother since there's enough going on in there already, and I don't have an instance to test against, so I'm just eyeballing my parentheses, etc.

Using class members for default values of instance variables is not a good idea, and it's the first time I've seen this idea mentioned at all. It works in your example, but it may fail in a lot of cases. E.g., if the value is mutable, mutating it on an unmodified instance will alter the default:

>>> class c:
...     l = []
... 
>>> x = c()
>>> y = c()
>>> x.l
[]
>>> y.l
[]
>>> x.l.append(10)
>>> y.l
[10]
>>> c.l
[10]

It seems that the shortest way is to combine LINQ and string.Concat:

var input = @"My name @is ,Wan.;'; Wan";
var chrs = new[] {'@', ',', '.', ';', '\''};
var result = string.Concat(input.Where(c => !chrs.Contains(c)));
// => result = "My name is Wan Wan" 

See the C# demo. Note that string.Concat is a shortcut to string.Join("", ...).

Note that using a regex to remove individual known chars is still possible to build dynamically, although it is believed that regex is slower. However, here is a way to build such a dynamic regex (where all you need is a character class):

var pattern = $"[{Regex.Escape(new string(chrs))}]+";
var result = Regex.Replace(input, pattern, string.Empty);

See another C# demo. The regex will look like [@,\.;']+ (matching one or more (+) consecutive occurrences of @, ,, ., ; or ' chars) where the dot does not have to be escaped, but Regex.Escape will be necessary to escape other chars that must be escaped, like \, ^, ] or - whose position inside the character class you cannot predict.

As of version 0.8.9, Android Studio supports the Maven Central Repository by default. So to add an external maven dependency all you need to do is edit the module's build.gradle file and insert a line into the dependencies section like this:

dependencies {

    // Remote binary dependency
    compile 'net.schmizz:sshj:0.10.0'

}

You will see a message appear like 'Sync now...' - click it and wait for the maven repo to be downloaded along with all of its dependencies. There will be some messages in the status bar at the bottom telling you what's happening regarding the download. After it finishes this, the imported JAR file along with its dependencies will be listed in the External Repositories tree in the Project Browser window, as shown below.

Some further explanations here: http://developer.android.com/sdk/installing/studio-build.html

Well you have to grab the client for that (surprise), you can either go the simple way:

var io = io.listen(server);
io.clients[sessionID].send()

Which may break, I doubt it, but it's always a possibility that io.clients might get changed, so use the above with caution

Or you keep track of the clients yourself, therefore you add them to your own clients object in the connection listener and remove them in the disconnect listener.

I would use the latter one, since depending on your application you might want to have more state on the clients anyway, so something like clients[id] = {conn: clientConnect, data: {...}} might do the job.

UPDATED FOR 2020

It seems in Septeber 2019, YouTube updated the values that are returned by get_video_info.

Rather than data.url_encoded_fmt_stream_map and data.adaptive_fmts (as used in the other older examples) now we are looking for for data.formats and data.adaptiveFormats.

Anyways here is what you are all here for some code that loads a YouTube video into an <audio> element. Try it on CodePen

// YouTube video ID
var videoID = "CMNry4PE93Y";

// Fetch video info (using a proxy to avoid CORS errors)
fetch('https://cors-anywhere.herokuapp.com/' + "https://www.youtube.com/get_video_info?video_id=" + videoID).then(response => {
  if (response.ok) {
    response.text().then(ytData => {
      
      // parse response to find audio info
      var ytData = parse_str(ytData);
      var getAdaptiveFormats = JSON.parse(ytData.player_response).streamingData.adaptiveFormats;
      var findAudioInfo = getAdaptiveFormats.findIndex(obj => obj.audioQuality);
      
      // get the URL for the audio file
      var audioURL = getAdaptiveFormats[findAudioInfo].url;
      
      // update the <audio> element src
      var youtubeAudio = document.getElementById('youtube');
      youtubeAudio.src = audioURL;
      
    });
  }
});

function parse_str(str) {
  return str.split('&').reduce(function(params, param) {
    var paramSplit = param.split('=').map(function(value) {
      return decodeURIComponent(value.replace('+', ' '));
    });
    params[paramSplit[0]] = paramSplit[1];
    return params;
  }, {});
}

<audio id="youtube" controls></audio>

This is the only install that resolved the issue for me.

SQL 2008 r2 w/ office 2010 64bit: "2007 Office System Driver: Data Connectivity Components"

I've done it like this:

var input = document.querySelector('input[type="file"]')

var data = new FormData()
data.append('file', input.files[0])
data.append('user', 'hubot')

fetch('/avatars', {
  method: 'POST',
  body: data
})

Use:

import color

class Color(color.Color):
    ...

If this were Python 2.x, you would also want to derive color.Color from object, to make it a new-style class:

class Color(object):
    ...

This is not necessary in Python 3.x.

The solution is the binding of variables through closure.

As a more basic example, here is an example function that receives and calls a callback function, as well as an example callback function:

function callbackReceiver(callback) {
    callback("Hello World");
}

function callback(value1, value2) {
    console.log(value1, value2);
}

This calls the callback and supplies a single argument. Now you want to supply an additional argument, so you wrap the callback in closure.

callbackReceiver(callback);     // "Hello World", undefined
callbackReceiver(function(value) {
    callback(value, "Foo Bar"); // "Hello World", "Foo Bar"
});

Or, more simply using ES6 Arrow Functions:

callbackReceiver(value => callback(value, "Foo Bar")); // "Hello World", "Foo Bar"

As for your specific example, I haven't used the .post function in jQuery, but a quick scan of the documentation suggests the call back should be a function pointer with the following signature:

function callBack(data, textStatus, jqXHR) {};

Therefore I think the solution is as follows:

var doSomething = function(extraStuff) {
    return function(data, textStatus, jqXHR) {
        // do something with extraStuff
    };
};

var clicked = function() {
    var extraStuff = {
        myParam1: 'foo',
        myParam2: 'bar'
    }; // an object / whatever extra params you wish to pass.

    $.post("someurl.php", someData, doSomething(extraStuff), "json");
};

What is happening?

In the last line, doSomething(extraStuff) is invoked and the result of that invocation is a function pointer.

Because extraStuff is passed as an argument to doSomething it is within scope of the doSomething function.

When extraStuff is referenced in the returned anonymous inner function of doSomething it is bound by closure to the outer function's extraStuff argument. This is true even after doSomething has returned.

I haven't tested the above, but I've written very similar code in the last 24 hours and it works as I've described.

You can of course pass multiple variables instead of a single 'extraStuff' object depending on your personal preference/coding standards.

dt.Columns[0].DataType.Name.ToString()

I think this may answer your question.

Non-static method ..... should not be called statically

If the method is not static you need to initialize it like so:

$var = new ClassName();
$var->method();

Or, in PHP 5.4+, you can use this syntax:

(new ClassName)->method();

In VS 2010 just make the browser as your default broswer in which you want to run your application and there is no need to set anything in visual studio. I did it for google chrome and its working for me. I just made google chrome as my default browser and its working fine. I am almost sure that this should work in VS 2008 also.

This error means Java is not properly installed .

1) brew cask install java (No need to install cask separately it comes with brew)

2) java -version

java version "1.8.0_131"
Java(TM) SE Runtime Environment (build 1.8.0_131-b11)

P.S - What is brew-cask ? Homebrew-Cask extends Homebrew , and solves the hassle of executing an extra command - “To install, drag this icon…” after installing a Application using Homebrew.

N.B - This problem is not specific to Mavericks , you will get it almost all the OS X, including EL Capitan.

Pure css way to make a table fully responsive, no JavaScript is needed. Checke demo here Responsive Tables

<!DOCTYPE>
  <html>
  <head>
  <title>Responsive Table</title>
  <style> 
  /* only for demo purpose. you can remove it */
 .container{border: 1px solid #ccc; background-color: #ff0000; 
  margin: 10px auto;width: 98%; height:auto;padding:5px; text-align: center;}

 /* required */
.tablewrapper{width: 95%; overflow-y: hidden; overflow-x: auto; 
 background-color:green;  height: auto; padding: 5px;}

 /* only for demo purpose just for stlying. you can remove it */
 table { font-family: arial; font-size: 13px; padding: 2px 3px}
 table.responsive{ background-color:#1a99e6; border-collapse: collapse; 
 border-color: #fff}

tr:nth-child(1) td:nth-of-type(1){
 background:#333; color: #fff}
 tr:nth-child(1) td{
 background:#333; color: #fff; font-weight: bold;}
 table tr td:nth-child(2) {
 background:yellow;
}
 tr:nth-child(1) td:nth-of-type(2){color: #333}
 tr:nth-child(odd){ background:#ccc;}
 tr:nth-child(even){background:#fff;}
</style>
</head>
<body>

<div class="container">
<div class="tablewrapper">
<table  class="responsive" width="98%" cellpadding="4" cellspacing="1" border="1">
 <tr> 
 <td>Name</td> 
 <td>Email</td> 
 <td>Phone</td> 
 <td>Address</td> 
 <td>Contact</td> 
 <td>Mobile</td> 
 <td>Office</td> 
 <td>Home</td> 
 <td>Residency</td> 
 <td>Height</td>
 <td>Weight</td>
 <td>Color</td> 
 <td>Desease</td> 
 <td>Extra</td>
 <td>DOB</td>
 <td>Nick Name</td> 
</tr>
<tr>  
<td>RN Kushwaha</td>
<td>[email protected]</td>
<td>--</td>  
<td>Varanasi</td>
<td>-</td> 
<td>999999999</td> 
<td>022-111111</td> 
<td>-</td>
<td>India</td> 
<td>165cm</td> 
<td>58kg</td> 
<td>bright</td> 
<td>--</td> 
<td>--</td> 
<td>03/07/1986</td> 
<td>Aryan</td> 
</tr>
</table>
</div>
</div>
</body>
</html>

If I let raw_input like that, no Josh or anything else. It's a variable,I think,but I don't understand her roll :-(

The raw_input function prompts you for input and returns that as a string. This certainly worked for me. You don't need idle. Just open a "DOS prompt" and run the program.

This is what it looked like for me:

C:\temp>type test.py
print "Halt!"
s = raw_input("Who Goes there? ")
print "You may pass,", s

C:\temp>python test.py
Halt!
Who Goes there? Magnus
You may pass, Magnus

I types my name and pressed [Enter] after the program had printed "Who Goes there?"

Try the file command with -i option.

-i option Causes the file command to output mime type strings rather than the more traditional human readable ones. Thus it may say text/plain; charset=us-ascii rather than ASCII text.

TLDR;

$ docker run --rm -iv${PWD}:/host-volume my-image sh -s <<EOF
chown $(id -u):$(id -g) my-artifact.tar.xz
cp -a my-artifact.tar.xz /host-volume
EOF

Description

docker run with a host volume, chown the artifact, cp the artifact to the host volume:

$ docker build -t my-image - <<EOF
> FROM busybox
> WORKDIR /workdir
> RUN touch foo.txt bar.txt qux.txt
> EOF
Sending build context to Docker daemon  2.048kB
Step 1/3 : FROM busybox
 ---> 00f017a8c2a6
Step 2/3 : WORKDIR /workdir
 ---> Using cache
 ---> 36151d97f2c9
Step 3/3 : RUN touch foo.txt bar.txt qux.txt
 ---> Running in a657ed4f5cab
 ---> 4dd197569e44
Removing intermediate container a657ed4f5cab
Successfully built 4dd197569e44

$ docker run --rm -iv${PWD}:/host-volume my-image sh -s <<EOF
chown -v $(id -u):$(id -g) *.txt
cp -va *.txt /host-volume
EOF
changed ownership of '/host-volume/bar.txt' to 10335:11111
changed ownership of '/host-volume/qux.txt' to 10335:11111
changed ownership of '/host-volume/foo.txt' to 10335:11111
'bar.txt' -> '/host-volume/bar.txt'
'foo.txt' -> '/host-volume/foo.txt'
'qux.txt' -> '/host-volume/qux.txt'

$ ls -n
total 0
-rw-r--r-- 1 10335 11111 0 May  7 18:22 bar.txt
-rw-r--r-- 1 10335 11111 0 May  7 18:22 foo.txt
-rw-r--r-- 1 10335 11111 0 May  7 18:22 qux.txt

This trick works because the chown invocation within the heredoc the takes $(id -u):$(id -g) values from outside the running container; i.e., the docker host.

The benefits are:

• you don't have to docker container run --name or docker container create --name before
• you don't have to docker container rm after

GUID has longstanding usage in areas where it isn't necessarily a 128-bit value in the same way as a UUID. For example, the RSS specification defines GUIDs to be any string of your choosing, as long as it's unique, with an "isPermalink" attribute to specify that the value you're using is just a permalink back to the item being syndicated.

import operator

To sort the list of dictionaries by key='name':

list_of_dicts.sort(key=operator.itemgetter('name'))

To sort the list of dictionaries by key='age':

list_of_dicts.sort(key=operator.itemgetter('age'))

Amplifying on baz's answer, if you need to enumerate the argument list with an index (such as to search for a specific word), you can do this without copying the list or mutating it.

Say you want to split an argument list at a double-dash ("--") and pass the arguments before the dashes to one command, and the arguments after the dashes to another:

 toolwrapper() {
   for i in $(seq 1 $#); do
     [[ "${!i}" == "--" ]] && break
   done || return $? # returns error status if we don't "break"

   echo "dashes at $i"
   echo "Before dashes: ${@:1:i-1}"
   echo "After dashes: ${@:i+1:$#}"
 }

Results should look like this:

 $ toolwrapper args for first tool -- and these are for the second
 dashes at 5
 Before dashes: args for first tool
 After dashes: and these are for the second

This is my solution without using any library or native javascript function.

function deepClone(obj) {
  if (typeof obj !== "object") {
    return obj;
  } else {
    let newObj =
      typeof obj === "object" && obj.length !== undefined ? [] : {};
    for (let key in obj) {
      if (key) {
        newObj[key] = deepClone(obj[key]);
      }
    }
    return newObj;
  }
}

As described here: Angular NgModelController, you should provide the <input with the required controller ngModel

<input submit-required="true" ng-model="user.Name"></input>

Problem statement

Problem occurs when we want to import CommonJS module into ES6 module codebase.

Before these flags we had to import CommonJS modules with star (* as something) import:

// node_modules/moment/index.js
exports = moment

// index.ts file in our app
import * as moment from 'moment'
moment(); // not compliant with es6 module spec

// transpiled js (simplified):
const moment = require("moment");
moment();

We can see that * was somehow equivalent to exports variable. It worked fine, but it wasn't compliant with es6 modules spec. In spec, the namespace record in star import (moment in our case) can be only a plain object, not callable (moment() is not allowed).

Solution

With flag esModuleInterop we can import CommonJS modules in compliance with es6 modules spec. Now our import code looks like this:

// index.ts file in our app
import moment from 'moment'
moment(); // compliant with es6 module spec

// transpiled js with esModuleInterop (simplified):
const moment = __importDefault(require('moment'));
moment.default();

It works and it's perfectly valid with es6 modules spec, because moment is not namespace from star import, it's default import.

But how does it work? As you can see, because we did a default import, we called the default property on a moment object. But we didn't declare a default property on the exports object in the moment library. The key is the __importDefault function. It assigns module (exports) to the default property for CommonJS modules:

var __importDefault = (this && this.__importDefault) || function (mod) {
    return (mod && mod.__esModule) ? mod : { "default": mod };
};

As you can see, we import es6 modules as they are, but CommonJS modules are wrapped into an object with the default key. This makes it possible to import defaults on CommonJS modules.

__importStar does the similar job - it returns untouched esModules, but translates CommonJS modules into modules with a default property:

// index.ts file in our app
import * as moment from 'moment'

// transpiled js with esModuleInterop (simplified):
const moment = __importStar(require("moment"));
// note that "moment" is now uncallable - ts will report error!

var __importStar = (this && this.__importStar) || function (mod) {
    if (mod && mod.__esModule) return mod;
    var result = {};
    if (mod != null) for (var k in mod) if (Object.hasOwnProperty.call(mod, k)) result[k] = mod[k];
    result["default"] = mod;
    return result;
};

Synthetic imports

And what about allowSyntheticDefaultImports - what is it for? Now the docs should be clear:

Allow default imports from modules with no default export. This does not affect code emit, just typechecking.

In moment typings we don't have specified default export, and we shouldn't have, because it's available only with flag esModuleInterop on. So allowSyntheticDefaultImports will not report an error if we want to import default from a third-party module which doesn't have a default export.

I tried the solutions mentioned above and none of them worked for me. I used JSON.parse and it worked:

$http.get('/api/getAdPolling')
  .success(function (data) {
    console.log('success: ' + data.length);

    if (JSON.stringify(data) != "not found") {
        $scope.adPoll = JSON.parse(data);
    }
})
  .error(function (data) {
    console.log('Error: ' + data);
});

I use something like this:

if schema_id('newSchema') is null
    exec('create schema newSchema');

The advantage is if you have this code in a long sql-script you can always execute it with the other code, and its short.

Alternatively, in python 3.6+, you can generate Unicode superscript and copy paste that in your code:

ax1.set_ylabel('Rate (min?¹)')

Instead of getViewById(), use

MenuItem item = getToolbar().getMenu().findItem(Menu.FIRST);

replacing the Menu.FIRST with your menu item id.

if your input's id is following

<input type='text'  id='kg_row1' >

then you can get explode/split the above with the following function of split in jquery

  var kg_id = $(this).attr("id");
  var getvalues =kg_id.split("_");
  var id = getvalues[1];

The complete recipe here for quicker reference (note that all the steps are mandatory):

1) when instantiating Twig, pass the debug option

$twig = new Twig_Environment(
$loader, ['debug'=>true, 'cache'=>false, /*other options */]
);

2) add the debug extension

$twig->addExtension(new \Twig_Extension_Debug());

3) Use it like @Hazarapet Tunanyan pointed out

{{ dump(MyVar) }}

or

{{ dump() }}

or

{{ dump(MyObject.MyPropertyName) }}

Found it just by poking around in /var/db. Thanks for the help though--I am sure these answers apply to other systems (e.g. Ubuntu) and will help others!

1) react-router > V5 useHistory hook:

If you have React >= 16.8 and functional components you can use the useHistory hook from react-router.

import React from 'react';
import { useHistory } from 'react-router-dom';

const YourComponent = () => {
    const history = useHistory();

    const handleClick = () => {
        history.push("/path/to/push");
    }

    return (
        <div>
            <button onClick={handleClick} type="button" />
        </div>
    );
}

export default YourComponent;

2) react-router > V4 withRouter HOC:

As @ambar mentioned in the comments, React-router has changed their code base since their V4. Here are the documentations - official, withRouter

import React, { Component } from 'react';
import { withRouter } from "react-router-dom";

class YourComponent extends Component {
    handleClick = () => {
        this.props.history.push("path/to/push");
    }

    render() {
        return (
            <div>
                <button onClick={this.handleClick} type="button">
            </div>
        );
    };
}

export default withRouter(YourComponent);

3) React-router < V4 with browserHistory

You can achieve this functionality using react-router BrowserHistory. Code below:

import React, { Component } from 'react';
import { browserHistory } from 'react-router';

export default class YourComponent extends Component {
    handleClick = () => {
        browserHistory.push('/login');
    };

    render() {
        return (
            <div>
                <button onClick={this.handleClick} type="button">
            </div>
        );
    };
}

4) Redux connected-react-router

If you have connected your component with redux, and have configured connected-react-router all you have to do is this.props.history.push("/new/url"); ie, you don't need withRouter HOC to inject history to the component props.

// reducers.js
import { combineReducers } from 'redux';
import { connectRouter } from 'connected-react-router';

export default (history) => combineReducers({
    router: connectRouter(history),
    ... // rest of your reducers
});


// configureStore.js
import { createBrowserHistory } from 'history';
import { applyMiddleware, compose, createStore } from 'redux';
import { routerMiddleware } from 'connected-react-router';
import createRootReducer from './reducers';
...
export const history = createBrowserHistory();

export default function configureStore(preloadedState) {
    const store = createStore(
        createRootReducer(history), // root reducer with router state
        preloadedState,
        compose(
            applyMiddleware(
                routerMiddleware(history), // for dispatching history actions
                // ... other middlewares ...
            ),
        ),
    );

    return store;
}


// set up other redux requirements like for eg. in index.js
import { Provider } from 'react-redux';
import { Route, Switch } from 'react-router';
import { ConnectedRouter } from 'connected-react-router';
import configureStore, { history } from './configureStore';
...
const store = configureStore(/* provide initial state if any */)

ReactDOM.render(
    <Provider store={store}>
        <ConnectedRouter history={history}>
            <> { /* your usual react-router v4/v5 routing */ }
                <Switch>
                    <Route exact path="/yourPath" component={YourComponent} />
                </Switch>
            </>
        </ConnectedRouter>
    </Provider>,
    document.getElementById('root')
);


// YourComponent.js
import React, { Component } from 'react';
import { connect } from 'react-redux';
...

class YourComponent extends Component {
    handleClick = () => {
        this.props.history.push("path/to/push");
    }

    render() {
        return (
          <div>
            <button onClick={this.handleClick} type="button">
          </div>
        );
      }
    };

}

export default connect(mapStateToProps = {}, mapDispatchToProps = {})(YourComponent);

If you are planning to hide show some span based on click event which is initially hidden with style="display:none" then .toggle() is best option to go with.

$("span").toggle();

Reasons : Each time you don't need to check whether the style is already there or not. .toggle() will take care of that automatically and hide/show span based on current state.

<script src="https://ajax.googleapis.com/ajax/libs/jquery/2.1.1/jquery.min.js"></script>_x000D_
<input type="button" value="Toggle" onclick="$('#hiddenSpan').toggle();"/>_x000D_
<br/>_x000D_
<br/>_x000D_
<span id="hiddenSpan" style="display:none">Just toggle me</span>

Use a LinkedHashMap and when you need to retrieve by position, convert the values into an ArrayList.

LinkedHashMap<String,String> linkedHashMap = new LinkedHashMap<String,String>();
/* Populate */
linkedHashMap.put("key0","value0");
linkedHashMap.put("key1","value1");
linkedHashMap.put("key2","value2");
/* Get by position */
int pos = 1;
String value = (new ArrayList<String>(linkedHashMap.values())).get(pos);

Use ClipboardManager#setPrimaryClip method:

import android.content.ClipboardManager;

// ...

ClipboardManager clipboard = (ClipboardManager) getSystemService(CLIPBOARD_SERVICE); 
ClipData clip = ClipData.newPlainText("label", "Text to copy");
clipboard.setPrimaryClip(clip);

ClipboardManager API reference

    IF CHARINDEX('TextToSearch',@TextWhereISearch, 0) > 0 => TEXT EXISTS

    IF PATINDEX('TextToSearch', @TextWhereISearch) > 0 => TEXT EXISTS

    Additionally we can also use LIKE but I usually don't use LIKE.

I'm a bit surprised nobody suggested creating a pipe, which is in my opinion the far simplest way to pass a string to stdin of a subprocess:

read, write = os.pipe()
os.write(write, "stdin input here")
os.close(write)

subprocess.check_call(['your-command'], stdin=read)

You are mixing the deprecated mysql extension with mysqli.

Try something like:

$sql = mysqli_query($success, "SELECT * FROM login WHERE username = '".$_POST['username']."' and password = '".md5($_POST['password'])."'");
$row = mysqli_num_rows($sql);

Console.OutputEncoding Property

https://docs.microsoft.com/en-us/dotnet/api/system.console.outputencoding

Note that successfully displaying Unicode characters to the console requires the following:

• The console must use a TrueType font, such as Lucida Console or Consolas, to display characters.

I ran into a problem where the typical position: fixed and bottom: 0 didn't work. Discovered a neat functionality with position: sticky. Note it's "relatively" new so it won't with IE/Edge 15 and earlier.

Here's an example for w3schools.

<!DOCTYPE html>
<html>
<head>
<style>
div.sticky {
  position: sticky;
  bottom: 0;
  background-color: yellow;
  padding: 30px;
  font-size: 20px;
}
</style>
</head>
<body>

<p>Lorem ipsum dolor nteger frinegestas odio, vitae scelerisque enim ligula venenatis dolor. Maecenas nisl est,  dolor nteger frinegestas odio, vitae scelerisque enim ligula venenatis dolor. Maecenas  dolor nteger frinegestas odio, vitae scelerisque enim ligula venenatis dolor. Maecenas  dolor nteger frinegestas odio, vitae scelerisque enim ligula venenatis dolor. Maecenas  dolor nteger frinegestas odio, vitae scelerisque enim ligula venenatis dolor. Maecenas  dolor nteger frinegestas odio, vitae scelerisque enim ligula venenatis dolor. Maecenas  dolor nteger frinegestas odio, vitae scelerisque enim ligula venenatis dolor. Maecenas  dolor nteger frinegestas odio, vitae scelerisque enim ligula venenatis dolor. Maecenas  dolor nteger frinegestas odio, vitae scelerisque enim ligula venenatis dolor. Maecenas  dlerisque enim ligula venenatis dolor. Maecenas  dolor nteger frinegestas odio, vitae scelerisque enim ligula venenatis dolor. Maecenas  dolor nteger frinegestas odio, vitae scelerisque enim ligula venenatis dolor. Maecenas  dolor nteger frinegestas odio, vitae scelerisque enim ligula venenatis dolor. Maecenas  dolor nteger frinegestas odio, vitae scelerisque enim ligula venenatis dolor. Maecenas  dolor nteger frinegestas odio, vitae scelerisque enim ligula venenatis dolor. Maecenas  dlerisque enim ligula venenatis dolor. Maecenas  dolor nteger frinegestas odio, vitae scelerisque enim ligula venenatis dolor. Maecenas  dolor nteger frinegestas odio, vitae scelerisque enim ligula venenatis dolor. Maecenas  dolor nteger frinegestas odio, vitae scelerisque enim ligula venenatis dolor. Maecenas  dolor nteger frinegestas odio, vitae scelerisque enim ligula venenatis dolor. Maecenas  dolor nteger frinegestas odio, vitae scelerisque enim ligula venenatis dolor. Maecenas  dlerisque enim ligula venenatis dolor. Maecenas  dolor nteger frinegestas odio, vitae scelerisque enim ligula venenatis dolor. Maecenas  dolor nteger frinegestas odio, vitae scelerisque enim ligula venenatis dolor. Maecenas  dolor nteger frinegestas odio, vitae scelerisque enim ligula venenatis dolor. Maecenas  dolor nteger frinegestas odio, vitae scelerisque enim ligula venenatis dolor. Maecenas  dolor nteger frinegestas odio, vitae scelerisque enim ligula venenatis dolor. Maecenas  dlerisque enim ligula venenatis dolor. Maecenas  dolor nteger frinegestas odio, vitae scelerisque enim ligula venenatis dolor. Maecenas  dolor nteger frinegestas odio, vitae scelerisque enim ligula venenatis dolor. Maecenas  dolor nteger frinegestas odio, vitae scelerisque enim ligula venenatis dolor. Maecenas  dolor nteger frinegestas odio, vitae scelerisque enim ligula venenatis dolor. Maecenas  dolor nteger frinegestas odio, vitae scelerisque enim ligula venenatis dolor. Maecenas  dolor nteger frinegestas odio, vitae scelerisque enim ligula venenatis dolor. Maecenas  dolor nteger frinegestas odio, vitae scelerisque enim ligula venenatis dolor. Maecenas  dolor nteger frinegestas odio, vitae scelerisque enim ligula venenatis dolor. Maecenas  dolor nteger frinegestas odio, vitae scelerisque enim ligula venenatis dolor. Maecenas </p>

<div class="sticky">I will stick to the screen when you reach my scroll position</div>

</body>
</html>

Actually, I solved the problem. I run it by eclipse jetty plugin.

1. I didn't have the JDK lib in my eclipse, that's why the message keep showing that I need the full JDK installed, that's the main reason.

2. I installed two versions of jetty plugin, wich is jetty7 and jetty8. I think they conflict with each other or something, so I removed the jetty7, and it works!

Concatenating strings in awk can be accomplished by the print command AWK manual page, and you can do complicated combination. Here I was trying to change the 16 char to A and used string concatenation:

echo    CTCTCTGAAATCACTGAGCAGGAGAAAGATT | awk -v w=15 -v BA=A '{OFS=""; print substr($0, 1, w), BA, substr($0,w+2)}'
Output: CTCTCTGAAATCACTAAGCAGGAGAAAGATT

I used the substr function to extract a portion of the input (STDIN). I passed some external parameters (here I am using hard-coded values) that are usually shell variable. In the context of shell programming, you can write -v w=$width -v BA=$my_charval. The key is the OFS which stands for Output Field Separate in awk. Print function take a list of values and write them to the STDOUT and glue them with the OFS. This is analogous to the perl join function.

It looks that in awk, string can be concatenated by printing variable next to each other:

echo xxx | awk -v a="aaa" -v b="bbb" '{ print a b $1 "string literal"}'
# will produce: aaabbbxxxstring literal

I’m using the PyCharm IDE. I could get Pygame to work with IDLE but not with PyCharm. This video helped me install Pygame through PyCharm.

https://youtu.be/HJ9bTO5yYw0

(It seems that PyCharm only recognizes a package; if you use its GUI.)

However, there were a few slight differences for me; because I’m using Windows instead of a Mac.

My “preferences” menu is found in: File->Settings…

Then, in the next screen, I expanded my project menu, and clicked Project Interpreter. Then I clicked the green plus icon to the right to get to the Available Packages screen.

There is Array.filter():

var numbers = [1, 2, 3, 4, 5];
var filtered = numbers.filter(function(x) { return x > 3; });

// As a JavaScript 1.8 expression closure
filtered = numbers.filter(function(x) x > 3);

Note that Array.filter() is not standard ECMAScript, and it does not appear in ECMAScript specs older than ES5 (thanks Yi Jiang and jAndy). As such, it may not be supported by other ECMAScript dialects like JScript (on MSIE).

Nov 2020 Update: Array.filter is now supported across all major browsers.

The SAMPLE clause will give you a random sample percentage of all rows in a table.

For example, here we obtain 25% of the rows:

SELECT * FROM emp SAMPLE(25)

The following SQL (using one of the analytical functions) will give you a random sample of a specific number of each occurrence of a particular value (similar to a GROUP BY) in a table.

Here we sample 10 of each:

SELECT * FROM (
SELECT job, sal, ROW_NUMBER()
OVER (
PARTITION BY job ORDER BY job
) SampleCount FROM emp
)
WHERE SampleCount <= 10

Firstly, if you are doing this just to prevent people viewing the source of your page - it won't work, because they can always use a keyboard shortcut to view it.

Secondly, you will have to use JavaScript to accomplish this. If the user has JS disabled, you cannot prevent the right click.

That said, add this to your body tag to disable right clicks.

<body oncontextmenu="return false;">

Use compact

function view($view)
{
    $ms = Person::where('name', '=', 'Foo Bar')->first();

    $persons = Person::order_by('list_order', 'ASC')->get();
    return View::make('users', compact('ms','persons'));
}

This works fine for me.

$(document).ready(function () {
       $('#btn_move').click( function(){
           var dateformat = /^(0?[1-9]|[12][0-9]|3[01])[\/\-](0?[1-9]|1[012])[\/\-]\d{4}$/;
           var Val_date=$('#txt_date').val();
               if(Val_date.match(dateformat)){
              var seperator1 = Val_date.split('/');
              var seperator2 = Val_date.split('-');

              if (seperator1.length>1)
              {
                  var splitdate = Val_date.split('/');
              }
              else if (seperator2.length>1)
              {
                  var splitdate = Val_date.split('-');
              }
              var dd = parseInt(splitdate[0]);
              var mm  = parseInt(splitdate[1]);
              var yy = parseInt(splitdate[2]);
              var ListofDays = [31,28,31,30,31,30,31,31,30,31,30,31];
              if (mm==1 || mm>2)
              {
                  if (dd>ListofDays[mm-1])
                  {
                      alert('Invalid date format!');
                      return false;
                  }
              }
              if (mm==2)
              {
                  var lyear = false;
                  if ( (!(yy % 4) && yy % 100) || !(yy % 400))
                  {
                      lyear = true;
                  }
                  if ((lyear==false) && (dd>=29))
                  {
                      alert('Invalid date format!');
                      return false;
                  }
                  if ((lyear==true) && (dd>29))
                  {
                      alert('Invalid date format!');
                      return false;
                  }
              }
          }
          else
          {
              alert("Invalid date format!");

              return false;
          }
       });
   });

There are many ways of doing it, I am listing few here.

1. Using backgroundColor

   Scaffold(
     backgroundColor: Colors.black,
     body: Center(...),
   )
   

2. Using Container in SizedBox.expand

   Scaffold(
     body: SizedBox.expand(
       child: Container(
         color: Colors.black,
         child: Center(...)
       ),
     ),
   )
   

3. Using Theme

   Theme(
     data: Theme.of(context).copyWith(scaffoldBackgroundColor: Colors.black),
     child: Scaffold(
       body: Center(...),
     ),
   )
   

You failed to find an app that does this because it is not possible.

The documentation clearly states (here):

Note: You can play back the audio data only to the standard output device. Currently, that is the mobile device speaker or a Bluetooth headset. You cannot play sound files in the conversation audio during a call.

The reason behind this decision has probably something to do with security: there are several scenarios where this capability could be used for cons.

(the OP is highly similar to this, hence I'm basically giving the same answer)

Send a SIGTERM or a SIGKILL to it:

http://en.wikipedia.org/wiki/SIGKILL

http://en.wikipedia.org/wiki/SIGTERM

SIGTERM is polite and lets the process clean up before it goes, whereas, SIGKILL is for when it won't listen >:)

Example from the shell (man page: http://unixhelp.ed.ac.uk/CGI/man-cgi?kill )

kill -9 pid

In C, you can do the same thing using the kill syscall:

kill(pid, SIGKILL);

See the following man page: http://linux.die.net/man/2/kill

if via a batch file use:

set SHORT_DIR=%~dsp0%

you can use the echo command to check:

echo %SHORT_DIR%

You can use ARG - see https://docs.docker.com/engine/reference/builder/#arg

The ARG instruction defines a variable that users can pass at build-time to the builder with the docker build command using the --build-arg <varname>=<value> flag. If a user specifies a build argument that was not defined in the Dockerfile, the build outputs an error.

Check out Oj. There are gotchas when it comes to converting any old object to JSON, but Oj can do it.

require 'oj'

class A
    def initialize a=[1,2,3], b='hello'
        @a = a
        @b = b
    end
end

a = A.new
puts Oj::dump a, :indent => 2

This outputs:

{
  "^o":"A",
  "a":[
    1,
    2,
    3
  ],
 "b":"hello"
}

Note that ^o is used to designate the object's class, and is there to aid deserialization. To omit ^o, use :compat mode:

puts Oj::dump a, :indent => 2, :mode => :compat

Output:

{
  "a":[
    1,
    2,
    3
  ],
  "b":"hello"
}

I spent a little over an hour trying just about every option presented. I eventually figured out that I had a lot of stale entries for software that I had uninstalled. I deleted all the registry nodes that had any stale data (pointed to the wrong directory). This included the

[HKEY_LOCAL_MACHINE\SOFTWARE\Wow6432Node\JavaSoft\Java Runtime Environment]

and

[HKEY_LOCAL_MACHINE\SOFTWARE\JavaSoft\Java Runtime Environment]

entries as a JRE included in the JDK.

I also got rid of all the JAVA entries in my environmental variables. I guess I blame it on bad uninstallers that do not clean up after themselves.

Since it is easy to tackle with Command Prompt. Open the CMD and type following.

netstat -aon | find "8080"

If a process uses above port, it should return something output like this.

TCP    xxx.xx.xx.xx:8080      xx.xx.xx.xxx:443      ESTABLISHED     2222

The last column value (2222) is referred to the Process ID (PID).

Just KILL it as follows.

taskkill /F /PID 2222

Now you can start your server.

For me it happened because I changed argument type in function, from Object a, to String a. I could resolve it with clean and build again

Beware of using string interpolation for SQL queries, since it won't escape the input parameters correctly and will leave your application open to SQL injection vulnerabilities. The difference might seem trivial, but in reality it's huge.

Incorrect (with security issues)

c.execute("SELECT * FROM foo WHERE bar = %s AND baz = %s" % (param1, param2))

Correct (with escaping)

c.execute("SELECT * FROM foo WHERE bar = %s AND baz = %s", (param1, param2))

It adds to the confusion that the modifiers used to bind parameters in a SQL statement varies between different DB API implementations and that the mysql client library uses printf style syntax instead of the more commonly accepted '?' marker (used by eg. python-sqlite).

This worked great for me. Don't forget to put a filler div in there where the navigation bar used to be, or else the content will jump every time it's fixed/unfixed.

function setSkrollr(){
    var objDistance = $navbar.offset().top;
    $(window).scroll(function() {
        var myDistance = $(window).scrollTop();
        if (myDistance > objDistance){
            $navbar.addClass('navbar-fixed-top');
        }
        if (objDistance > myDistance){
            $navbar.removeClass('navbar-fixed-top');
        }
    });
}

You cannot use iOS APIs alone to capture the phone number (even in a private app with private APIs), as all known methods of doing this have been patched and blocked as of iOS 11. Even if a new exploit is found, Apple has made clear that they will reject any apps from the app store for using private APIs to do this. See @Dylan's answer for details.

However, there is a legal way to capture the phone number without any user data entry. This is similar to what Snapchat does, but easier, as it does not require the user to type in their own phone number.

The idea is to have the app programmatically send a SMS message to a server with the app’s unique installation code. The app can then query the same server to see if it has recently received a SMS message from a device with this unique app installation code. If it has, it can read the phone number that sent it. Here’s a demo video showing the process. As you can see, it works like a charm!

This is not super easy to set up, but it be configured in a few hours at no charge on a free AWS tier with the sample code provided in the tutorial here.

If you are looking to just repopulate the fields with the values that were posted in them, then just echo the post value back into the field, like so:

<input type="text" name="myField1" value="<?php echo isset($_POST['myField1']) ? $_POST['myField1'] : '' ?>" />