Programs & Examples On #Tetris

Sometimes, we need to create a new instance of an inner class that can't be static because it depends on some global variables of the parent class. In that situation, if you try to create the instance of an inner class that is not static, a not an enclosing class error is thrown.

Taking the example of the question, what if ZShape can't be static because it need global variable of Shape class?

How can you create new instance of ZShape? This is how:

Add a getter in the parent class:

public ZShape getNewZShape() {
    return new ZShape();
}

Access it like this:

Shape ss = new Shape();
ZShape s = ss.getNewZShape();

So I assume your permissions table has a foreign key reference to admin_accounts table. If so because of referential integrity you will only be able to add permissions for account ids exsiting in the admin accounts table. Which also means that you wont be able to enter a user_account_id [assuming there are no duplicates!]

You can do this if you use an <a> tag instead of a button. I know it's not exactly what you asked for, but it might give you some other options if you cannot find a solution to this:

Borrowing from a demo from another answer here I produced this:

a {_x000D_
  display: block;_x000D_
  font-size: 18px;_x000D_
  border: 2px solid gray;_x000D_
  border-radius: 100px;_x000D_
  width: 100px;_x000D_
  height: 100px;_x000D_
  text-align: center;_x000D_
  line-height: 100px;_x000D_
}_x000D_
_x000D_
a:active {_x000D_
  font-size: 18px;_x000D_
  border: 2px solid green;_x000D_
  border-radius: 100px;_x000D_
  width: 100px;_x000D_
  height: 100px;_x000D_
}_x000D_
_x000D_
a:target {_x000D_
  font-size: 18px;_x000D_
  border: 2px solid red;_x000D_
  border-radius: 100px;_x000D_
  width: 100px;_x000D_
  height: 100px;_x000D_
}

<a id="btn" href="#btn">Demo</a>

Notice the use of :target; this will be the style applied when the element is targeted via the hash. Which also means your HTML will need to be this: <a id="btn" href="#btn">Demo</a> a link targeting itself. and the demo http://jsfiddle.net/rlemon/Awdq5/4/

Thanks to @BenjaminGruenbaum here is a better demo: http://jsfiddle.net/agzVt/

_{Also, as a footnote: this should really be done with JavaScript and applying / removing CSS classes from the element. It would be much less convoluted.}

there are many ways can do this:

add X-UA-Compatible tag to head http response header

using IE tools F12

change windows Registry

Use toCharArray() method. It splits the string into an array of characters:

http://java.sun.com/j2se/1.5.0/docs/api/java/lang/String.html#toCharArray%28%29

String str = "aabbab";
char[] chs = str.toCharArray();

The MOST CORRECT answer to your question is...

#content > div:first-of-type { /* css */ }

This will apply the CSS to the first div that is a direct child of #content (which may or may not be the first child element of #content)

Another option:

#content > div:nth-of-type(1) { /* css */ }

For me it was occurring in a .net project and turned out to be something to do with my Visual Studio installation. I downloaded and installed the latest .net core sdk separately and then reinstalled VS and it worked.

From a UX perspective, it can help to visibly let the user know when they can proceed to submit the form - either by enabling a disabled button, or simply making the button visible.

Here's a simple example...

<form>
    <div class="g-recaptcha" data-sitekey="YOUR_PRIVATE_KEY" data-callback="recaptchaCallback"></div>
    <button type="submit" class="btn btn-default hidden" id="btnSubmit">Submit</button>
</form>

<script>
    function recaptchaCallback() {
        var btnSubmit = document.getElementById("btnSubmit");

        if ( btnSubmit.classList.contains("hidden") ) {
            btnSubmit.classList.remove("hidden");
            btnSubmitclassList.add("show");
        }
    }
</script>

I thought I'd share a situation where my team decided to include .c files. Our archicture largely consists of modules that are decoupled through a message system. These message handlers are public, and call many local static worker functions to do their work. The problem came about when trying to get coverage for our unit test cases, as the only way to exercise this private implementation code was indirectly through the public message interface. With some worker functions knee-deep in the stack, this turned out to be a nightmare to achieve proper coverage.

Including the .c files gave us a way to reach the cog in the machine we were interesting in testing.

You seem close.

I would try to set the URI like this :

String folderPath = Environment.getExternalStorageDirectory()+"/pathTo/folder";

Intent intent = new Intent();  
intent.setAction(Intent.ACTION_GET_CONTENT);
Uri myUri = Uri.parse(folderPath);
intent.setDataAndType(myUri , "file/*");   
startActivity(intent);

But it's not so different from what you have tried. Tell us if it changes anything ?

Also make sure the targeted folder exists, and have a look on the resulting Uri object before to send it to the intent, it may not be what we are expected.

You can simply do ifconfig on host machine to check your host IP, then connect to the ip from within your container, works perfectly for me.

Angular 4 to 8

Either works

<img [src]="imageSrc" [alt]="imageAlt" />

<img src="{{imageSrc}}" alt="{{imageAlt}}" />

and the Component would be

export class sample Component implements OnInit {
   imageSrc = 'assets/images/iphone.png'  
   imageAlt = 'iPhone'

Tree structure:

-> src 
   -> app
   -> assets
      -> images
           'iphone.png'

Before going to answer read this Documentation once. Then you clearly understand the answer.

Try this It may work for you.

Object.keys(data.shareInfo[i]).length

Set the colspan attribute to 2.

...but please don't use tables for layout.

You could use crypto-js.

I would also recommend using SHA256, rather than MD5.

To install crypto-js via NPM:

npm install crypto-js

Alternatively you can use a CDN and reference the JS file.

Then to display a MD5 and SHA256 hash, you can do the following:

<script type="text/javascript">
    var md5Hash = CryptoJS.MD5("Test");
    var sha256Hash = CryptoJS.SHA256("Test1");

    console.log(md5Hash.toString());
    console.log(sha256Hash.toString());
</script>

Working example located here, JSFiddle

There are also other JS functions that will generate an MD5 hash, outlined below.

http://www.myersdaily.org/joseph/javascript/md5-text.html

http://pajhome.org.uk/crypt/md5/md5.html

function md5cycle(x, k) {
var a = x[0], b = x[1], c = x[2], d = x[3];

a = ff(a, b, c, d, k[0], 7, -680876936);
d = ff(d, a, b, c, k[1], 12, -389564586);
c = ff(c, d, a, b, k[2], 17,  606105819);
b = ff(b, c, d, a, k[3], 22, -1044525330);
a = ff(a, b, c, d, k[4], 7, -176418897);
d = ff(d, a, b, c, k[5], 12,  1200080426);
c = ff(c, d, a, b, k[6], 17, -1473231341);
b = ff(b, c, d, a, k[7], 22, -45705983);
a = ff(a, b, c, d, k[8], 7,  1770035416);
d = ff(d, a, b, c, k[9], 12, -1958414417);
c = ff(c, d, a, b, k[10], 17, -42063);
b = ff(b, c, d, a, k[11], 22, -1990404162);
a = ff(a, b, c, d, k[12], 7,  1804603682);
d = ff(d, a, b, c, k[13], 12, -40341101);
c = ff(c, d, a, b, k[14], 17, -1502002290);
b = ff(b, c, d, a, k[15], 22,  1236535329);

a = gg(a, b, c, d, k[1], 5, -165796510);
d = gg(d, a, b, c, k[6], 9, -1069501632);
c = gg(c, d, a, b, k[11], 14,  643717713);
b = gg(b, c, d, a, k[0], 20, -373897302);
a = gg(a, b, c, d, k[5], 5, -701558691);
d = gg(d, a, b, c, k[10], 9,  38016083);
c = gg(c, d, a, b, k[15], 14, -660478335);
b = gg(b, c, d, a, k[4], 20, -405537848);
a = gg(a, b, c, d, k[9], 5,  568446438);
d = gg(d, a, b, c, k[14], 9, -1019803690);
c = gg(c, d, a, b, k[3], 14, -187363961);
b = gg(b, c, d, a, k[8], 20,  1163531501);
a = gg(a, b, c, d, k[13], 5, -1444681467);
d = gg(d, a, b, c, k[2], 9, -51403784);
c = gg(c, d, a, b, k[7], 14,  1735328473);
b = gg(b, c, d, a, k[12], 20, -1926607734);

a = hh(a, b, c, d, k[5], 4, -378558);
d = hh(d, a, b, c, k[8], 11, -2022574463);
c = hh(c, d, a, b, k[11], 16,  1839030562);
b = hh(b, c, d, a, k[14], 23, -35309556);
a = hh(a, b, c, d, k[1], 4, -1530992060);
d = hh(d, a, b, c, k[4], 11,  1272893353);
c = hh(c, d, a, b, k[7], 16, -155497632);
b = hh(b, c, d, a, k[10], 23, -1094730640);
a = hh(a, b, c, d, k[13], 4,  681279174);
d = hh(d, a, b, c, k[0], 11, -358537222);
c = hh(c, d, a, b, k[3], 16, -722521979);
b = hh(b, c, d, a, k[6], 23,  76029189);
a = hh(a, b, c, d, k[9], 4, -640364487);
d = hh(d, a, b, c, k[12], 11, -421815835);
c = hh(c, d, a, b, k[15], 16,  530742520);
b = hh(b, c, d, a, k[2], 23, -995338651);

a = ii(a, b, c, d, k[0], 6, -198630844);
d = ii(d, a, b, c, k[7], 10,  1126891415);
c = ii(c, d, a, b, k[14], 15, -1416354905);
b = ii(b, c, d, a, k[5], 21, -57434055);
a = ii(a, b, c, d, k[12], 6,  1700485571);
d = ii(d, a, b, c, k[3], 10, -1894986606);
c = ii(c, d, a, b, k[10], 15, -1051523);
b = ii(b, c, d, a, k[1], 21, -2054922799);
a = ii(a, b, c, d, k[8], 6,  1873313359);
d = ii(d, a, b, c, k[15], 10, -30611744);
c = ii(c, d, a, b, k[6], 15, -1560198380);
b = ii(b, c, d, a, k[13], 21,  1309151649);
a = ii(a, b, c, d, k[4], 6, -145523070);
d = ii(d, a, b, c, k[11], 10, -1120210379);
c = ii(c, d, a, b, k[2], 15,  718787259);
b = ii(b, c, d, a, k[9], 21, -343485551);

x[0] = add32(a, x[0]);
x[1] = add32(b, x[1]);
x[2] = add32(c, x[2]);
x[3] = add32(d, x[3]);

}

function cmn(q, a, b, x, s, t) {
a = add32(add32(a, q), add32(x, t));
return add32((a << s) | (a >>> (32 - s)), b);
}

function ff(a, b, c, d, x, s, t) {
return cmn((b & c) | ((~b) & d), a, b, x, s, t);
}

function gg(a, b, c, d, x, s, t) {
return cmn((b & d) | (c & (~d)), a, b, x, s, t);
}

function hh(a, b, c, d, x, s, t) {
return cmn(b ^ c ^ d, a, b, x, s, t);
}

function ii(a, b, c, d, x, s, t) {
return cmn(c ^ (b | (~d)), a, b, x, s, t);
}

function md51(s) {
txt = '';
var n = s.length,
state = [1732584193, -271733879, -1732584194, 271733878], i;
for (i=64; i<=s.length; i+=64) {
md5cycle(state, md5blk(s.substring(i-64, i)));
}
s = s.substring(i-64);
var tail = [0,0,0,0, 0,0,0,0, 0,0,0,0, 0,0,0,0];
for (i=0; i<s.length; i++)
tail[i>>2] |= s.charCodeAt(i) << ((i%4) << 3);
tail[i>>2] |= 0x80 << ((i%4) << 3);
if (i > 55) {
md5cycle(state, tail);
for (i=0; i<16; i++) tail[i] = 0;
}
tail[14] = n*8;
md5cycle(state, tail);
return state;
}

/* there needs to be support for Unicode here,
 * unless we pretend that we can redefine the MD-5
 * algorithm for multi-byte characters (perhaps
 * by adding every four 16-bit characters and
 * shortening the sum to 32 bits). Otherwise
 * I suggest performing MD-5 as if every character
 * was two bytes--e.g., 0040 0025 = @%--but then
 * how will an ordinary MD-5 sum be matched?
 * There is no way to standardize text to something
 * like UTF-8 before transformation; speed cost is
 * utterly prohibitive. The JavaScript standard
 * itself needs to look at this: it should start
 * providing access to strings as preformed UTF-8
 * 8-bit unsigned value arrays.
 */
function md5blk(s) { /* I figured global was faster.   */
var md5blks = [], i; /* Andy King said do it this way. */
for (i=0; i<64; i+=4) {
md5blks[i>>2] = s.charCodeAt(i)
+ (s.charCodeAt(i+1) << 8)
+ (s.charCodeAt(i+2) << 16)
+ (s.charCodeAt(i+3) << 24);
}
return md5blks;
}

var hex_chr = '0123456789abcdef'.split('');

function rhex(n)
{
var s='', j=0;
for(; j<4; j++)
s += hex_chr[(n >> (j * 8 + 4)) & 0x0F]
+ hex_chr[(n >> (j * 8)) & 0x0F];
return s;
}

function hex(x) {
for (var i=0; i<x.length; i++)
x[i] = rhex(x[i]);
return x.join('');
}

function md5(s) {
return hex(md51(s));
}

/* this function is much faster,
so if possible we use it. Some IEs
are the only ones I know of that
need the idiotic second function,
generated by an if clause.  */

function add32(a, b) {
return (a + b) & 0xFFFFFFFF;
}

if (md5('hello') != '5d41402abc4b2a76b9719d911017c592') {
function add32(x, y) {
var lsw = (x & 0xFFFF) + (y & 0xFFFF),
msw = (x >> 16) + (y >> 16) + (lsw >> 16);
return (msw << 16) | (lsw & 0xFFFF);
}
}

Then simply use the MD5 function, as shown below:

alert(md5("Test string"));

Another working JS Fiddle here

this is might be a possible solution

void 0 != document.getElementById("ad") &&       (document.getElementById("ad").onclick =function(){
 var a = $("#client_id").val();
 var b = $("#contact").val();
 var c = $("#message").val();
 var Qdata = { client_id: a, contact:b, message:c }
 var respo='';
     $("#message").html('');

return $.ajax({

    url: applicationPath ,
    type: "POST",
    data: Qdata,
    success: function(e) {
         $("#mcg").html("msg send successfully");

    }

})

});

The accepted solution does not work when there are multiple different timezones in a Series. It throws ValueError: Tz-aware datetime.datetime cannot be converted to datetime64 unless utc=True

The solution is to use the apply method.

Please see the examples below:

# Let's have a series `a` with different multiple timezones. 
> a
0    2019-10-04 16:30:00+02:00
1    2019-10-07 16:00:00-04:00
2    2019-09-24 08:30:00-07:00
Name: localized, dtype: object

> a.iloc[0]
Timestamp('2019-10-04 16:30:00+0200', tz='Europe/Amsterdam')

# trying the accepted solution
> a.dt.tz_localize(None)
ValueError: Tz-aware datetime.datetime cannot be converted to datetime64 unless utc=True

# Make it tz-naive. This is the solution:
> a.apply(lambda x:x.tz_localize(None))
0   2019-10-04 16:30:00
1   2019-10-07 16:00:00
2   2019-09-24 08:30:00
Name: localized, dtype: datetime64[ns]

# a.tz_convert() also does not work with multiple timezones, but this works:
> a.apply(lambda x:x.tz_convert('America/Los_Angeles'))
0   2019-10-04 07:30:00-07:00
1   2019-10-07 13:00:00-07:00
2   2019-09-24 08:30:00-07:00
Name: localized, dtype: datetime64[ns, America/Los_Angeles]

In C#, Array.Resize is the simplest method to resize any array to new size, e.g.:

Array.Resize<LinkButton>(ref area, size);

Here, i want to resize the array size of LinkButton array:

<LinkButton> = specifies the array type
ref area = ref is a keyword and 'area' is the array name
size = new size array

You can view/copy/download a timecoded xml file of a youtube's closed captions file by accessing

http://video.google.com/timedtext?lang=[LANGUAGE]&v=[YOUTUBE VIDEO IDENTIFIER]

For example http://video.google.com/timedtext?lang=pt&v=WSVKbw7LC2w

NOTE: this method does not download autogenerated closed captions, even if you get the language right (maybe there's a special code for autogenerated languages).

See ?merge:

the name "row.names" or the number 0 specifies the row names.

Example:

R> de <- merge(d, e, by=0, all=TRUE)  # merge by row names (by=0 or by="row.names")
R> de[is.na(de)] <- 0                 # replace NA values
R> de
  Row.names   a   b   c   d   e   f   g   h   i  j  k  l  m  n  o  p  q  r  s
1         1 1.0 2.0 3.0 4.0 5.0 6.0 7.0 8.0 9.0 10 11 12 13 14 15 16 17 18 19
2         2 0.1 0.2 0.3 0.4 0.5 0.6 0.7 0.8 0.9  1  0  0  0  0  0  0  0  0  0
3         3 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0  0 21 22 23 24 25 26 27 28 29
   t
1 20
2  0
3 30

In XMLHttpRequest, using XMLHttpRequest.responseText may raise the exception like below

 Failed to read the \'responseText\' property from \'XMLHttpRequest\': 
 The value is only accessible if the object\'s \'responseType\' is \'\' 
 or \'text\' (was \'arraybuffer\')

Best way to access the response from XHR as follows

function readBody(xhr) {
    var data;
    if (!xhr.responseType || xhr.responseType === "text") {
        data = xhr.responseText;
    } else if (xhr.responseType === "document") {
        data = xhr.responseXML;
    } else {
        data = xhr.response;
    }
    return data;
}

var xhr = new XMLHttpRequest();
xhr.onreadystatechange = function() {
    if (xhr.readyState == 4) {
        console.log(readBody(xhr));
    }
}
xhr.open('GET', 'http://www.google.com', true);
xhr.send(null);

Sometime we have the column name is below format in SQLServer or MySQL table

Ex  : Account Number,customer number

But Hive tables do not support column name containing spaces, so please use below solution to rename your old column names.

Solution:

val renamedColumns = df.columns.map(c => df(c).as(c.replaceAll(" ", "_").toLowerCase()))
df = df.select(renamedColumns: _*)

Here is a full example on how to transform your date in different types:

Date date = Calendar.getInstance().getTime();

    // Display a date in day, month, year format
    DateFormat formatter = new SimpleDateFormat("dd/MM/yyyy");
    String today = formatter.format(date);
    System.out.println("Today : " + today);

    // Display date with day name in a short format
    formatter = new SimpleDateFormat("EEE, dd/MM/yyyy");
    today = formatter.format(date);
    System.out.println("Today : " + today);

    // Display date with a short day and month name
    formatter = new SimpleDateFormat("EEE, dd MMM yyyy");
    today = formatter.format(date);
    System.out.println("Today : " + today);

    // Formatting date with full day and month name and show time up to
    // milliseconds with AM/PM
    formatter = new SimpleDateFormat("EEEE, dd MMMM yyyy, hh:mm:ss.SSS a");
    today = formatter.format(date);
    System.out.println("Today : " + today);

INSERT INTO destination_table ( 
      Field_1, 
      Field_2, 
      Field_3) 
SELECT Field_1, 
      Field_2, 
      Field_3 
      FROM source_table;

BUT this is a BAD MYSQL

Do this instead:

1. drop the destination table: DROP DESTINATION_TABLE;
2. CREATE TABLE DESTINATION_TABLE AS (SELECT * FROM SOURCE_TABLE);

 $(this).css({'text-align':'center'}); 

You can use class name and id in place of this

$('.classname').css({'text-align':'center'});

or

$('#id').css({'text-align':'center'});

You can store a reference to that timeout, and then call clearTimeout on that reference.

// in the example above, assign the result
var timeoutHandle = window.setTimeout(...);

// in your click function, call clearTimeout
window.clearTimeout(timeoutHandle);

// then call setTimeout again to reset the timer
timeoutHandle = window.setTimeout(...);

There's no need to manually set the colors. Instead, specify a grayscale colormap...

import numpy as np
import matplotlib.pyplot as plt

# Generate data...
x = np.random.random(10)
y = np.random.random(10)

# Plot...
plt.scatter(x, y, c=y, s=500)
plt.gray()

plt.show()

Or, if you'd prefer a wider range of colormaps, you can also specify the cmap kwarg to scatter. To use the reversed version of any of these, just specify the "_r" version of any of them. E.g. gray_r instead of gray. There are several different grayscale colormaps pre-made (e.g. gray, gist_yarg, binary, etc).

import matplotlib.pyplot as plt
import numpy as np

# Generate data...
x = np.random.random(10)
y = np.random.random(10)

plt.scatter(x, y, c=y, s=500, cmap='gray')
plt.show()

Open command line and type: netstat -a -o -n or tasklist to see currently running processes. Find port that related to Java and type: taskkill /F /PID <your PID number>. Click Enter.

http://pinvoke.net/default.aspx/user32.EnumDesktopWindows

There is an example of using user.dll's EnumWindow in C# to list all open windows.

Surprisingly there is no accepted answer. The issue only exists in 32-bit PHP.

From the documentation,

If the string does not contain any of the characters '.', 'e', or 'E' and the numeric value fits into integer type limits (as defined by PHP_INT_MAX), the string will be evaluated as an integer. In all other cases it will be evaluated as a float.

In other words, the $string is first interpreted as INT, which cause overflow (The $string value 2968789218 exceeds the maximum value (PHP_INT_MAX) of 32-bit PHP, which is 2147483647.), then evaluated to float by (float) or floatval().

Thus, the solution is:

$string = "2968789218";
echo 'Original: ' . floatval($string) . PHP_EOL;
$string.= ".0";
$float = floatval($string);
echo 'Corrected: ' . $float . PHP_EOL;

which outputs:

Original: 2.00
Corrected: 2968789218

To check whether your PHP is 32-bit or 64-bit, you can:

echo PHP_INT_MAX;

If your PHP is 64-bit, it will print out 9223372036854775807, otherwise it will print out 2147483647.

According to this it does have a Text property

http://msdn.microsoft.com/en-us/library/system.windows.forms.richtextbox_members.aspx

You can also try the "Lines" property if you want the text broken up as lines.

Considering the question specifies UNIX, not Linux, use of a stat binary is not necessary. The solution below works on a very old UNIX, though a shell other than sh (i.e. bash) was necessary. It is a derivation of glenn jackman's perl stat solution. It seems like an alternative worth exploring for conciseness.

$ alias lls='llsfn () { while test $# -gt 0; do perl -s -e \
  '\''@fields = stat "$f"; printf "%04o\t", $fields[2] & 07777'\'' \
    -- -f=$1; ls -ld $1; shift; done; unset -f llsf; }; llsfn'
$ lls /tmp /etc/resolv.conf
1777    drwxrwxrwt   7 sys      sys       246272 Nov  5 15:10 /tmp
0644    -rw-r--r--   1 bin      bin           74 Sep 20 23:48 /etc/resolv.conf

The alias was developed using information in this answer

The whole answer is a modified version of a solution in this answer

Also, if you have a variable,

CabRes::where('m_Id', 46)
      ->where('t_Id', 2)
      ->where(function($q) use ($variable){
          $q->where('Cab', 2)
            ->orWhere('Cab', $variable);
      })
      ->get();

The Return View(model) returns you error because you don't fill the model with the values in your post method and the model data for the dropdown is empty. Please provide the Get method to explain further how to manage displaying the error. In order to the error to be shown you should use this:

[HttpPost]
public ActionResult form_edit(FormModels model)
{          
   if(ModelState.IsValid())
   {
      --- operations 
      return Redirect("OtherAction", "SomeController");
   }

   // here you can use a little trick
   //fill the model property that holds the information for the dropdown with the data 

   // you haven't provided the get method but it should look something like this
   model.Countries = ... some data goes here;
   model.dd_value = ... some other data;
   model.dd_text = ... other data;

   ModelState.AddModelError("", "adfdghdghgdhgdhdgda");
   return View(model);
}

and then in the view just use :

@model mvc_cs.Models.FormModels
@using ctrlr = mvc_cs.Controllers.FormController


@using (Html.BeginForm("form_edit", "Form", FormMethod.Post))
{

    <table>
    <tr>
    <td>       
    @Html.ValidationSummary(true)             
    </td>
    </tr>
<tr>
    <th>
        @Html.DisplayNameFor(model => model.content_name)
        @Html.DropDownListFor(x => x.selectedvalue, new SelectList(Model.Countries, Model.dd_value, Model.dd_text), "-- Select Product--")

    </th>
</tr>
</table>

<table>
<tr>
    <td>
        <input  type="submit" value="Submit" />
    </td>
</tr>
</table>
}

This should work okay.

If you just use RedirectToAction it will redirect you to the get method --> you will have no error but the view will be just reloaded and no error would be shown.

other way around is that you can pass the error not by ModelState.AddError, but with ViewData["error"] like this:

[HttpPost]
public ActionResult form_edit(FormModels model)
{          
   TempData["error"] = "someErrorMessage";
   return RedirectToAction("form_Post", "Form");
}

[HttpGet]
public ActionResult form_edit()
{
    do stuff here ----
    ViewData["error"] = TempData["error"];
    return View();
}

@model mvc_cs.Models.FormModels
@using ctrlr = mvc_cs.Controllers.FormController


@using (Html.BeginForm("form_edit", "Form", FormMethod.Post))
{

    <table>
    <tr>
    <td>       
    <div>@ViewData["error"]</div>             
    </td>
    </tr>
<tr>
    <th>
        @Html.DisplayNameFor(model => model.content_name)
        @Html.DropDownListFor(x => x.selectedvalue, new SelectList(Model.Countries, Model.dd_value, Model.dd_text), "-- Select Product--")

    </th>
</tr>
</table>

<table>
<tr>
    <td>
        <input  type="submit" value="Submit" />
    </td>
</tr>
</table>
}

There is no difference.

COUNT(1) is basically just counting a constant value 1 column for each row. As other users here have said, it's the same as COUNT(0) or COUNT(42). Any non-NULL value will suffice.

http://asktom.oracle.com/pls/asktom/f?p=100:11:2603224624843292::::P11_QUESTION_ID:1156151916789

The Oracle optimizer did apparently use to have bugs in it, which caused the count to be affected by which column you picked and whether it was in an index, so the COUNT(1) convention came into being.

A solution by using the new ConstraintLayout is wrapping the ConstraintLayout in a LinearLayout with minHeight and minWidth fixed. Without the wrapping, ConstraintLayout is not getting the right size for the Dialog.

<?xml version="1.0" encoding="utf-8"?>
<LinearLayout xmlns:android="http://schemas.android.com/apk/res/android"
    xmlns:app="http://schemas.android.com/apk/res-auto"
    android:layout_width="match_parent"
    android:layout_height="match_parent"
    android:minWidth="1000dp"
    android:minHeight="1000dp"
    android:orientation="vertical">

    <androidx.constraintlayout.widget.ConstraintLayout
        android:layout_width="match_parent"
        android:layout_height="match_parent"
        android:background="@color/background_color"
        android:orientation="vertical">
        <!-- some constrained views -->
    </androidx.constraintlayout.widget.ConstraintLayout>

</LinearLayout>

Spring has some standard events which you can handle.

To do that, you must create and register a bean that implements the ApplicationListener interface, something like this:

package test.pack.age;

import org.springframework.context.ApplicationContext;
import org.springframework.context.ApplicationEvent;
import org.springframework.context.ApplicationListener;
import org.springframework.context.event.ContextRefreshedEvent;

public class ApplicationListenerBean implements ApplicationListener {

    @Override
    public void onApplicationEvent(ApplicationEvent event) {
        if (event instanceof ContextRefreshedEvent) {
            ApplicationContext applicationContext = ((ContextRefreshedEvent) event).getApplicationContext();
            // now you can do applicationContext.getBean(...)
            // ...
        }
    }
}

You then register this bean within your servlet.xml or applicationContext.xml file:

<bean id="eventListenerBean" class="test.pack.age.ApplicationListenerBean" />

and Spring will notify it when the application context is initialized.

In Spring 3 (if you are using this version), the ApplicationListener class is generic and you can declare the event type that you are interested in, and the event will be filtered accordingly. You can simplify a bit your bean code like this:

public class ApplicationListenerBean implements ApplicationListener<ContextRefreshedEvent> {

    @Override
    public void onApplicationEvent(ContextRefreshedEvent event) {
        ApplicationContext applicationContext = event.getApplicationContext();
        // now you can do applicationContext.getBean(...)
        // ...
    }
}

I tried Noah's suggestion which leads to the best solution up to now.

Just insert \let\cleardoublepage\clearpage before all the parts with the blank pages Especially when you use \documentclass[12pt,a4paper]{book}

frederic snyers's advice \documentclass[oneside]{book} is also very good and solves the problem, but if we just want to use the book.cls or article.cls, the one would make a big difference presenting your particles.

Hence, Big support to \let\cleardoublepage\clearpage for the people who will ask the same question in the future.

Particularly when using something like Twitter's Bootstrap, white-space: nowrap; doesn't always work in CSS when applying padding or margin to a child div. Instead however, adding an equivalent border: 20px solid transparent; style in place of padding/margin works more consistently.

You can use the iterator that is returned by the begin() method of the map template:

std::map<K,V> myMap;
std::pair<K,V> firstEntry = *myMap.begin()

But remember that the std::map container stores its content in an ordered way. So the first entry is not always the first entry that has been added.

I am a beginner in iPhone apps and I still have an issue although I followed the above advices. It looks like POST variables are not received by my server - not sure if it comes from php or objective-c code ...

the objective-c part (coded following Chris' protocol methodo)

// Create the request.
NSMutableURLRequest *request = [NSMutableURLRequest requestWithURL:[NSURL URLWithString:@"http://example.php"]];

// Specify that it will be a POST request
request.HTTPMethod = @"POST";

// This is how we set header fields
[request setValue:@"application/xml; charset=utf-8" forHTTPHeaderField:@"Content-Type"];

// Convert your data and set your request's HTTPBody property
NSString *stringData = [NSString stringWithFormat:@"user_name=%@&password=%@", self.userNameField.text , self.passwordTextField.text];
NSData *requestBodyData = [stringData dataUsingEncoding:NSUTF8StringEncoding];
request.HTTPBody = requestBodyData;

// Create url connection and fire request
//NSURLConnection *conn = [[NSURLConnection alloc] initWithRequest:request delegate:self];
NSData *response = [NSURLConnection sendSynchronousRequest:request
                                         returningResponse:nil error:nil];

NSLog(@"Response: %@",[[NSString alloc] initWithData:response encoding:NSUTF8StringEncoding]);

Below the php part :

if (isset($_POST['user_name'],$_POST['password'])) 

{

// Create connection
$con2=mysqli_connect($servername, $username, $password, $dbname);
if (mysqli_connect_errno())
{
echo "Failed to connect to MySQL: " . mysqli_connect_error();
}
else 
{
// retrieve POST vars
$username = $_POST['user_name'];
$password = $_POST['password'];

$sql = "INSERT INTO myTable (user_name, password) VALUES ('$username',   '$password')";
$retval = mysqli_query( $sql, $con2 );
if(! $retval )
{
die('Could not enter data: ' . mysql_error());
}
echo "Entered data successfully\n";

mysqli_close($con2);

}
}
else
{
echo "No data input in php";
}

I have been stuck the last days on this one.

On MacOS Catalina, open terminal, follow this step:

1. Create zshrc file: touch ~/.zshrc
2. Open file zshrc: open ~/.zshrc
3. Insert this line to file, type: export PATH="/Users/YOUR_NAME/Downloads/flutter/bin:$PATH" Save file and close. (explain: YOUR_NAME -is name of user your Mac, Downloads -is folder i put folder flutter)

System.IO.File.ReadLines() is perfect for this scenario. It returns all the lines of a file, but lets you begin iterating over the lines immediately which means it does not have to store the entire contents in memory.

Requires .NET 4.0 or higher.

foreach ($line in [System.IO.File]::ReadLines($filename)) {
    # do something with $line
}

http://msdn.microsoft.com/en-us/library/dd383503.aspx

In my case,

Build Phases -> check Compile Sources files -> delete xxx.swift files that xcode says "can't find "xxx.swift"

#include <iostream>
#include <fstream>
using namespace std;

void main()
{
    ifstream in_stream; // fstream command to initiate "in_stream" as a command.
    char filename[31]; // variable for "filename".
    cout << "Enter file name to open :: "; // asks user for input for "filename".
    cin.getline(filename, 30); // this gets the line from input for "filename".
    in_stream.open(filename); // this in_stream (fstream) the "filename" to open.
    if (in_stream.fail())
    {
        cout << "Could not open file to read.""\n"; // if the open file fails.
        return;
    }
    //.....the rest of the text goes beneath......
}

<html>
<head>
<title></title>
<script type="text/javascript" src="http://ajax.googleapis.com/ajax/libs/jquery/1.3.2/jquery.js"></script>
<script type="text/javascript">

$(function() {

    //here you have the control over the body of the iframe document
    var iBody = $("#iView").contents().find("body");

    //here you have the control over any element (#myContent)
    var myContent = iBody.find("#myContent");

});

</script>
</head>
<body>
  <iframe src="mifile.html" id="iView" style="width:200px;height:70px;border:dotted 1px red" frameborder="0"></iframe>
</body>
</html>

Adding to Bryan Chen's answer above:

Just incase anyone else is getting something similar with Alamofire:

error: Alamofire was compiled with optimization - stepping may behave oddly; variables may not be available.

It's not a very descriptive error. I was getting that error when constructing a URL for google geo services. I was appending a street address to the end of the URL WITHOUT encoding the street address itself first. I was able to fix it using Bryan Chen's solution:

var streetAdress = "123 fake street, new york, ny"
var escapedStreetAddress = streetAddress.stringByAddingPercentEncodingWithAllowedCharacters(.URLHostAllowedCharacterSet())
let url = "\(self.baseUrl)&address=\(escapedAddress!)"

That fixed it for me! It didnt like that the address had spaces and commas, etc.

Hope this helps someone else!

$Query_String  = explode("&", explode("?", $_SERVER['REQUEST_URI'])[1] );
var_dump($Query_String)

Array ( [ 0] => link=www.google.com )

Thanks to all, for me this solution worked: Magento 404 page in backoffice after login

insert into table1 values("sunil''s book",123,99382932938);

use double apostrophe inside of single apostrophe, it will work

I made this work in this way:

<button class="btn" ng-click='toggleClass($event)'>button one</button>
<button class="btn" ng-click='toggleClass($event)'>button two</button>

in your controller:

$scope.toggleClass = function (event) {
    $(event.target).toggleClass('active');
}

Not pretty good solution, but you can try the hjson tool. It allows you to write text multi-lined in editor and then converts it to the proper valid JSON format.

Note: it adds '\n' characters for the new lines, but you can simply delete them in any text editor with the "Replace all.." function.

You could use both LTRIM and RTRIM.

select rtrim(ltrim('abcdab','ab'),'ab') from dual;

If you want to trim CHR(13) only when it comes with a CHR(10) it gets more complicated. Firstly, translated the combined string to a single character. Then LTRIM/RTRIM that character, then replace the single character back to the combined string.

select replace(rtrim(ltrim(replace('abccccabcccaab','ab','#'),'#'),'#'),'#','ab') from dual;

No.

But you can check out SWFUpload and Ajax Upload

Check for the value of the parameter:

// .NET < 4.0
if (string.IsNullOrEmpty(Request.QueryString["aspxerrorpath"]))
{
 // not there!
}

// .NET >= 4.0
if (string.IsNullOrWhiteSpace(Request.QueryString["aspxerrorpath"]))
{
 // not there!
}

If it does not exist, the value will be null, if it does exist, but has no value set it will be an empty string.

I believe the above will suit your needs better than just a test for null, as an empty string is just as bad for your specific situation.

1.Check the Environment variables (must be set for System and not for user):

ORACLE_HOME = C:\oraclexe\app\oracle\product\11.2.0\server
ORACLE_SID = XE

2.Check if you have the right definition in listener.ora

XE =
  (DESCRIPTION_LIST =
    (DESCRIPTION =
      (ADDRESS = (PROTOCOL = IPC)(KEY = EXTPROC1))
      (ADDRESS = (PROTOCOL = TCP)(HOST = localhost)(PORT = 1521))
    )
  )

DEFAULT_SERVICE_LISTENER = (XE)

3.Restart the service (Services > OracleServiceXE)

After that you may see a new service called OracleXETNSListenerXE.
There is already an old OracleXETNSListener.

I started both and then I was able to make a successful connection.

Edit:

If everything is running but you still can't connect, check if there is no error: ORA-12557: TNS:protocol adapter not loadable.

To correct the error go back to the Environment variables and this time edit the one called: Path. Be sure that C:\oraclexe\app\oracle\product\11.2.0\server\bin is somewhere at the beginning, definitely before any other path pointing to a different version of the Oracle DB.

Try this:

echo str_replace(array('\r\n', '\n\r', '\n', '\r'), '<br>', $description);

Why don't you try to grep the return of your command ? Something like :

adb devices -l | grep 123abc12

It should return only the line you want to.

like this?

docker run -p 3306:3306 -e MYSQL_ALLOW_EMPTY_PASSWORD=yes -d mysql --default-authentication-plugin=mysql_native_password
mysql -uroot --protocol tcp

Try in PWD

https://github.com/GitHub30/docs/blob/change-default_authentication_plugin/mysql/stack.yml

or You shoud use MySQL Workbench 8.0.11.

In Python you can use (.)\1{9,}

• (.) makes group from one char (any char)
• \1{9,} matches nine or more characters from 1st group

example:

txt = """1. aaaaaaaaaaaaaaa
2. bb
3. cccccccccccccccccccc
4. dd
5. eeeeeeeeeeee"""
rx = re.compile(r'(.)\1{9,}')
lines = txt.split('\n')
for line in lines:
    rxx = rx.search(line)
    if rxx:
        print line

Output:

1. aaaaaaaaaaaaaaa
3. cccccccccccccccccccc
5. eeeeeeeeeeee

For the select tag, angular provides the ng-options directive. It gives you the specific framework to set up options and set a default. Here is the updated fiddle using ng-options that works as expected: http://jsfiddle.net/FxM3B/4/

Updated HTML (code stays the same)

<body ng-app ng-controller="AppCtrl">
<div>Operator is: {{filterCondition.operator}}</div>
<select ng-model="filterCondition.operator" ng-options="operator.value as operator.displayName for operator in operators">
</select>
</body>

Follow these steps:

1. login to bitbucket
2. Click on Personal Settings
3. Click on Create App Password, here give permission to read and write and the login to GitHub desktop using the same password. Note: Take a screenshot of the password as you won't retrieve it again.

steps updated as on 13th July 2020 Thank You: Rahul Daksh

You can use pd.Index.difference with np.hstack, then reindex or use label-based indexing. In general, it's a good idea to avoid list comprehensions or other explicit loops with NumPy / Pandas objects.

cols_to_move = ['b', 'x']
new_cols = np.hstack((df.columns.difference(cols_to_move), cols_to_move))

# OPTION 1: reindex
df = df.reindex(columns=new_cols)

# OPTION 2: direct label-based indexing
df = df[new_cols]

# OPTION 3: loc label-based indexing
df = df.loc[:, new_cols]

print(df)

#    a  y  b   x
# 0  1 -1  2   3
# 1  2 -2  4   6
# 2  3 -3  6   9
# 3  4 -4  8  12

You could use the longer boringer way

<p style="font-size:14px; color:#538b01; font-weight:bold; font-style:italic;">Enter the competition by</p><p style="font-size:14px; color:#ff00; font-weight:bold; font-style:italic;">summer</p> 

you get the point for the rest

On the side bar of the PHP 7 alpha download page, it does say this:

VC9, VC11 & VC14 More recent versions of PHP are built with VC9, VC11 or VC14 (Visual Studio 2008, 2012 or 2015 compiler respectively) and include improvements in performance and stability.

• The VC9 builds require you to have the Visual C++ Redistributable for Visual Studio 2008 SP1 x86 or x64 installed

• The VC11 builds require to have the Visual C++ Redistributable for Visual Studio 2012 x86 or x64 installed

• The VC14 builds require to have the Visual C++ Redistributable for Visual Studio 2015 x86 or x64 installed

^{There's been a problem with some of those links, so the files are also available from Softpedia.}

In the case of the PHP 7 alpha, it's the last option that's required.

I think that the placement of this information is poor, as it's kind of marginalized (i.e.: it's basically literally in the margin!) whereas it's actually critical for the software to run.

I documented my experiences of getting PHP 7 alpha up and running on Windows 8.1 in PHP: getting PHP7 alpha running on Windows 8.1, and it covers some more symptoms that might crop up. They're out of scope for this question but might help other people.

Other symptom of this issue:

• Apache not starting, claiming php7apache2_4.dll is missing despite it definitely being in place, and offering nothing else in any log.
• php-cgi.exe - The FastCGI process exited unexpectedly (as per @ftexperts's comment below)

Attempted solution:

• Using the php7apache2_4.dll file from an earlier PHP 7 dev build. This did not work.

(I include those for googleability.)

Unique pointers are guaranteed to destroy the object they manage when they go out of scope. http://en.cppreference.com/w/cpp/memory/unique_ptr

In this case:

unique_ptr<double> uptr2 (pd);

pd will be destroyed when uptr2 goes out of scope. This facilitates memory management by automatic deletion.

The case of unique_ptr<int> uptr (new int(3)); is not different, except that the raw pointer is not assigned to any variable here.

For a quick one-line setup use

((LayoutParams) cvHolder.getLayoutParams()).setMargins(0, 0, 0, 0);

but be carfull for any wrong use to LayoutParams, as this will have no if statment instance chech

What you describe for the second method only gives you a 1D array:

int *board = new int[10];

This just allocates an array with 10 elements. Perhaps you meant something like this:

int **board = new int*[4];
for (int i = 0; i < 4; i++) {
  board[i] = new int[10];
}

In this case, we allocate 4 int*s and then make each of those point to a dynamically allocated array of 10 ints.

So now we're comparing that with int* board[4];. The major difference is that when you use an array like this, the number of "rows" must be known at compile-time. That's because arrays must have compile-time fixed sizes. You may also have a problem if you want to perhaps return this array of int*s, as the array will be destroyed at the end of its scope.

The method where both the rows and columns are dynamically allocated does require more complicated measures to avoid memory leaks. You must deallocate the memory like so:

for (int i = 0; i < 4; i++) {
  delete[] board[i];
}
delete[] board;

I must recommend using a standard container instead. You might like to use a std::array<int, std::array<int, 10> 4> or perhaps a std::vector<std::vector<int>> which you initialise to the appropriate size.

You can do this with one simple command:

npm ci

Documentation:

npm ci
Install a project with a clean slate

 function createQuestionPanel() {

        var element = document.createElement("Input");
        element.setAttribute("type", "button");
        element.setAttribute("value", "button");
        element.setAttribute("name", "button");


        var div = document.createElement("div"); <------- Create DIv Node
        div.appendChild(element);<--------------------
        document.body.appendChild(div) <------------- Then append it to body

    }

    function formvalidate() {

    }

It turns out I was just missing DECIMAL on the CAST() description:

DECIMAL[(M[,D])]

Converts a value to DECIMAL data type. The optional arguments M and D specify the precision (M specifies the total number of digits) and the scale (D specifies the number of digits after the decimal point) of the decimal value. The default precision is two digits after the decimal point.

Thus, the following query worked:

UPDATE table SET
latitude = CAST(old_latitude AS DECIMAL(10,6)),
longitude = CAST(old_longitude AS DECIMAL(10,6));

The network is always unpredictable. TCP makes a lot of this random behavior go away for you. One wonderful thing TCP does: it guarantees that the bytes will arrive in the same order. But! It does not guarantee that they will arrive chopped up in the same way. You simply cannot assume that every send() from one end of the connection will result in exactly one recv() on the far end with exactly the same number of bytes.

When you say socket.recv(x), you're saying 'don't return until you've read x bytes from the socket'. This is called "blocking I/O": you will block (wait) until your request has been filled. If every message in your protocol was exactly 1024 bytes, calling socket.recv(1024) would work great. But it sounds like that's not true. If your messages are a fixed number of bytes, just pass that number in to socket.recv() and you're done.

But what if your messages can be of different lengths? The first thing you need to do: stop calling socket.recv() with an explicit number. Changing this:

data = self.request.recv(1024)

to this:

data = self.request.recv()

means recv() will always return whenever it gets new data.

But now you have a new problem: how do you know when the sender has sent you a complete message? The answer is: you don't. You're going to have to make the length of the message an explicit part of your protocol. Here's the best way: prefix every message with a length, either as a fixed-size integer (converted to network byte order using socket.ntohs() or socket.ntohl() please!) or as a string followed by some delimiter (like '123:'). This second approach often less efficient, but it's easier in Python.

Once you've added that to your protocol, you need to change your code to handle recv() returning arbitrary amounts of data at any time. Here's an example of how to do this. I tried writing it as pseudo-code, or with comments to tell you what to do, but it wasn't very clear. So I've written it explicitly using the length prefix as a string of digits terminated by a colon. Here you go:

length = None
buffer = ""
while True:
  data += self.request.recv()
  if not data:
    break
  buffer += data
  while True:
    if length is None:
      if ':' not in buffer:
        break
      # remove the length bytes from the front of buffer
      # leave any remaining bytes in the buffer!
      length_str, ignored, buffer = buffer.partition(':')
      length = int(length_str)

    if len(buffer) < length:
      break
    # split off the full message from the remaining bytes
    # leave any remaining bytes in the buffer!
    message = buffer[:length]
    buffer = buffer[length:]
    length = None
    # PROCESS MESSAGE HERE

<input type="number" name="numericInput" size="2" min="0" maxlength="2" value="0" />

ALTER TABLE {tableName} ADD COLUMN COLNew {type};
UPDATE {tableName} SET COLNew = {base on {type} pass value here};

This update is required to handle the null value, inputting a default value as you require. As in your case, you need to call the SELECT query and you will get the order of columns, as paxdiablo already said:

SELECT name, colnew, qty, rate FROM{tablename}

and in my opinion, your column name to get the value from the cursor:

private static final String ColNew="ColNew";
String val=cursor.getString(cursor.getColumnIndex(ColNew));

so if the index changes your application will not face any problems.

This is the safe way in the sense that otherwise, if you are using CREATE temptable or RENAME table or CREATE, there would be a high chance of data loss if not handled carefully, for example in the case where your transactions occur while the battery is running out.

So you need a natural sort ?

If so, than maybe this script by Brian Huisman based on David koelle's work would be what you need.

It seems like Brian Huisman's solution is now directly hosted on David Koelle's blog:

• Brian Huisman's javascript solutions
• David koelle's article on the subject

I generally just put a log4j.xml file into src/test/resources and let log4j find it by itself: no code required, the default log4j initialisation will pick it up. (I typically want to set my own loggers to 'DEBUG' anyway)

 public enum Operator
    {
        PLUS, MINUS, MULTIPLY, DIVIDE
    }

    public class Calc
    {
        public void Calculate(int left, int right, Operator op)
        {

            switch (op)
            {
                case Operator.DIVIDE:
                    //Divide
                    break;
                case Operator.MINUS:
                    //Minus
                    break;
                case Operator.MULTIPLY:
                    //...
                    break;
                case Operator.PLUS:
                    //;;
                    break;
                default:
                    throw new InvalidOperationException("Couldn't process operation: " + op);
            }
        }
    }

What happens if somebody passes a unicode string to your function? Or a class derived from dict? Or a class implementing a dict-like interface? Following code covers first two cases. If you are using Python 2.6 you might want to use collections.Mapping instead of dict as per the ABC PEP.

def value_list(x):
    if isinstance(x, dict):
        return list(set(x.values()))
    elif isinstance(x, basestring):
        return [x]
    else:
        return None

The same as David's, but without attr()

$('<input>', {
    type: 'hidden',
    id: 'foo',
    name: 'foo',
    value: 'bar'
}).appendTo('form');

Actually the navigation bar on tablets (at least Nexus 7) has different size in portrait and landscape so this function should look like this:

private int getNavigationBarHeight(Context context, int orientation) {
    Resources resources = context.getResources();

    int id = resources.getIdentifier(
            orientation == Configuration.ORIENTATION_PORTRAIT ? "navigation_bar_height" : "navigation_bar_height_landscape",
            "dimen", "android");
    if (id > 0) {
        return resources.getDimensionPixelSize(id);
    }
    return 0;
}

If you have less than 4 rows, you can use the head function ( head(data, 4) or head(data, n=4)) and it works like a charm. But, assume we have the following dataset with 15 rows

>data <- data <- read.csv("./data.csv", sep = ";", header=TRUE)

>data
 LungCap Age Height Smoke Gender Caesarean
1    6.475   6   62.1    no   male        no
2   10.125  18   74.7   yes female        no
3    9.550  16   69.7    no female       yes
4   11.125  14   71.0    no   male        no
5    4.800   5   56.9    no   male        no
6    6.225  11   58.7    no female        no
7    4.950   8   63.3    no   male       yes
8    7.325  11   70.4    no  male         no
9    8.875  15   70.5    no   male        no
10   6.800  11   59.2    no   male        no
11   6.900  12   59.3    no   male        no
12   6.100  13   59.4    no   male        no
13   6.110  14   59.5    no   male        no
14   6.120  15   59.6    no   male        no
15   6.130  16   59.7    no   male        no

Let's say, you want to select the first 10 rows. The easiest way to do it would be data[1:10, ].

> data[1:10,]
   LungCap Age Height Smoke Gender Caesarean
1    6.475   6   62.1    no   male        no
2   10.125  18   74.7   yes female        no
3    9.550  16   69.7    no female       yes
4   11.125  14   71.0    no   male        no
5    4.800   5   56.9    no   male        no
6    6.225  11   58.7    no female        no
7    4.950   8   63.3    no   male       yes
8    7.325  11   70.4    no  male         no
9    8.875  15   70.5    no   male        no
10   6.800  11   59.2    no   male        no

However, let's say you try to retrieve the first 19 rows and see the what happens - you will have missing values

> data[1:19,]
     LungCap Age Height Smoke Gender Caesarean
1      6.475   6   62.1    no   male        no
2     10.125  18   74.7   yes female        no
3      9.550  16   69.7    no female       yes
4     11.125  14   71.0    no   male        no
5      4.800   5   56.9    no   male        no
6      6.225  11   58.7    no female        no
7      4.950   8   63.3    no   male       yes
8      7.325  11   70.4    no  male         no
9      8.875  15   70.5    no   male        no
10     6.800  11   59.2    no   male        no
11     6.900  12   59.3    no   male        no
12     6.100  13   59.4    no   male        no
13     6.110  14   59.5    no   male        no
14     6.120  15   59.6    no   male        no
15     6.130  16   59.7    no   male        no
NA        NA  NA     NA  <NA>   <NA>      <NA>
NA.1      NA  NA     NA  <NA>   <NA>      <NA>
NA.2      NA  NA     NA  <NA>   <NA>      <NA>
NA.3      NA  NA     NA  <NA>   <NA>      <NA>

and with the head() function,

> head(data, 19) # or head(data, n=19)
   LungCap Age Height Smoke Gender Caesarean
1    6.475   6   62.1    no   male        no
2   10.125  18   74.7   yes female        no
3    9.550  16   69.7    no female       yes
4   11.125  14   71.0    no   male        no
5    4.800   5   56.9    no   male        no
6    6.225  11   58.7    no female        no
7    4.950   8   63.3    no   male       yes
8    7.325  11   70.4    no  male         no
9    8.875  15   70.5    no   male        no
10   6.800  11   59.2    no   male        no
11   6.900  12   59.3    no   male        no
12   6.100  13   59.4    no   male        no
13   6.110  14   59.5    no   male        no
14   6.120  15   59.6    no   male        no
15   6.130  16   59.7    no   male        no

Hope this help!

finally I found... it will work nice when table displays only 3 rows... if rows are more change should be accordingly...

- (NSInteger)numberOfSectionsInTableView:(UITableView *)tableView
{    
    return 1;
}


// Customize the number of rows in the table view.
- (NSInteger)tableView:(UITableView *)tableView 
 numberOfRowsInSection:(NSInteger)section
{  
    return 30;
}

- (UITableViewCell *)tableView:(UITableView *)tableView 
         cellForRowAtIndexPath:(NSIndexPath *)indexPath
{
    static NSString *CellIdentifier = @"Cell";

    UITableViewCell *cell = [tableView dequeueReusableCellWithIdentifier:CellIdentifier];

    if (cell == nil)
    {         
        cell = [[[UITableViewCell alloc] initWithStyle:UITableViewCellStyleDefault    
                                       reuseIdentifier:CellIdentifier] autorelease];
    }

    // Configure the cell.
    cell.textLabel.text =[NSString stringWithFormat:@"Hello roe no. %d",[indexPath row]];

    return cell;
}

- (void)tableView:(UITableView *)tableView didSelectRowAtIndexPath:(NSIndexPath *)indexPath
{
    UITableViewCell * theCell = (UITableViewCell *)[tableView     
                                              cellForRowAtIndexPath:indexPath];

    CGPoint tableViewCenter = [tableView contentOffset];
    tableViewCenter.y += myTable.frame.size.height/2;

    [tableView setContentOffset:CGPointMake(0,theCell.center.y-65) animated:YES];
    [tableView reloadData]; 
 }

The coalesce() is the best solution when there are multiple columns [and]/[or] values and you want the first one. However, looking at books on-line, the query optimize converts it to a case statement.

MSDN excerpt

The COALESCE expression is a syntactic shortcut for the CASE expression.

That is, the code COALESCE(expression1,...n) is rewritten by the query optimizer as the following CASE expression:

CASE
   WHEN (expression1 IS NOT NULL) THEN expression1
   WHEN (expression2 IS NOT NULL) THEN expression2
   ...
   ELSE expressionN
END

With that said, why not a simple ISNULL()? Less code = better solution?

Here is a complete code snippet.

-- drop the test table
drop table #temp1
go

-- create test table
create table #temp1
(
    issue varchar(100) NOT NULL,
    total_amount int NULL
); 
go

-- create test data
insert into #temp1 values
    ('No nulls here', 12),
    ('I am a null', NULL);
go

-- isnull works fine
select
    isnull(total_amount, 0) as total_amount  
from #temp1

Last but not least, how are you getting null values into a NOT NULL column?

I had to change the table definition so that I could setup the test case. When I try to alter the table to NOT NULL, it fails since it does a nullability check.

-- this alter fails
alter table #temp1 alter column total_amount int NOT NULL

Both <ins>text</ins> and <span style="text-decoration:underline">text</span> work perfectly in Joplin, although I agree with @nfm that underlined text looks like a link and can be misleading in Markdown.

simpledb.execSQL("CREATE TABLE IF NOT EXISTS " + tablename + "(id INTEGER PRIMARY KEY   AUTOINCREMENT,lat double,lng double,address varchar)");
            simpledb.execSQL("insert into '" + tablename + "'(lat,lng,address)values('22.2891001','70.780154','craftbox');");
            simpledb.execSQL("insert into '" + tablename + "'(lat,lng,address)values('22.2901396','70.7782428','kotecha');");//22.2904718 //70.7783906
            simpledb.execSQL("insert into '" + tablename + "'(lat,lng,address)values('22.2863155','70.772108','kkv Hall');");
            simpledb.execSQL("insert into '" + tablename + "'(lat,lng,address)values('22.275993','70.778076','nana mava');");
            simpledb.execSQL("insert into '" + tablename + "'(lat,lng,address)values('22.2667148','70.7609386','Govani boys hostal');");


    double curentlat=22.2667258;  //22.2677258
    double curentlong=70.76096826;//70.76096826

    double curentlat1=curentlat+0.0010000;
    double curentlat2=curentlat-0.0010000;

    double curentlong1=curentlong+0.0010000;
    double curentlong2=curentlong-0.0010000;

    try{

        Cursor c=simpledb.rawQuery("select * from '"+tablename+"' where (lat BETWEEN '"+curentlat2+"' and '"+curentlat1+"') or (lng BETWEEN         '"+curentlong2+"' and '"+curentlong1+"')",null);

        Log.d("SQL ", c.toString());
        if(c.getCount()>0)
        {
            while (c.moveToNext())
            {
                double d=c.getDouble(1);
                double d1=c.getDouble(2);

            }
        }
    }
    catch (Exception e)
    {
        e.printStackTrace();
    }

I also got this terrible error and found a solution for this...

1. Right Click on the Solution name
2. Click Clean Solution
3. Restart Visual Studio
4. Goto project Properties >> Build
5. Change Configuration to Release
6. Start Debugging (F5)

1) , 2)

4) , 5)

Hope this will help you also.

If you load a page in your browser using HTTPS, the browser will refuse to load any resources over HTTP. As you've tried, changing the API URL to have HTTPS instead of HTTP typically resolves this issue. However, your API must not allow for HTTPS connections. Because of this, you must either force HTTP on the main page or request that they allow HTTPS connections.

Note on this: The request will still work if you go to the API URL instead of attempting to load it with AJAX. This is because the browser is not loading a resource from within a secured page, instead it's loading an insecure page and it's accepting that. In order for it to be available through AJAX, though, the protocols should match.

I recommend you to use a HTML parser. Just find the fastest one.

Parsing HTML is not as easy as it may seem.

Browsers parse invalid UTF-8 sequences, in UTF-8 HTML documents, just putting the "?" symbol. So once the invalid UTF-8 sequence in the HTML gets parsed the resulting text is a valid string.

Even inside attribute values you have to decode HTML entities like amp

Here is a great question that sums up why you can not reliably parse HTML with a regular expression: RegEx match open tags except XHTML self-contained tags

This works for MySQL and is really just an implicit transaction but it should go something like this:

UPDATE Table1 t1, Table2 t2 SET 
t2.field = t2.field+2,
t1.field = t1.field+2

WHERE t1.id = t2.foreign_id and t2.id = '123414'

if you are doing updates to multi tables that require multi statements… which is likely possible if you update one, then another based on other conditions… you should use a transaction. 

You can pre-fetch your data by using Resolvers in Angular2+, Resolvers process your data before your Component fully be loaded.

There are many cases that you want to load your component only if there is certain thing happening, for example navigate to Dashboard only if the person already logged in, in this case Resolvers are so handy.

Look at the simple diagram I created for you for one of the way you can use the resolver to send the data to your component.

Applying Resolver to your code is pretty simple, I created the snippets for you to see how the Resolver can be created:

import { Injectable } from '@angular/core';
import { Router, Resolve, RouterStateSnapshot, ActivatedRouteSnapshot } from '@angular/router';
import { MyData, MyService } from './my.service';

@Injectable()
export class MyResolver implements Resolve<MyData> {
  constructor(private ms: MyService, private router: Router) {}

  resolve(route: ActivatedRouteSnapshot, state: RouterStateSnapshot): Promise<MyData> {
    let id = route.params['id'];

    return this.ms.getId(id).then(data => {
      if (data) {
        return data;
      } else {
        this.router.navigate(['/login']);
        return;
      }
    });
  }
}

and in the module:

import { MyResolver } from './my-resolver.service';

@NgModule({
  imports: [
    RouterModule.forChild(myRoutes)
  ],
  exports: [
    RouterModule
  ],
  providers: [
    MyResolver
  ]
})
export class MyModule { }

and you can access it in your Component like this:

/////
 ngOnInit() {
    this.route.data
      .subscribe((data: { mydata: myData }) => {
        this.id = data.mydata.id;
      });
  }
/////

And in the Route something like this (usually in the app.routing.ts file):

////
{path: 'yourpath/:id', component: YourComponent, resolve: { myData: MyResolver}}
////

Something like this

<html>
  <body style="height:100%; width:100%">
    <div id="header" style="position:absolute; top:0px; left:0px; height:200px; right:0px;overflow:hidden;"> 
    </div> 
    <div id="content" style="position:absolute; top:200px; bottom:200px; left:0px; right:0px; overflow:auto;"> 
    </div> 
    <div id="footer" style="position:absolute; bottom:0px; height:200px; left:0px; right:0px; overflow:hidden;"> 
    </div>
  </body>
</html> 

After searching around a bit, the best solution in my opinion makes use of hudson.model.EnvironmentContributingAction.

import hudson.model.EnvironmentContributingAction
import hudson.model.AbstractBuild 
import hudson.EnvVars

class BuildVariableInjector {

    def build
    def out

    def BuildVariableInjector(build, out) {
        this.build = build
        this.out = out
    }

    def addBuildEnvironmentVariable(key, value) {
        def action = new VariableInjectionAction(key, value)
        build.addAction(action)
        //Must call this for action to be added
        build.getEnvironment()
    }

    class VariableInjectionAction implements EnvironmentContributingAction {

        private String key
        private String value

        public VariableInjectionAction(String key, String value) {
            this.key = key
            this.value = value
        }

        public void buildEnvVars(AbstractBuild build, EnvVars envVars) {

            if (envVars != null && key != null && value != null) {
                envVars.put(key, value);
            }
        }

        public String getDisplayName() {
            return "VariableInjectionAction";
        }

        public String getIconFileName() {
            return null;
        }

        public String getUrlName() {
            return null;
        }
    }    
}

I use this class in a system groovy script (using the groovy plugin) within a job.

import hudson.model.*
import java.io.File;
import jenkins.model.Jenkins;    

def jenkinsRootDir = build.getEnvVars()["JENKINS_HOME"];
def parent = getClass().getClassLoader()
def loader = new GroovyClassLoader(parent)

def buildVariableInjector = loader.parseClass(new File(jenkinsRootDir + "/userContent/GroovyScripts/BuildVariableInjector.groovy")).newInstance(build, getBinding().out)

def projectBranchDependencies = [] 
//Some logic to set projectBranchDependencies variable

buildVariableInjector.addBuildEnvironmentVariable("projectBranchDependencies", projectBranchDependencies.join(","));

You can then access the projectBranchDependencies variable at any other point in your build, in my case, from an ANT script.

Note: I borrowed / modified the ideas for parts of this implementation from a blog post, but at the time of this posting I was unable to locate the original source in order to give due credit.

Angular is based on observable instead of promise base as of angularjs 1.x, so when we try to get data using http it returns observable instead of promise, like you did

 return this.http
      .get(this.configEndPoint)
      .map(res => res.json());

then to get data and show on view we have to convert it into desired form using RxJs functions like .map() function and .subscribe()

.map() is used to convert the observable (received from http request)to any form like .json(), .text() as stated in Angular's official website,

.subscribe() is used to subscribe those observable response and ton put into some variable so from which we display it into the view

this.myService.getConfig().subscribe(res => {
   console.log(res);
   this.data = res;
});

That is a self-invoking anonymous function.

Check out the W3Schools explanation of a self-invoking function.

Function expressions can be made "self-invoking".

A self-invoking expression is invoked (started) automatically, without being called.

Function expressions will execute automatically if the expression is followed by ().

You cannot self-invoke a function declaration.

Try this code,

this.startActivity(new Intent(v.getContext(), newactivity.class).addFlags(Intent.FLAG_ACTIVITY_NO_ANIMATION));

I found that the user control must have a parameterless constructor or it won't show up in the list. at least that was true in vs2005.

Just in case it helps someone, since these questions (and answers) helped me really much; I decided to create an alias that runs these 4 commands in a row:

Just add the following line to your ~/.bashrc file (modify the main keyword accordingly to the name of your .tex and .bib files)

alias texbib = 'pdflatex main.tex && bibtex main && pdflatex main.tex && pdflatex main.tex'

And now, by just executing the texbib command (alias), all these commands will be executed sequentially.

A great way of handling this is with regular expressions.

string modifiedString = Regex.Replace(originalString, @"(\r\n)|\n|\r", "<br/>");

This will replace any of the 3 legal types of newline with the html tag.

src={"/images/resto.png"}

Using of src attribute in this way means, your image will be loaded from the absolute path "/images/resto.png" for your site. Images directory should be located at the root of your site. Example: http://www.example.com/images/resto.png

One way is to: (Assumes index column begins at A1)

MsgBox Range("A1").End(xlDown).Row

Which is looking for the 1st unoccupied cell downwards from A1 and showing you its ordinal row number.

You can select the next empty cell with:

Range("A1").End(xlDown).Offset(1, 0).Select

If you need the end of a dataset (including blanks), try: Range("A:A").SpecialCells(xlLastCell).Row

I'm surprised nobody has mentioned the awesome pathlib to do this job.

If you only want to remove files in a directory it can be a oneliner

from pathlib import Path

[f.unlink() for f in Path("/path/to/folder").glob("*") if f.is_file()] 

To also recursively remove directories you can write something like this:

from pathlib import Path
from shutil import rmtree

for path in Path("/path/to/folder").glob("**/*"):
    if path.is_file():
        path.unlink()
    elif path.is_dir():
        rmtree(path)

The date time you're passing is not a iso local date time format.

Change to

@Column(name = "start_date")
@DateTimeFormat(iso = DateTimeFormatter.ISO_LOCAL_DATE_TIME)
@JsonFormat(pattern = "YYYY-MM-dd HH:mm")
private LocalDateTime startDate;

and pass date string in the format '2011-12-03T10:15:30'.

But if you still want to pass your custom format, use just have to specify the right formatter.

Change to

@Column(name = "start_date")
@DateTimeFormat(iso = DateTimeFormatter.ofPattern("yyyy-MM-dd HH:mm"))
@JsonFormat(pattern = "YYYY-MM-dd HH:mm")
private LocalDateTime startDate;

I think your problem is the @DateTimeFormat has no effect at all. As the jackson is doing the deseralization and it doesnt know anything about spring annotation and I dont see spring scanning this annotation in the deserialization context.

Alternatively, you can try setting the formatter while registering the java time module.

LocalDateTimeDeserializer localDateTimeDeserializer = new LocalDateTimeDeserializer(DateTimeFormatter.ofPattern("yyyy-MM-dd HH:mm"));
module.addDeserializer(LocalDateTime.class, localDateTimeDeserializer);

Here is the test case with the deseralizer which works fine. May be try to get rid of that DateTimeFormat annotation altogether.

@RunWith(JUnit4.class)
public class JacksonLocalDateTimeTest {

    private ObjectMapper objectMapper;

    @Before
    public void init() {
        JavaTimeModule module = new JavaTimeModule();
        LocalDateTimeDeserializer localDateTimeDeserializer =  new LocalDateTimeDeserializer(DateTimeFormatter.ofPattern("yyyy-MM-dd HH:mm"));
        module.addDeserializer(LocalDateTime.class, localDateTimeDeserializer);
        objectMapper = Jackson2ObjectMapperBuilder.json()
                .modules(module)
                .featuresToDisable(SerializationFeature.WRITE_DATES_AS_TIMESTAMPS)
                .build();
    }

    @Test
    public void test() throws IOException {
        final String json = "{ \"date\": \"2016-11-08 12:00\" }";
        final JsonType instance = objectMapper.readValue(json, JsonType.class);

        assertEquals(LocalDateTime.parse("2016-11-08 12:00",DateTimeFormatter.ofPattern("yyyy-MM-dd HH:mm") ), instance.getDate());
    }
}


class JsonType {
    private LocalDateTime date;

    public LocalDateTime getDate() {
        return date;
    }

    public void setDate(LocalDateTime date) {
        this.date = date;
    }
}

As @MatrixFrog pointed out in their comment, if the goal is to edit the config, you might want to run:

git config --global --edit

This command will open the config file (in this case, the --global one) in the editor of choice, and await for the file to be closed (just like during git rebase -i).

Use the android.support.v4.graphics.drawable.DrawableCompat:

            Drawable progressDrawable = progressBar.getIndeterminateDrawable();
            if (progressDrawable  != null) {
                Drawable mutateDrawable = progressDrawable.mutate();
                DrawableCompat.setTint(mutateDrawable, primaryColor);
                progressBar.setProgressDrawable(mutateDrawable);
            }

It seems that RouteParams no longer exists, and is replaced by ActivatedRoute. ActivatedRoute gives us access to the matrix URL notation Parameters. If we want to get Query string ? paramaters we need to use Router.RouterState. The traditional query string paramaters are persisted across routing, which may not be the desired result. Preserving the fragment is now optional in router 3.0.0-rc.1.

import { Router, ActivatedRoute } from '@angular/router';
@Component ({...})
export class paramaterDemo {
  private queryParamaterValue: string;
  private matrixParamaterValue: string;
  private querySub: any;
  private matrixSub: any;

  constructor(private router: Router, private route: ActivatedRoute) { }
  ngOnInit() {
    this.router.routerState.snapshot.queryParams["queryParamaterName"];
    this.querySub = this.router.routerState.queryParams.subscribe(queryParams => 
      this.queryParamaterValue = queryParams["queryParameterName"];
    );

    this.route.snapshot.params["matrixParameterName"];
    this.route.params.subscribe(matrixParams =>
      this.matrixParamterValue = matrixParams["matrixParameterName"];
    );
  }

  ngOnDestroy() {
    if (this.querySub) {
      this.querySub.unsubscribe();
    }
    if (this.matrixSub) {
      this.matrixSub.unsubscribe();
    }
  }
}

We should be able to manipulate the ? notation upon navigation, as well as the ; notation, but I only gotten the matrix notation to work yet. The plnker that is attached to the latest router documentation shows it should look like this.

let sessionId = 123456789;
let navigationExtras = {
  queryParams: { 'session_id': sessionId },
  fragment: 'anchor'
};

// Navigate to the login page with extras
this.router.navigate(['/login'], navigationExtras);

If you are getting $scope binding errors make sure you wrap the click event code on a setTimeout Function.

VIEW

<input id="upload"
    type="file"
    ng-file-select="onFileSelect($files)"
    style="display: none;">

<button type="button"
    ng-click="clickUpload()">Upload</button>

CONTROLLER

$scope.clickUpload = function(){
    setTimeout(function () {
      angular.element('#upload').trigger('click');
    }, 0);
};

My approach, i think coming more from an development than an operations point of view, is:

• Error means that the execution of some task could not be completed; an email couldn't be sent, a page couldn't be rendered, some data couldn't be stored to a database, something like that. Something has definitively gone wrong.
• Warning means that something unexpected happened, but that execution can continue, perhaps in a degraded mode; a configuration file was missing but defaults were used, a price was calculated as negative, so it was clamped to zero, etc. Something is not right, but it hasn't gone properly wrong yet - warnings are often a sign that there will be an error very soon.
• Info means that something normal but significant happened; the system started, the system stopped, the daily inventory update job ran, etc. There shouldn't be a continual torrent of these, otherwise there's just too much to read.
• Debug means that something normal and insignificant happened; a new user came to the site, a page was rendered, an order was taken, a price was updated. This is the stuff excluded from info because there would be too much of it.
• Trace is something i have never actually used.

Also when I hit the post(Config.getURL("login"), values) the app seems to pause for a while (seems weird - thought the idea behind a service was that it runs on a different thread!)

No you have to create a thread yourself, a Local service runs in the UI thread by default.

For anyone looking for a regex:

const BLACKLIST = /[<>:"\/\\|?*]/g;

What you have to do is to set the MinimumHeight property of the row. Not only the Height property. That's the key. Put the code bellow in the CellPainting event of the datagridview

private void dataGridView1_CellPainting(object sender, DataGridViewCellPaintingEventArgs e)
{
   foreach(DataGridViewRow x in dataGridView1.Rows)
   {
     x.MinimumHeight = 50;
   }
}

In the current version of Sublime Text 2 (Build: 2139), you can set the syntax for all files of a certain file extension using an option in the menu bar. Open a file with the extension you want to set a default for and navigate through the following menus: View -> Syntax -> Open all with current extension as... ->[your syntax choice].

Updated 2012-06-28: Recent builds of Sublime Text 2 (at least since Build 2181) have allowed the syntax to be set by clicking the current syntax type in the lower right corner of the window. This will open the syntax selection menu with the option to Open all with current extension as... at the top of the menu.

Updated 2016-04-19: As of now, this also works for Sublime Text 3.

In Windows -> use Command Promt:

tnsping localhost

It show the version and if is installed 32 o 64 bit client, for example:

TNS Ping Utility for 64-bit Windows: Version 10.2.0.4.0 - Production on 03-MAR-2015 16:47:26

Source: https://decipherinfosys.wordpress.com/2007/02/10/checking-for-oracle-client-version-on-windows/

The problem is an issue of semantic meaning (as BoltClock mentions) and visual rendering.

Originally HTML used <b> and <i> for these purposes, entirely stylistic commands, laid down in the semantic environment of the document markup. CSS is an attempt to separate out as far as possible the stylistic elements of the medium. Thus style information such as bold and italics should go in CSS.

<strong> and <em> were introduced to fill the semantic need for text to be marked as more important or stressed. They have default stylistic interpretations akin to bold and italic, but they are not bound to that fate.

    wp_register_script('custom-js',WP_PLUGIN_URL.'/PLUGIN_NAME/js/custom.js',array(),NULL,true);
    wp_enqueue_script('custom-js');

    $wnm_custom = array( 'template_url' => get_bloginfo('template_url') );
    wp_localize_script( 'custom-js', 'wnm_custom', $wnm_custom );

and in custom.js

alert(wnm_custom.template_url);

Player[] players = Stream.iterate(0, x-> x+1 ).limit(PlayerCount).map(i -> new Player(i)).toArray(Player[]::new);

You can write following codes to achieve this task:

SELECT ... FROM ... WHERE ... 
INTO OUTFILE 'textfile.csv'
FIELDS TERMINATED BY '|'

It export the result to CSV and then export it to excel sheet.

I had the same problem. In my case I just overwrote the file

GoogleService-Info.plist

on that path:

Platform\ios\YOUR_APP_NAME\Resources\Resources

In my case the files were present without data.

This would be work very fine

<a href="<%:Url.Action("Edit","Account",new {  id=item.UserId }) %>"><img src="../../Content/ThemeNew/images/edit_notes_delete11.png" alt="Edit" width="25px" height="25px" /></a>

The code using NetworkInterface to wait for the network worked for me until I switched from fixed network address to DHCP. A slight enhancement makes it work also with DHCP:

Enumeration<NetworkInterface> interfaces = NetworkInterface.getNetworkInterfaces();
while (interfaces.hasMoreElements()) {
    NetworkInterface interf = interfaces.nextElement();
    if (interf.isUp() && !interf.isLoopback()) {
    List<InterfaceAddress> adrs = interf.getInterfaceAddresses();
    for (Iterator<InterfaceAddress> iter = adrs.iterator(); iter.hasNext();) {
        InterfaceAddress adr = iter.next();
        InetAddress inadr = adr.getAddress();
        if (inadr instanceof Inet4Address) return true;
            }
    }
}

This works for Java 7 in openSuse 13.1 for IPv4 network. The problem with the original code is that although the interface was up after resuming from suspend, an IPv4 network address was not yet assigned. After waiting for this assignment, the program can connect to servers. But I have no idea what to do in case of IPv6.

I find it simplest to subclass the button inside your cell (Swift 3):

class MyCellInfoButton: UIButton {
    var indexPath: IndexPath?
}

In your cell class:

class MyCell: UICollectionViewCell {
    @IBOutlet weak var infoButton: MyCellInfoButton!
   ...
}

In the table view's or collection view's data source, when dequeueing the cell, give the button its index path:

cell.infoButton.indexPath = indexPath

So you can just put these code into your table view controller:

@IBAction func handleTapOnCellInfoButton(_ sender: MyCellInfoButton) {
        print(sender.indexPath!) // Do whatever you want with the index path!
}

And don't forget to set the button's class in your Interface Builder and link it to the handleTapOnCellInfoButton function!

edited:

Using dependency injection. To set up calling a closure:

class MyCell: UICollectionViewCell {
    var someFunction: (() -> Void)?
    ...
    @IBAction func didTapInfoButton() {
        someFunction?()
    }
}

and inject the closure in the willDisplay method of the collection view's delegate:

 func collectionView(_ collectionView: UICollectionView, willDisplay cell: UICollectionViewCell, forItemAt indexPath: IndexPath) {
    (cell as? MyCell)?.someFunction = {
        print(indexPath) // Do something with the indexPath.
    }
}

It seems that you need to wait for the page to be reloaded before clicking on the "Add" button. In this case you could wait for the "Add Item" element to become stale before clicking on the reloaded element:

WebDriverWait wait = new WebDriverWait(driver, 20);
By addItem = By.xpath("//input[.='Add Item']");

// get the "Add Item" element
WebElement element = wait.until(ExpectedConditions.presenceOfElementLocated(addItem));

//trigger the reaload of the page
driver.findElement(By.id("...")).click();

// wait the element "Add Item" to become stale
wait.until(ExpectedConditions.stalenessOf(element));

// click on "Add Item" once the page is reloaded
wait.until(ExpectedConditions.presenceOfElementLocated(addItem)).click();

You can catch it like any other exception:

try {
  foo();
}
catch (const std::bad_alloc&) {
  return -1;
}

Quite what you can usefully do from this point is up to you, but it's definitely feasible technically.

In general you cannot, and should not try, to respond to this error. bad_alloc indicates that a resource cannot be allocated because not enough memory is available. In most scenarios your program cannot hope to cope with that, and terminating soon is the only meaningful behaviour.

Worse, modern operating systems often over-allocate: on such systems, malloc and new can return a valid pointer even if there is not enough free memory left – std::bad_alloc will never be thrown, or is at least not a reliable sign of memory exhaustion. Instead, attempts to access the allocated memory will then result in a segmentation fault, which is not catchable (you can handle the segmentation fault signal, but you cannot resume the program afterwards).

The only thing you could do when catching std::bad_alloc is to perhaps log the error, and try to ensure a safe program termination by freeing outstanding resources (but this is done automatically in the normal course of stack unwinding after the error gets thrown if the program uses RAII appropriately).

In certain cases, the program may attempt to free some memory and try again, or use secondary memory (= disk) instead of RAM but these opportunities only exist in very specific scenarios with strict conditions:

1. The application must ensure that it runs on a system that does not overcommit memory, i.e. it signals failure upon allocation rather than later.
2. The application must be able to free memory immediately, without any further accidental allocations in the meantime.

It’s exceedingly rare that applications have control over point 1 — userspace applications never do, it’s a system-wide setting that requires root permissions to change.¹

OK, so let’s assume you’ve fixed point 1. What you can now do is for instance use a LRU cache for some of your data (probably some particularly large business objects that can be regenerated or reloaded on demand). Next, you need to put the actual logic that may fail into a function that supports retry — in other words, if it gets aborted, you can just relaunch it:

lru_cache<widget> widget_cache;

double perform_operation(int widget_id) {
    std::optional<widget> maybe_widget = widget_cache.find_by_id(widget_id);
    if (not maybe_widget) {
        maybe_widget = widget_cache.store(widget_id, load_widget_from_disk(widget_id));
    }
    return maybe_widget->frobnicate();
}

…

for (int num_attempts = 0; num_attempts < MAX_NUM_ATTEMPTS; ++num_attempts) {
    try {
        return perform_operation(widget_id);
    } catch (std::bad_alloc const&) {
        if (widget_cache.empty()) throw; // memory error elsewhere.
        widget_cache.remove_oldest();
    }
}

// Handle too many failed attempts here.

But even here, using std::set_new_handler instead of handling std::bad_alloc provides the same benefit and would be much simpler.

¹ If you’re creating an application that does control point 1, and you’re reading this answer, please shoot me an email, I’m genuinely curious about your circumstances.

What is the C++ Standard specified behavior of new in c++?

The usual notion is that if new operator cannot allocate dynamic memory of the requested size, then it should throw an exception of type std::bad_alloc.
However, something more happens even before a bad_alloc exception is thrown:

C++03 Section 3.7.4.1.3: says

An allocation function that fails to allocate storage can invoke the currently installed new_handler(18.4.2.2), if any. [Note: A program-supplied allocation function can obtain the address of the currently installed new_handler using the set_new_handler function (18.4.2.3).] If an allocation function declared with an empty exception-specification (15.4), throw(), fails to allocate storage, it shall return a null pointer. Any other allocation function that fails to allocate storage shall only indicate failure by throw-ing an exception of class std::bad_alloc (18.4.2.1) or a class derived from std::bad_alloc.

Consider the following code sample:

#include <iostream>
#include <cstdlib>

// function to call if operator new can't allocate enough memory or error arises
void outOfMemHandler()
{
    std::cerr << "Unable to satisfy request for memory\n";

    std::abort();
}

int main()
{
    //set the new_handler
    std::set_new_handler(outOfMemHandler);

    //Request huge memory size, that will cause ::operator new to fail
    int *pBigDataArray = new int[100000000L];

    return 0;
}

In the above example, operator new (most likely) will be unable to allocate space for 100,000,000 integers, and the function outOfMemHandler() will be called, and the program will abort after issuing an error message.

As seen here the default behavior of new operator when unable to fulfill a memory request, is to call the new-handler function repeatedly until it can find enough memory or there is no more new handlers. In the above example, unless we call std::abort(), outOfMemHandler() would be called repeatedly. Therefore, the handler should either ensure that the next allocation succeeds, or register another handler, or register no handler, or not return (i.e. terminate the program). If there is no new handler and the allocation fails, the operator will throw an exception.

What is the new_handler and set_new_handler?

new_handler is a typedef for a pointer to a function that takes and returns nothing, and set_new_handler is a function that takes and returns a new_handler.

Something like:

typedef void (*new_handler)();
new_handler set_new_handler(new_handler p) throw();

set_new_handler's parameter is a pointer to the function operator new should call if it can't allocate the requested memory. Its return value is a pointer to the previously registered handler function, or null if there was no previous handler.

How to handle out of memory conditions in C++?

Given the behavior of newa well designed user program should handle out of memory conditions by providing a proper new_handlerwhich does one of the following:

Make more memory available: This may allow the next memory allocation attempt inside operator new's loop to succeed. One way to implement this is to allocate a large block of memory at program start-up, then release it for use in the program the first time the new-handler is invoked.

Install a different new-handler: If the current new-handler can't make any more memory available, and of there is another new-handler that can, then the current new-handler can install the other new-handler in its place (by calling set_new_handler). The next time operator new calls the new-handler function, it will get the one most recently installed.

(A variation on this theme is for a new-handler to modify its own behavior, so the next time it's invoked, it does something different. One way to achieve this is to have the new-handler modify static, namespace-specific, or global data that affects the new-handler's behavior.)

Uninstall the new-handler: This is done by passing a null pointer to set_new_handler. With no new-handler installed, operator new will throw an exception ((convertible to) std::bad_alloc) when memory allocation is unsuccessful.

Throw an exception convertible to std::bad_alloc. Such exceptions are not be caught by operator new, but will propagate to the site originating the request for memory.

Not return: By calling abort or exit.

Use svn merge:

svn merge -c -[rev num that deleted the file] http://<path to repository>

So an example:

svn merge -c -12345 https://svn.mysite.com/svn/repo/project/trunk
             ^ The negative is important

For TortoiseSVN (I think...)

• Right click in Explorer, go to TortoiseSVN -> Merge...
• Make sure "Merge a range of revisions" is selected, click Next
• In the "Revision range to merge" textbox, specify the revision that removed the file
• Check the "Reverse merge" checkbox, click Next
• Click Merge

That is completely untested, however.

Edited by OP: This works on my version of TortoiseSVN (the old kind without the next button)

• Go to the folder that stuff was delated from
• Right click in Explorer, go to TortoiseSVN -> Merge...
• in the From section enter the revision that did the delete
• in the To section enter the revision before the delete.
• Click "merge"
• commit

The trick is to merge backwards. Kudos to sean.bright for pointing me in the right direction!

Edit: We are using different versions. The method I described worked perfectly with my version of TortoiseSVN.

Also of note is that if there were multiple changes in the commit you are reverse merging, you'll want to revert those other changes once the merge is done before you commit. If you don't, those extra changes will also be reversed.

A bit late to the party, but JQuery change inner text but preserve html has at least one approach not mentioned here:

var $td = $("#demoTable td");
$td.html($td.html().replace('Tap on APN and Enter', 'new text'));

Without fixing the text, you could use (snother)[https://stackoverflow.com/a/37828788/1587329]:

var $a = $('#demoTable td');
var inner = '';
$a.children.html().each(function() {
    inner = inner + this.outerHTML;
});
$a.html('New text' + inner);

Considering you have 3 nodes.

Prepare your cluster

export ES_HOST=localhost:9200

# Disable shard allocation
curl -X PUT "$ES_HOST/_cluster/settings" -H 'Content-Type: application/json' -d'
{
  "persistent": {
    "cluster.routing.allocation.enable": "none"
  }
}
'

# Stop non-essential indexing and perform a synced flush
curl -X POST "$ES_HOST/_flush/synced"

Stop elasticsearch service in each node

# check nodes
export ES_HOST=localhost:9200
curl -X GET "$ES_HOST/_cat/nodes"

# node 1
systemctl stop elasticsearch.service

# node 2
systemctl stop elasticsearch.service

# node 3
systemctl stop elasticsearch.service

Restarting cluster again

# start
systemctl start elasticsearch.service

# Reenable shard allocation once the node has joined the cluster
curl -X PUT "$ES_HOST/_cluster/settings" -H 'Content-Type: application/json' -d'
{
  "persistent": {
    "cluster.routing.allocation.enable": null
  }
}
'

Tested on Elasticseach 6.5

Source:

1. https://www.elastic.co/guide/en/elasticsearch/reference/6.5/stopping-elasticsearch.html
2. https://www.elastic.co/guide/en/elasticsearch/reference/6.5/rolling-upgrades.html

Use following html

<link rel="stylesheet" href="app/components/directives/navBar/navBar.scss"/>
<nav class="navbar navbar-default" role="navigation">
    <div class="container-fluid">
        <!-- Collect the nav links, forms, and other content for toggling -->
            <ul class="nav navbar-nav">
                <li><h5><a href="#/">Home</a></h5></li>
                <li>|</li>
                <li><h5><a href="#products">About</a></h5></li>
                <li>|</li>
                <li><h5><a href="#">Contacts</a></h5></li>
                <li>|</li>
                <li><h5><a href="#cart">Cart</a></h5></li>
            </ul>
    </div><!-- /.container-fluid -->
</nav>

And css

.navbar-nav {
  width: 100%;
  text-align: center;
}
.navbar-nav > li {
  float: none;
  display: inline-block;
}
.navbar-default {
  background-color: white;
  border-color: white;
}
.navbar-default .navbar-nav>.active>a, .navbar-default .navbar-nav>.active>a:hover, .navbar-default .navbar-nav>.active>a:focus{
  background-color:white;
}

Modify according to your needs

Best way to do this is to use a function:

<div ng-repeat="product in products | filter: myFilter">

$scope.myFilter = function (item) { 
    return item === 'red' || item === 'blue'; 
};

Alternatively, you can use ngHide or ngShow to dynamically show and hide elements based on a certain criteria.

I believe spaces must be encoded as:

• %20 when used inside URL path component
• + when used inside URL query string component or form data (see 17.13.4 Form content types)

The following example shows the correct use of rawurlencode and urlencode:

echo "http://example.com"
    . "/category/" . rawurlencode("latest songs")
    . "/search?q=" . urlencode("lady gaga");

Output:

http://example.com/category/latest%20songs/search?q=lady+gaga

What happens if you encode path and query string components the other way round? For the following example:

http://example.com/category/latest+songs/search?q=lady%20gaga

• The webserver will look for the directory latest+songs instead of latest songs
• The query string parameter q will contain lady gaga

Remove these two lines:

xmlHttp.setRequestHeader("Content-length", params.length);
xmlHttp.setRequestHeader("Connection", "close");

XMLHttpRequest isn't allowed to set these headers, they are being set automatically by the browser. The reason is that by manipulating these headers you might be able to trick the server into accepting a second request through the same connection, one that wouldn't go through the usual security checks - that would be a security vulnerability in the browser.

Use Object.entries() function.

Object.entries(object) return:

[
    [key, value],
    [key, value],
    ...
]

see https://developer.mozilla.org/en-US/docs/Web/JavaScript/Reference/Global_Objects/Object/entries

{Object.entries(subjects).map(([key, subject], i) => (
    <li className="travelcompany-input" key={i}>
        <span className="input-label">key: {i} Name: {subject.name}</span>
    </li>
))}

This is the btn click event

btnvideo.setOnClickListener(new OnClickListener() {

public void onClick(View v) {

    startActivity(new Intent(Intent.ACTION_VIEW,Uri.parse("http://www.youtube.com/watch?v=Hxy8BZGQ5Jo")));
    Log.i("Video", "Video Playing....");

    }
}); 

this type it opened in another page with the youtube where u can show your video

I have used Unlocker for years and really like it. It not only will identify programs and offer to unlock the folder\file, it will allow you to kill the processing that has the lock as well.

Additionally, it offers actions to do to the locked file in question such as deleting it.

Unlocker helps delete locked files with error messages including "cannot delete file," and "access is denied." Video tutorial available.

Some errors you might get that Unlocker can help with include:

• Cannot delete file: Access is denied.
• There has been a sharing violation.
• The source or destination file may be in use.
• The file is in use by another program or user.
• Make sure the disk is not full or write-protected and that the file is not currently in use.

Best Solution to print any text in red color in Java is:

System.err.print("Hello World");

Update

As of 17th May 2017 the README of autoenv states that direnv is probably the better option and implies autoenv is no longer maintained.

Old answer

I wrote autoenv to do exactly this:

https://github.com/kennethreitz/autoenv

I'd recommend using nlargest for better performance and shorter code. import pandas

df[col_name].value_counts().nlargest(n=1)

You simply can't do that in SQL. You have to explicitly list the fields and concat each one:

SELECT CONCAT(field1, '/'), CONCAT(field2, '/'), ... FROM `socials` WHERE 1

If you are using an app, you can use SQL to read the column names, and then use your app to construct a query like above. See this stackoverflow question to find the column names: Get table column names in mysql?

We used the following mod_rewrite rule:

RewriteEngine on
RewriteCond %{REQUEST_URI} !^/test/
RewriteCond %{REQUEST_URI} !^/my-folder/
RewriteRule (.*) http://www.newdomain.com/$1 [R=301,L]

This redirects (permanently with a 301 redirect) all traffic to the site to http://www.newdomain.com, except requests to resources in the /test and /my-folder directories. We transfer the user to the exact resource they requested by using the (.*) capture group and then including $1 in the new URL. Mind the spaces.

The following should work:

ABC: *\([a-zA-Z]+\) *(.+)

Explanation:

ABC:            # match literal characters 'ABC:'
 *              # zero or more spaces
\([a-zA-Z]+\)   # one or more letters inside of parentheses
 *              # zero or more spaces
(.+)            # capture one or more of any character (except newlines)

To get your desired grouping based on the comments below, you can use the following:

(ABC:) *(\([a-zA-Z]+\).+)

For me the solution was to change the view model. Consider you are searching for invoices. These invoices can be paid or not. So your search has three options: Paid, Unpaid, or "I don't Care".

I had this originally set as a bool? field:

public bool? PaidInvoices { get; set; }

This made me stumble onto this question. I ended up created an Enum type and I handled this as follows:

@Html.RadioButtonFor(m => m.PaidInvoices, PaidStatus.NotSpecified, new { @checked = true })
@Html.RadioButtonFor(m => m.PaidInvoices, PaidStatus.Yes) 
@Html.RadioButtonFor(m => m.PaidInvoices, PaidStatus.No)

Of course I had them wrapped in labels and had text specified, I just mean here's another option to consider.

String newString = originalString.substring(originalString.length()-3);

In case if you are using checkstyle from qulice mvn plugin (https://github.com/teamed/qulice) you may use the following suppresion:

// @checkstyle <Rulename> (N lines)
... code with violation(s)

or

/**
 * ...
 * @checkstyle <Rulename> (N lines)
 * ...
 */
 ... code with violation(s)

you can try this indside findall for loop:

item_price = item.find('span', attrs={'class':'s-item__price'}).text

it extracts only text and assigs it to "item_pice"

Swift 4 without NSString.

extension String {
    func matches(regex: String) -> [String] {
        guard let regex = try? NSRegularExpression(pattern: regex, options: [.caseInsensitive]) else { return [] }
        let matches  = regex.matches(in: self, options: [], range: NSMakeRange(0, self.count))
        return matches.map { match in
            return String(self[Range(match.range, in: self)!])
        }
    }
}

we can do it with a single line of code.

 user1 = pd.read_csv('dataset/1.csv', names=['TIME', 'X', 'Y', 'Z'], header=None)

I recommend trying the Java OCR project on sourceforge.net. I originally developed it, and I have a blog posting on it.

Since I put it up on sourceforge, its functionality been expanded and improved quite a bit through the great work of a volunteer researcher/developer.

Give it a try, and if you don't like it, you can always improve it!

This is one way without using time a zone:

LocalDateTime now = LocalDateTime.now();
long epoch = (now.getLong(ChronoField.EPOCH_DAY) * 86400000) + now.getLong(ChronoField.MILLI_OF_DAY);

alias testcases="sed -n 's/func.*\(Test.*\)(.*/\1/p' | xargs | sed 's/ /|/g'"

go test -v -run $(cat coordinator_test.go | testcases)

http://support.microsoft.com/kb/815065

A DLL is a library that contains code and data that can be used by more than one program at the same time. For example, in Windows operating systems, the Comdlg32 DLL performs common dialog box related functions. Therefore, each program can use the functionality that is contained in this DLL to implement an Open dialog box. This helps promote code reuse and efficient memory usage.

By using a DLL, a program can be modularized into separate components. For example, an accounting program may be sold by module. Each module can be loaded into the main program at run time if that module is installed. Because the modules are separate, the load time of the program is faster, and a module is only loaded when that functionality is requested.

Additionally, updates are easier to apply to each module without affecting other parts of the program. For example, you may have a payroll program, and the tax rates change each year. When these changes are isolated to a DLL, you can apply an update without needing to build or install the whole program again.

http://en.wikipedia.org/wiki/Dynamic-link_library

pdfunite is fine to merge entire PDFs. If you want, for example, pages 2-7 from file1.pdf and pages 1,3,4 from file2.pdf, you have to use pdfseparate to split the files into separate PDFs for each page to give to pdfunite.

At that point you probably want a program with more options. qpdf is the best utility I've found for manipulating PDFs. pdftk is bigger and slower and Red Hat/Fedora don't package it because of its dependency on gcj. Other PDF utilities have Mono or Python dependencies. I found qpdf produced a much smaller output file than using pdfseparate and pdfunite to assemble pages into a 30-page output PDF, 970kB vs. 1,6450 kB. Because it offers many more options, qpdf's command line is not as simple; the original request to merge file1 and file2 can be performed with

qpdf --empty --pages file1.pdf file2.pdf -- merged.pdf

if i understood you can do the following

Right Click on View Name in SQL Server Management Studio -> Script View As ->CREATE To ->New Query Window

Just Store the current time and If it exceeds 30 minutes by comparing then destroy the current session.

MySQL only listens to localhost, if we want to enable the remote access to it, then we need to made some changes in my.cnf file:

sudo nano /etc/mysql/my.cnf

We need to comment out the bind-address and skip-external-locking lines:

#bind-address = 127.0.0.1
# skip-external-locking

After making these changes, we need to restart the mysql service:

sudo service mysql restart

since answers are disappointing I would like suggest a way in which I got deleted stuff back.

I use an ide to code and accidently I used rm -rf from terminal to remove complete folder. Thanks to ide I recoved it back by reverting the change from ide's local history.

(my ide is intelliJ but all ide's support history backup)

I would do something like,

Main

var getPage = get_page
func get_page (...

func downloader() {
    dl_slots = make(chan bool, DL_SLOT_AMOUNT) // Init the download slot semaphore
    content := getPage(BASE_URL)
    links_regexp := regexp.MustCompile(LIST_LINK_REGEXP)
    matches := links_regexp.FindAllStringSubmatch(content, -1)
    for _, match := range matches{
        go serie_dl(match[1], match[2])
    }
}

Test

func TestDownloader (t *testing.T) {
    origGetPage := getPage
    getPage = mock_get_page
    defer func() {getPage = origGatePage}()
    // The rest to be written
}

// define mock_get_page and rest of the codes
func mock_get_page (....

And I would avoid _ in golang. Better use camelCase

In the example code below I use variables just to show how the command could be used for other situations.

FirstCol = 1
LastCol = FirstCol + 5
Range(Columns(FirstCol), Columns(LastCol)).Select

$datetime = DateTime::createFromFormat('Ymd', '20151102');

echo $datetime->format('D');

Put this on an event

$(function(){
    $('.package').click(function(){
       var content = $('.container').html();
       $(this).html(content);
    });
});

To add on to chepner's answer for Python 3.0 you can alternatively do:

x = lambda x: list(map(print, x))

Of course this is only if you have the means of using Python > 3 in the future... Looks a bit cleaner in my opinion, but it also has a weird return value, but you're probably discarding it anyway.

I'll just leave this here for reference.

at process._tickCallback (internal/process/next_tick.js:10
4:9)
npm ERR! code ELIFECYCLE
npm ERR! errno 1
npm ERR! [email protected] sample: `node src/server/dat
a/seed-db.js`
npm ERR! Exit status 1
npm ERR!
npm ERR! Failed at the [email protected] sample script.
npm ERR! This is probably not a problem with npm. There is lik
ely additional logging output above.

npm ERR! A complete log of this run can be found in:

I have the same issue here is how I got solved finally! the error: my error from the terminal when i run npm run sample after correcting my database connection username and password I was using mlab for my database and under the file .env i forget to properly put the user name and password. When I correct that I works.

> [email protected] sample /Users/mohammedr.kemal/Downl
oads/Ex_Files_ANGULAR_API_AUTH/Exercise Files/Ch01/01_04/start
> node src/server/data/seed-db.js

connected to mongodb...
connected to mongodb...
2 records inserted.
closing connection...
done.
12 records inserted.
closing connection...
done.

So it might be good to look any data connection we made in our code if we have.

I had a similar problem with IndentationError in PyCharm.

I could not find any tabs in my code, but once I deleted code AFTER the line with the IndentationError, all was well.

I suspect that you had a tab in the following line: sex = sex if not sex == 2 else random.randint(0,1)

To use % instead of px or em with @Gaurav's answer, it's just

<div class="home-component" [style.width.%]="80" [style.height.%]="95">
Some stuff in this div</div>

I had this problem as well, until I came up with this method.

public static int[] indexesOf(String s, String flag) {
    int flagLen = flag.length();
    String current = s;
    int[] res = new int[s.length()];
    int count = 0;
    int base = 0;
    while(current.contains(flag)) {
        int index = current.indexOf(flag);
        res[count] = index + base;
        base += index + flagLen;
        current = current.substring(current.indexOf(flag) + flagLen, current.length());
        ++ count;
    }
    return Arrays.copyOf(res, count);
}

This method can be used to find indexes of any flag of any length in a string, for example:

public class Main {

    public static void main(String[] args) {
        int[] indexes = indexesOf("Hello, yellow jello", "ll");

        // Prints [2, 9, 16]
        System.out.println(Arrays.toString(indexes));
    }

    public static int[] indexesOf(String s, String flag) {
        int flagLen = flag.length();
        String current = s;
        int[] res = new int[s.length()];
        int count = 0;
        int base = 0;
        while(current.contains(flag)) {
            int index = current.indexOf(flag);
            res[count] = index + base;
            base += index + flagLen;
            current = current.substring(current.indexOf(flag) + flagLen, current.length());
            ++ count;
        }
        return Arrays.copyOf(res, count);
    }
}

Although this question is quite old, and the accepted response is valid, I find it a bit unconfortable because the content of the HTTP response (HTML, XML, JSON, binary or whatever) becomes mixed with the headers.

I've found a different alternative. CURL provides an option (CURLOPT_HEADERFUNCTION) to set a callback that will be called for each response header line. The function will receive the curl object and a string with the header line.

You can use a code like this (adapted from TML response):

$cookies = Array();
$ch = curl_init('http://www.google.com/');
// Ask for the callback.
curl_setopt($ch, CURLOPT_HEADERFUNCTION, "curlResponseHeaderCallback");
$result = curl_exec($ch);
var_dump($cookies);

function curlResponseHeaderCallback($ch, $headerLine) {
    global $cookies;
    if (preg_match('/^Set-Cookie:\s*([^;]*)/mi', $headerLine, $cookie) == 1)
        $cookies[] = $cookie;
    return strlen($headerLine); // Needed by curl
}

This solution has the drawback of using a global variable, but I guess this is not an issue for short scripts. And you can always use static methods and attributes if curl is being wrapped into a class.

You can start web pages using command line in any browser typing this command

cd %your chrome directory%
start /max http://google.com

save it as bat and run it :)

I found that AlertifyJS is a better alternative and have a Bootstrap theme.

alertify.alert('Alert Title', 'Alert Message!', function(){ alertify.success('Ok'); });

Also have a 4 components: Alert, Confirm, Prompt and Notifier.

Exmaple: JSFiddle

My problem was a little bit different. As mentioned by @kzfabi - a registry is made to get details of the installed VS version. So the user executing the developer command line tools exe needs admin access as well as registry editing rights. In controlled environment set up by companies you may not have these rights and cause this error.

On modern browsers you can use wheel event:

// Content is the element you want to apply the wheel scroll effect to
content.addEventListener('wheel', function(e) {
    const step = 100; // How many pixels to scroll

    if (e.deltaY > 0) // Scroll down
        content.scrollTop += step;
    else // Scroll up
        content.scrollTop -= step;
});

I having some problem with the accepted answer, but it seems it solve answer for others. I would like a solution that can get a response from the url it uses, so I thought http would be great for that functionality, and for that I found this answer really helpful. How do I check Internet Connectivity using HTTP requests(Flutter/Dart)?

Adding to assylias's answer - assylias shows us D.ITEMS is a method that returns an array. Knowing that, we don't need the variant array a(i) [See caveat below]. We just need to use the proper array syntax.

For i = 0 To d.Count - 1
    s = d.Items()(i)
    Debug.Print s
Next i()

KEYS works the same way

For i = 0 To d.Count - 1
    Debug.Print d.Keys()(i), d.Items()(i)
Next i

This syntax is also useful for the SPLIT function which may help make this clearer. SPLIT also returns an array with lower bounds at 0. Thus, the following prints "C".

Debug.Print Split("A,B,C,D", ",")(2)

SPLIT is a function. Its parameters are in the first set of parentheses. Methods and Functions always use the first set of parentheses for parameters, even if no parameters are needed. In the example SPLIT returns the array {"A","B","C","D"}. Since it returns an array we can use a second set of parentheses to identify an element within the returned array just as we would any array.

Caveat: This shorter syntax may not be as efficient as using the variant array a() when iterating through the entire dictionary since the shorter syntax invokes the dictionary's Items method with each iteration. The shorter syntax is best for plucking a single item by number from a dictionary.

To adjust the length of the samples:

set key samplen X

(default is 4)

To adjust the vertical spacing of the samples:

set key spacing X

(default is 1.25)

and (for completeness), to adjust the fontsize:

set key font "<face>,<size>"

(default depends on the terminal)

And of course, all these can be combined into one line:

set key samplen 2 spacing .5 font ",8"

Note that you can also change the position of the key using set key at <position> or any one of the pre-defined positions (which I'll just defer to help key at this point)

if your field name is Roles and table name is table1 you can use following to search

DECLARE @Role varchar(50);
SELECT * FROM table1
WHERE Roles.exist ('/root/role = sql:variable("@Role")') = 1

put this line in parent construct : $this->load->database();

function  __construct() {
    parent::__construct();
    $this->load->library('lib_name');
    $model=array('model_name');
    $this->load->model($model);
    $this->load->database();
}

this way.. it should work..

I think you can create a simple SQL query:

$sql="select username from user where id in (select id from idtables)";
$query=$this->db->query($sql);

and then you can use it normally.

I didn't try this but I think it works in all browsers:

target="_parent"

All of the paths above assume that your objects are serializable to XML or JSON,
or you must implement your own solution.

But in the end you still get to the point where you have to solve problems like

• recursion in objects
• non-serializable objects
• exceptions
• ...

Plus log you want more information:

• when the event happened
• callstack
• which threead
• what was in the web session
• which ip address
• url
• ...

There is the best solution that solves all of this and much more.
Use this Nuget package: Desharp.
For all types of applications - both web and desktop applications.
See it's Desharp Github documentation. It has many configuration options.

Just call anywhere:

Desharp.Debug.Log(anyException);
Desharp.Debug.Log(anyCustomValueObject);
Desharp.Debug.Log(anyNonserializableObject);
Desharp.Debug.Log(anyFunc);
Desharp.Debug.Log(anyFunc, Desharp.Level.EMERGENCY); // you can store into different files

• it can save the log in nice HTML (or in TEXT format, configurable)
• it's possible to write optionally in background thread (configurable)
• it has options for max objects depth and max strings length (configurable)
• it uses loops for iteratable objects and backward reflection for everything else,
  indeed for anything you can find in .NET environment.

I believe it will help.

I found a solution for my problem while writing my question !

Going into my remote session i tried two key combinations, and it solved the problem on my Desktop : Alt+Enter and Ctrl+Enter (i don't know which one solved the problem though)

I tried to reproduce the problem, but i couldn't... but i'm almost sure it's one of the key combinations described in the question above (since i experienced this problem several times)

So it seems the problem comes from the use of RDP (windows7 and 8)

Update 2017: Problem occurs on Windows 10 aswell.

try this

Intent a = new Intent(Intent.ACTION_MAIN);
a.addCategory(Intent.CATEGORY_HOME);
a.setFlags(Intent.FLAG_ACTIVITY_NEW_TASK);
startActivity(a);

It's also possible to customise your bootstrap build by using:

http://twitter.github.com/bootstrap/customize.html

All the plugins are included by default.

This is worked for me, anyone can try it

$("#myModal").on("hidden.bs.modal", function () {
    for (instance in CKEDITOR.instances)
        CKEDITOR.instances[instance].destroy();
    $('#myModal .modal-body').html('');    
});

you can open ckEditor in Modal window

Concatenating strings in awk can be accomplished by the print command AWK manual page, and you can do complicated combination. Here I was trying to change the 16 char to A and used string concatenation:

echo    CTCTCTGAAATCACTGAGCAGGAGAAAGATT | awk -v w=15 -v BA=A '{OFS=""; print substr($0, 1, w), BA, substr($0,w+2)}'
Output: CTCTCTGAAATCACTAAGCAGGAGAAAGATT

I used the substr function to extract a portion of the input (STDIN). I passed some external parameters (here I am using hard-coded values) that are usually shell variable. In the context of shell programming, you can write -v w=$width -v BA=$my_charval. The key is the OFS which stands for Output Field Separate in awk. Print function take a list of values and write them to the STDOUT and glue them with the OFS. This is analogous to the perl join function.

It looks that in awk, string can be concatenated by printing variable next to each other:

echo xxx | awk -v a="aaa" -v b="bbb" '{ print a b $1 "string literal"}'
# will produce: aaabbbxxxstring literal

You can use a CASE statement with an aggregate function. This is basically the same thing as a PIVOT function in some RDBMS:

SELECT distributor_id,
    count(*) AS total,
    sum(case when level = 'exec' then 1 else 0 end) AS ExecCount,
    sum(case when level = 'personal' then 1 else 0 end) AS PersonalCount
FROM yourtable
GROUP BY distributor_id

1. in your sample code you must remove the brackets, because it's not a functional assignment; also for documentary reasons I would suggest you use the := notation (see code sample below)

   2. Application.Thisworkbook refers to the book containing the VBA code, not necessarily the book containing the data, so be cautious.

Express the sheet you're working on as a sheet object and pass it, together with a logical variable to the following sub:

Sub SetProtectionMode(MySheet As Worksheet, ProtectionMode As Boolean)

    If ProtectionMode Then
        MySheet.Protect DrawingObjects:=True, Contents:=True, _
                        AllowSorting:=True, AllowFiltering:=True
    Else
        MySheet.Unprotect
    End If
End Sub

Within the .Protect method you can define what you want to allow/disallow. This code block will switch protection on/off - without password in this example, you can add it as a parameter or hardcoded within the Sub. Anyway somewhere the PW will be hardcoded. If you don't want this, just call the Protection Dialog window and let the user decide what to do:

Application.Dialogs(xlDialogProtectDocument).Show

Hope that helps

Good luck - MikeD

I had the same problem. Here's what I figured out:

=BDP(A1&"@BGN Corp", "Issuer_parent_eqy_ticker")

A1 being the ISINs. This will return the ticker number. Then just use the ticker number to get the price.

One-liner (java8):

list.removeIf(s -> s.equals("acbd")); // removes all instances, not just the 1st one

(does all the iterating implicitly)

remove partition by and add group by clause,

SELECT BrandId
      ,SUM(ICount) totalSum
  FROM Table 
WHERE DateId  = 20130618
GROUP BY BrandId

Change to directory with correct java.exe i.e. go to the required JDK version java.exe

cd C:/Program Files/Java/jdk1.7.0_25/bin

Run the java.exe from this directory, it has precedence over registry and $PATH settings.

java -jar C:/installed/selenium-server-standalone-2.53.0.jar 

just figured this out for Windows, using credentials for each repo:

cd c:\User1\SomeRepo
git config --local credential.https://github.com.user1 user1
git config --local credential.useHttpPath true
git config --local credential.helper manager
git remote set-url origin https://[email protected]/USERNAME/PROJECTNAME.git

The format of credential.https://github.com. tells the credential helper the URL for the credential. The 'useHttpPath' tells the credential manager to use the path for the credential. If useHttpPath is omitted then the credential manager will store one credential for https://github.com. If it is included then the credential manager will store multiple credentials, which is what I really wanted.

To copy all files, including hidden files use:

cp -r /home/server/folder/test/. /home/server/

If you are running a recent Linux OS with SystemD, you can use the SystemD Timer unit to run your script at any granularity level you wish (theoretically down to nanoseconds), and - if you wish - much more flexible launching rules than Cron ever allowed. No sleep kludges required

It takes a bit more to set up than a single line in a cron file, but if you need anything better than "Every minute", it is well worth the effort.

The SystemD timer model is basically this: timers are units that start service units when a timer elapses.

So for every script/command that you want to schedule, you must have a service unit and then an additional timer unit. A single timer unit can include multiple schedules, so you normally wouldn't need more than one timer and one service.

Here is a simple example that logs "Hello World" every 10 seconds:

/etc/systemd/system/helloworld.service:

[Unit]
Description=Say Hello
[Service]
ExecStart=/usr/bin/logger -i Hello World

/etc/systemd/system/helloworld.timer:

[Unit]
Description=Say Hello every 10 seconds
[Timer]
OnBootSec=10
OnUnitActiveSec=10
AccuracySec=1ms
[Install]
WantedBy=timers.target

After setting up these units (in /etc/systemd/system, as described above, for a system-wide setting, or at ~/.config/systemd/user for a user-specific setup), you need to enable the timer (not the service though) by running systemctl enable --now helloworld.timer (the --now flag also starts the timer immediately, otherwise, it will only start after the next boot, or user login).

The [Timer] section fields used here are as follows:

• OnBootSec - start the service this many seconds after each boot.
• OnUnitActiveSec - start the service this many seconds after the last time the service was started. This is what causes the timer to repeat itself and behave like a cron job.
• AccuracySec - sets the accuracy of the timer. Timers are only as accurate as this field sets, and the default is 1 minute (emulates cron). The main reason to not demand the best accuracy is to improve power consumption - if SystemD can schedule the next run to coincide with other events, it needs to wake the CPU less often. The 1ms in the example above is not ideal - I usually set accuracy to 1 (1 second) in my sub-minute scheduled jobs, but that would mean that if you look at the log showing the "Hello World" messages, you'd see that it is often late by 1 second. If you're OK with that, I suggest setting the accuracy to 1 second or more.

As you may have noticed, this timer doesn't mimic Cron all that well - in the sense that the command doesn't start at the beginning of every wall clock period (i.e. it doesn't start on the 10th second on the clock, then the 20th and so on). Instead is just happens when the timer ellapses. If the system booted at 12:05:37, then the next time the command runs will be at 12:05:47, then at 12:05:57, etc. If you are interested in actual wall clock accuracy, then you may want to replace the OnBootSec and OnUnitActiveSec fields and instead set an OnCalendar rule with the schedule that you want (which as far as I understand can't be faster than 1 second, using the calendar format). The above example can also be written as:

OnCalendar=*-*-* *:*:00,10,20,30,40,50

Last note: as you probably guessed, the helloworld.timer unit starts the helloworld.service unit because they have the same name (minus the unit type suffix). This is the default, but you can override that by setting the Unit field for the [Timer] section.

More gory details can be found at:

• Arch Linux Wiki page about SystemD timers which gives a very good overview of the topic, with examples.
• man systemd.timer
• man systemd.time
• man systemd.service
• man system.exec

The 'frame' command will give you what you are looking for. (This can be abbreviated just 'f'). Here is an example:

(gdb) frame
\#0  zmq::xsub_t::xrecv (this=0x617180, msg_=0x7ffff00008e0) at xsub.cpp:139
139         int rc = fq.recv (msg_);
(gdb)

Without an argument, 'frame' just tells you where you are at (with an argument it changes the frame). More information on the frame command can be found here.

I've tried bson = require('../browser_build/bson'); but end up running into another error

Cannot set property 'BSON_BINARY_SUBTYPE_DEFAULT' of undefined

Finally I fixed this issue simply by npm update, this will fix the bson module in mongoose.

You may:

Find: (\w) Replace With: \L$1

Or select the text, ctrl+K+L.

Yes. Use WindowBuilder Pro (provided by Google). It supports SWT and Swing as well with multiple layouts (Group layout, MiGLayout etc.) It's integrated out of the box with Eclipse Indigo, but you can install plugin on previous versions (3.4/3.5/3.6):

Use ARRAY_AGG function for PostgreSQL, U-SQL, IBM DB2, and Google BigQuery SQL:

SELECT customer, (ARRAY_AGG(id ORDER BY total DESC))[1], MAX(total)
FROM purchases
GROUP BY customer

In SQL Server...

SELECT [name] AS [Column Name]
FROM syscolumns
WHERE id = (SELECT id FROM sysobjects WHERE type = 'V' AND [Name] = 'Your table name')

Type = 'V' for views Type = 'U' for tables

make sure you have mapped the y: drive, or copy all the files to local dir c:/local

c:/local> copy *.* c:/newfile.txt

The proxy setting is stored in the user's prefs.js file in their Firefox profile.

The path to the Firefox profile directory and the file is:

%APPDATA%\Mozilla\Firefox\Profiles\7b9ja6xv.default\prefs.js

where "7b9ja6xv" is a random string. However, the directory of the default profile always ends in ".default". Most of the time there will be only one profile anyway.

Setting you are after are named "network.proxy.http" and "network.proxy.http_port".

Now it depends on what technology you are able/prepared to use to change the file.

P.S.: If this is about changing the proxy settings of a group of users via the logon script or similar, I recommend looking into the possibility of using the automatic proxy discovery (WPAD) mechanism. You would never have to change proxy configuration on a user machine again.

I think in your Angular-2 version directives are not supported in Component decorator, hence you have to register directive same as other component in @NgModule and then import in component as below and also remove directives: [ChildComponent] from decorator.

import {myDirective} from './myDirective';

You are experiencing this issue for two reasons.

• The JPQL Query is not valid.
• You have not created an association between your entities that the underlying JPQL query can utilize.

When performing a join in JPQL you must ensure that an underlying association between the entities attempting to be joined exists. In your example, you are missing an association between the User and Area entities. In order to create this association we must add an Area field within the User class and establish the appropriate JPA Mapping. I have attached the source for User below. (Please note I moved the mappings to the fields)

User.java

@Entity
@Table(name="user")
public class User {

    @Id
    @GeneratedValue(strategy=GenerationType.AUTO)
    @Column(name="iduser")
    private Long idUser;

    @Column(name="user_name")
    private String userName;

    @OneToOne()
    @JoinColumn(name="idarea")
    private Area area;

    public Long getIdUser() {
        return idUser;
    }

    public void setIdUser(Long idUser) {
        this.idUser = idUser;
    }

    public String getUserName() {
        return userName;
    }

    public void setUserName(String userName) {
        this.userName = userName;
    }

    public Area getArea() {
        return area;
    }

    public void setArea(Area area) {
        this.area = area;
    }
}

Once this relationship is established you can reference the area object in your @Query declaration. The query specified in your @Query annotation must follow proper syntax, which means you should omit the on clause. See the following:

@Query("select u.userName from User u inner join u.area ar where ar.idArea = :idArea")

While looking over your question I also made the relationship between the User and Area entities bidirectional. Here is the source for the Area entity to establish the bidirectional relationship.

Area.java

@Entity
@Table(name = "area")
public class Area {

    @Id
    @GeneratedValue(strategy=GenerationType.AUTO)
    @Column(name="idarea")
    private Long idArea;

    @Column(name="area_name")
    private String areaName;

    @OneToOne(fetch=FetchType.LAZY, mappedBy="area")
    private User user;

    public Long getIdArea() {
        return idArea;
    }

    public void setIdArea(Long idArea) {
        this.idArea = idArea;
    }

    public String getAreaName() {
        return areaName;
    }

    public void setAreaName(String areaName) {
        this.areaName = areaName;
    }

    public User getUser() {
        return user;
    }

    public void setUser(User user) {
        this.user = user;
    }
}

With Swift 5.2 and iOS 13.4, according to your needs, you can use one of the following examples to align your VStack with top leading constraints and a full size frame.

Note that the code snippets below all result in the same display, but do not guarantee the effective frame of the VStack nor the number of View elements that might appear while debugging the view hierarchy.

1. Using frame(minWidth:idealWidth:maxWidth:minHeight:idealHeight:maxHeight:alignment:) method

The simplest approach is to set the frame of your VStack with maximum width and height and also pass the required alignment in frame(minWidth:idealWidth:maxWidth:minHeight:idealHeight:maxHeight:alignment:):

struct ContentView: View {

    var body: some View {
        VStack(alignment: .leading) {
            Text("Title")
                .font(.title)
            Text("Content")
                .font(.body)
        }
        .frame(
            maxWidth: .infinity,
            maxHeight: .infinity,
            alignment: .topLeading
        )
        .background(Color.red)
    }

}

As an alternative, if setting maximum frame with specific alignment for your Views is a common pattern in your code base, you can create an extension method on View for it:

extension View {

    func fullSize(alignment: Alignment = .center) -> some View {
        self.frame(
            maxWidth: .infinity,
            maxHeight: .infinity,
            alignment: alignment
        )
    }

}

struct ContentView : View {

    var body: some View {
        VStack(alignment: .leading) {
            Text("Title")
                .font(.title)
            Text("Content")
                .font(.body)
        }
        .fullSize(alignment: .topLeading)
        .background(Color.red)
    }

}

2. Using Spacers to force alignment

You can embed your VStack inside a full size HStack and use trailing and bottom Spacers to force your VStack top leading alignment:

struct ContentView: View {

    var body: some View {
        HStack {
            VStack(alignment: .leading) {
                Text("Title")
                    .font(.title)
                Text("Content")
                    .font(.body)

                Spacer() // VStack bottom spacer
            }

            Spacer() // HStack trailing spacer
        }
        .frame(
            maxWidth: .infinity,
            maxHeight: .infinity
        )
        .background(Color.red)
    }

}

3. Using a ZStack and a full size background View

This example shows how to embed your VStack inside a ZStack that has a top leading alignment. Note how the Color view is used to set maximum width and height:

struct ContentView: View {

    var body: some View {
        ZStack(alignment: .topLeading) {
            Color.red
                .frame(maxWidth: .infinity, maxHeight: .infinity)

            VStack(alignment: .leading) {
                Text("Title")
                    .font(.title)
                Text("Content")
                    .font(.body)
            }
        }
    }

}

4. Using GeometryReader

GeometryReader has the following declaration:

A container view that defines its content as a function of its own size and coordinate space. [...] This view returns a flexible preferred size to its parent layout.

The code snippet below shows how to use GeometryReader to align your VStack with top leading constraints and a full size frame:

struct ContentView : View {

    var body: some View {
        GeometryReader { geometryProxy in
            VStack(alignment: .leading) {
                Text("Title")
                    .font(.title)
                Text("Content")
                    .font(.body)
            }
            .frame(
                width: geometryProxy.size.width,
                height: geometryProxy.size.height,
                alignment: .topLeading
            )
        }
        .background(Color.red)
    }

}

5. Using overlay(_:alignment:) method

If you want to align your VStack with top leading constraints on top of an existing full size View, you can use overlay(_:alignment:) method:

struct ContentView: View {

    var body: some View {
        Color.red
            .frame(
                maxWidth: .infinity,
                maxHeight: .infinity
            )
            .overlay(
                VStack(alignment: .leading) {
                    Text("Title")
                        .font(.title)
                    Text("Content")
                        .font(.body)
                },
                alignment: .topLeading
            )
    }

}

Display: