Model-View-Presenter

In MVP, the Presenter contains the UI business logic for the View. All invocations from the View delegate directly to the Presenter. The Presenter is also decoupled directly from the View and talks to it through an interface. This is to allow mocking of the View in a unit test. One common attribute of MVP is that there has to be a lot of two-way dispatching. For example, when someone clicks the "Save" button, the event handler delegates to the Presenter's "OnSave" method. Once the save is completed, the Presenter will then call back the View through its interface so that the View can display that the save has completed.

MVP tends to be a very natural pattern for achieving separated presentation in WebForms. The reason is that the View is always created first by the ASP.NET runtime. You can find out more about both variants.

Two primary variations

Passive View: The View is as dumb as possible and contains almost zero logic. A Presenter is a middle man that talks to the View and the Model. The View and Model are completely shielded from one another. The Model may raise events, but the Presenter subscribes to them for updating the View. In Passive View there is no direct data binding, instead, the View exposes setter properties that the Presenter uses to set the data. All state is managed in the Presenter and not the View.

• Pro: maximum testability surface; clean separation of the View and Model
• Con: more work (for example all the setter properties) as you are doing all the data binding yourself.

Supervising Controller: The Presenter handles user gestures. The View binds to the Model directly through data binding. In this case, it's the Presenter's job to pass off the Model to the View so that it can bind to it. The Presenter will also contain logic for gestures like pressing a button, navigation, etc.

• Pro: by leveraging data binding the amount of code is reduced.
• Con: there's a less testable surface (because of data binding), and there's less encapsulation in the View since it talks directly to the Model.

Model-View-Controller

In the MVC, the Controller is responsible for determining which View to display in response to any action including when the application loads. This differs from MVP where actions route through the View to the Presenter. In MVC, every action in the View correlates with a call to a Controller along with an action. In the web, each action involves a call to a URL on the other side of which there is a Controller who responds. Once that Controller has completed its processing, it will return the correct View. The sequence continues in that manner throughout the life of the application:

    Action in the View
        -> Call to Controller
        -> Controller Logic
        -> Controller returns the View.

One other big difference about MVC is that the View does not directly bind to the Model. The view simply renders and is completely stateless. In implementations of MVC, the View usually will not have any logic in the code behind. This is contrary to MVP where it is absolutely necessary because, if the View does not delegate to the Presenter, it will never get called.

Presentation Model

One other pattern to look at is the Presentation Model pattern. In this pattern, there is no Presenter. Instead, the View binds directly to a Presentation Model. The Presentation Model is a Model crafted specifically for the View. This means this Model can expose properties that one would never put on a domain model as it would be a violation of separation-of-concerns. In this case, the Presentation Model binds to the domain model and may subscribe to events coming from that Model. The View then subscribes to events coming from the Presentation Model and updates itself accordingly. The Presentation Model can expose commands which the view uses for invoking actions. The advantage of this approach is that you can essentially remove the code-behind altogether as the PM completely encapsulates all of the behavior for the view. This pattern is a very strong candidate for use in WPF applications and is also called Model-View-ViewModel.

There is a MSDN article about the Presentation Model and a section in the Composite Application Guidance for WPF (former Prism) about Separated Presentation Patterns

Concept:

To be very simple Type Safe like the meanings, it makes sure that type of the variable should be safe like

1. no wrong data type e.g. can't save or initialized a variable of string type with integer
2. Out of bound indexes are not accessible
3. Allow only the specific memory location

so it is all about the safety of the types of your storage in terms of variables.

In other words...

IDE Even your notepad is an IDE. Every software you write/compile code with is an IDE.

Library A bunch of code which simplifies functions/methods for quick use.

API A programming interface for functions/configuration which you work with, its usage is often documented.

SDK Extras and/or for development/testing purposes.

ToolKit Tiny apps for quick use, often GUIs.

GUI Apps with a graphical interface, requires no knowledge of programming unlike APIs.

Framework Bunch of APIs/huge Library/Snippets wrapped in a namespace/or encapsulated from outer scope for compact handling without conflicts with other code.

MVC A design pattern separated in Models, Views and Controllers for huge applications. They are not dependent on each other and can be changed/improved/replaced without to take care of other code.

Example:

<sup>Car (Model)
The object that is being presented.
Example in IT: A HTML form.

Camera (View)
Something that is able to see the object(car).
Example in IT: Browser that renders a website with the form.

Driver (Controller)
Someone who drives that car.
Example in IT: Functions which handle form data that's being submitted.</sup>

Snippets Small codes of only a few lines, may not be even complete but worth for a quick share.

Plug-ins Exclusive functions for specified frameworks/APIs/libraries only.

Add-ons Additional modules or services for specific GUIs.

Think of void as the "empty structure". Let me explain.

Every function takes a sequence of parameters, where each parameter has a type. In fact, we could package up the parameters into a structure, with the structure slots corresponding to the parameters. This makes every function have exactly one argument. Similarly, functions produce a result, which has a type. It could be a boolean, or it could be float, or it could be a structure, containing an arbitrary set of other typed values. If we want a languge that has multiple return values, it is easy to just insist they be packaged into a structure. In fact, we could always insist that a function returned a structure. Now every function takes exactly one argument, and produces exactly one value.

Now, what happens when I need a function that produces "no" value? Well, consider what I get when I form a struct with 3 slots: it holds 3 values. When I have 2 slots, it holds two values. When it has one slot, one value. And when it has zero slots, it holds... uh, zero values, or "no" value". So, I can think of a function returning void as returning a struct containing no values. You can even decide that "void" is just a synonym for the type represented by the empty structure, rather than a keyword in the language (maybe its just a predefined type :)

Similarly, I can think of a function requiring no values as accepting an empty structure, e.g., "void".

I can even implement my programming language this way. Passing a void value takes up zero bytes, so passing void values is just a special case of passing other values of arbitrary size. This makes it easy for the compiler to treat the "void" result or argument. You probably want a langauge feature that can throw a function result away; in C, if you call the non-void result function foo in the following statement: foo(...); the compiler knows that foo produces a result and simply ignores it. If void is a value, this works perfectly and now "procedures" (which are just an adjective for a function with void result) are just trivial special cases of general functions.

Void* is a bit funnier. I don't think the C designers thought of void in the above way; they just created a keyword. That keyword was available when somebody needed a point to an arbitrary type, thus void* as the idiom in C. It actually works pretty well if you interpret void as an empty structure. A void* pointer is the address of a place where that empty structure has been put.

Casts from void* to T* for other types T, also work out with this perspective. Pointer casts are a complete cheat that work on most common architectures to take advantage of the fact that if a compound type T has an element with subtype S placed physically at the beginning of T in its storage layout, then casting S* to T* and vice versa using the same physical machine address tends to work out, since most machine pointers have a single representation. Replacing the type S by the type void gives exactly the same effect, and thus casting to/from void* works out.

The PARLANSE programming language implements the above ideas pretty closely. We goofed in its design, and didn't pay close attention to "void" as a return type and thus have langauge keywords for procedure. Its mostly just a simple syntax change but its one of things you don't get around to once you get a large body working code in a language.

JSONP stands for JSON with Padding.

Here is the site, with great examples, with the explanation from the simplest use of this technique to the most advanced in plane JavaScript:

w3schools.com / JSONP

One of my more favorite techniques described above is Dynamic JSON Result, which allow to send JSON to the PHP file in URL parameter, and let the PHP file also return a JSON object based on the information it gets.

Tools like jQuery also have facilities to use JSONP:

jQuery.ajax({
  url: "https://data.acgov.org/resource/k9se-aps6.json?city=Berkeley",
  jsonp: "callbackName",
  dataType: "jsonp"
}).done(
  response => console.log(response)
);

'method' is the object-oriented word for 'function'. That's pretty much all there is to it (ie., no real difference).

Unfortunately, I think a lot of the answers here are perpetuating or advancing the idea that there's some complex, meaningful difference.

Really - there isn't all that much to it, just different words for the same thing.

[late addition]

In fact, as Brian Neal pointed out in a comment to this question, the C++ standard never uses the term 'method' when refering to member functions. Some people may take that as an indication that C++ isn't really an object-oriented language; however, I prefer to take it as an indication that a pretty smart group of people didn't think there was a particularly strong reason to use a different term.

http://martinfowler.com/articles/microservice-testing/

Martin Fowler's blog post speaks about strategies to test code (Especially in a micro-services architecture) but most of it applies to any application.

I'll quote from his summary slide:

• Unit tests - exercise the smallest pieces of testable software in the application to determine whether they behave as expected.
• Integration tests - verify the communication paths and interactions between components to detect interface defects.
• Component tests - limit the scope of the exercised software to a portion of the system under test, manipulating the system through internal code interfaces and using test doubles to isolate the code under test from other components.
• Contract tests - verify interactions at the boundary of an external service asserting that it meets the contract expected by a consuming service.
• End-To-End tests - verify that a system meets external requirements and achieves its goals, testing the entire system, from end to end.

Explaining "what is a monad" is a bit like saying "what is a number?" We use numbers all the time. But imagine you met someone who didn't know anything about numbers. How the heck would you explain what numbers are? And how would you even begin to describe why that might be useful?

What is a monad? The short answer: It's a specific way of chaining operations together.

In essence, you're writing execution steps and linking them together with the "bind function". (In Haskell, it's named >>=.) You can write the calls to the bind operator yourself, or you can use syntax sugar which makes the compiler insert those function calls for you. But either way, each step is separated by a call to this bind function.

So the bind function is like a semicolon; it separates the steps in a process. The bind function's job is to take the output from the previous step, and feed it into the next step.

That doesn't sound too hard, right? But there is more than one kind of monad. Why? How?

Well, the bind function can just take the result from one step, and feed it to the next step. But if that's "all" the monad does... that actually isn't very useful. And that's important to understand: Every useful monad does something else in addition to just being a monad. Every useful monad has a "special power", which makes it unique.

(A monad that does nothing special is called the "identity monad". Rather like the identity function, this sounds like an utterly pointless thing, yet turns out not to be... But that's another story™.)

Basically, each monad has its own implementation of the bind function. And you can write a bind function such that it does hoopy things between execution steps. For example:

• If each step returns a success/failure indicator, you can have bind execute the next step only if the previous one succeeded. In this way, a failing step aborts the whole sequence "automatically", without any conditional testing from you. (The Failure Monad.)

• Extending this idea, you can implement "exceptions". (The Error Monad or Exception Monad.) Because you're defining them yourself rather than it being a language feature, you can define how they work. (E.g., maybe you want to ignore the first two exceptions and only abort when a third exception is thrown.)

• You can make each step return multiple results, and have the bind function loop over them, feeding each one into the next step for you. In this way, you don't have to keep writing loops all over the place when dealing with multiple results. The bind function "automatically" does all that for you. (The List Monad.)

• As well as passing a "result" from one step to another, you can have the bind function pass extra data around as well. This data now doesn't show up in your source code, but you can still access it from anywhere, without having to manually pass it to every function. (The Reader Monad.)

• You can make it so that the "extra data" can be replaced. This allows you to simulate destructive updates, without actually doing destructive updates. (The State Monad and its cousin the Writer Monad.)

• Because you're only simulating destructive updates, you can trivially do things that would be impossible with real destructive updates. For example, you can undo the last update, or revert to an older version.

• You can make a monad where calculations can be paused, so you can pause your program, go in and tinker with internal state data, and then resume it.

• You can implement "continuations" as a monad. This allows you to break people's minds!

All of this and more is possible with monads. Of course, all of this is also perfectly possible without monads too. It's just drastically easier using monads.

Nowadays, new focus: we need the old classifications?

The Imperative/Declarative/Functional aspects was good in the past to classify generic languages, but in nowadays all "big language" (as Java, Python, Javascript, etc.) have some option (typically frameworks) to express with "other focus" than its main one (usual imperative), and to express parallel processes, declarative functions, lambdas, etc.

So a good variant of this question is "What aspect is good to classify frameworks today?" ... An important aspect is something that we can labeling "programming style"...

Focus on the fusion of data with algorithm

A good example to explain. As you can read about jQuery at Wikipedia,

The set of jQuery core features — DOM element selections, traversal and manipulation —, enabled by its selector engine (...), created a new "programming style", fusing algorithms and DOM-data-structures

So jQuery is the best (popular) example of focusing on a "new programming style", that is not only object orientation, is "Fusing algorithms and data-structures". jQuery is somewhat reactive as spreadsheets, but not "cell-oriented", is "DOM-node oriented"... Comparing the main styles in this context:

1. No fusion: in all "big languages", in any Functional/Declarative/Imperative expression, the usual is "no fusion" of data and algorithm, except by some object-orientation, that is a fusion in strict algebric structure point of view.

2. Some fusion: all classic strategies of fusion, in nowadays have some framework using it as paradigm... dataflow, Event-driven programming (or old domain specific languages as awk and XSLT)... Like programming with modern spreadsheets, they are also examples of reactive programming style.

3. Big fusion: is "the jQuery style"... jQuery is a domain specific language focusing on "fusing algorithms and DOM-data-structures".
   PS: other "query languages", as XQuery, SQL (with PL as imperative expression option) are also data-algorith-fusion examples, but they are islands, with no fusion with other system modules... Spring, when using find()-variants and Specification clauses, is another good fusion example.

As Rutesh and jmservera pointed out, the distinction is a fuzzy one. Historically, they were different, but through the 90's these two previously distinct categories blended features and effectively merged. At this point is is probably best to imagine that the "App Server" product category is a strict superset of the "web server" category.

Some history. In early days of the Mosaic browser and hyperlinked content, there evolved this thing called a "web server" that served web page content and images over HTTP. Most of the content was static, and the HTTP 1.0 protocol was just a way to ship files around. Quickly the "web server" category evolved to include CGI capability - effectively launching a process on each web request to generate dynamic content. HTTP also matured and the products became more sophisticated, with caching, security, and management features. As the technology matured, we got company-specific Java-based server-side technology from Kiva and NetDynamics, which eventually all merged into JSP. Microsoft added ASP, I think in 1996, to Windows NT 4.0. The static web server had learned some new tricks, so that it was an effective "app server" for many scenarios.

In a parallel category, the app server had evolved and existed for a long time. companies delivered products for Unix like Tuxedo, TopEnd, Encina that were philosophically derived from Mainframe application management and monitoring environments like IMS and CICS. Microsoft's offering was Microsoft Transaction Server (MTS), which later evolved into COM+. Most of these products specified "closed" product-specific communications protocols to interconnect "fat" clients to servers. (For Encina, the comms protocol was DCE RPC; for MTS it was DCOM; etc.) In 1995/96, these traditional app server products began to embed basic HTTP communication capability, at first via gateways. And the lines began to blur.

Web servers got more and more mature with respect to handling higher loads, more concurrency, and better features. App servers delivered more and more HTTP-based communication capability.

At this point the line between "app server" and "web server" is a fuzzy one. But people continue to use the terms differently, as a matter of emphasis. When someone says "web server" you often think HTTP-centric, web UI, oriented apps. When someone says "App server" you may think "heavier loads, enterprise features, transactions and queuing, multi-channel communication (HTTP + more). But often it is the same product that serves both sets of workload requirements.

• WebSphere, IBM's "app server" has its own bundled web server.
• WebLogic, another traditional app server, likewise.
• Windows, which is Microsoft's App Server (in addition to being its File&Print Server, Media Server, etc.), bundles IIS.

The answer to static function depends on the language:

1) In languages without OOPS like C, it means that the function is accessible only within the file where its defined.

2)In languages with OOPS like C++ , it means that the function can be called directly on the class without creating an instance of it.

One more way to understand would be to think in terms of communication between processes and threads. Processes communicate with the help of coarse grained communication mechanisms like sockets, signal handlers, shared memory, semaphores and files. Threads, on the other hand, have access to shared memory space that belongs to a process, which allows them to apply finer grain communication mechanisms.

Source: Java concurrency in practice

UTF-8 is a method for encoding Unicode characters using 8-bit sequences.

Unicode is a standard for representing a great variety of characters from many languages.

null is special value, it is not instance of anything. For obviously reason it cannot be instanceof anything.

• Basic Availability: The database appears to work most of the time.

• Soft State: Stores don’t have to be write-consistent or mutually consistent all the time.

• Eventual consistency: Data should always be consistent, with regards how any number of changes are performed.

Simply:

• pop: returns the item at the top then remove it from the stack

• push: add an item onto the top of the stack.

• Value Object : Use when need to measure the objects' equality based on the objects' value.
• Data Transfer Object : Pass data with multiple attributes in one shot from client to server across layer, to avoid multiple calls to remote server.
• Plain Old Java Object : It's like simple class which properties, public no-arg constructor. As we declare for JPA entity.

difference-between-value-object-pattern-and-data-transfer-pattern

A website might just be static content - a web application would have dynamic content. It is a very fuzzy line.

Primary key is a subset of super key. Which is uniquely define and other field are depend on it. In a table their can be just one primary key and rest sub set are candidate key or alternate keys.

Bill Bumgarner aka @bbum, who should know, posted on the CocoaBuilder mailing list in 2005:

Sun entered the picture a bit after the NS prefix had come into play. The NS prefix came about in public APIs during the move from NeXTSTEP 3.0 to NeXTSTEP 4.0 (also known as OpenStep). Prior to 4.0, a handful of symbols used the NX prefix, but most classes provided by the system libraries were not prefixed at all -- List, Hashtable, View, etc...

It seems that everyone agrees that the prefix NX (for NeXT) was used until 1993/1994, and Apple's docs say:

The official OpenStep API, published in September of 1994, was the first to split the API between Foundation and Application Kit and the first to use the “NS” prefix.

To me it is about 2 different meanings of symbol =:

1. In math x = sin(t) means, that x is different name for sin(t). So writing x + y is the same thing as sin(t) + y. Functional reactive programming is like math in this respect: if you write x + y, it is computed with whatever the value of t is at the time it's used.
2. In C-like programming languages (imperative languages), x = sin(t) is an assignment: it means that x stores the value of sin(t) taken at the time of the assignment.

A endpoint is a URL for web service.And Endpoints also is a distributed API.

The Simple Object Access Protocol (SOAP) endpoint is a URL. It identifies the location on the built-in HTTP service where the web services listener listens for incoming requests.

Reference: https://www.ibm.com/support/knowledgecenter/SSSHYH_7.1.0.4/com.ibm.netcoolimpact.doc/dsa/imdsa_web_netcool_impact_soap_endpoint_c.html

Lambda explained for everyone:

Lambda is an annonymous function. This means lambda is a function objekt in Python that doesnt require a reference before. Let's concider this bit of code here:

def name_of_func():
    #command/instruction
    print('hello')

print(type(name_of_func))   #the name of the function is a reference
                            #the reference contains a function Objekt with command/instruction

To proof my proposition I print out the type of name_of_func which returns us:

<class 'function'>

A function must have a interface, but a interface dosent needs to contain something. What does this mean? Let's look a little bit closer to our function and we may notice that out of the name of the functions there are some more details we need to explain to understand what a function is.

A regular function will be defined with the syntax "def", then we type in the name and settle the interface with "()" and ending our definition by the syntax ":". Now we enter the functions body with our instructions/commands.

So let's consider this bit of code here:

def print_my_argument(x):
    print(x)


print_my_argument('Hello')

In this case we run our function, named "print_my_argument" and passing a parameter/argument through the interface. The Output will be:

Hello

So now that we know what a function is and how the architecture works for a function, we can take a look to an annonymous function. Let's consicder this bit of code here:

def name_of_func():
    print('Hello')



lambda: print('Hello')

these function objekts are pretty much the same except of the fact that the upper, regular function have a name and the other function is an annonymous one. Let's take a closer look on our annonymous function, to understand how to use it.

So let's concider this bit of code here:

def delete_last_char(arg1=None):
    print(arg1[:-1])

string = 'Hello World'
delete_last_char(string)

f = lambda arg1=None: print(arg1[:-1])
f(string)

So what we have done in the above code is to write once againg, a regular function and an anonymous function. Our anonymous function we had assignd to a var, which is pretty much the same as to give this function a name. Anyway, the output will be:

Hello Worl
Hello Worl

To fully proof that lambda is a function object and doesnt just mimik a function we run this bit of code here:

string = 'Hello World'
f = lambda arg1=string: print(arg1[:-1])
f()
print(type(f))

and the Output will be:

Hello Worl
<class 'function'>

Last but not least you should know that every function in python needs to return something. If nothing is defined in the body of the function, None will be returned by default. look at this bit of code here:

def delete_last_char(arg1):
    print(arg1[:-1])

string = 'Hello World'
x = delete_last_char(string)

f = lambda arg1=string: print(arg1[:-1])
x2 = f()

print(x)
print(x2)

Output will be:

Hello Worl
Hello Worl
None
None

One of my favorite uses of reflection is the below Java dump method. It takes any object as a parameter and uses the Java reflection API to print out every field name and value.

import java.lang.reflect.Array;
import java.lang.reflect.Field;

public static String dump(Object o, int callCount) {
    callCount++;
    StringBuffer tabs = new StringBuffer();
    for (int k = 0; k < callCount; k++) {
        tabs.append("\t");
    }
    StringBuffer buffer = new StringBuffer();
    Class oClass = o.getClass();
    if (oClass.isArray()) {
        buffer.append("\n");
        buffer.append(tabs.toString());
        buffer.append("[");
        for (int i = 0; i < Array.getLength(o); i++) {
            if (i < 0)
                buffer.append(",");
            Object value = Array.get(o, i);
            if (value.getClass().isPrimitive() ||
                    value.getClass() == java.lang.Long.class ||
                    value.getClass() == java.lang.String.class ||
                    value.getClass() == java.lang.Integer.class ||
                    value.getClass() == java.lang.Boolean.class
                    ) {
                buffer.append(value);
            } else {
                buffer.append(dump(value, callCount));
            }
        }
        buffer.append(tabs.toString());
        buffer.append("]\n");
    } else {
        buffer.append("\n");
        buffer.append(tabs.toString());
        buffer.append("{\n");
        while (oClass != null) {
            Field[] fields = oClass.getDeclaredFields();
            for (int i = 0; i < fields.length; i++) {
                buffer.append(tabs.toString());
                fields[i].setAccessible(true);
                buffer.append(fields[i].getName());
                buffer.append("=");
                try {
                    Object value = fields[i].get(o);
                    if (value != null) {
                        if (value.getClass().isPrimitive() ||
                                value.getClass() == java.lang.Long.class ||
                                value.getClass() == java.lang.String.class ||
                                value.getClass() == java.lang.Integer.class ||
                                value.getClass() == java.lang.Boolean.class
                                ) {
                            buffer.append(value);
                        } else {
                            buffer.append(dump(value, callCount));
                        }
                    }
                } catch (IllegalAccessException e) {
                    buffer.append(e.getMessage());
                }
                buffer.append("\n");
            }
            oClass = oClass.getSuperclass();
        }
        buffer.append(tabs.toString());
        buffer.append("}\n");
    }
    return buffer.toString();
}

Sorry I don't have comment permission.

@Tomas Petricek as you mentioned

A weaker invariant that is also true is that i >= 0 && i < 10 (because this is the continuation condition!)"

How it's a loop invariant?

I hope I am not wrong, as far as I understand^[1], Loop invariant will be true at the beginning of the loop (Initialization), it will be true before and after each iteration (Maintenance) and it will also be true after the termination of the loop (Termination). But after the last iteration i becomes 10. So, the condition i >= 0 && i < 10 becomes false and terminates the loop. It violates the third property (Termination) of loop invariant.

[1] http://www.win.tue.nl/~kbuchin/teaching/JBP030/notebooks/loop-invariants.html

Pushing and popping registers are behind the scenes equivalent to this:

push reg   <= same as =>      sub  $8,%rsp        # subtract 8 from rsp
                              mov  reg,(%rsp)     # store, using rsp as the address

pop  reg    <= same as=>      mov  (%rsp),reg     # load, using rsp as the address
                              add  $8,%rsp        # add 8 to the rsp

Note this is x86-64 At&t syntax.

Used as a pair, this lets you save a register on the stack and restore it later. There are other uses, too.

Here's the explanation I use in teaching Python classes:

An ITERABLE is:

• anything that can be looped over (i.e. you can loop over a string or file) or
• anything that can appear on the right-side of a for-loop: for x in iterable: ... or
• anything you can call with iter() that will return an ITERATOR: iter(obj) or
• an object that defines __iter__ that returns a fresh ITERATOR, or it may have a __getitem__ method suitable for indexed lookup.

An ITERATOR is an object:

• with state that remembers where it is during iteration,
• with a __next__ method that:
  • returns the next value in the iteration
  • updates the state to point at the next value
  • signals when it is done by raising StopIteration
• and that is self-iterable (meaning that it has an __iter__ method that returns self).

Notes:

• The __next__ method in Python 3 is spelt next in Python 2, and
• The builtin function next() calls that method on the object passed to it.

For example:

>>> s = 'cat'      # s is an ITERABLE
                   # s is a str object that is immutable
                   # s has no state
                   # s has a __getitem__() method 

>>> t = iter(s)    # t is an ITERATOR
                   # t has state (it starts by pointing at the "c"
                   # t has a next() method and an __iter__() method

>>> next(t)        # the next() function returns the next value and advances the state
'c'
>>> next(t)        # the next() function returns the next value and advances
'a'
>>> next(t)        # the next() function returns the next value and advances
't'
>>> next(t)        # next() raises StopIteration to signal that iteration is complete
Traceback (most recent call last):
...
StopIteration

>>> iter(t) is t   # the iterator is self-iterable

All JavaBeans are POJOs but not all POJOs are JavaBeans.

A JavaBean is a Java object that satisfies certain programming conventions:

• the JavaBean class must implement either Serializable or Externalizable;
• the JavaBean class must have a public no-arg constructor;
• all JavaBean properties must have public setter and getter methods (as appropriate);
• all JavaBean instance variables should be private.

Cloud: the hardware running the application scales to meet the demand (potentially crossing multiple machines, networks, etc).

Grid: the application scales to take as much hardware as possible (for example in the hope of finding extra-terrestrial intelligence).

Cluster: this is an old term referring to one OS instance or one DB instance installed across multiple machines. It was done with special OS handling, proprietary drivers, low latency network cards with fat cables, and various hardware bedfellows.

(We love you SGI, but notice that "Cloud" and "Grid" are available to the little guy and your NUMAlink never has been...)

<p>Here is a quote from WWF's website:</p>.

In this part <p> is a tag.

<blockquote cite="www.facebook.com">facebook is the world's largest socialsite..</blockquote>

in this part <blockquote> is an element.

From Wikipedia,

The Card Security Code is located on the back of MasterCard, Visa and Discover credit or debit cards and is typically a separate group of 3 digits to the right of the signature strip. On American Express cards, the Card Security Code is a printed (NOT embossed) group of four digits on the front towards the right.

The Card Security Code (CSC), sometimes called Card Verification Value (CVV or CV2), Card Verification Value Code (CVVC), Card Verification Code (CVC), Verification Code (V-Code or V Code), or Card Code Verification (CCV)[1] is a security feature for credit or debit card transactions, giving increased protection against credit card fraud.

There are actually several types of security codes:

* The first code, called CVC1 or CVV1, is encoded on the magnetic stripe of the card and used for transactions in person.
* The second code, and the most cited, is CVV2 or CVC2. This CSC (also known as a CCID or Credit Card ID) is often asked for by merchants for them to secure "card not present" transactions occurring over the Internet, by mail, fax or over the phone. In many countries in Western Europe, due to increased attempts at card fraud, it is now mandatory to provide this code when the cardholder is not present in person.
* Contactless Card and Chip cards may supply their own codes generated electronically, such as iCVV or Dynamic CVV.

The CVC should not be confused with the standard card account number appearing in embossed or printed digits. (The standard card number undergoes a separate validation algorithm called the Luhn algorithm which serves to determine whether a given card's number is appropriate.)

The CVC should not be confused with PIN codes such as MasterCard SecureCode or Visa Verified by Visa. These codes are not printed or embedded in the card but are entered at the time of transaction using a keypad.

Abstract Data Type(ADT) is a data type, where only behavior is defined but not implementation.

Opposite of ADT is Concrete Data Type (CDT), where it contains an implementation of ADT.

Examples:
Array, List, Map, Queue, Set, Stack, Table, Tree, and Vector are ADTs. Each of these ADTs has many implementations i.e. CDT. The container is a high-level ADT of above all ADTs.

Real life example:
book is Abstract (Telephone Book is an implementation)

Another advantage of extracting a magic number as a constant gives the possibility to clearly document the business information.

public class Foo {
    /** 
     * Max age in year to get child rate for airline tickets
     * 
     * The value of the constant is {@value}
     */
    public static final int MAX_AGE_FOR_CHILD_RATE = 2;

    public void computeRate() {
         if (person.getAge() < MAX_AGE_FOR_CHILD_RATE) {
               applyChildRate();
         }
    }
}

< stands for lesser than (<) symbol and, the > sign stands for greater than (>) symbol.

For more information on HTML Entities, visit this link:

https://www.w3schools.com/HTML/html_entities.asp

Your interpretation sounds pretty good to me... A library could be anything that's compiled and self-contained for re-use in other code, there's literally no restriction on its content.

A framework on the other hand is expected to have a range of facilities for use in some specific arena of application development, just like your example, MVC.

"So does it mean definition equals declaration plus initialization."

Not necessarily, your declaration might be without any variable being initialized like:

 void helloWorld(); //declaration or Prototype.

 void helloWorld()
 {
    std::cout << "Hello World\n";
 } 

+Classification: you are given some new data, you have to set new label for them.

For example, a company wants to classify their prospect customers. When a new customer comes, they have to determine if this is a customer who is going to buy their products or not.

+Clustering: you're given a set of history transactions which recorded who bought what.

By using clustering techniques, you can tell the segmentation of your customers.

Instead of accepting a self parameter, class methods take a cls parameter that points to the class—and not the object instance—when the method is called. Since the class method only has access to this cls argument, it can’t modify object instance state. That would require access to self . However, class methods can still modify class state that applies across all instances of the class.

-Python Tricks

A function returns a value and a procedure just executes commands.

The name function comes from math. It is used to calculate a value based on input.

A procedure is a set of command which can be executed in order.

In most programming languages, even functions can have a set of commands. Hence the difference is only in the returning a value part.

But if you like to keep a function clean, (just look at functional languages), you need to make sure a function does not have a side effect.

Use the computation your users will most likely expect. Do your users care to know how many actual bytes are on a disk or in memory or whatever, or do they only care about usable space? The answer to that question will tell you which calculation makes the most sense.

This isn't a precision question as much as it is a usability question. Provide the calculation that is most useful to your users.

In terms of source control, you're "downstream" when you copy (clone, checkout, etc) from a repository. Information flowed "downstream" to you.

When you make changes, you usually want to send them back "upstream" so they make it into that repository so that everyone pulling from the same source is working with all the same changes. This is mostly a social issue of how everyone can coordinate their work rather than a technical requirement of source control. You want to get your changes into the main project so you're not tracking divergent lines of development.

Sometimes you'll read about package or release managers (the people, not the tool) talking about submitting changes to "upstream". That usually means they had to adjust the original sources so they could create a package for their system. They don't want to keep making those changes, so if they send them "upstream" to the original source, they shouldn't have to deal with the same issue in the next release.

compiler changes checks your source code for errors and changes it into object code.this is the code that operating system runs.

You often don't write a whole program in single file so linker links all your object code files.

your program wont get executed unless it is in main memory

A mask defines which bits you want to keep, and which bits you want to clear.

Masking is the act of applying a mask to a value. This is accomplished by doing:

• Bitwise ANDing in order to extract a subset of the bits in the value
• Bitwise ORing in order to set a subset of the bits in the value
• Bitwise XORing in order to toggle a subset of the bits in the value

Below is an example of extracting a subset of the bits in the value:

Mask:   00001111b
Value:  01010101b

Applying the mask to the value means that we want to clear the first (higher) 4 bits, and keep the last (lower) 4 bits. Thus we have extracted the lower 4 bits. The result is:

Mask:   00001111b
Value:  01010101b
Result: 00000101b

Masking is implemented using AND, so in C we get:

uint8_t stuff(...) {
  uint8_t mask = 0x0f;   // 00001111b
  uint8_t value = 0x55;  // 01010101b
  return mask & value;
}

Here is a fairly common use-case: Extracting individual bytes from a larger word. We define the high-order bits in the word as the first byte. We use two operators for this, &, and >> (shift right). This is how we can extract the four bytes from a 32-bit integer:

void more_stuff(uint32_t value) {             // Example value: 0x01020304
    uint32_t byte1 = (value >> 24);           // 0x01020304 >> 24 is 0x01 so
                                              // no masking is necessary
    uint32_t byte2 = (value >> 16) & 0xff;    // 0x01020304 >> 16 is 0x0102 so
                                              // we must mask to get 0x02
    uint32_t byte3 = (value >> 8)  & 0xff;    // 0x01020304 >> 8 is 0x010203 so
                                              // we must mask to get 0x03
    uint32_t byte4 = value & 0xff;            // here we only mask, no shifting
                                              // is necessary
    ...
}

Notice that you could switch the order of the operators above, you could first do the mask, then the shift. The results are the same, but now you would have to use a different mask:

uint32_t byte3 = (value & 0xff00) >> 8;

The meaning of subscript in computing is: "a symbol (notionally written as a subscript but in practice usually not) used in a program, alone or with others, to specify one of the elements of an array."

Now, in the simple example given by @user2194711 we can see that the appending element is not able to be a part of the list because of two reasons:-

1) We are not really calling the method append; because it needs () to call it.

2) The error is indicating that the function or method is not subscriptable; means they are not indexable like a list or sequence.

Now see this:-

>>> var = "myString"
>>> def foo(): return 0
... 
>>> var[3]
't'
>>> foo[3]
Traceback (most recent call last):
  File "<stdin>", line 1, in <module>
TypeError: 'function' object is not subscriptable

That means there are no subscripts or say elements in function like they occur in sequences; and we cannot access them like we do, with the help of [].

Also; as mipadi said in his answer; It basically means that the object implements the __getitem__() method. (if it is subscriptable). Thus the error produced:

arr.append["HI"]

TypeError: 'builtin_function_or_method' object is not subscriptable

Kernel space and user space is the separation of the privileged operating system functions and the restricted user applications. The separation is necessary to prevent user applications from ransacking your computer. It would be a bad thing if any old user program could start writing random data to your hard drive or read memory from another user program's memory space.

User space programs cannot access system resources directly so access is handled on the program's behalf by the operating system kernel. The user space programs typically make such requests of the operating system through system calls.

Kernel threads, processes, stack do not mean the same thing. They are analogous constructs for kernel space as their counterparts in user space.

Think of it this way, the "Public API Key" is similar to a user name that your database is using as a login to a verification server. The "Private API Key" would then be similar to the password. By the site/databse using this method, the security is maintained on the third party/verification server in order to authentic request of posting or editing your site/database.

The API string is just the URL of the login for your site/database to contact the verification server.

I/O Bound process:- If most part of the lifetime of a process is spent in i/o state, then the process is a i/o bound process.example:-calculator,internet explorer

CPU Bound process:- If most part of the process life is spent in cpu,then it is cpu bound process.

Web service is absolutely the same as Web API - just a bit more restricted in terms of underlying data format. Both use HTTP protocol and both allows to create RESTful services. And don't forget for other protocols like JSON-RPC - maybe they fit better.

An API (Application Programming Interface) is the means by which third parties can write code that interfaces with other code. A Web Service is a type of API, one that almost always operates over HTTP (though some, like SOAP, can use alternate transports, like SMTP). The official W3C definition mentions that Web Services don't necessarily use HTTP, but this is almost always the case and is usually assumed unless mentioned otherwise.

For examples of web services specifically, see SOAP, REST, and XML-RPC. For an example of another type of API, one written in C for use on a local machine, see the Linux Kernel API.

As far as the protocol goes, a Web service API almost always uses HTTP (hence the Web part), and definitely involves communication over a network. APIs in general can use any means of communication they wish. The Linux kernel API, for example, uses Interrupts to invoke the system calls that comprise its API for calls from user space.

Normal array can serve as a dictionary data structure. In general it has multipurpose usage: array, list (vector), hash table, dictionary, collection, stack, queue etc.

$names = [
    'bob' => 27,
    'billy' => 43,
    'sam' => 76,
];

$names['bob'];

And because of wide design it gains no full benefits of specific data structure. You can implement your own dictionary by extending an ArrayObject or you can use SplObjectStorage class which is map (dictionary) implementation allowing objects to be assigned as keys.

On the etymology the term boilerplate: from http://www.takeourword.com/Issue009.html...

Interestingly, the term arose from the newspaper business. Columns and other pieces that were syndicated were sent out to subscribing newspapers in the form of a mat (i.e. a matrix). Once received, boiling lead was poured into this mat to create the plate used to print the piece, hence the name boilerplate. As the article printed on a boilerplate could not be altered, the term came to be used by attorneys to refer to the portions of a contract which did not change through repeated uses in different applications, and finally to language in general which did not change in any document that was used repeatedly for different occasions.

What constitutes boilerplate in programming? As may others have pointed out, it is just a chunk of code that is copied over and over again with little or no changes made to it in the process.

Mutable objects can have their fields changed after construction. Immutable objects cannot.

public class MutableClass {

 private int value;

 public MutableClass(int aValue) {
  value = aValue;
 }

 public void setValue(int aValue) {
  value = aValue;
 }

 public getValue() {
  return value;
 }

}

public class ImmutableClass {

 private final int value;
 // changed the constructor to say Immutable instead of mutable
 public ImmutableClass (final int aValue) {
  //The value is set. Now, and forever.
  value = aValue;
 }

 public final getValue() {
  return value;
 }

}

OPTional

It holds optional software and packages that you install that are not required for the system to run.

There is no standardized name.

Libraries like jquery and lodash refer it as kebab-case. So does Vuejs javascript framework. However, I am not sure whether it's safe to declare that it's referred as kebab-case in javascript world.

Stub - an object that provides predefined answers to method calls.

Mock - an object on which you set expectations.

Fake - an object with limited capabilities (for the purposes of testing), e.g. a fake web service.

Test Double is the general term for stubs, mocks and fakes. But informally, you'll often hear people simply call them mocks.

A group of 8 bits is called a byte ( with the exception where it is not :) for certain architectures )

A word is a fixed sized group of bits that are handled as a unit by the instruction set and/or hardware of the processor. That means the size of a general purpose register ( which is generally more than a byte ) is a word

In the C, a word is most often called an integer => int

My understanding is this:

• A computer program is a set of instructions that can be executed on a computer.
• An application is software that directly helps a user perform tasks.
• The two intersect, but are not synonymous. A program with a user-interface is an application, but many programs are not applications.

Most of the answers here are on the right track. However, a row is not a tuple. Tuples* are unordered sets of known values with names. Thus, the following tuples are the same thing (I'm using an imaginary tuple syntax since a relational tuple is largely a theoretical construct):

(x=1, y=2, z=3)
(z=3, y=2, x=1)
(y=2, z=3, x=1)

...assuming of course that x, y, and z are all integers. Also note that there is no such thing as a "duplicate" tuple. Thus, not only are the above equal, they're the same thing. Lastly, tuples can only contain known values (thus, no nulls).

A row** is an ordered set of known or unknown values with names (although they may be omitted). Therefore, the following comparisons return false in SQL:

(1, 2, 3) = (3, 2, 1)
(3, 1, 2) = (2, 1, 3)

Note that there are ways to "fake it" though. For example, consider this INSERT statement:

INSERT INTO point VALUES (1, 2, 3)

Assuming that x is first, y is second, and z is third, this query may be rewritten like this:

INSERT INTO point (x, y, z) VALUES (1, 2, 3)

Or this:

INSERT INTO point (y, z, x) VALUES (2, 3, 1)

...but all we're really doing is changing the ordering rather than removing it.

And also note that there may be unknown values as well. Thus, you may have rows with unknown values:

(1, 2, NULL) = (1, 2, NULL)

...but note that this comparison will always yield UNKNOWN. After all, how can you know whether two unknown values are equal?

And lastly, rows may be duplicated. In other words, (1, 2) and (1, 2) may compare to be equal, but that doesn't necessarily mean that they're the same thing.

If this is a subject that interests you, I'd highly recommend reading SQL and Relational Theory: How to Write Accurate SQL Code by CJ Date.

* Note that I'm talking about tuples as they exist in the relational model, which is a bit different from mathematics in general.

**And just in case you're wondering, just about everything in SQL is a row or table. Therefore, (1, 2) is a row, while VALUES (1, 2) is a table (with one row).

UPDATE: I've expanded a little bit on this answer in a blog post here.

Marshaling uses Serialization process actually but the major difference is that it in Serialization only data members and object itself get serialized not signatures but in Marshalling Object + code base(its implementation) will also get transformed into bytes.

Marshalling is the process to convert java object to xml objects using JAXB so that it can be used in web services.

Tag = a defined slice in time, usually used for releases

I think this is what one typically means by "tag". But in Subversion:

They don't really have any formal meaning. A folder is a folder to SVN.

which I find rather confusing: a revision control system that knows nothing about branches or tags. From an implementation point of view, I think the Subversion way of creating "copies" is very clever, but me having to know about it is what I'd call a leaky abstraction.

Or perhaps I've just been using CVS far too long.

The answer by Daniel A.A. Pelsmaeker and Yesh analogy is excellent. I would like to add a bit more from hackerrank tutorial. Hope it helps a bit too.

• The depth(or level) of a node is its distance(i.e. no of edges) from tree's root node.
• The height is number of edges between root node and furthest leaf.
• height(node) = 1 + max(height(node.leftSubtree),height(node.rightSubtree)).
  Keep in mind the following points before reading the example ahead.
• Any node has a height of 1.
• Height of empty subtree is -1.
• Height of single element tree or leaf node is 0.
  

You can prevent race condition, if you use "Atomic" classes. The reason is just the thread don't separate operation get and set, example is below:

AtomicInteger ai = new AtomicInteger(2);
ai.getAndAdd(5);

As a result, you will have 7 in link "ai". Although you did two actions, but the both operation confirm the same thread and no one other thread will interfere to this, that means no race conditions!

From wiki.answers.com:

The term declaration means (in C) that you are telling the compiler about type, size and in case of function declaration, type and size of its parameters of any variable, or user defined type or function in your program. No space is reserved in memory for any variable in case of declaration. However compiler knows how much space to reserve in case a variable of this type is created.

for example, following are all declarations:

extern int a; 
struct _tagExample { int a; int b; }; 
int myFunc (int a, int b);

Definition on the other hand means that in additions to all the things that declaration does, space is also reserved in memory. You can say "DEFINITION = DECLARATION + SPACE RESERVATION" following are examples of definition:

int a; 
int b = 0; 
int myFunc (int a, int b) { return a + b; } 
struct _tagExample example; 

see Answers.

A parameter is the variable which is part of the method’s signature (method declaration). An argument is an expression used when calling the method.

Consider the following code:

void Foo(int i, float f)
{
    // Do things
}

void Bar()
{
    int anInt = 1;
    Foo(anInt, 2.0);
}

Here i and f are the parameters, and anInt and 2.0 are the arguments.

I had the same doubt about stateful v/s stateless class design and did some research. Just completed and my findings has been posted in my blog

• Entity classes needs to be stateful
• The helper / worker classes should not be stateful.

Runtime is a general term that refers to any library, framework, or platform that your code runs on.

The C and C++ runtimes are collections of functions.

The .NET runtime contains an intermediate language interpreter, a garbage collector, and more.

Arguments and parameters are different in that parameters are used to different values in the program and The arguments are passed the same value in the program so they are used in c++. But no difference in c. It is the same for arguments and parameters in c.

Callback functions :

We define a callback function named callback give it a parameter otherFunction and invoke it inside the function body.

function callback(otherFunction){
    otherFunction();
}

When we invoke callback function it expects an argument of the type function, so we invoke it with an anonymous function. However, it produces an error if the argument is not of type function.

callback(function(){console.log('SUCCESS!')}); 
callback(1); // error

Baking the pizza example. oven to bake pizza base topped with ingredients Now here, oven is the callback function. and pizza base with ingredients is the otherFunction.

Point to note is that different pizza ingredients produce different types of pizzas but the oven which bakes it stays the same. That is somewhat a job of a callback function, which keeps expecting functions with different functionalities in order to produce different custom outcomes.

According to Wikipedia:

In Python, the term monkey patch only refers to dynamic modifications of a class or module at runtime, motivated by the intent to patch existing third-party code as a workaround to a bug or feature which does not act as you desire.

Monolithic kernel is a single large process running entirely in a single address space. It is a single static binary file. All kernel services exist and execute in the kernel address space. The kernel can invoke functions directly. Examples of monolithic kernel based OSs: Unix, Linux.

In microkernels, the kernel is broken down into separate processes, known as servers. Some of the servers run in kernel space and some run in user-space. All servers are kept separate and run in different address spaces. Servers invoke "services" from each other by sending messages via IPC (Interprocess Communication). This separation has the advantage that if one server fails, other servers can still work efficiently. Examples of microkernel based OSs: Mac OS X and Windows NT.

Here's a concrete example:

Suppose you have a function that calculates the gravitational force acting on an object. If you don't know the formula, you can find it here. This function takes in the three necessary parameters as arguments.

Now, being on the earth, you only want to calculate forces for objects on this planet. In a functional language, you could pass in the mass of the earth to the function and then partially evaluate it. What you'd get back is another function that takes only two arguments and calculates the gravitational force of objects on earth. This is called currying.

Explaining the practical use for a closure in JavaScript

When we create a function inside another function, we are creating a closure. Closures are powerful because they are capable of reading and manipulating the data of its outer functions. Whenever a function is invoked, a new scope is created for that call. The local variable declared inside the function belong to that scope and they can only be accessed from that function. When the function has finished the execution, the scope is usually destroyed.

A simple example of such function is this:

function buildName(name) {
    const greeting = "Hello, " + name;
    return greeting;
}

In above example, the function buildName() declares a local variable greeting and returns it. Every function call creates a new scope with a new local variable. After the function is done executing, we have no way to refer to that scope again, so it’s garbage collected.

But how about when we have a link to that scope?

Let’s look at the next function:

function buildName(name) {
    const greeting = "Hello, " + name + " Welcome ";
    const sayName = function() {
        console.log(greeting);
    };
    return sayName;
}

const sayMyName = buildName("Mandeep");
sayMyName();  // Hello, Mandeep Welcome

The function sayName() from this example is a closure. The sayName() function has its own local scope (with variable welcome) and has also access to the outer (enclosing) function’s scope. In this case, the variable greeting from buildName().

After the execution of buildName is done, the scope is not destroyed in this case. The sayMyName() function still has access to it, so it won’t be garbage collected. However, there is no other way of accessing data from the outer scope except the closure. The closure serves as the gateway between the global context and the outer scope.

This standard provides a common basis for Unix-like operating systems. It specifies how the shell should work, what to expect from commands like ls and grep, and a number of C libraries that C authors can expect to have available.

For example, the pipes that command-line users use to string together commands are specified in detail here, which means C’s popen (pipe open) function is POSIX-standard, not ISO C-standard.

In short, function pointer is just a pointer to a location in the program code base (like program counter). Whereas Closure = Function pointer + Stack frame.

.

Here's an example of a reverse proxy (as a load balancer).

A client surfs to website.com and the server it hits has a reverse proxy running on it. The reverse proxy happens to be Pound. Pound takes the request and sends it to one of the three application servers sitting behind it. In this example, Pound is a load balancer. That is, it is balancing the load between three application servers.

The application servers serve up the website content back to the client.

There's a lot of possible answers to this.

First: it's not really a question of the difference between a scripting language and a programming language, because a scripting language is a programming language. It's more a question of what traits make some programming language a scripting language while another programming language isn't a scripting language.

Second: it's really hard to say what a XYZ language is, whether that XYZ be "scripting", "functional programming", "object-oriented programming" or what have you. The definition of what "functional programming" is, is pretty clear, but nobody knows what a "functional programming language" is.

Functional programming or object-oriented programming are programming styles; you can write in a functional style or an object-oriented style in pretty much any language. For example, the Linux Virtual File System Switch and the Linux Driver Model are heavily object-oriented despite written in C, whereas a lot of Java or C# code you see on the web is very procedural and not object-oriented at all. OTOH, I have seen some heavily functional Java code.

So, if functional programming and object-oriented programming are merely styles that can be done in any language, then how do you define an "object-oriented programming language"? You could say that an object-oriented programming language is a language that allows object-oriented programming. But that's not much of a definition: all languages allow object-oriented programming, therefore all languages are object-oriented? So, you say, well a language is object-oriented, if it forces you to programming in an object-oriented style. But that's not much of a definition, either: all languages allow functional programming, therefore no language is object-oriented?

So, for me, I have found the following definition:

A language is a scripting language (object-oriented language / functional language) if it both

• facilitates scripting (object-oriented programming / functional programming), i.e. it not only allows it but makes it easy and natural and contains features that help with it, AND
• encourages and guides you towards scripting (object-oriented programming / functional programming).

So, after five paragraphs, I have arrived at: "a scripting language is a language for scripting". What a great definition. NOT.

Obviously, we now need to look at the definition of "scripting".

This is where the third problem comes in: whereas the term "functional programming" is well-defined and it's only the term "functional programming language" that is problematic, unfortunately with scripting, both the term "scripting" and the term "scripting language" are ill-defined.

Well, firstly scripting is programming. It's just a special kind of programming. IOW: every script is a program, but not every program is a script; the set of all scripts is a proper subset of the set of all programs.

In my personal opinion, the thing that makes scripting scripting and distinguishes it from other kinds of programming, is that …

Scripts largely manipulate objects that

• were not created by the script,
• have a lifetime independent of the script and
• live outside the domain of the script.

Also, the datatypes and algorithms used are generally not defined by the script but by the outside environment.

Think about a shell script: shell scripts usually manipulate files, directories and processes. The majority of files, directories and processes on your system were probably not created by the currently running script. And they don't vanish when the script exits: their lifetime is completely independent of the script. And they aren't really part of the script, either, they are a part of the system. You didn't start your script by writing File and Directory classes, those datatypes are none of your concern: you just assume they are there, and you don't even know (nor do you need to know) how they work. And you don't implement your own algorithms, either, e.g. for directory traversal you just use find instead of implementing your own breadth-first-search.

In short: a script attaches itself to a larger system that exists independently of the script, manipulates some small part of the system and then exits.

That larger system can be the operating system in case of a shell script, the browser DOM in case of a browser script, a game (e.g. World of Warcraft with Lua or Second Life with the Linden Scripting Language), an application (e.g. the AutoLisp language for AutoCAD or Excel/Word/Office macros), a web server, a pack of robots or something else entirely.

Note that the scripting aspect is completely orthogonal to all the other aspects of programming languages: a scripting language can be strongly or weakly typed, strictly or loosely typed, statically or dynamically typed, nominally, structurally or duck typed, heck it can even be untyped. It can be imperative or functional, object-oriented, procedural or functional, strict or lazy. Its implementations can be interpreted, compiled or mixed.

For example, Mondrian is a strictly strongly statically typed lazy functional scripting language with a compiled implementation.

However, all of this is moot, because the way the term scripting language is really used in the real world, has nothing to do with any of the above. It is most often used simply as an insult, and the definition is rather simple, even simplistic:

• real programming language: my programming language
• scripting language: your programming language

This seems to be the way that the term is most often used.

Parameter is variable in the declaration of function.

Argument is the actual value of this variable that gets passed to function.

Thread

The bare metal thing, you probably don't need to use it, you probably can use a LongRunning task and take the benefits from the TPL - Task Parallel Library, included in .NET Framework 4 (february, 2002) and above (also .NET Core).

Tasks

Abstraction above the Threads. It uses the thread pool (unless you specify the task as a LongRunning operation, if so, a new thread is created under the hood for you).

Thread Pool

As the name suggests: a pool of threads. Is the .NET framework handling a limited number of threads for you. Why? Because opening 100 threads to execute expensive CPU operations on a Processor with just 8 cores definitely is not a good idea. The framework will maintain this pool for you, reusing the threads (not creating/killing them at each operation), and executing some of them in parallel, in a way that your CPU will not burn.

OK, but when to use each one?

In resume: always use tasks.

Task is an abstraction, so it is a lot easier to use. I advise you to always try to use tasks and if you face some problem that makes you need to handle a thread by yourself (probably 1% of the time) then use threads.

BUT be aware that:

• I/O Bound: For I/O bound operations (database calls, read/write files, APIs calls, etc) avoid using normal tasks, use LongRunning tasks (or threads if you need to). Because using tasks would lead you to a thread pool with a few threads busy and a lot of another tasks waiting for its turn to take the pool.
• CPU Bound: For CPU bound operations just use the normal tasks (that internally will use the thread pool) and be happy.

Sharding is just another name for "horizontal partitioning" of a database. You might want to search for that term to get it clearer.

From Wikipedia:

Horizontal partitioning is a design principle whereby rows of a database table are held separately, rather than splitting by columns (as for normalization). Each partition forms part of a shard, which may in turn be located on a separate database server or physical location. The advantage is the number of rows in each table is reduced (this reduces index size, thus improves search performance). If the sharding is based on some real-world aspect of the data (e.g. European customers vs. American customers) then it may be possible to infer the appropriate shard membership easily and automatically, and query only the relevant shard.

Some more information about sharding:

Firstly, each database server is identical, having the same table structure. Secondly, the data records are logically split up in a sharded database. Unlike the partitioned database, each complete data record exists in only one shard (unless there's mirroring for backup/redundancy) with all CRUD operations performed just in that database. You may not like the terminology used, but this does represent a different way of organizing a logical database into smaller parts.

Update: You wont break MVC. The work of determining the correct shard where to store the data would be transparently done by your data access layer. There you would have to determine the correct shard based on the criteria which you used to shard your database. (As you have to manually shard the database into some different shards based on some concrete aspects of your application.) Then you have to take care when loading and storing the data from/into the database to use the correct shard.

Maybe this example with Java code makes it somewhat clearer (it's about the Hibernate Shards project), how this would work in a real world scenario.

To address the "why sharding": It's mainly only for very large scale applications, with lots of data. First, it helps minimizing response times for database queries. Second, you can use more cheaper, "lower-end" machines to host your data on, instead of one big server, which might not suffice anymore.

Grid computing is where more than one computer coordinates to solve a problem together. Often used for problems involving a lot of number crunching, which can be easily parallelisable.

Cloud computing is where an application doesn't access resources it requires directly, rather it accesses them through something like a service. So instead of talking to a specific hard drive for storage, and a specific CPU for computation, etc. it talks to some service that provides these resources. The service then maps any requests for resources to its physical resources, in order to provide for the application. Usually the service has access to a large amount of physical resources, and can dynamically allocate them as they are needed.

In this way, if an application requires only a small amount of some resource, say computation, then the service only allocates a small amount, say on a single physical CPU (that may be shared with some other application using the service). If the application requires a large amount of some resource, then the service allocates that large amount, say a grid of CPUs. The application is relatively oblivious to this, and all the complex handling and coordination is performed by the service, not the application. In this way the application can scale well.

For example a web site written "on the cloud" may share a server with many other web sites while it has a low amount of traffic, but may be moved to its own dedicated server, or grid of servers, if it ever has massive amounts of traffic. This is all handled by the cloud service, so the application shouldn't have to be modified drastically to cope.

A cloud would usually use a grid. A grid is not necessarily a cloud or part of a cloud.

Wikipedia articles: Grid computing, Cloud computing.

An epoch contains a few iterations. That's actually what this 'epoch' is. Let's define 'epoch' as the number of iterations over the data set in order to train the neural network.

In computer science both a simulation and emulation produce the same outputs, from the same inputs, that the original system does; However, an emulation also uses the same processes to achieve it and is made out of the same materials. A simulation uses different processes from the original system. Also worth noting is the term replication, which is the intermediate of the two - using the same processes but being made out of a different material.

So if I want to run my old Super Mario Bros game on my PC I use an SNES emulator, because it is using the same or similar computer code (processes) to run the game, and uses the same or similar materials (silicon chip). However, if I want to fly a Boeing 747 jet on my PC I use a flight simulator because it uses completely different processes from the original (there are no actual wings, lift or aerodynamics involved!).

Here are the exact definitions taken from a computer science glossary:

A simulation is a model of a system that captures the functional connections between inputs and outputs of the system, but without necessarily being based on processes that are the same as, or similar to, those of the system itself.

A replication is a model of a system that captures the functional connections between inputs and outputs of the system and is based on processes that are the same as, or similar to, those of the system itself.

An emulation is a model of some system that captures the functional connections between inputs and outputs of the system, based on processes that are the same as, or similar to, those of that system, and that is built of the same materials as that system.

Reference: The Open University, M366 Glossary 1.1, 2007

This I believe is a subjective question, so I will provide my subjective opinion.

Angular has a modularization mechanism built in. When you create your app, the first thing you would do is

var app = angular.module("myApp");

and then

app.directive(...);

app.controller(...);

app.service(...);

If you have a look at the angular-seed which is neat starter app for angular, they have separated out the directives, services, controllers etc into different modules and then loaded those modules as dependancies on your main app.

Something like :

var app = angular.module("myApp",["Directives","Controllers","Services"];

Angular also lazy loads these modules ( into memory) not their script files.

In terms of lazy loading script files, to be frank unless you are writing something extremely large it would be an overkill because angular by its very nature reduces the amount of code you write. A typical app written in most other frameworks could expect a reduction in around 30-50% in LOC if written in angular.

There is no way to delete or read the past history.

You could try going around it by emulating history in your own memory and calling history.pushState everytime window popstate event is emitted (which is proposed by the currently accepted Mike's answer), but it has a lot of disadvantages that will result in even worse UX than not supporting the browser history at all in your dynamic web app, because:

• popstate event can happen when user goes back ~2-3 states to the past
• popstate event can happen when user goes forward

So even if you try going around it by building virtual history, it's very likely that it can also lead into a situation where you have blank history states (to which going back/forward does nothing), or where that going back/forward skips some of your history states totally.

When you use toolbar:

....
private void InitToolbar() {
    toolbar = (Toolbar) findViewById(R.id.my_awesome_toolbar);
    toolbartitle = (TextView) findViewById(R.id.titletool);
    toolbar.inflateMenu(R.menu.show_post);
    toolbar.setOnMenuItemClickListener(this);
    Menu menu = toolbar.getMenu();
    MenuItem menu_comments = menu.findItem(R.id.action_comments);
    MenuItemCompat
            .setActionView(menu_comments, R.layout.menu_commentscount);
    View v = MenuItemCompat.getActionView(menu_comments);
    v.setOnClickListener(new OnClickListener() {

        @Override
        public void onClick(View arg0) {
            // Your Action
        }
    });
    comment_count = (TextView) v.findViewById(R.id.count);
}

and in your load data call refreshMenu():

private void refreshMenu() {
    comment_count.setVisibility(View.VISIBLE);
    comment_count.setText("" + post_data.getComment_count());
}

iReport does not work with java 8.

• if not yet installed, download and install java 7
• find the install dir of your iReport and open the file: ireport.conf

(you will find it here: iReport-x.x.x\etc\ )

change this line:

#jdkhome="/path/to/jdk"

to this (if not this is your java 7 install dir then replace the parameter value between ""s with your installed java 7's path):

jdkhome="C:\Program Files\Java\jdk1.7.0_67"

If you want to push or pull your files from devices monitor now android studio offers something better then android monitor. Just take a look at right side of your studio there is an option device file explorer. Open it and you are good to go. Select your device from top dropdown and rest of everything is pretty much the same as it was in android monitor. Below is the screen Shot attached to give you the exact location and idea.

mmm...

Static means that you can access that function without having an instance of the class.

You can access directly from the class definition.

You'll get that error once your numbers are greater than sys.maxsize:

>>> p = [sys.maxsize]
>>> preds[0] = p
>>> p = [sys.maxsize+1]
>>> preds[0] = p
Traceback (most recent call last):
  File "<stdin>", line 1, in <module>
OverflowError: Python int too large to convert to C long

You can confirm this by checking:

>>> import sys
>>> sys.maxsize
2147483647

To take numbers with larger precision, don't pass an int type which uses a bounded C integer behind the scenes. Use the default float:

>>> preds = np.zeros((1, 3))

I can't set "UTF-8 with BOM" in the corner button either, but I can change it from the menu bar.

"File"->"Save with encoding"->"UTF-8 with BOM"

Some days ago, I worked on the problem of removing trailing zeros from the string of a number.

In the continuity of that problem, I find this one interesting because it widens the problem to numbers comprising commas.

I have taken the regex's pattern I had writen in that previous problem I worked on and I improved it in order that it can treat the numbers with commas as an answer for this problem.

I've been carried away with my enthusiasm and my liking of regexes. I don't know if the result fits exactly to the need expressed by Michael Prescott. I would be interested to know the points that are in excess or in lack in my regex, and to correct it to make it more suitable for you.

Now, after a long session of work on this regex, I have a sort of weight in the brain, so I'm not fresh enough to give a lot of explanation. If points are obscure, and if anybody may come to be interested enough, please, ask me.

The regex is built in order that it can detect the numbers expressed in scientific notation 2E10 or even 5,22,454.12E-00.0478 , removing unnecessary zeros in the two parts of such numbers too. If an exponent is equal to zero , the number is modified so that there is no more exponent.

I put some verification in the pattern so that some particular cases will not match, for exemple '12..57' won't match. But in ',111' the string '111' matches because the preceding comma is considered a comma not being in a number but a comma of sentence.

I think that the managing of commas should be improved, because it seems to me that there are only 2 digits between commas in Indian numbering. It won't be dificult to correct, I presume

Here after is a code demonstrating how my regex works. There are two functions, according if one wants the numbers '.1245' to be transformed in '0.1245' or not. I wouldn't be surprised if errors or unwanted matchings or unmatchings will remain for certain cases of number strings; then I'd like to know these cases to understand and correct the deficiency.

I apologize for this code written in Python, but regexes are trans-langage and I think everybody will be capable of undertsanding the reex's pattern

import re

regx = re.compile('(?<![\d.])(?!\.\.)(?<![\d.][eE][+-])(?<![\d.][eE])(?<!\d[.,])'
                  '' #---------------------------------
                  '([+-]?)'
                  '(?![\d,]*?\.[\d,]*?\.[\d,]*?)'
                  '(?:0|,(?=0)|(?<!\d),)*'
                  '(?:'
                  '((?:\d(?!\.[1-9])|,(?=\d))+)[.,]?'
                  '|\.(0)'
                  '|((?<!\.)\.\d+?)'
                  '|([\d,]+\.\d+?))'
                  '0*'
                  '' #---------------------------------
                  '(?:'
                  '([eE][+-]?)(?:0|,(?=0))*'
                  '(?:'
                  '(?!0+(?=\D|\Z))((?:\d(?!\.[1-9])|,(?=\d))+)[.,]?'
                  '|((?<!\.)\.(?!0+(?=\D|\Z))\d+?)'
                  '|([\d,]+\.(?!0+(?=\D|\Z))\d+?))'
                  '0*'
                  ')?'
                  '' #---------------------------------
                  '(?![.,]?\d)')


def dzs_numbs(x,regx = regx): # ds = detect and zeros-shave
    if not regx.findall(x):
        yield ('No match,', 'No catched string,', 'No groups.')
    for mat in regx.finditer(x):
        yield (mat.group(), ''.join(mat.groups('')), mat.groups(''))

def dzs_numbs2(x,regx = regx): # ds = detect and zeros-shave
    if not regx.findall(x):
        yield ('No match,', 'No catched string,', 'No groups.')
    for mat in regx.finditer(x):
        yield (mat.group(),
               ''.join(('0' if n.startswith('.') else '')+n for n in mat.groups('')),
               mat.groups(''))

NS = ['  23456000and23456000. or23456000.000  00023456000 s000023456000.  000023456000.000 ',
      'arf 10000 sea10000.+10000.000  00010000-00010000. kant00010000.000 ',
      '  24:  24,  24.   24.000  24.000,   00024r 00024. blue 00024.000  ',
      '  8zoom8.  8.000  0008  0008. and0008.000  ',
      '  0   00000M0. = 000.  0.0  0.000    000.0   000.000   .000000   .0   ',
      '  .0000023456    .0000023456000   '
      '  .0005872    .0005872000   .00503   .00503000   ',
      '  .068    .0680000   .8   .8000  .123456123456    .123456123456000    ',
      '  .657   .657000   .45    .4500000   .7    .70000  0.0000023230000   000.0000023230000   ',
      '  0.0081000    0000.0081000  0.059000   0000.059000     ',
      '  0.78987400000 snow  00000.78987400000  0.4400000   00000.4400000   ',
      '  -0.5000  -0000.5000   0.90   000.90   0.7   000.7   ',
      '  2.6    00002.6   00002.60000  4.71   0004.71    0004.7100   ',
      '  23.49   00023.49   00023.490000  103.45   0000103.45   0000103.45000    ',
      '  10003.45067   000010003.45067   000010003.4506700 ',
      '  +15000.0012   +000015000.0012   +000015000.0012000    ',
      '  78000.89   000078000.89   000078000.89000    ',
      '  .0457e10   .0457000e10   00000.0457000e10  ',
      '   258e8   2580000e4   0000000002580000e4   ',
      '  0.782e10   0000.782e10   0000.7820000e10  ',
      '  1.23E2   0001.23E2  0001.2300000E2   ',
      '  432e-102  0000432e-102   004320000e-106   ',
      '  1.46e10and0001.46e10  0001.4600000e10   ',
      '  1.077e-300  0001.077e-300  0001.077000e-300   ',
      '  1.069e10   0001.069e10   0001.069000e10   ',
      '  105040.03e10  000105040.03e10  105040.0300e10    ',
      '  +286E000024.487900  -78.4500e.14500   .0140E789.  ',
      '  081,12.40E07,95.0120     0045,78,123.03500e-0.00  ',
      '  0096,78,473.0380e-0.    0008,78,373.066000E0.    0004512300.E0000  ',
      '  ..18000  25..00 36...77   2..8  ',
      '  3.8..9    .12500.     12.51.400  ',
      '  00099,111.8713000   -0012,45,83,987.26+0.000,099,88,44.or00,00,00.00must',
      '  00099,44,and   0000,099,88,44.bom',
      '00,000,00.587000  77,98,23,45.,  this,that ',
      '  ,111  145.20  +9,9,9  0012800  .,,.  1  100,000 ',
      '1,1,1.111  000,001.111   -999.  0.  111.110000  1.1.1.111  9.909,888']


for ch in NS:
    print 'string: '+repr(ch)
    for strmatch, modified, the_groups in dzs_numbs2(ch):
        print strmatch.rjust(20),'',modified,'',the_groups
    print

result

string: '  23456000and23456000. or23456000.000  00023456000 s000023456000.  000023456000.000 '
            23456000  23456000  ('', '23456000', '', '', '', '', '', '', '')
           23456000.  23456000  ('', '23456000', '', '', '', '', '', '', '')
        23456000.000  23456000  ('', '23456000', '', '', '', '', '', '', '')
         00023456000  23456000  ('', '23456000', '', '', '', '', '', '', '')
       000023456000.  23456000  ('', '23456000', '', '', '', '', '', '', '')
    000023456000.000  23456000  ('', '23456000', '', '', '', '', '', '', '')

string: 'arf 10000 sea10000.+10000.000  00010000-00010000. kant00010000.000 '
               10000  10000  ('', '10000', '', '', '', '', '', '', '')
              10000.  10000  ('', '10000', '', '', '', '', '', '', '')
           10000.000  10000  ('', '10000', '', '', '', '', '', '', '')
            00010000  10000  ('', '10000', '', '', '', '', '', '', '')
           00010000.  10000  ('', '10000', '', '', '', '', '', '', '')
        00010000.000  10000  ('', '10000', '', '', '', '', '', '', '')

string: '  24:  24,  24.   24.000  24.000,   00024r 00024. blue 00024.000  '
                  24  24  ('', '24', '', '', '', '', '', '', '')
                 24,  24  ('', '24', '', '', '', '', '', '', '')
                 24.  24  ('', '24', '', '', '', '', '', '', '')
              24.000  24  ('', '24', '', '', '', '', '', '', '')
              24.000  24  ('', '24', '', '', '', '', '', '', '')
               00024  24  ('', '24', '', '', '', '', '', '', '')
              00024.  24  ('', '24', '', '', '', '', '', '', '')
           00024.000  24  ('', '24', '', '', '', '', '', '', '')

string: '  8zoom8.  8.000  0008  0008. and0008.000  '
                   8  8  ('', '8', '', '', '', '', '', '', '')
                  8.  8  ('', '8', '', '', '', '', '', '', '')
               8.000  8  ('', '8', '', '', '', '', '', '', '')
                0008  8  ('', '8', '', '', '', '', '', '', '')
               0008.  8  ('', '8', '', '', '', '', '', '', '')
            0008.000  8  ('', '8', '', '', '', '', '', '', '')

string: '  0   00000M0. = 000.  0.0  0.000    000.0   000.000   .000000   .0   '
                   0  0  ('', '0', '', '', '', '', '', '', '')
               00000  0  ('', '0', '', '', '', '', '', '', '')
                  0.  0  ('', '0', '', '', '', '', '', '', '')
                000.  0  ('', '0', '', '', '', '', '', '', '')
                 0.0  0  ('', '', '0', '', '', '', '', '', '')
               0.000  0  ('', '', '0', '', '', '', '', '', '')
               000.0  0  ('', '', '0', '', '', '', '', '', '')
             000.000  0  ('', '', '0', '', '', '', '', '', '')
             .000000  0  ('', '', '0', '', '', '', '', '', '')
                  .0  0  ('', '', '0', '', '', '', '', '', '')

string: '  .0000023456    .0000023456000     .0005872    .0005872000   .00503   .00503000   '
         .0000023456  0.0000023456  ('', '', '', '.0000023456', '', '', '', '', '')
      .0000023456000  0.0000023456  ('', '', '', '.0000023456', '', '', '', '', '')
            .0005872  0.0005872  ('', '', '', '.0005872', '', '', '', '', '')
         .0005872000  0.0005872  ('', '', '', '.0005872', '', '', '', '', '')
              .00503  0.00503  ('', '', '', '.00503', '', '', '', '', '')
           .00503000  0.00503  ('', '', '', '.00503', '', '', '', '', '')

string: '  .068    .0680000   .8   .8000  .123456123456    .123456123456000    '
                .068  0.068  ('', '', '', '.068', '', '', '', '', '')
            .0680000  0.068  ('', '', '', '.068', '', '', '', '', '')
                  .8  0.8  ('', '', '', '.8', '', '', '', '', '')
               .8000  0.8  ('', '', '', '.8', '', '', '', '', '')
       .123456123456  0.123456123456  ('', '', '', '.123456123456', '', '', '', '', '')
    .123456123456000  0.123456123456  ('', '', '', '.123456123456', '', '', '', '', '')

string: '  .657   .657000   .45    .4500000   .7    .70000  0.0000023230000   000.0000023230000   '
                .657  0.657  ('', '', '', '.657', '', '', '', '', '')
             .657000  0.657  ('', '', '', '.657', '', '', '', '', '')
                 .45  0.45  ('', '', '', '.45', '', '', '', '', '')
            .4500000  0.45  ('', '', '', '.45', '', '', '', '', '')
                  .7  0.7  ('', '', '', '.7', '', '', '', '', '')
              .70000  0.7  ('', '', '', '.7', '', '', '', '', '')
     0.0000023230000  0.000002323  ('', '', '', '.000002323', '', '', '', '', '')
   000.0000023230000  0.000002323  ('', '', '', '.000002323', '', '', '', '', '')

string: '  0.0081000    0000.0081000  0.059000   0000.059000     '
           0.0081000  0.0081  ('', '', '', '.0081', '', '', '', '', '')
        0000.0081000  0.0081  ('', '', '', '.0081', '', '', '', '', '')
            0.059000  0.059  ('', '', '', '.059', '', '', '', '', '')
         0000.059000  0.059  ('', '', '', '.059', '', '', '', '', '')

string: '  0.78987400000 snow  00000.78987400000  0.4400000   00000.4400000   '
       0.78987400000  0.789874  ('', '', '', '.789874', '', '', '', '', '')
   00000.78987400000  0.789874  ('', '', '', '.789874', '', '', '', '', '')
           0.4400000  0.44  ('', '', '', '.44', '', '', '', '', '')
       00000.4400000  0.44  ('', '', '', '.44', '', '', '', '', '')

string: '  -0.5000  -0000.5000   0.90   000.90   0.7   000.7   '
             -0.5000  -0.5  ('-', '', '', '.5', '', '', '', '', '')
          -0000.5000  -0.5  ('-', '', '', '.5', '', '', '', '', '')
                0.90  0.9  ('', '', '', '.9', '', '', '', '', '')
              000.90  0.9  ('', '', '', '.9', '', '', '', '', '')
                 0.7  0.7  ('', '', '', '.7', '', '', '', '', '')
               000.7  0.7  ('', '', '', '.7', '', '', '', '', '')

string: '  2.6    00002.6   00002.60000  4.71   0004.71    0004.7100   '
                 2.6  2.6  ('', '', '', '', '2.6', '', '', '', '')
             00002.6  2.6  ('', '', '', '', '2.6', '', '', '', '')
         00002.60000  2.6  ('', '', '', '', '2.6', '', '', '', '')
                4.71  4.71  ('', '', '', '', '4.71', '', '', '', '')
             0004.71  4.71  ('', '', '', '', '4.71', '', '', '', '')
           0004.7100  4.71  ('', '', '', '', '4.71', '', '', '', '')

string: '  23.49   00023.49   00023.490000  103.45   0000103.45   0000103.45000    '
               23.49  23.49  ('', '', '', '', '23.49', '', '', '', '')
            00023.49  23.49  ('', '', '', '', '23.49', '', '', '', '')
        00023.490000  23.49  ('', '', '', '', '23.49', '', '', '', '')
              103.45  103.45  ('', '', '', '', '103.45', '', '', '', '')
          0000103.45  103.45  ('', '', '', '', '103.45', '', '', '', '')
       0000103.45000  103.45  ('', '', '', '', '103.45', '', '', '', '')

string: '  10003.45067   000010003.45067   000010003.4506700 '
         10003.45067  10003.45067  ('', '', '', '', '10003.45067', '', '', '', '')
     000010003.45067  10003.45067  ('', '', '', '', '10003.45067', '', '', '', '')
   000010003.4506700  10003.45067  ('', '', '', '', '10003.45067', '', '', '', '')

string: '  +15000.0012   +000015000.0012   +000015000.0012000    '
         +15000.0012  +15000.0012  ('+', '', '', '', '15000.0012', '', '', '', '')
     +000015000.0012  +15000.0012  ('+', '', '', '', '15000.0012', '', '', '', '')
  +000015000.0012000  +15000.0012  ('+', '', '', '', '15000.0012', '', '', '', '')

string: '  78000.89   000078000.89   000078000.89000    '
            78000.89  78000.89  ('', '', '', '', '78000.89', '', '', '', '')
        000078000.89  78000.89  ('', '', '', '', '78000.89', '', '', '', '')
     000078000.89000  78000.89  ('', '', '', '', '78000.89', '', '', '', '')

string: '  .0457e10   .0457000e10   00000.0457000e10  '
            .0457e10  0.0457e10  ('', '', '', '.0457', '', 'e', '10', '', '')
         .0457000e10  0.0457e10  ('', '', '', '.0457', '', 'e', '10', '', '')
    00000.0457000e10  0.0457e10  ('', '', '', '.0457', '', 'e', '10', '', '')

string: '   258e8   2580000e4   0000000002580000e4   '
               258e8  258e8  ('', '258', '', '', '', 'e', '8', '', '')
           2580000e4  2580000e4  ('', '2580000', '', '', '', 'e', '4', '', '')
  0000000002580000e4  2580000e4  ('', '2580000', '', '', '', 'e', '4', '', '')

string: '  0.782e10   0000.782e10   0000.7820000e10  '
            0.782e10  0.782e10  ('', '', '', '.782', '', 'e', '10', '', '')
         0000.782e10  0.782e10  ('', '', '', '.782', '', 'e', '10', '', '')
     0000.7820000e10  0.782e10  ('', '', '', '.782', '', 'e', '10', '', '')

string: '  1.23E2   0001.23E2  0001.2300000E2   '
              1.23E2  1.23E2  ('', '', '', '', '1.23', 'E', '2', '', '')
           0001.23E2  1.23E2  ('', '', '', '', '1.23', 'E', '2', '', '')
      0001.2300000E2  1.23E2  ('', '', '', '', '1.23', 'E', '2', '', '')

string: '  432e-102  0000432e-102   004320000e-106   '
            432e-102  432e-102  ('', '432', '', '', '', 'e-', '102', '', '')
        0000432e-102  432e-102  ('', '432', '', '', '', 'e-', '102', '', '')
      004320000e-106  4320000e-106  ('', '4320000', '', '', '', 'e-', '106', '', '')

string: '  1.46e10and0001.46e10  0001.4600000e10   '
             1.46e10  1.46e10  ('', '', '', '', '1.46', 'e', '10', '', '')
          0001.46e10  1.46e10  ('', '', '', '', '1.46', 'e', '10', '', '')
     0001.4600000e10  1.46e10  ('', '', '', '', '1.46', 'e', '10', '', '')

string: '  1.077e-300  0001.077e-300  0001.077000e-300   '
          1.077e-300  1.077e-300  ('', '', '', '', '1.077', 'e-', '300', '', '')
       0001.077e-300  1.077e-300  ('', '', '', '', '1.077', 'e-', '300', '', '')
    0001.077000e-300  1.077e-300  ('', '', '', '', '1.077', 'e-', '300', '', '')

string: '  1.069e10   0001.069e10   0001.069000e10   '
            1.069e10  1.069e10  ('', '', '', '', '1.069', 'e', '10', '', '')
         0001.069e10  1.069e10  ('', '', '', '', '1.069', 'e', '10', '', '')
      0001.069000e10  1.069e10  ('', '', '', '', '1.069', 'e', '10', '', '')

string: '  105040.03e10  000105040.03e10  105040.0300e10    '
        105040.03e10  105040.03e10  ('', '', '', '', '105040.03', 'e', '10', '', '')
     000105040.03e10  105040.03e10  ('', '', '', '', '105040.03', 'e', '10', '', '')
      105040.0300e10  105040.03e10  ('', '', '', '', '105040.03', 'e', '10', '', '')

string: '  +286E000024.487900  -78.4500e.14500   .0140E789.  '
  +286E000024.487900  +286E24.4879  ('+', '286', '', '', '', 'E', '', '', '24.4879')
     -78.4500e.14500  -78.45e0.145  ('-', '', '', '', '78.45', 'e', '', '.145', '')
          .0140E789.  0.014E789  ('', '', '', '.014', '', 'E', '789', '', '')

string: '  081,12.40E07,95.0120     0045,78,123.03500e-0.00  '
081,12.40E07,95.0120  81,12.4E7,95.012  ('', '', '', '', '81,12.4', 'E', '', '', '7,95.012')
   0045,78,123.03500  45,78,123.035  ('', '', '', '', '45,78,123.035', '', '', '', '')

string: '  0096,78,473.0380e-0.    0008,78,373.066000E0.    0004512300.E0000  '
    0096,78,473.0380  96,78,473.038  ('', '', '', '', '96,78,473.038', '', '', '', '')
  0008,78,373.066000  8,78,373.066  ('', '', '', '', '8,78,373.066', '', '', '', '')
         0004512300.  4512300  ('', '4512300', '', '', '', '', '', '', '')

string: '  ..18000  25..00 36...77   2..8  '
           No match,  No catched string,  No groups.

string: '  3.8..9    .12500.     12.51.400  '
           No match,  No catched string,  No groups.

string: '  00099,111.8713000   -0012,45,83,987.26+0.000,099,88,44.or00,00,00.00must'
   00099,111.8713000  99,111.8713  ('', '', '', '', '99,111.8713', '', '', '', '')
  -0012,45,83,987.26  -12,45,83,987.26  ('-', '', '', '', '12,45,83,987.26', '', '', '', '')
         00,00,00.00  0  ('', '', '0', '', '', '', '', '', '')

string: '  00099,44,and   0000,099,88,44.bom'
           00099,44,  99,44  ('', '99,44', '', '', '', '', '', '', '')
     0000,099,88,44.  99,88,44  ('', '99,88,44', '', '', '', '', '', '', '')

string: '00,000,00.587000  77,98,23,45.,  this,that '
    00,000,00.587000  0.587  ('', '', '', '.587', '', '', '', '', '')
        77,98,23,45.  77,98,23,45  ('', '77,98,23,45', '', '', '', '', '', '', '')

string: '  ,111  145.20  +9,9,9  0012800  .,,.  1  100,000 '
                ,111  111  ('', '111', '', '', '', '', '', '', '')
              145.20  145.2  ('', '', '', '', '145.2', '', '', '', '')
              +9,9,9  +9,9,9  ('+', '9,9,9', '', '', '', '', '', '', '')
             0012800  12800  ('', '12800', '', '', '', '', '', '', '')
                   1  1  ('', '1', '', '', '', '', '', '', '')
             100,000  100,000  ('', '100,000', '', '', '', '', '', '', '')

string: '1,1,1.111  000,001.111   -999.  0.  111.110000  1.1.1.111  9.909,888'
           1,1,1.111  1,1,1.111  ('', '', '', '', '1,1,1.111', '', '', '', '')
         000,001.111  1.111  ('', '', '', '', '1.111', '', '', '', '')
               -999.  -999  ('-', '999', '', '', '', '', '', '', '')
                  0.  0  ('', '0', '', '', '', '', '', '', '')
          111.110000  111.11  ('', '', '', '', '111.11', '', '', '', '')

Set the FOREIGN_KEY_CHECKS before and after your delete SQL statements.

SET FOREIGN_KEY_CHECKS = 0;
DELETE FROM table WHERE ...
DELETE FROM table WHERE ...
DELETE FROM table WHERE ...
SET FOREIGN_KEY_CHECKS = 1;

Source: https://alvinalexander.com/blog/post/mysql/drop-mysql-tables-in-any-order-foreign-keys.

Not exactly what you are after, but you can also check the type of the variable against Swift types like so:

let object: AnyObject = 1

if object is Int {
}
else if object is String {
}

For example.

Text shouldn't be on its own. Put it into a span element.

Change it to this:

<div id="one">
       <div class="first"></div>
       <span>"Hi I am text"</span>
       <div class="second"></div>
       <div class="third"></div>
</div>

$('#one span').text('Hi I am replace');

The UIWindow.tintColor method wasn't working for me in iOS8 (it was still black), so I had to do this:

let b = UIButton.buttonWithType(UIButtonType.System) as UIButton
var color = b.titleColorForState(.Normal)

This gave the proper blue tint seen in a UIBarButtonItem

You can also use the actual text of the *e*xample test case with -e !

So for:

it "shows the plane arrival time"

you can use

rspec path/to/spec/file.rb -e 'shows the plane arrival time'
./scripts/spec path/to/spec/file.rb -e 'shows the plane arrival time'

no need for rake here.

        DataTable DT = new DataTable();
        DT.Columns.Add("first", typeof(string));
        DT.Columns.Add("second", typeof(string));

        DT.Rows.Add("ss", "test1");
        DT.Rows.Add("sss", "test2");
        DT.Rows.Add("sys", "test3");
        DT.Rows.Add("ss", "test4");
        DT.Rows.Add("ss", "test5");
        DT.Rows.Add("sts", "test6");

        var dr = DT.AsEnumerable().GroupBy(S => S.Field<string>("first")).Select(S => S.First()).
            Select(S => new KeyValuePair<string, string>(S.Field<string>("first"), S.Field<string>("second"))).
           ToDictionary(S => S.Key, T => T.Value);

        foreach (var item in dr)
        {
            Console.WriteLine(item.Key + "-" + item.Value);
        }

You can choose filling zero data or create zero Mat.

1. Filling zero data with setTo():

   img.setTo(Scalar::all(0));
   

2. Create zero data with zeros():

   img = zeros(img.size(), img.type());
   

The img changes address of memory.

I had facing the same issue while writing a simple rest api using node.js eventually found out it was due to wifi blockage and security reason . try once connecting it using your mobile hotspot . if this be the reason it will get resolved immediately.

I wrote with parameters that are predefined

They are not "predefined" logically, somewhere inside your code. But as arguments of SP they have no default values and are required. To avoid passing those params explicitly you have to define default values in SP definition:

Alter Procedure [Test]
    @StartDate AS varchar(6) = NULL, 
    @EndDate AS varchar(6) = NULL
AS
...

NULLs or empty strings or something more sensible - up to you. It does not matter since you are overwriting values of those arguments in the first lines of SP.

Now you can call it without passing any arguments e.g. exec dbo.TEST

I know this post is quite old, but still, if anyone using IntelliJ any want to see dependency tree directly in IDE then they can install Maven Helper Plugin plugin.

Once installed open pom.xml and you would able to see Dependency Analyze tab like below. It also provides option to see dependency that is conflicted only and also as a tree structure.

public JsonResult GetAjaxValue() 
{
  return Json("string value", JsonRequetBehaviour.Allowget); 
}

In Ionic 2 there's a easier way to do that. See the Ionic Docs.

It is more or less like the following:

<ion-grid>
  <ion-row>
    <ion-col>
      1 of 3
    </ion-col>
    <ion-col>
      2 of 3
    </ion-col>
    <ion-col>
      3 of 3
    </ion-col>
  </ion-row>
</ion-grid>

If you are trying to insert the therefore symbol into a WORD DOCUMENT

Hold down the ALT key and type 8756

Hope the answer ur question Regards Al~Hash.

If you are utilizing arrays too much then you should include cstring.h because it has too many functions including finding substrings.

I... don't think so. You can redirect the subdomain (such as blah.something.com) to point to something.com:25566, but I don't think you can actually set up the subdomain to be on a different port like that. I could be wrong, but it'd probably be easier to use a simple .htaccess or something to check %{HTTP_HOST} and redirect according to the subdomain.

This tutorial displays splash screen for 2 seconds. You can easily change it to suit your needs.

- (void)showSplash {
  UIViewController *modalViewController = [[UIViewController alloc] init];
  modalViewController.view = modelView;
  [self presentModalViewController:modalViewController animated:NO];
  [self performSelector:@selector(hideSplash) withObject:nil afterDelay:yourDelay];
}

There's no "best" IDE, only better and worse ones.

Right now I'm trying to settle in with Aptana. It has a lot of cruft that I don't want, like "Jaxer" doodads all over the place. It's reasonably fast, but chokes on large files when syntax highliting is on. I have not been able to figure out how to set up PHP debugging. Three good things about Aptana: easy plugin installations, very fast and intuitive Subversion plugins, ligning fast file search.

I tried Eclipse PDT and Zend for Eclipse, but they have nightmare levels of interface cruft. Installing plugins is a living horror of version mismatches and cryptic error messages.

I also use Komodo (they bought us licenses at work). Komodo has a very intuitive interface, but is ridiculously slow, chokes on medium sized files with syntax highlighting. File search is intuitive, but rather slow. Subversion integration is not that great - slow and buggy. If not for slowness, I would have probably stuck with Komodo, especially for the debugger.

A little more pythonic way I think would be:

timestr = '00:04:23'

ftr = [3600,60,1]

sum([a*b for a,b in zip(ftr, map(int,timestr.split(':')))])

Output is 263Sec.

I would be interested to see if anyone could simplify it further.

Your question is not particularly clear, but in case you want to send POST data to a url without using a form, you can use either fsockopen or curl.

Here's a pretty good walkthrough of both

As Martin K suggested java.util.concurrent.CountDownLatch seems to be a better solution for this. Just adding an example for the same

     public class CountDownLatchDemo
{

    public static void main (String[] args)
    {
        int noOfThreads = 5;
        // Declare the count down latch based on the number of threads you need
        // to wait on
        final CountDownLatch executionCompleted = new CountDownLatch(noOfThreads);
        for (int i = 0; i < noOfThreads; i++)
        {
            new Thread()
            {

                @Override
                public void run ()
                {

                    System.out.println("I am executed by :" + Thread.currentThread().getName());
                    try
                    {
                        // Dummy sleep
                        Thread.sleep(3000);
                        // One thread has completed its job
                        executionCompleted.countDown();
                    }
                    catch (InterruptedException e)
                    {
                        // TODO Auto-generated catch block
                        e.printStackTrace();
                    }
                }

            }.start();
        }

        try
        {
            // Wait till the count down latch opens.In the given case till five
            // times countDown method is invoked
            executionCompleted.await();
            System.out.println("All over");
        }
        catch (InterruptedException e)
        {
            e.printStackTrace();
        }
    }

}

A struct (without a typedef) often needs to (or should) be with the keyword struct when used.

struct A;                      // forward declaration
void function( struct A *a );  // using the 'incomplete' type only as pointer

If you typedef your struct you can leave out the struct keyword.

typedef struct A A;          // forward declaration *and* typedef
void function( A *a );

Note that it is legal to reuse the struct name

Try changing the forward declaration to this in your code:

typedef struct context context;

It might be more readable to do add a suffix to indicate struct name and type name:

typedef struct context_s context_t;

SELECT *
FROM
(
SELECT [Period], [Account], [Value]
FROM TableName
) AS source
PIVOT
(
    MAX([Value])
    FOR [Period] IN ([2000], [2001], [2002])
) as pvt

Another way,

SELECT ACCOUNT,
      MAX(CASE WHEN Period = '2000' THEN Value ELSE NULL END) [2000],
      MAX(CASE WHEN Period = '2001' THEN Value ELSE NULL END) [2001],
      MAX(CASE WHEN Period = '2002' THEN Value ELSE NULL END) [2002]
FROM tableName
GROUP BY Account

• SQLFiddle Demo (both queries)

For Bootstrap version 3.1.1 and above, the best class for centering the content is the .center-block helper class.

I have faced same problem from java heap size.

I have two solutions if you are using java 5(1.5).

1. just install jdk1.6 and go to the preferences of eclipse and set the jre path of jav1 1.6 as you have installed.

2. Check your VM argument and let it be whatever it is. just add one line below of all the arguments present in VM arguments as -Xms512m -Xmx512m -XX:MaxPermSize=...m(192m).

I think it will work...

Use the $( ... ) construct:

hash=$(genhash --use-ssl -s $IP -p 443 --url $URL | grep MD5 | grep -c $MD5)

import numpy as np

x = np.array([1,0,2,3,6])
non_zero_arr = np.extract(x>0,x)

min_index = np.amin(non_zero_arr)
min_value = np.argmin(non_zero_arr)

in your <head>

<meta id="viewport"
      name="viewport"
      content="width=1024, height=768, initial-scale=0, minimum-scale=0.25" />

somewhere in your javascript

document.getElementById("viewport").setAttribute("content",
      "initial-scale=0.5; maximum-scale=1.0; user-scalable=0;");

... but good luck with tweaking it for your device, fiddling for hours... and i'm still not there!

source

I don't think you need cookies. Each document's js code can access the other document elements. So you can use them directly to share data. Your first window w1 opens w2 and save the reference

var w2 = window.open(...) 

In w2 you can access w1 using the opener property of window.

I had a lot of trouble with this and this is what helped me get the DataGrid reloaded with the new values. Make sure you use the data type that your are getting the data from to get the latest data values.

I represented that with SomeDataType below.

DataContext.Refresh(RefreshMode.OverwriteCurrentValues, DataContext.SomeDataType);

Hope this helps someone with the same issues I had.

Is there a good reason not to use a hash? Lookups are O(1) vs. O(n) for the array.

You can use this to call predefined android colours:

element.setBackgroundColor(android.R.color.red);

If you want to use one of your own custom colours, you can add your custom colour to strings.xml and then use the below to call it.

element.setBackgroundColor(R.color.mycolour);

However if you want to set the colour in your layout.xml you can modify and add the below to any element that accepts it.

android:background="#FFFFFF"

Uses ISO8601DateFormatter on iOS10 or newer.

Uses DateFormatter on iOS9 or older.

Swift 4

protocol DateFormatterProtocol {
    func string(from date: Date) -> String
    func date(from string: String) -> Date?
}

extension DateFormatter: DateFormatterProtocol {}

@available(iOS 10.0, *)
extension ISO8601DateFormatter: DateFormatterProtocol {}

struct DateFormatterShared {
    static let iso8601: DateFormatterProtocol = {
        if #available(iOS 10, *) {
            return ISO8601DateFormatter()
        } else {
            // iOS 9
            let formatter = DateFormatter()
            formatter.calendar = Calendar(identifier: .iso8601)
            formatter.locale = Locale(identifier: "en_US_POSIX")
            formatter.timeZone = TimeZone(secondsFromGMT: 0)
            formatter.dateFormat = "yyyy-MM-dd'T'HH:mm:ss.SSSXXXXX"
            return formatter
        }
    }()
}

Another somewhat rare use for the this keyword is when you need to invoke an explicit interface implementation from within the implementing class. Here's a contrived example:

class Example : ICloneable
{
    private void CallClone()
    {
        object clone = ((ICloneable)this).Clone();
    }

    object ICloneable.Clone()
    {
        throw new NotImplementedException();
    }
}

Using java 8, specifically lambda expression, you can do it simply like the below example:

myProducts.stream().filter(prod -> prod.price>10).collect(Collectors.toList())

where for each product inside myProducts collection, if prod.price>10, then add this product to the new filtered list.

If you have installed .NET desktop development and still you can't see the templates, then VS is probably getting the templates from your custom templates folder and not installed.

To fix that, copy the installed templates folder to custom.

This is your "installed" folder

C:\Program Files (x86)\Microsoft Visual Studio 14.0\Common7\IDE\ProjectTemplates

This is your "custom" folder

C:\Users[your username]\Documents\Visual Studio\2017\Templates\ProjectTemplates

Typically this happens when you are at the office and you are running VS as an administrator and visual studio is confused how to merge both of them and if you notice they don't have the same folder structure and folder names.. One is CSHARP and the other C#....

I didn't have the same problem when I installed VS 2017 community edition at home though. This happened when I installed visual studio 2017 "enterprise" edition.

Maybe not as clean or efficient as the already posted solutions, but how about the .each() function? E.g:

var mvar = "";
$(".mbox").each(function() {
    console.log($(this).html());
    mvar += $(this).html();
});
console.log(mvar);

The accepted answer is great, however this can be done with flexbox.

Here's a grid system written with BEM syntax that allows for 1-10 columns to be displayed per row.

If there the last row is incomplete (for example you choose to show 5 cells per row and there are 7 items), the trailing items will be centered horizontally. To control the horizontal alignment of the trailing items, simply change the justify-content property under the .square-grid class.

.square-grid {
  display: flex;
  flex-wrap: wrap;
  justify-content: center;
}

.square-grid__cell {
  background-color: rgba(0, 0, 0, 0.03);
  box-shadow: 0 0 0 1px black;
  overflow: hidden;
  position: relative;
}

.square-grid__content {
  left: 0;
  position: absolute;
  top: 0;
}

.square-grid__cell:after {
  content: '';
  display: block;
  padding-bottom: 100%;
}

// Sizes – Number of cells per row

.square-grid__cell--10 {
  flex-basis: 10%;
}

.square-grid__cell--9 {
  flex-basis: 11.1111111%;
}

.square-grid__cell--8 {
  flex-basis: 12.5%;
}

.square-grid__cell--7 {
  flex-basis: 14.2857143%;
}

.square-grid__cell--6 {
  flex-basis: 16.6666667%;
}

.square-grid__cell--5 {
  flex-basis: 20%;
}

.square-grid__cell--4 {
  flex-basis: 25%;
}

.square-grid__cell--3 {
  flex-basis: 33.333%;
}

.square-grid__cell--2 {
  flex-basis: 50%;
}

.square-grid__cell--1 {
  flex-basis: 100%;
}

.square-grid {_x000D_
  display: flex;_x000D_
  flex-wrap: wrap;_x000D_
  justify-content: center;_x000D_
}_x000D_
_x000D_
.square-grid__cell {_x000D_
  background-color: rgba(0, 0, 0, 0.03);_x000D_
  box-shadow: 0 0 0 1px black;_x000D_
  overflow: hidden;_x000D_
  position: relative;_x000D_
}_x000D_
_x000D_
.square-grid__content {_x000D_
  left: 0;_x000D_
  position: absolute;_x000D_
  top: 0;_x000D_
}_x000D_
_x000D_
.square-grid__cell:after {_x000D_
  content: '';_x000D_
  display: block;_x000D_
  padding-bottom: 100%;_x000D_
}_x000D_
_x000D_
// Sizes – Number of cells per row_x000D_
_x000D_
.square-grid__cell--10 {_x000D_
  flex-basis: 10%;_x000D_
}_x000D_
_x000D_
.square-grid__cell--9 {_x000D_
  flex-basis: 11.1111111%;_x000D_
}_x000D_
_x000D_
.square-grid__cell--8 {_x000D_
  flex-basis: 12.5%;_x000D_
}_x000D_
_x000D_
.square-grid__cell--7 {_x000D_
  flex-basis: 14.2857143%;_x000D_
}_x000D_
_x000D_
.square-grid__cell--6 {_x000D_
  flex-basis: 16.6666667%;_x000D_
}_x000D_
_x000D_
.square-grid__cell--5 {_x000D_
  flex-basis: 20%;_x000D_
}_x000D_
_x000D_
.square-grid__cell--4 {_x000D_
  flex-basis: 25%;_x000D_
}_x000D_
_x000D_
.square-grid__cell--3 {_x000D_
  flex-basis: 33.333%;_x000D_
}_x000D_
_x000D_
.square-grid__cell--2 {_x000D_
  flex-basis: 50%;_x000D_
}_x000D_
_x000D_
.square-grid__cell--1 {_x000D_
  flex-basis: 100%;_x000D_
}

<div class='square-grid'>_x000D_
  <div class='square-grid__cell square-grid__cell--7'>_x000D_
    <div class='square-grid__content'>_x000D_
      Some content_x000D_
    </div>_x000D_
  </div>_x000D_
  <div class='square-grid__cell square-grid__cell--7'>_x000D_
    <div class='square-grid__content'>_x000D_
      Some content_x000D_
    </div>_x000D_
  </div>_x000D_
  <div class='square-grid__cell square-grid__cell--7'>_x000D_
    <div class='square-grid__content'>_x000D_
      Some content_x000D_
    </div>_x000D_
  </div>_x000D_
  <div class='square-grid__cell square-grid__cell--7'>_x000D_
    <div class='square-grid__content'>_x000D_
      Some content_x000D_
    </div>_x000D_
  </div>_x000D_
  <div class='square-grid__cell square-grid__cell--7'>_x000D_
    <div class='square-grid__content'>_x000D_
      Some content_x000D_
    </div>_x000D_
  </div>_x000D_
  <div class='square-grid__cell square-grid__cell--7'>_x000D_
    <div class='square-grid__content'>_x000D_
      Some content_x000D_
    </div>_x000D_
  </div>_x000D_
  <div class='square-grid__cell square-grid__cell--7'>_x000D_
    <div class='square-grid__content'>_x000D_
      Some content_x000D_
    </div>_x000D_
  </div>_x000D_
  <div class='square-grid__cell square-grid__cell--7'>_x000D_
    <div class='square-grid__content'>_x000D_
      Some content_x000D_
    </div>_x000D_
  </div>_x000D_
</div>

Fiddle: https://jsfiddle.net/patrickberkeley/noLm1r45/3/

This is tested in FF and Chrome.

Pass the arguments to the run command from within gdb.

$ gdb ./a.out
(gdb) r < t
Starting program: /dir/a.out < t

Some additional information for anyone who might be struggling with this:

You'll be getting null values if you're trying to get URL from iframe before it's loaded. I solved this problem by creating the whole iframe in javascript and getting the values I needed with the onLoad function:

var iframe = document.createElement('iframe');
iframe.onload = function() {

    //some custom settings
    this.width=screen.width;this.height=screen.height; this.passing=0; this.frameBorder="0";

    var href = iframe.contentWindow.location.href;
    var origin = iframe.contentWindow.location.origin;
    var url = iframe.contentWindow.location.url;
    var path = iframe.contentWindow.location.pathname;

    console.log("href: ", href)
    console.log("origin: ", origin)
    console.log("path: ", path)
    console.log("url: ", url)
};

iframe.src = 'http://localhost/folder/index.html';

document.body.appendChild(iframe);

Because of the same-origin policy, I had problems when accessing "cross origin" frames - I solved that by running a webserver locally instead of running all the files directly from my disk. In order for all of this to work, you need to be accessing the iframe with the same protocol, hostname and port as the origin. Not sure which of these was/were missing when running all files from my disk.

Also, more on location objects: https://www.w3schools.com/JSREF/obj_location.asp

Here's a google chrome extension that'll allow you to download your reviews: https://chrome.google.com/webstore/detail/my-play-store-reviews/ldggikfajgoedghjnflfafiiheagngoa?hl=en

Maybe these examples will help illustrate what in does. It basically translate to Is this item in this other item?

listOfNums = [ 1, 2, 3, 4, 5, 6, 45, 'j' ]

>>> 3 in listOfNums:
>>> True

>>> 'j' in listOfNums:
>>> True

>>> 66 in listOfNums:
>>> False

Just because I like to question code. I propose that you can also make use of the ternary by doing something like this:

Example:

bool flipValue = false;
bool bShouldFlip = true;
flipValue = bShouldFlip ? !flipValue : flipValue;

As supplementary, if you are reading a vvvvery large file, and you don't want read all of the content into memory at once, you might consider using a buffer, then return each word by yield:

def read_words(inputfile):
    with open(inputfile, 'r') as f:
        while True:
            buf = f.read(10240)
            if not buf:
                break

            # make sure we end on a space (word boundary)
            while not str.isspace(buf[-1]):
                ch = f.read(1)
                if not ch:
                    break
                buf += ch

            words = buf.split()
            for word in words:
                yield word
        yield '' #handle the scene that the file is empty

if __name__ == "__main__":
    for word in read_words('./very_large_file.txt'):
        process(word)

For DEFAULT CURRENT_TIMESTAMP:

ALTER TABLE tablename
 CHANGE COLUMN columnname1 columname1 DATETIME NOT NULL DEFAULT CURRENT_TIMESTAMP,
 CHANGE COLUMN columnname2 columname2 DATETIME NOT NULL DEFAULT CURRENT_TIMESTAMP;

Please note double columnname declaration

Removing DEFAULT CURRENT_TIMESTAMP:

ALTER TABLE tablename
 ALTER COLUMN columnname1 DROP DEFAULT,
 ALTER COLUMN columnname2 DROPT DEFAULT;

There is a String.prototype.includes in ES6:

"potato".includes("to");
> true

Note that this does not work in Internet Explorer or some other old browsers with no or incomplete ES6 support. To make it work in old browsers, you may wish to use a transpiler like Babel, a shim library like es6-shim, or this polyfill from MDN:

if (!String.prototype.includes) {
  String.prototype.includes = function(search, start) {
    'use strict';
    if (typeof start !== 'number') {
      start = 0;
    }

    if (start + search.length > this.length) {
      return false;
    } else {
      return this.indexOf(search, start) !== -1;
    }
  };
}

This is an online/offline solution and very easy to convert. SCSS to CSS converter

Try this, you can parse nested JSON

public static String getJsonValue(String jsonReq, String key) {
        JSONObject json = new JSONObject(jsonReq);
        boolean exists = json.has(key);
        Iterator<?> keys;
        String nextKeys;
        String val = "";
        if (!exists) {
            keys = json.keys();
            while (keys.hasNext()) {
                nextKeys = (String) keys.next();
                try {
                    if (json.get(nextKeys) instanceof JSONObject) {
                        return getJsonValue(json.getJSONObject(nextKeys).toString(), key);
                    } else if (json.get(nextKeys) instanceof JSONArray) {
                        JSONArray jsonArray = json.getJSONArray(nextKeys);
                        int i = 0;
                        if (i < jsonArray.length()) do {
                            String jsonArrayString = jsonArray.get(i).toString();
                            JSONObject innerJson = new JSONObject(jsonArrayString);
                            return getJsonValue(innerJson.toString(),key);
                        } while (i < jsonArray.length());
                    }
                } catch (Exception e) {
                    e.printStackTrace();
                }
            }
        } else {
            val = json.get(key).toString();
        }
        return val;
    }

Type this to B3, and then pull it to the rest of the rows:

=IF(C3=C2,B2,B2+COUNTIF($C$1:$C3,C2))

What it does is:

• If my points equals the previous points, I have the same position.
• Othewise count the players with the same score as the previous one, and add their numbers to the previous player's position.

Using the C++ API, the function name has slightly changed and it writes now:

#include <opencv2/imgproc/imgproc.hpp>

cv::Mat greyMat, colorMat;
cv::cvtColor(colorMat, greyMat, CV_BGR2GRAY);

The main difficulties are that the function is in the imgproc module (not in the core), and by default cv::Mat are in the Blue Green Red (BGR) order instead of the more common RGB.

OpenCV 3

Starting with OpenCV 3.0, there is yet another convention. Conversion codes are embedded in the namespace cv:: and are prefixed with COLOR. So, the example becomes then:

#include <opencv2/imgproc/imgproc.hpp>

cv::Mat greyMat, colorMat;
cv::cvtColor(colorMat, greyMat, cv::COLOR_BGR2GRAY);

As far as I have seen, the included file path hasn't changed (this is not a typo).

You need to define the enum outside of the class.

public enum card_suits
{
    Clubs,
    Hearts,
    Spades,
    Diamonds
}

public class Card
{
     // ...

That being said, you may also want to consider using the standard naming guidelines for Enums, which would be CardSuit instead of card_suits, since Pascal Casing is suggested, and the enum is not marked with the FlagsAttribute, suggesting multiple values are appropriate in a single variable.

from pip.req import parse_requirements did not work for me and I think it's for the blank lines in my requirements.txt, but this function does work

def parse_requirements(requirements):
    with open(requirements) as f:
        return [l.strip('\n') for l in f if l.strip('\n') and not l.startswith('#')]

reqs = parse_requirements(<requirements_path>)

setup(
    ...
    install_requires=reqs,
    ...
)

Java Script to find IP

To get the IP Address I am making a JSON call to the Free Web Service. like

[jsonip.com/json, ipinfo.io/json, www.telize.com/geoip, ip-api.com/json, api.hostip.info/get_json.php]

and I am passing the name of the callback function which will be called on completion of the request.

<script type="text/javascript">
    window.onload = function () {
    var webService = "http://www.telize.com/geoip";
        var script = document.createElement("script");
        script.type = "text/javascript";
        script.src = webService+"?callback=MyIP";
        document.getElementsByTagName("head")[0].appendChild(script);
    };
    function MyIP(response) {
        document.getElementById("ipaddress").innerHTML = "Your IP Address is " + response.ip;
    }
</script>
<body>
    <form>
        <span id = "ipaddress"></span>
    </form>
</body>

for xml response code

WebRTC which doesn't require server support.

Here's an example for continuous/regression data (until this issue on GitHub is resolved).

min = np.amin(y)
max = np.amax(y)

# 5 bins may be too few for larger datasets.
bins     = np.linspace(start=min, stop=max, num=5)
y_binned = np.digitize(y, bins, right=True)

X_train, X_test, y_train, y_test = train_test_split(
    X, 
    y, 
    stratify=y_binned
)

• Where start is min and stop is max of your continuous target.
• If you don't set right=True then it will more or less make your max value a separate bin and your split will always fail because too few samples will be in that extra bin.

Since the question is how to replace ALL whitespaces

UPDATE `table` 
SET `col_name` = REPLACE
(REPLACE(REPLACE(`col_name`, ' ', ''), '\t', ''), '\n', '');

Check this out... I just got this working and it seems exactly what you are trying to do as well.

2 functions. One to select the table and copy it to the clipboard, and the second writes it to excel en masse. Just call write_to_excel() and put in your table id (or modify it to take it as an argument).

  function selectElementContents(el) {
        var body = document.body, range, sel;
        if (document.createRange && window.getSelection) {
            range = document.createRange();
            sel = window.getSelection();
            sel.removeAllRanges();
            try {
                range.selectNodeContents(el);
                sel.addRange(range);
            } catch (e) {
                range.selectNode(el);
                sel.addRange(range);
            }
        } else if (body.createTextRange) {
            range = body.createTextRange();
            range.moveToElementText(el);
            range.select();
        }
        range.execCommand("Copy");
    }

function write_to_excel() 
{
var tableID = "AllItems";
selectElementContents( document.getElementById(tableID) );

var excel = new ActiveXObject("Excel.Application");
// excel.Application.Visible = true; 
var wb=excel.WorkBooks.Add();
var ws=wb.Sheets("Sheet1");
ws.Cells(1,1).Select;
ws.Paste;
ws.DrawingObjects.Delete;
ws.Range("A1").Select
 excel.Application.Visible = true; 
}

Heavily influenced from: Select a complete table with Javascript (to be copied to clipboard)

String.valueOf(Character.toChars(int))

Assuming the integer is, as you say, between 0 and 255, you'll get an array with a single character back from Character.toChars, which will become a single-character string when passed to String.valueOf.

Using Character.toChars is preferable to methods involving a cast from int to char (i.e. (char) i) for a number of reasons, including that Character.toChars will throw an IllegalArgumentException if you fail to properly validate the integer while the cast will swallow the error (per the narrowing primitive conversions specification), potentially giving an output other than what you intended.

I'd suggest <a href='page1.jsp'>Refresh</a>.

Couple of ways. Firstly, if you're adding a row each time a [de]activation occurs, you can set the column default to GETDATE() and not set the value in the insert. Otherwise,

UPDATE TableName SET [ColumnName] = GETDATE() WHERE UserId = @userId

You need to define height of ul or your div and set overflow equals to auto as below:

<ul style="width: 300px; height: 200px; overflow: auto">
  <li>text</li>
  <li>text</li>

Sleep() causes the currently executing thread to sleep (temporarily cease execution).

Yield() causes the currently executing thread object to temporarily pause and allow other threads to execute.

Read [this] (Link Removed) for a good explanation of the topic.

No, that's not possible. The port is not part of the hostname, so it has no meaning in the hosts-file.

Using a decorator for measuring execution time for functions can be handy. There is an example at http://www.zopyx.com/blog/a-python-decorator-for-measuring-the-execution-time-of-methods.

Below I've shamelessly pasted the code from the site mentioned above so that the example exists at SO in case the site is wiped off the net.

import time                                                

def timeit(method):

    def timed(*args, **kw):
        ts = time.time()
        result = method(*args, **kw)
        te = time.time()

        print '%r (%r, %r) %2.2f sec' % \
              (method.__name__, args, kw, te-ts)
        return result

    return timed

class Foo(object):

    @timeit
    def foo(self, a=2, b=3):
        time.sleep(0.2)

@timeit
def f1():
    time.sleep(1)
    print 'f1'

@timeit
def f2(a):
    time.sleep(2)
    print 'f2',a

@timeit
def f3(a, *args, **kw):
    time.sleep(0.3)
    print 'f3', args, kw

f1()
f2(42)
f3(42, 43, foo=2)
Foo().foo()

// John

Indeed, you can use the "create" method of Mongoose, it can contain an array of documents, see this example:

Candy.create({ candy: 'jelly bean' }, { candy: 'snickers' }, function (err, jellybean, snickers) {
});

The callback function contains the inserted documents. You do not always know how many items has to be inserted (fixed argument length like above) so you can loop through them:

var insertedDocs = [];
for (var i=1; i<arguments.length; ++i) {
    insertedDocs.push(arguments[i]);
}

Update: A better solution

A better solution would to use Candy.collection.insert() instead of Candy.create() - used in the example above - because it's faster (create() is calling Model.save() on each item so it's slower).

See the Mongo documentation for more information: http://docs.mongodb.org/manual/reference/method/db.collection.insert/

(thanks to arcseldon for pointing this out)

Try this for match condition if scroll to bottom end

if ($(this)[0].scrollHeight - $(this).scrollTop() == 
    $(this).outerHeight()) {

    //code for your custom logic

}

Here's how you might implement a counter:

counter=0
while true; do
  if /home/hadoop/latest/bin/hadoop fs -ls /apps/hdtech/bds/quality-rt/dt=$DATE_YEST_FORMAT2 then
       echo "Files Present" | mailx -s "File Present"  -r [email protected] [email protected]
       exit 0
  elif [[ "$counter" -gt 20 ]]; then
       echo "Counter: $counter times reached; Exiting loop!"
       exit 1
  else
       counter=$((counter+1))
       echo "Counter: $counter time(s); Sleeping for another half an hour" | mailx -s "Time to Sleep Now"  -r [email protected] [email protected]
       sleep 1800
  fi
done

Some Explanations:

• counter=$((counter+1)) - this is how you can increment a counter. The $ for counter is optional inside the double parentheses in this case.
• elif [[ "$counter" -gt 20 ]]; then - this checks whether $counter is not greater than 20. If so, it outputs the appropriate message and breaks out of your while loop.

Here is what I do. Using my editParams() function, you can add, remove, or change any parameter, then use the built in replaceState() function to update the URL:

window.history.replaceState('object or string', 'Title', 'page.html' + editParams('enable', 'true'));


// background functions below:

// add/change/remove URL parameter
// use a value of false to remove parameter
// returns a url-style string
function editParams (key, value) {
  key = encodeURI(key);

  var params = getSearchParameters();

  if (Object.keys(params).length === 0) {
    if (value !== false)
      return '?' + key + '=' + encodeURI(value);
    else
      return '';
  }

  if (value !== false)
    params[key] = encodeURI(value);
  else
    delete params[key];

  if (Object.keys(params).length === 0)
    return '';

  return '?' + $.map(params, function (value, key) {
    return key + '=' + value;
  }).join('&');
}

// Get object/associative array of URL parameters
function getSearchParameters () {
  var prmstr = window.location.search.substr(1);
  return prmstr !== null && prmstr !== "" ? transformToAssocArray(prmstr) : {};
}

// convert parameters from url-style string to associative array
function transformToAssocArray (prmstr) {
  var params = {},
      prmarr = prmstr.split("&");

  for (var i = 0; i < prmarr.length; i++) {
    var tmparr = prmarr[i].split("=");
    params[tmparr[0]] = tmparr[1];
  }
  return params;
}

Just for fun, here's another way:

;with counts as (
    select CustomerName, EmailAddress,
      count(*) over (partition by EmailAddress) as num
    from Customers
)
select CustomerName, EmailAddress
from counts
where num > 1

The warning indicates that you're not returning something at the end of your map arrow function in every case.

A better approach to what you're trying to accomplish is first using a .filter and then a .map, like this:

this.props.comments
  .filter(commentReply => commentReply.replyTo === comment.id)
  .map((commentReply, idx) => <CommentItem key={idx} className="SubComment"/>);

You could try:

MyTextBox.Select();

According to the documentation:

The Select method activates the control if the control's Selectable style bit is set to true in ControlStyles, it is contained in another control, and all its parent controls are both visible and enabled.

You can first check if the control can be selectable by inspecting the MyTextBox.CanSelect property.

have you tried using <pre> tag.

http://jsfiddle.net/NweRa/

I ran into a similar problem. It works on one server and does not on another server with same Nginx configuration. Found the the solution which is answered by Igor here http://forum.nginx.org/read.php?2,1612,1627#msg-1627

Yes. Or you may combine SSL/non-SSL servers in one server:

server {
  listen 80;
  listen 443 default ssl;

  # ssl on   - remember to comment this out

}

You can manipulate the stylesheets and stylesheet rules themselves with javascript

var sheetCount = document.styleSheets.length;
var lastSheet = document.styleSheets[sheetCount-1];
var ruleCount;
if (lastSheet.cssRules) { // Firefox uses 'cssRules'
    ruleCount = lastSheet.cssRules.length;
}
else if (lastSheet.rules) { / /IE uses 'rules'
    ruleCount = lastSheet.rules.length;
}
var newRule = "a:hover { text-decoration: none !important; color: #000 !important; }";
// insert as the last rule in the last sheet so it
// overrides (not overwrites) previous definitions
lastSheet.insertRule(newRule, ruleCount);

Making the attributes !important and making this the very last CSS definition should override any previous definition, unless one is more specifically targeted. You may have to insert more rules in that case.

BigInteger would only be used if you know it will not be a decimal and there is a possibility of the long data type not being large enough. BigInteger has no cap on its max size (as large as the RAM on the computer can hold).

From here.

It is implemented using an int[]:

  110       /**
  111        * The magnitude of this BigInteger, in <i>big-endian</i> order: the
  112        * zeroth element of this array is the most-significant int of the
  113        * magnitude.  The magnitude must be "minimal" in that the most-significant
  114        * int ({@code mag[0]}) must be non-zero.  This is necessary to
  115        * ensure that there is exactly one representation for each BigInteger
  116        * value.  Note that this implies that the BigInteger zero has a
  117        * zero-length mag array.
  118        */
  119       final int[] mag;

From the source

From the Wikipedia article Arbitrary-precision arithmetic:

Several modern programming languages have built-in support for bignums, and others have libraries available for arbitrary-precision integer and floating-point math. Rather than store values as a fixed number of binary bits related to the size of the processor register, these implementations typically use variable-length arrays of digits.

I know the answer for this question is posted a long back, but I wanted to share my answer for the same.

For finding the one’s complement of a number, first find its binary equivalent. Here, decimal number 2 is represented as 0000 0010 in binary form. Now taking its one’s complement by inverting (flipping all 1’s into 0’s and all 0’s into 1’s) all the digits of its binary representation, which will result in:

0000 0010 ? 1111 1101

This is the one’s complement of the decimal number 2. And since the first bit, i.e., the sign bit is 1 in the binary number, it means that the sign is negative for the number it stored. (here, the number referred to is not 2 but the one’s complement of 2).

Now, since the numbers are stored as 2’s complement (taking the one’s complement of a number plus one), so to display this binary number, 1111 1101, into decimal, first we need to find its 2’s complement, which will be:

1111 1101 ? 0000 0010 + 1 ? 0000 0011

This is the 2’s complement. The decimal representation of the binary number, 0000 0011, is 3. And, since the sign bit was one as mentioned above, so the resulting answer is -3.

Hint: If you read this procedure carefully, then you would have observed that the result for the one’s complement operator is actually, the number (operand - on which this operator is applied) plus one with a negative sign. You can try this with other numbers too.

var empty = $("#cartContent").html().trim().length == 0;

Suppose your drop down list is:

<asp:DropDownList runat="server" id="ddl">
<asp:ListItem Value="0" text="Select a Value">
....
</asp:DropDownList>

There are two ways:

<asp:RequiredFieldValidator ID="re1" runat="Server" InitialValue="0" />

the 2nd way is to use a compare validator:

<asp:CompareValidator ID="re1" runat="Server" ValueToCompare="0" ControlToCompare="ddl" Operator="Equal" />

From http://www.oreillynet.com/linux/cmd/cmd.csp?path=g/gcc

The > character does not redirect the standard error. It's useful when you want to save legitimate output without mucking up a file with error messages. But what if the error messages are what you want to save? This is quite common during troubleshooting. The solution is to use a greater-than sign followed by an ampersand. (This construct works in almost every modern UNIX shell.) It redirects both the standard output and the standard error. For instance:

$ gcc invinitjig.c >& error-msg

Have a look there, if this helps: another forum

So If you present a view controller it will not show in navigation controller. It will just take complete screen. For this case you have to create another navigation controller and add your nextViewController as root for this and present this new navigationController.

Another way is to just push the view controller.

self.presentViewController(nextViewController, animated:true, completion:nil)

For more info check Apple documentation:- https://developer.apple.com/library/ios/documentation/UIKit/Reference/UIViewController_Class/#//apple_ref/doc/uid/TP40006926-CH3-SW96

I detected another reason - Thumbs.db, which affected performance badly.

Go to File > Settings > Editor > File Types and in field Ignore files and folders add this: Thumbs.db;

Now, Android Studio runs like a charm.

random.uniform(a, b) appears to be what your looking for. From the docs:

Return a random floating point number N such that a <= N <= b for a <= b and b <= N <= a for b < a.

See here.

Please use the below mentioned URL to encrypt string using AES excryption with 
key and IV values.

https://github.com/muneebahmad/AESiOSObjC

this is the correct answer that worked for me

$(document).ready(function () {
        function resizeIframe() {
            if ($('iframe').contents().find('html').height() > 100) {
                $('iframe').height(($('iframe').contents().find('html').height()) + 'px')
            } else {
                setTimeout(function (e) {
                    resizeIframe();
                }, 50);
            }
        }
        resizeIframe();
    });

Then provided your button is showing and the click event is being fired you can call the following in your click event:

final FragmentTransaction ft = getFragmentManager().beginTransaction(); 
ft.replace(R.id.details, new NewFragmentToReplace(), "NewFragmentTag"); 
ft.commit(); 

and if you want to go back to the DetailsFragment on clicking back ensure you add the above transaction to the back stack, i.e.

ft.addToBackStack(null);

Or am I missing something? Alternatively some people suggest that your activity gets the click event for the button and it has responsibility for replacing the fragments in your details pane.

What about using getApplicationState().isInForeground() ?

I'm assume you cannot get css working for your button using anchor tag. So you need to override the css styles which are being overwritten by other elements using !important property.

HTML

<a href="#" class="selected_btn" data-role="button">Button name</a>

CSS

.selected_btn
{
    border:1px solid red;
    text-decoration:none;
    font-family:helvetica;
    color:red !important;            
    background:url('http://www.lessardstephens.com/layout/images/slideshow_big.png') repeat-x;
}

Here is the demo

Well, the simple regex is this:

/^dbo\..*_fn$/

It would be better, however, to use the string manipulation functionality of whatever programming language you're using to slice off the first four and the last three characters of the string and check whether they're what you want.

Configuration configManager = ConfigurationManager.OpenExeConfiguration(ConfigurationUserLevel.None);
KeyValueConfigurationCollection confCollection = configManager.AppSettings.Settings;

confCollection["YourKey"].Value = "YourNewKey";


configManager.Save(ConfigurationSaveMode.Modified);
ConfigurationManager.RefreshSection(configManager.AppSettings.SectionInformation.Name);

If you only want to upgrade one specific package called somepackage, the command you should use in recent versions of pip is

pip install --upgrade --upgrade-strategy only-if-needed somepackage

This is very useful when you develop an application in Django that currently will only work with a specific version of Django (say Django=1.9.x) and want to upgrade some dependent package with a bug-fix/new feature and the upgraded package depends on Django (but it works with, say, any version of Django after 1.5).

The default behavior of pip install --upgrade django-some-package would be to upgrade Django to the latest version available which could otherwise break your application, though with the --upgrade-strategy only-if-needed dependent packages will now only be upgraded as necessary.

int nMonths = 0;
if (FDate.ToDateTime().Year == TDate.ToDateTime().Year)
     nMonths = TDate.ToDateTime().Month - FDate.ToDateTime().Month;                         
else
nMonths = (12 - FDate.Month) + TDate.Month;                          

Try adding the other two non COUNT columns to the GROUP BY:

select CURRENT_DATE-1 AS day, 
model.name, 
attempt.type, 
CASE WHEN attempt.result = 0 THEN 0 ELSE 1 END, 
count(*) 
from attempt attempt, prod_hw_id prod_hw_id, model model
where time >= '2013-11-06 00:00:00'  
AND time < '2013-11-07 00:00:00'
AND attempt.hard_id = prod_hw_id.hard_id
AND prod_hw_id.model_id = model.model_id
group by 1,2,3,4
order by model.name, attempt.type, attempt.result;

If you want to use the iframe's scrollbar and not the parent's use this:

document.body.style.overflow = 'hidden';

If you want to use the parent's scrollbar and not the iframe's then you need to use:

document.getElementById('your_iframes_id').scrolling = 'no';

or set the scrolling="no" attribute in your iframe's tag: <iframe src="some_url" scrolling="no">.

It seems like there may be a issue to dump numpy.int64 into json string in Python 3 and the python team already have a conversation about it. More details can be found here.

There is a workaround provided by Serhiy Storchaka. It works very well so I paste it here:

def convert(o):
    if isinstance(o, numpy.int64): return int(o)  
    raise TypeError

json.dumps({'value': numpy.int64(42)}, default=convert)

Let’s say you are making an executable that uses some functions found in a library.

If the library you are using is static, the linker will copy the object code for these functions directly from the library and insert them into the executable.

Now if this executable is run it has every thing it needs, so the executable loader just loads it into memory and runs it.

If the library is dynamic the linker will not insert object code but rather it will insert a stub which basically says this function is located in this DLL at this location.

Now if this executable is run, bits of the executable are missing (i.e the stubs) so the loader goes through the executable fixing up the missing stubs. Only after all the stubs have been resolved will the executable be allowed to run.

To see this in action delete or rename the DLL and watch how the loader will report a missing DLL error when you try to run the executable.

Hence the name Dynamic Link Library, parts of the linking process is being done dynamically at run time by the executable loader.

One a final note, if you don't link to the DLL then no stubs will be inserted by the linker, but Windows still provides the GetProcAddress API that allows you to load an execute the DLL function entry point long after the executable has started.

fromEvent<KeyboardEvent>(document.querySelector('#searcha') as HTMLInputElement , 'keyup')
    .pipe(
      debounceTime(500),
      distinctUntilChanged(),
      map(e  => {
            return e.target['value']; // <-- target does not exist on {}
        })
    ).subscribe(k => console.log(k));

Maybe something like the above could help. Change it based on the real code. The issue is ........ target['value']

Another approach with lapply and a dplyr statement. We can apply an arbitrary number of whatever summary functions to the same statement:

lapply(c(first, last), 
       function(x) df %>% group_by(id) %>% summarize_all(funs(x))) %>% 
bind_rows()

You could for example be interested in rows with the max stopSequence value as well and do:

lapply(c(first, last, max("stopSequence")), 
       function(x) df %>% group_by(id) %>% summarize_all(funs(x))) %>%
bind_rows()

CSS :

ul{
list-style-type:none;
}

You can take a look at W3School

In addition to all the options listed by other answers, you can use git reset with the Git object (hash, branch, HEAD~x, tag, ...) of interest and the path of your file:

git reset <hash> /path/to/file

In your example:

git reset 27cf8e8 my_file.txt

What this does is that it will revert my_file.txt to its version at the commit 27cf8e8 in the index while leaving it untouched (so in its current version) in the working directory.

From there, things are very easy:

• you can compare the two versions of your file with git diff --cached my_file.txt
• you can get rid of the old version of the file with git restore --staged file.txt (or, prior to Git v2.23, git reset file.txt) if you decide that you don't like it
• you can restore the old version with git commit -m "Restore version of file.txt from 27cf8e8" and git restore file.txt (or, prior to Git v2.23, git checkout -- file.txt)
• you can add updates from the old to the new version only for some hunks by running git add -p file.txt (then git commit and git restore file.txt).

Lastly, you can even interactively pick and choose which hunk(s) to reset in the very first step if you run:

git reset -p 27cf8e8 my_file.txt

So git reset with a path gives you lots of flexibility to retrieve a specific version of a file to compare with its currently checked-out version and, if you choose to do so, to revert fully or only for some hunks to that version.

Edit: I just realized that I am not answering your question since what you wanted wasn't a diff or an easy way to retrieve part or all of the old version but simply to cat that version.

Of course, you can still do that after resetting the file with:

git show :file.txt

to output to standard output or

git show :file.txt > file_at_27cf8e8.txt

But if this was all you wanted, running git show directly with git show 27cf8e8:file.txt as others suggested is of course much more direct.

I am going to leave this answer though because running git show directly allows you to get that old version instantly, but if you want to do something with it, it isn't nearly as convenient to do so from there as it is if you reset that version in the index.

We had this requirement on getting the delta between two json updates for tracking database updates. Maybe someone else can find this helpful.

https://gist.github.com/jp6rt/7fcb6907e159d7851c8d59840b669e3d

const {
  isObject,
  isEqual,
  transform,
  has,
  merge,
} = require('lodash');
const assert = require('assert');

/**
 * Perform a symmetric comparison on JSON object.
 * @param {*} baseObj - The base object to be used for comparison against the withObj.
 * @param {*} withObj - The withObject parameter is used as the comparison on the base object.
 * @param {*} invert  - Because this is a symmetric comparison. Some values in the with object
 *                      that doesn't exist on the base will be lost in translation.
 *                      You can execute again the function again with the parameters interchanged.
 *                      However you will lose the reference if the value is from the base or with
 *                      object if you intended to do an assymetric comparison.
 *                      Setting this to true will do make sure the reference is not lost.
 * @returns           - The returned object will label the result of the comparison with the
 *                      value from base and with object.
 */
const diffSym = (baseObj, withObj, invert = false) => transform(baseObj, (result, value, key) => {
  if (isEqual(value, withObj[key])
    && has(withObj, key)) {
    return;
  }

  if (isObject(value)
    && isObject(withObj[key])
    && !Array.isArray(value)) {
    result[key] = diffSym(value, withObj[key], invert);
    return;
  }

  if (!invert) {
    result[key] = {
      base: value,
      with: withObj[key],
    };
    return;
  }

  if (invert) {
    result[key] = {
      base: withObj[key],
      with: value,
    };
  }
});

/**
 * Perform a assymmetric comparison on JSON object.
 * @param {*} baseObj - The base object to be used for comparison against the withObj.
 * @param {*} withObj - The withObject parameter is used as the comparison on the base object.
 * @returns           - The returned object will label the values with
 *                      reference to the base and with object.
 */
const diffJSON = (baseObj, withObj) => {
  // Deep clone the objects so we don't update the reference objects.
  const baseObjClone = JSON.parse(JSON.stringify(baseObj));
  const withObjClone = JSON.parse(JSON.stringify(withObj));

  const beforeDelta = diffSym(baseObjClone, withObjClone);
  const afterDelta = diffSym(withObjClone, baseObjClone, true);

  return merge(afterDelta, beforeDelta);
};

// By Example:

const beforeDataObj = {
  a: 1,
  c: { d: 2, f: 3 },
  g: 4,
  h: 5,
};
const afterDataObj = {
  a: 2,
  b: 3,
  c: { d: 1, e: 1 },
  h: 5,
};

const delta = diffJSON(beforeDataObj, afterDataObj);

// Assert expected result.
assert(isEqual(delta, {
  a: { base: 1, with: 2 },
  b: { base: undefined, with: 3 },
  c: {
    d: { base: 2, with: 1 },
    e: { base: undefined, with: 1 },
    f: { base: 3, with: undefined },
  },
  g: { base: 4, with: undefined },
}));

A simple way to used copy module to transfer the file from one server to another

Here is playbook

---
- hosts: machine1 {from here file will be transferred to another remote machine}
  tasks:
  - name: transfer data from machine1 to machine2

    copy:
     src=/path/of/machine1

     dest=/path/of/machine2

    delegate_to: machine2 {file/data receiver machine}

I believe the intent was to rename System32, but so many applications hard-coded for that path, that it wasn't feasible to remove it.

SysWoW64 wasn't intended for the dlls of 64-bit systems, it's actually something like "Windows on Windows64", meaning the bits you need to run 32bit apps on a 64bit windows.

This article explains a bit:

"Windows x64 has a directory System32 that contains 64-bit DLLs (sic!). Thus native processes with a bitness of 64 find “their” DLLs where they expect them: in the System32 folder. A second directory, SysWOW64, contains the 32-bit DLLs. The file system redirector does the magic of hiding the real System32 directory for 32-bit processes and showing SysWOW64 under the name of System32."

Edit: If you're talking about an installer, you really should not hard-code the path to the system folder. Instead, let Windows take care of it for you based on whether or not your installer is running on the emulation layer.

I used following:

if str and not str.isspace():
  print('not null and not empty nor whitespace')
else:
  print('null or empty or whitespace')

1. Edit your virtual device using AVD.
2. Press the "show advance setting" button to show more option scroll down to the bottom and check "Enable keyboard input" press "finish" button
   at the bottom corner of your window
3. then start the emulator device that you just set up.
4. inside the emulator, go to the "Settings" -> "Language & Input"
5. and in the "Keyboard & Input Methods" -> "Default" then "choose input method" is shown
6. and switch off "Hardware Physical Keyboard" toggle button

Besides the most common approach with Period and Duration objects you can widen your knowledge with another way for dealing with time in Java.

Advanced Java 8 libraries. ChronoUnit for Differences.

ChronoUnit is a great way to determine how far apart two Temporal values are. Temporal includes LocalDate, LocalTime and so on.

LocalTime one = LocalTime.of(5,15);
LocalTime two = LocalTime.of(6,30);
LocalDate date = LocalDate.of(2019, 1, 29);

System.out.println(ChronoUnit.HOURS.between(one, two)); //1
System.out.println(ChronoUnit.MINUTES.between(one, two)); //75
System.out.println(ChronoUnit.MINUTES.between(one, date)); //DateTimeException

First example shows that between truncates rather than rounds.

The second shows how easy it is to count different units.

And the last example reminds us that we should not mess up with dates and times in Java :)

It sounds like you want the ifelse statement to interpret NA values as FALSE instead of NA in the comparison. I use the following functions to handle this situation so I don't have to continuously handle the NA situation:

falseifNA <- function(x){
  ifelse(is.na(x), FALSE, x)
}

ifelse2 <- function(x, a, b){
  ifelse(falseifNA(x), a, b)
}

You could also combine these functions into one to be more efficient. So to return the result you want, you could use:

test$ID <- ifelse2(is.na(test$time) | test$type == "A", NA, "1")

To expand upon Alex's answer, I have an example with variable arguments and promises. I wanted to load images via ajax and display them on the page after they all loaded.

To do that, I used the following:

let urlCreator = window.URL || window.webkitURL;

// Helper function for making ajax requests
let fetch = function(url) {
    return $.ajax({
        type: "get",
        xhrFields: {
            responseType: "blob"
        },
        url: url,
    });
};

// Map the array of urls to an array of ajax requests
let urls = ["https://placekitten.com/200/250", "https://placekitten.com/300/250"];
let files = urls.map(url => fetch(url));

// Use the spread operator to wait for all requests
$.when(...files).then(function() {
    // If we have multiple urls, then loop through
    if(urls.length > 1) {
        // Create image urls and tags for each result
        Array.from(arguments).forEach(data => {
            let imageUrl = urlCreator.createObjectURL(data[0]);
            let img = `<img src=${imageUrl}>`;
            $("#image_container").append(img);
        });
    }
    else {
        // Create image source and tag for result
        let imageUrl = urlCreator.createObjectURL(arguments[0]);
        let img = `<img src=${imageUrl}>`;
        $("#image_container").append(img);
    }
});

Updated to work for either single or multiple urls: https://jsfiddle.net/euypj5w9/

For SQL Server 2000, this should tell you only the #temp tables in your session. (Adapted from my example for more modern versions of SQL Server here.) This assumes you don't name your tables with three consecutive underscores, like CREATE TABLE #foo___bar:

SELECT 
  name = SUBSTRING(t.name, 1, CHARINDEX('___', t.name)-1),
  t.id
FROM tempdb..sysobjects AS t
WHERE t.name LIKE '#%[_][_][_]%'
AND t.id = 
  OBJECT_ID('tempdb..' + SUBSTRING(t.name, 1, CHARINDEX('___', t.name)-1));

Code for clearing up the text field when clicked

<EditText android:onClick="TextFieldClicked"/>

public void TextFieldClicked(View view){      
      if(view.getId()==R.id.editText1);
           text.setText("");    
}

Using join:

join -t $'\t' -o 1.2,1.1 file.txt file.txt

Notes:

• -t $'\t' In GNU join the more intuitive -t '\t' without the $ fails, (coreutils v8.28 and earlier?); it's probably a bug that a workaround like $ should be necessary. See: unix join separator char.

• join needs two filenames, even though there's just one file being worked on. Using the same name twice tricks join into performing the desired action.

• For systems with low resources join offers a smaller footprint than some of the tools used in other answers:

  wc -c $(realpath `which cut join sed awk perl`) | head -n -1
    43224 /usr/bin/cut
    47320 /usr/bin/join
   109840 /bin/sed
   658072 /usr/bin/gawk
  2093624 /usr/bin/perl
  

In case anyone else has come here looking for an answer to this question, there's a Windows API function called GetProcessTimes(). It doesn't look like too much work to write a little C program that would start the command, make this call, and return the process times.

404 is just the HTTP response code. On top of that, you can provide a response body and/or other headers with a more meaningful error message that developers will see.

If you have multiple tooltip configurations that you want to initialise, this works well for me.

$("body").tooltip({
    selector: '[data-toggle="tooltip"]'
});

You can then set the property on individual elements using data attributes.

For Windows, you can check the Java home location. If it contains (x86) it is 32-bit otherwise 64-bit:

public static boolean is32Bit()
{
    val javaHome = System.getProperty("java.home");
    return javaHome.contains("(x86)");
}

public static boolean is64Bit()
{
    return !is32Bit();
}

Example paths:

C:\Program Files (x86)\Java\jdk1.8.0_181\bin\java.exe # 32-bit
C:\Program Files\Java\jdk-10.0.2\bin\java.exe # 64-bit

Why care about a Windows only solution?

If you need to know which bit version you're running on, you're likely fiddling around with native code on Windows so platform-independence is out of the window anyway.

Concatenating strings in awk can be accomplished by the print command AWK manual page, and you can do complicated combination. Here I was trying to change the 16 char to A and used string concatenation:

echo    CTCTCTGAAATCACTGAGCAGGAGAAAGATT | awk -v w=15 -v BA=A '{OFS=""; print substr($0, 1, w), BA, substr($0,w+2)}'
Output: CTCTCTGAAATCACTAAGCAGGAGAAAGATT

I used the substr function to extract a portion of the input (STDIN). I passed some external parameters (here I am using hard-coded values) that are usually shell variable. In the context of shell programming, you can write -v w=$width -v BA=$my_charval. The key is the OFS which stands for Output Field Separate in awk. Print function take a list of values and write them to the STDOUT and glue them with the OFS. This is analogous to the perl join function.

It looks that in awk, string can be concatenated by printing variable next to each other:

echo xxx | awk -v a="aaa" -v b="bbb" '{ print a b $1 "string literal"}'
# will produce: aaabbbxxxstring literal

Read a file line by line and execute commands: 4 answers

This is because there is not only 1 answer...

1. shell command line expansion
2. xargs dedicated tool
3. while read with some remarks
4. while read -u using dedicated fd, for interactive processing (sample)

Regarding the OP request: running chmod on all targets listed in file, xargs is the indicated tool. But for some other applications, small amount of files, etc...

1. Read entire file as command line argument.

   If your file is not too big and all files are well named (without spaces or other special chars like quotes), you could use shell command line expansion. Simply:

   chmod 755 $(<file.txt)
   

   For small amount of files (lines), this command is the lighter one.

2. xargs is the right tool

   For bigger amount of files, or almost any number of lines in your input file...

   For many binutils tools, like chown, chmod, rm, cp -t ...

   xargs chmod 755 <file.txt
   

   If you have special chars and/or a lot of lines in file.txt.

   xargs -0 chmod 755 < <(tr \\n \\0 <file.txt)
   

   if your command need to be run exactly 1 time by entry:

   xargs -0 -n 1 chmod 755 < <(tr \\n \\0 <file.txt)
   

   This is not needed for this sample, as chmod accept multiple files as argument, but this match the title of question.

   For some special case, you could even define location of file argument in commands generateds by xargs:

   xargs -0 -I '{}' -n 1 myWrapper -arg1 -file='{}' wrapCmd < <(tr \\n \\0 <file.txt)
   

   Test with seq 1 5 as input

   Try this:

   xargs -n 1 -I{} echo Blah {} blabla {}.. < <(seq 1 5)
   Blah 1 blabla 1..
   Blah 2 blabla 2..
   Blah 3 blabla 3..
   Blah 4 blabla 4..
   Blah 5 blabla 5..
   

   Where commande is done once per line.

3. while read and variants.

   As OP suggest cat file.txt | while read in; do chmod 755 "$in"; done will work, but there is 2 issues:

   • cat | is an useless fork, and

   • | while ... ;done will become a subshell where environment will disapear after ;done.

   So this could be better written:

   while read in; do chmod 755 "$in"; done < file.txt
   

   But,

   • You may be warned about $IFS and read flags:

     help read
     

     read: read [-r] ... [-d delim] ... [name ...]
         ...
         Reads a single line from the standard input... The line is split
         into fields as with word splitting, and the first word is assigned
         to the first NAME, the second word to the second NAME, and so on...
         Only the characters found in $IFS are recognized as word delimiters.
         ...
         Options:
           ...
           -d delim   continue until the first character of DELIM is read, 
                      rather than newline
           ...
           -r do not allow backslashes to escape any characters
         ...
         Exit Status:
         The return code is zero, unless end-of-file is encountered...
     

     In some case, you may need to use

     while IFS= read -r in;do chmod 755 "$in";done <file.txt
     

     For avoiding problems with stranges filenames. And maybe if you encouter problems with UTF-8:

     while LANG=C IFS= read -r in ; do chmod 755 "$in";done <file.txt
     

   • While you use STDIN for reading file.txt, your script could not be interactive (you cannot use STDIN anymore).

4. while read -u, using dedicated fd.

   Syntax: while read ...;done <file.txt will redirect STDIN to file.txt. That mean, you won't be able to deal with process, until they finish.

   If you plan to create interactive tool, you have to avoid use of STDIN and use some alternative file descriptor.

   Constants file descriptors are: 0 for STDIN, 1 for STDOUT and 2 for STDERR. You could see them by:

   ls -l /dev/fd/
   

   or

   ls -l /proc/self/fd/
   

   From there, you have to choose unused number, between 0 and 63 (more, in fact, depending on sysctl superuser tool) as file descriptor:

   For this demo, I will use fd 7:

   exec 7<file.txt      # Without spaces between `7` and `<`!
   ls -l /dev/fd/
   

   Then you could use read -u 7 this way:

   while read -u 7 filename;do
       ans=;while [ -z "$ans" ];do
           read -p "Process file '$filename' (y/n)? " -sn1 foo
           [ "$foo" ]&& [ -z "${foo/[yn]}" ]&& ans=$foo || echo '??'
       done
       if [ "$ans" = "y" ] ;then
           echo Yes
           echo "Processing '$filename'."
       else
           echo No
       fi
   done 7<file.txt
   

   done
   

   To close fd/7:

   exec 7<&-            # This will close file descriptor 7.
   ls -l /dev/fd/
   

   Nota: I let striked version because this syntax could be usefull, when doing many I/O with parallels process:

   mkfifo sshfifo
   exec 7> >(ssh -t user@host sh >sshfifo)
   exec 6<sshfifo
   

Recommended: don't translate in the controller, translate in your view

I'd recommend to keep your controller free from translation logic and translate your strings directly inside your view like this:

<h1>{{ 'TITLE.HELLO_WORLD' | translate }}</h1>

Using the provided service

Angular Translate provides the $translate service which you can use in your Controllers.

An example usage of the $translate service can be:

.controller('TranslateMe', ['$scope', '$translate', function ($scope, $translate) {
    $translate('PAGE.TITLE')
        .then(function (translatedValue) {
            $scope.pageTitle = translatedValue;
        });
});

The translate service also has a method for directly translating strings without the need to handle a promise, using $translate.instant():

.controller('TranslateMe', ['$scope', '$translate', function ($scope, $translate) {
    $scope.pageTitle = $translate.instant('TITLE.DASHBOARD'); // Assuming TITLE.DASHBOARD is defined
});

The downside with using $translate.instant() could be that the language file isn't loaded yet if you are loading it async.

Using the provided filter

This is my preferred way since I don't have to handle promises this way. The output of the filter can be directly set to a scope variable.

.controller('TranslateMe', ['$scope', '$filter', function ($scope, $filter) {
    var $translate = $filter('translate');

    $scope.pageTitle = $translate('TITLE.DASHBOARD'); // Assuming TITLE.DASHBOARD is defined
});

Using the provided directive

Since @PascalPrecht is the creator of this awesome library, I'd recommend going with his advise (see his answer below) and use the provided directive which seems to handle translations very intelligent.

The directive takes care of asynchronous execution and is also clever enough to unwatch translation ids on the scope if the translation has no dynamic values.

For reference, you can also utilize initWithDictionary to init the NSMutableDictionary with a literal one:

NSMutableDictionary buttons = [[NSMutableDictionary alloc] initWithDictionary: @{
    @"touch": @0,
    @"app": @0,
    @"back": @0,
    @"volup": @0,
    @"voldown": @0
}];

Updated Bootstrap 3.x

You can use the .input-group class like this:

<div class="input-group">
    <input type="text" class="form-control"/>
    <span class="input-group-addon">
        <i class="fa fa-search"></i>
    </span>
</div>

Working Demo in jsFiddle for 3.x

Bootstrap 2.x

You can use the .input-append class like this:

<div class="input-append">
    <input class="span2" type="text">
    <button type="submit" class="btn">
        <i class="icon-search"></i>
    </button>
</div>

Working Demo in jsFiddle for 2.x

Both will look like this:

If you'd like the icon inside the input box, like this:

Then see my answer to Add a Bootstrap Glyphicon to Input Box

Alphanumeric characters and all of

~ - _ . ! * ' ( ) ,

are valid within an URL.

All other characters must be encoded.

I had this same problem described in the following way: If I typed

$ git diff

Git simply returned to the prompt with no error.

If I typed

$ git diff <filename>

Git simply returned to the prompt with no error.

Finally, by reading around I noticed that git diff actually calls the mingw64\bin\diff.exe to do the work.

Here's the deal. I'm running Windows and had installed another Bash utility and it changed my path so it no longer pointed to my mingw64\bin directory.

So if you type:

git diff

and it just returns to the prompt you may have this problem.

The actual diff.exe which is run by git is located in your mingw64\bin directory

Finally, to fix this, I actually copied my mingw64\bin directory to the location Git was looking for it in. I tried it and it still didn't work.

Then, I closed my Git Bash window and opened it again went to my same repository that was failing and now it works.

Yes, there are a few of them.

• ReDoc [Article on swagger.io] [GitHub] [demo] - Reinvented OpenAPI/Swagger-generated API Reference Documentation (I'm the author)

• OpenAPI GUI [GitHub] [demo] - GUI / visual editor for creating and editing OpenApi / Swagger definitions (has OpenAPI 3 support)

• Responsive Fork of SwaggerUI [GitHub] [demo]

• SwaggerUI-Angular [GitHub] [demo] - An angularJS implementation of Swagger UI

• angular-swagger-ui-material [GitHub] [demo] - Material Design template for angular-swager-ui

Hosted solutions that support swagger:

• Apiary - can import from swagger
• Readme.io - can import from swagger
• Lucybot console - supports swagger natively
• Postman - can import from swagger
• Stoplight - supports swagger natively - editing and reading

Check the following articles for more details:

• Ultimate Guide to 30+ API Documentation Solutions
• Turning Contracts into Beautiful Documentation (focused mainly on Swagger)
• An evaluation of auto-generated REST API Documentation UIs (focused mainly on Swagger)
• Free and Open Source API Documentation Tools

You do not need jQuery to do this...

function sortUnorderedList(ul, sortDescending) {
  if(typeof ul == "string")
    ul = document.getElementById(ul);

  // Idiot-proof, remove if you want
  if(!ul) {
    alert("The UL object is null!");
    return;
  }

  // Get the list items and setup an array for sorting
  var lis = ul.getElementsByTagName("LI");
  var vals = [];

  // Populate the array
  for(var i = 0, l = lis.length; i < l; i++)
    vals.push(lis[i].innerHTML);

  // Sort it
  vals.sort();

  // Sometimes you gotta DESC
  if(sortDescending)
    vals.reverse();

  // Change the list on the page
  for(var i = 0, l = lis.length; i < l; i++)
    lis[i].innerHTML = vals[i];
}

Easy to use...

sortUnorderedList("ID_OF_LIST");

Live Demo →

See http://msdn.microsoft.com/en-us/library/aa365247(VS.85).aspx

This explains that Unicode versions of Windows APIs have higher limits, and how to enable that.

Need to make sure once switched into a frame, need to switch back to default content for accessing webelements in another frames. As Webdriver tend to find the new frame inside the current frame.

driver.switchTo().defaultContent()

There is no need to do the reader loop yourself. The JsonTokener has this built in. E.g.

ttpResponse response; // some response object
BufferedReader reader = new BufferedReader(new    
JSONTokener tokener = new JSONTokener(reader);
JSONArray finalResult = new JSONArray(tokener);

No need to use jquery for any major browser to swap elements at the moment. Native dom method, insertAdjacentElement does the trick no matter how they are located:

var el1 = $("el1");
var el2 = $("el2");
el1[0].insertAdjacentElement("afterend", el2[0]);

Well, it generally depends on the shell. For bash, it marks the variable as "exportable" meaning that it will show up in the environment for any child processes you run.

Non-exported variables are only visible from the current process (the shell).

From the bash man page:

export [-fn] [name[=word]] ...
export -p

The supplied names are marked for automatic export to the environment of subsequently executed commands.

If the -f option is given, the names refer to functions. If no names are given, or if the -p option is supplied, a list of all names that are exported in this shell is printed.

The -n option causes the export property to be removed from each name.

If a variable name is followed by =word, the value of the variable is set to word.

export returns an exit status of 0 unless an invalid option is encountered, one of the names is not a valid shell variable name, or -f is supplied with a name that is not a function.

You can also set variables as exportable with the typeset command and automatically mark all future variable creations or modifications as such, with set -a.

Another way of running integration tests with Maven is to make use of the profile feature:

...
<build>
    <plugins>
        <plugin>
            <groupId>org.apache.maven.plugins</groupId>
            <artifactId>maven-surefire-plugin</artifactId>
            <configuration>
                <includes>
                    <include>**/*Test.java</include>
                </includes>
                <excludes>
                    <exclude>**/*IntegrationTest.java</exclude>
                </excludes>
            </configuration>
        </plugin>
    </plugins>
</build>

<profiles>
    <profile>
        <id>integration-tests</id>
        <build>
            <plugins>
                <plugin>
                    <groupId>org.apache.maven.plugins</groupId>
                    <artifactId>maven-surefire-plugin</artifactId>
                    <configuration>
                        <includes>
                            <include>**/*IntegrationTest.java</include>
                        </includes>
                        <excludes>
                            <exclude>**/*StagingIntegrationTest.java</exclude>
                        </excludes>
                    </configuration>
                </plugin>
            </plugins>
        </build>
    </profile>
</profiles>
...

Running 'mvn clean install' will run the default build. As specified above integration tests will be ignored. Running 'mvn clean install -P integration-tests' will include the integration tests (I also ignore my staging integration tests). Furthermore, I have a CI server that runs my integration tests every night and for that I issue the command 'mvn test -P integration-tests'.

<div id="item">show taille height</div>
<script>
    alert(document.getElementById('item').offsetHeight);
</script>

Jsfiddle

if (!$_GET) echo "empty";

why do you need such a checking?

lol
you guys too direct-minded.
don't take as offense but sometimes not-minded at all
$_GET is very special variable, not like others.
it is supposed to be always set. no need to treat it as other variables. when $_GET is not set and it's expected - it is emergency case and that's what "Undefined variable" notice invented for

Like this: (Assuming a typed dataset)

someTable.Select(r => new { r.attribute1_name, r.attribute2_name }).Distinct();

You might want to put the absolutely aligned div in a relatively aligned container - this way it will still be contained into the container rather than the browser window.

<div style="position: relative;background-color: blue; width: 600px; height: 800px;">    

    <div style="position: absolute; bottom: 5px; background-color: green">
    TEST (C) 2010
    </div>
</div>

esp stands for "Extended Stack Pointer".....ebp for "Something Base Pointer"....and eip for "Something Instruction Pointer"...... The stack Pointer points to the offset address of the stack segment. The Base Pointer points to the offset address of the extra segment. The Instruction Pointer points to the offset address of the code segment. Now, about the segments...they are small 64KB divisions of the processors memory area.....This process is known as Memory Segmentation. I hope this post was helpful.

Hi this issue is because docker containers exit if there is no running application in the container.

-d 

option is just to run a container in deamon mode.

So the trick to make your container continuously running is point to a shell file in docker which will keep your application running.You can try with a start.sh file

Eg: docker run -d centos sh /yourlocation/start.sh

This start.sh should point to a never ending application.

In case if you dont want any application to be running,you can install monit which will keep your docker container running. Please let us know if these two cases worked for you to keep your container running.

All the best

You can create a dict and pass this as the data param to the dataframe constructor:

In [235]:

df = pd.DataFrame({'Gene':s.index, 'count':s.values})
df
Out[235]:
   Gene  count
0  Ezh2      2
1  Hmgb      7
2  Irf1      1

Alternatively you can create a df from the series, you need to call reset_index as the index will be used and then rename the columns:

In [237]:

df = pd.DataFrame(s).reset_index()
df.columns = ['Gene', 'count']
df
Out[237]:
   Gene  count
0  Ezh2      2
1  Hmgb      7
2  Irf1      1

As an even easier solution, you could just use:

$results = $objects.Name

Which should fill $results with an array of all the 'Name' property values of the elements in $objects.

This answer is going to briefly explain how the native files are handled on the latest launcher.

As of 4/29/2017 the Minecraft launcher for Windows extracts all native files and places them info %APPDATA%\Local\Temp{random folder}. That folder is temporary and is deleted once the javaw.exe process finishes (when Minecraft is closed). The location of that temporary folder must be provided in the launch arguments as the value of

-Djava.library.path=

Also, the latest launcher (2.0.847) does not show you the launch arguments so if you need to check them yourself you can do so under the Task Manager (simply enable the Command Line tab and expand it) or by using the WMIC utility as explained here.

Hope this helps some people who are still interested in doing this in 2017.

The simpliest way is to use something like this but note that it may not be that good.

input {
  outline: none;
}

I hope you find this useful.

From ?read.table: The number of data columns is determined by looking at the first five lines of input (or the whole file if it has less than five lines), or from the length of col.names if it is specified and is longer. This could conceivably be wrong if fill or blank.lines.skip are true, so specify col.names if necessary.

So, perhaps your data file isn't clean. Being more specific will help the data import:

d = read.table("foobar.txt", 
               sep="\t", 
               col.names=c("id", "name"), 
               fill=FALSE, 
               strip.white=TRUE)

will specify exact columns and fill=FALSE will force a two column data frame.

If you want to react on certain breakpoints (e.g. do something if width is less than 768px), you can also use BreakpointObserver:

import {BreakpointObserver, Breakpoints} from '@angular/cdk/layout';

{ ... }

const isSmallScreen = breakpointObserver.isMatched('(max-width: 599px)');

or even listen to changes to that breakpoint:

breakpointObserver.observe([
  '(max-width: 768px)'
    ]).subscribe(result => {
      if (result.matches) {
        doSomething();
      } else {
        // if necessary:
        doSomethingElse();
      }
    });

If anyone like me is searching to read only a specific line, example only line 18 here is the code:

filename = "C:\log.log"

Set fso = CreateObject("Scripting.FileSystemObject")
Set f = fso.OpenTextFile(filename)

For i = 1 to 17
    f.ReadLine
Next

strLine = f.ReadLine
Wscript.Echo strLine

f.Close

time.time() return the unix timestamp. you could use datetime library to get local time or UTC time.

import datetime

local_time = datetime.datetime.now()
print(local_time.strftime('%Y%m%d %H%M%S'))

utc_time = datetime.datetime.utcnow() 
print(utc_time.strftime('%Y%m%d %H%M%S'))

CPU Virtualization is enabled by default on all MacBooks with compatible CPUs (i7 is compatible). You can try to reset PRAM if you think it was disabled somehow, but I doubt it.

I think the issue might be in the old version of OS. If your MacBook is i7, then you better upgrade OS to something newer.

Well by doing the above you open yourself to run time errors, unless you are happy to accept that your arraylists can contains both strings and integers and elephants.

Eclipse returns an error because it does not want you to be unaware of the fact that by specifying no type for the generic parameter you are opening yourself up for run time errors. At least with the other two examples you know that you can have objects in your Arraylist and since Inetegers and Strings are both objects Eclipse doesn't warn you.

Either code 2 or 3 are ok. But if you know you will have either only ints or only strings in your arraylist then I would do

ArrayList<Integer> arr = new ArrayList<Integer>();

or

ArrayList<String> arr = new ArrayList<String>();

respectively.

A nice solution that I've found is to do on UI something like:

<div *ngIf="isDataLoaded">
 ...Your page...
</div

Only when: isDataLoaded is true the page is rendered.

Try to do all the steps specified in the link below and before that upgrade VirtualBox to 4.2 by following the instructions in VirtualBox 4.2.0 Released With Support For Drag'n'drop From Host To Linux Guests, More. Then upgrade Genymotion to the latest version.

Go to the desktop and run Genymotion. Select a virtual device with Android version 4.2 and then drag and drop the two files Genymotion-ARM-Translation_v1.1.zip first. Then Genymotion will show progress and after this it will promt a dialog. Then click OK and it will ask to reboot the device. Restart ADB. Do the same steps for the second file, gapps-jb-20130812-signed.zip and restart ADB.

I hope this will resolve the issue. Check this link - it explains it clearer.

Necromancing.
I assume when somebody lands here, he needs a foreign key to column in a table that contains non-unique keys.

The problem is, that if you have that problem, the database-schema is denormalized.

You're for example keeping rooms in a table, with a room-uid primary key, a DateFrom and a DateTo field, and another uid, here RM_ApertureID to keep track of the same room, and a soft-delete field, like RM_Status, where 99 means 'deleted', and <> 99 means 'active'.

So when you create the first room, you insert RM_UID and RM_ApertureID as the same value as RM_UID. Then, when you terminate the room to a date, and re-establish it with a new date range, RM_UID is newid(), and the RM_ApertureID from the previous entry becomes the new RM_ApertureID.

So, if that's the case, RM_ApertureID is a non-unique field, and so you can't set a foreign-key in another table.

And there is no way to set a foreign key to a non-unique column/index, e.g. in T_ZO_REM_AP_Raum_Reinigung (WHERE RM_UID is actually RM_ApertureID).
But to prohibit invalid values, you need to set a foreign key, otherwise, data-garbage is the result sooner rather than later...

Now what you can do in this case (short of rewritting the entire application) is inserting a CHECK-constraint, with a scalar function checking the presence of the key:

IF  EXISTS (SELECT * FROM sys.check_constraints WHERE object_id = OBJECT_ID(N'[dbo].[Check_RM_ApertureIDisValid_T_ZO_REM_AP_Raum_Reinigung]') AND parent_object_id = OBJECT_ID(N'[dbo].[T_ZO_REM_AP_Raum_Reinigung]'))
ALTER TABLE dbo.T_ZO_REM_AP_Raum_Reinigung DROP CONSTRAINT [Check_RM_ApertureIDisValid_T_ZO_REM_AP_Raum_Reinigung]
GO


IF  EXISTS (SELECT * FROM sys.objects WHERE object_id = OBJECT_ID(N'[dbo].[fu_Constaint_ValidRmApertureId]') AND type in (N'FN', N'IF', N'TF', N'FS', N'FT'))
DROP FUNCTION [dbo].[fu_Constaint_ValidRmApertureId]
GO




CREATE FUNCTION [dbo].[fu_Constaint_ValidRmApertureId](
     @in_RM_ApertureID uniqueidentifier 
    ,@in_DatumVon AS datetime 
    ,@in_DatumBis AS datetime 
    ,@in_Status AS integer 
) 
    RETURNS bit 
AS 
BEGIN   
    DECLARE @bNoCheckForThisCustomer AS bit 
    DECLARE @bIsInvalidValue AS bit 
    SET @bNoCheckForThisCustomer = 'false' 
    SET @bIsInvalidValue = 'false' 

    IF @in_Status = 99 
        RETURN 'false' 


    IF @in_DatumVon > @in_DatumBis 
    BEGIN 
        RETURN 'true' 
    END 


    IF @bNoCheckForThisCustomer = 'true'
        RETURN @bIsInvalidValue 


    IF NOT EXISTS
    ( 
        SELECT 
             T_Raum.RM_UID 
            ,T_Raum.RM_Status 
            ,T_Raum.RM_DatumVon 
            ,T_Raum.RM_DatumBis 
            ,T_Raum.RM_ApertureID 
        FROM T_Raum 
        WHERE (1=1) 
        AND T_Raum.RM_ApertureID = @in_RM_ApertureID 
        AND @in_DatumVon >= T_Raum.RM_DatumVon 
        AND @in_DatumBis <= T_Raum.RM_DatumBis 
        AND T_Raum.RM_Status <> 99  
    ) 
        SET @bIsInvalidValue = 'true' -- IF ! 

    RETURN @bIsInvalidValue 
END 



GO



IF  EXISTS (SELECT * FROM sys.check_constraints WHERE object_id = OBJECT_ID(N'[dbo].[Check_RM_ApertureIDisValid_T_ZO_REM_AP_Raum_Reinigung]') AND parent_object_id = OBJECT_ID(N'[dbo].[T_ZO_REM_AP_Raum_Reinigung]'))
ALTER TABLE dbo.T_ZO_REM_AP_Raum_Reinigung DROP CONSTRAINT [Check_RM_ApertureIDisValid_T_ZO_REM_AP_Raum_Reinigung]
GO


-- ALTER TABLE dbo.T_AP_Kontakte WITH CHECK ADD CONSTRAINT [Check_RM_ApertureIDisValid_T_ZO_REM_AP_Raum_Reinigung]  
ALTER TABLE dbo.T_ZO_REM_AP_Raum_Reinigung WITH NOCHECK ADD CONSTRAINT [Check_RM_ApertureIDisValid_T_ZO_REM_AP_Raum_Reinigung] 
CHECK 
( 
    NOT 
    ( 
        dbo.fu_Constaint_ValidRmApertureId(ZO_RMREM_RM_UID, ZO_RMREM_GueltigVon, ZO_RMREM_GueltigBis, ZO_RMREM_Status) = 1 
    ) 
) 
GO


IF  EXISTS (SELECT * FROM sys.check_constraints WHERE object_id = OBJECT_ID(N'[dbo].[Check_RM_ApertureIDisValid_T_ZO_REM_AP_Raum_Reinigung]') AND parent_object_id = OBJECT_ID(N'[dbo].[T_ZO_REM_AP_Raum_Reinigung]')) 
ALTER TABLE dbo.T_ZO_REM_AP_Raum_Reinigung CHECK CONSTRAINT [Check_RM_ApertureIDisValid_T_ZO_REM_AP_Raum_Reinigung] 
GO

Look at the yesno helper

Eg:

{{ myValue|yesno:"itwasTrue,itWasFalse,itWasNone" }}

You can use Database Engine Tuning Advisor.

This tool is for improving the query performances by examining the way queries are processed and recommended enhancements by specific indexes.

How to use the Database Engine Tuning Advisor?

1- Copy the select statement that you need to speed up into the new query.

2- Parse (Ctrl+F5).

3- Press The Icon of the (Database Engine Tuning Advisor).

To Trim on the right, use:

SELECT RTRIM(Names) FROM Customer

To Trim on the left, use:

SELECT LTRIM(Names) FROM Customer

To Trim on the both sides, use:

SELECT LTRIM(RTRIM(Names)) FROM Customer

What onetrickpony posted is okay, but if you want to have a more general solution, you can just use the code below.

Instead of selecting just the id of the anchor, you can make it bit more standard-like and just selecting the attribute name of the <a>-Tag. This will save you from writing an extra id tag. Just add the smoothscroll class to the navbar element.

What changed

1) $('#nav ul li a[href^="#"]') to $('#nav.smoothscroll ul li a[href^="#"]')

2) $(this.hash) to $('a[name="' + this.hash.replace('#', '') + '"]')

Final Code

/* Enable smooth scrolling on all links with anchors */
$('#nav.smoothscroll ul li a[href^="#"]').on('click', function(e) {

  // prevent default anchor click behavior
  e.preventDefault();

  // store hash
  var hash = this.hash;

  // animate
  $('html, body').animate({
    scrollTop: $('a[name="' + this.hash.replace('#', '') + '"]').offset().top
  }, 300, function(){

    // when done, add hash to url
    // (default click behaviour)
    window.location.hash = hash;

  });
});

I guess this should do it:

/**
 * 
 * @param colorStr e.g. "#FFFFFF"
 * @return 
 */
public static Color hex2Rgb(String colorStr) {
    return new Color(
            Integer.valueOf( colorStr.substring( 1, 3 ), 16 ),
            Integer.valueOf( colorStr.substring( 3, 5 ), 16 ),
            Integer.valueOf( colorStr.substring( 5, 7 ), 16 ) );
}

Checkout CefSharp .Net bindings, a project I started a while back that thankfully got picked up by the community and turned into something wonderful.

The project wraps the Chromium Embedded Framework and has been used in a number of major projects including Rdio's Windows client, Facebook Messenger for Windows and Github for Windows.

It features browser controls for WPF and Winforms and has tons of features and extension points. Being based on Chromium it's blisteringly fast too.

Grab it from NuGet: Install-Package CefSharp.Wpf or Install-Package CefSharp.WinForms

Check out examples and give your thoughts/feedback/pull-requests: https://github.com/cefsharp/CefSharp

BSD Licensed

You can just create your own .white class and add it to the glyphicon element.

.white, .white a {
  color: #fff;
}

<i class="glyphicon glyphicon-home white"></i>

I think what Evan meant was this:

SELECT SUBSTRING(@Text, CHARINDEX(@First, @Text) + LEN(@First), 
                 CHARINDEX(@Second, @Text) - CHARINDEX(@First, @Text) - LEN(@First))

Simply create it as new byte[100] it will be initialized with 0 by default

Could your issue be linked to this other SO question "checkout problem"?

i.e.: a problem related to:

• an old version of Git
• a curious checkout syntax, which should be: git checkout -b [<new_branch>] [<start_point>], with [<start_point>] referring to the name of a commit at which to start the new branch, and 'origin/remote-name' is not that.
  (whereas git branch does support a start_point being the name of a remote branch)

Note: what the checkout.sh script says is:

  if test '' != "$newbranch$force$merge"
  then
    die "git checkout: updating paths is incompatible with switching branches/forcing$hint"
  fi

It is like the syntax git checkout -b [] [remote_branch_name] was both renaming the branch and resetting the new starting point of the new branch, which is deemed incompatible.

I encountered this issue while running an app on Java 1.6 while I have all three versions of Java 6,7,8 for different apps.I accessed the Navigator View and manually removed the unwanted facet from the facet.core.xml .Clean build and wallah!

<?xml version="1.0" encoding="UTF-8"?>

<fixed facet="jst.java"/>

<fixed facet="jst.web"/>

<installed facet="jst.web" version="2.4"/>

<installed facet="jst.java" version="6.0"/>

<installed facet="jst.utility" version="1.0"/>

views.py

from django.contrib import messages 

def view_name(request):
    if request.method == 'POST':
        form = form_class(request.POST)
        if form.is_valid():
            return HttpResponseRedirect('/thanks'/)
        else:
            messages.error(request, "Error")
return render(request, 'page.html', {'form':form_class()})

If you want to show the errors of the form other than that not valid just put {{form.as_p}} like what I did below

page.html

<html>
    <head>
        <script>
            {% if messages %}
                {% for message in messages %}
                    alert('{{message}}')
                {% endfor %}
            {% endif %}
        </script>
    </head>
    <body>
        {{form.as_p}}
    </body>
</html> 

I find it useful to understand the underlying tools. These are cl.exe (compiler) and link.exe (linker). You need to tell the compiler the signatures of the functions you want to call in the dynamic library (by including the library's header) and you need to tell the linker what the library is called and how to call it (by including the "implib" or import library).

This is roughly the same process gcc uses for linking to dynamic libraries on *nix, only the library object file differs.

Knowing the underlying tools means you can more quickly find the appropriate settings in the IDE and allows you to check that the commandlines generated are correct.

Example

Say A.exe depends B.dll. You need to include B's header in A.cpp (#include "B.h") then compile and link with B.lib:

cl A.cpp /c /EHsc
link A.obj B.lib

The first line generates A.obj, the second generates A.exe. The /c flag tells cl not to link and /EHsc specifies what kind of C++ exception handling the binary should use (there's no default, so you have to specify something).

If you don't specify /c cl will call link for you. You can use the /link flag to specify additional arguments to link and do it all at once if you like:

cl A.cpp /EHsc /link B.lib

If B.lib is not on the INCLUDE path you can give a relative or absolute path to it or add its parent directory to your include path with the /I flag.

If you're calling from cygwin (as I do) replace the forward slashes with dashes.

If you write #pragma comment(lib, "B.lib") in A.cpp you're just telling the compiler to leave a comment in A.obj telling the linker to link to B.lib. It's equivalent to specifying B.lib on the link commandline.

Alternatively, you can use evals from my pander package to capture output and all warnings, errors and other messages along with the raw results:

> pander::evals("5+5")
[[1]]
$src
[1] "5 + 5"

$result
[1] 10

$output
[1] "[1] 10"

$type
[1] "numeric"

$msg
$msg$messages
NULL

$msg$warnings
NULL

$msg$errors
NULL


$stdout
NULL

attr(,"class")
[1] "evals"

try this script..

#!/bin/bash
NULL="_"
for f in `svn st|grep -v ^\?|sed s/.\ *//`; 
     do LIST="${LIST} $f $NULL on"; 
done
dialog --checklist "Select files to commit" 30 60 30 $LIST 2>/tmp/svnlist.txt
svn ci `cat /tmp/svnlist.txt|sed 's/"//g'`

Disabled means that no data from that form element will be submitted when the form is submitted. Read-only means any data from within the element will be submitted, but it cannot be changed by the user.

For example:

<input type="text" name="yourname" value="Bob" readonly="readonly" />

This will submit the value "Bob" for the element "yourname".

<input type="text" name="yourname" value="Bob" disabled="disabled" />

This will submit nothing for the element "yourname".

You can use HTML5 Fullscreen API for this (which is the most suitable way i think).

The fullscreen has to be triggered via a user event (click, keypress) otherwise it won't work.

Here is a button which makes the div fullscreen on click. And in fullscreen mode, the button click will exit fullscreen mode.

$('#toggle_fullscreen').on('click', function(){_x000D_
  // if already full screen; exit_x000D_
  // else go fullscreen_x000D_
  if (_x000D_
    document.fullscreenElement ||_x000D_
    document.webkitFullscreenElement ||_x000D_
    document.mozFullScreenElement ||_x000D_
    document.msFullscreenElement_x000D_
  ) {_x000D_
    if (document.exitFullscreen) {_x000D_
      document.exitFullscreen();_x000D_
    } else if (document.mozCancelFullScreen) {_x000D_
      document.mozCancelFullScreen();_x000D_
    } else if (document.webkitExitFullscreen) {_x000D_
      document.webkitExitFullscreen();_x000D_
    } else if (document.msExitFullscreen) {_x000D_
      document.msExitFullscreen();_x000D_
    }_x000D_
  } else {_x000D_
    element = $('#container').get(0);_x000D_
    if (element.requestFullscreen) {_x000D_
      element.requestFullscreen();_x000D_
    } else if (element.mozRequestFullScreen) {_x000D_
      element.mozRequestFullScreen();_x000D_
    } else if (element.webkitRequestFullscreen) {_x000D_
      element.webkitRequestFullscreen(Element.ALLOW_KEYBOARD_INPUT);_x000D_
    } else if (element.msRequestFullscreen) {_x000D_
      element.msRequestFullscreen();_x000D_
    }_x000D_
  }_x000D_
});

#container{_x000D_
  border:1px solid red;_x000D_
  border-radius: .5em;_x000D_
  padding:10px;_x000D_
}

<script src="https://ajax.googleapis.com/ajax/libs/jquery/2.1.1/jquery.min.js"></script>_x000D_
<div id="container">_x000D_
  <p>_x000D_
    <a href="#" id="toggle_fullscreen">Toggle Fullscreen</a>_x000D_
  </p>_x000D_
  I will be fullscreen, yay!_x000D_
</div>

Please also note that Fullscreen API for Chrome does not work in non-secure pages. See https://sites.google.com/a/chromium.org/dev/Home/chromium-security/deprecating-powerful-features-on-insecure-origins for more details.

Another thing to note is the :fullscreen CSS selector. You can append this to any css selector so the that the rules will be applied when that element is fullscreen:

#container:-webkit-full-screen,
#container:-moz-full-screen,
#container:-ms-fullscreen,
#container:fullscreen {
    width: 100vw;
    height: 100vh;
    }

If you don't actually need a backup of the database dumped onto disk in a plain-text .sql script file format, you could connect pg_dump and pg_restore directly together over a pipe.

To drop and recreate tables, you could use the --clean command-line option for pg_dump to emit SQL commands to clean (drop) database objects prior to (the commands for) creating them. (This will not drop the whole database, just each table/sequence/index/etc. before recreating them.)

The above two would look something like this:

pg_dump -U username --clean | pg_restore -U username

If you like haml, but want something even better check out http://jade-lang.com for node, I wrote haml.js as well :)

You can try this Circle Progress library

NB: please always use same width and height for progress views

DonutProgress:

 <com.github.lzyzsd.circleprogress.DonutProgress
        android:id="@+id/donut_progress"
        android:layout_marginLeft="50dp"
        android:layout_width="100dp"
        android:layout_height="100dp"
        custom:circle_progress="20"/>

CircleProgress:

  <com.github.lzyzsd.circleprogress.CircleProgress
        android:id="@+id/circle_progress"
        android:layout_marginLeft="50dp"
        android:layout_width="100dp"
        android:layout_height="100dp"
        custom:circle_progress="20"/>

ArcProgress:

<com.github.lzyzsd.circleprogress.ArcProgress
        android:id="@+id/arc_progress"
        android:background="#214193"
        android:layout_marginLeft="50dp"
        android:layout_width="100dp"
        android:layout_height="100dp"
        custom:arc_progress="55"
        custom:arc_bottom_text="MEMORY"/>

A char in C is already a number (the character's ASCII code), no conversion required.

If you want to convert a digit to the corresponding character, you can simply add '0':

c = i +'0';

The '0' is a character in the ASCll table.

In your CSS

th {
    background-color: blue;
    color: white;
} 

In BBEdit works this (ex.: changing the ID values to lowercase):

Search any value: <a id="(?P<x>.*?)"></a> Replace with the same in lowercase: <a id="\L\P<x>\E"></a>

Was: <a id="VALUE"></a> Became: <a id="value"></a>

You can set max connections using:

set global max_connections = '1 < your number > 100000';

This will set your number of mysql connection unti (Requires SUPER privileges).

FOMO:

The following example shows apply and applymap applied to a DataFrame.

map function is something you do apply on Series only. You cannot apply map on DataFrame.

The thing to remember is that apply can do anything applymap can, but apply has eXtra options.

The X factor options are: axis and result_type where result_type only works when axis=1 (for columns).

df = DataFrame(1, columns=list('abc'),
                  index=list('1234'))
print(df)

f = lambda x: np.log(x)
print(df.applymap(f)) # apply to the whole dataframe
print(np.log(df)) # applied to the whole dataframe
print(df.applymap(np.sum)) # reducing can be applied for rows only

# apply can take different options (vs. applymap cannot)
print(df.apply(f)) # same as applymap
print(df.apply(sum, axis=1))  # reducing example
print(df.apply(np.log, axis=1)) # cannot reduce
print(df.apply(lambda x: [1, 2, 3], axis=1, result_type='expand')) # expand result

As a sidenote, Series map function, should not be confused with the Python map function.

The first one is applied on Series, to map the values, and the second one to every item of an iterable.

Lastly don't confuse the dataframe apply method with groupby apply method.

You want to convert html (a byte-like object) into a string using .decode, e.g. html = response.read().decode('utf-8').

See Convert bytes to a Python String

The below css code always keep the button at the bottom of the page

position:absolute;
bottom:0;

Since you want to do it in relative positioning, you should go for margin-top:100%

position:relative;
margin-top:100%;

EDIT1: JSFiddle1

EDIT2: To place button at center of the screen,

position:relative;
left: 50%;
margin-top:50%;

JSFiddle2

Basically you have two options

scale_x_continuous(limits = c(-5000, 5000))

or

coord_cartesian(xlim = c(-5000, 5000)) 

Where the first removes all data points outside the given range and the second only adjusts the visible area. In most cases you would not see the difference, but if you fit anything to the data it would probably change the fitted values.

You can also use the shorthand function xlim (or ylim), which like the first option removes data points outside of the given range:

+ xlim(-5000, 5000)

For more information check the description of coord_cartesian.

The RStudio cheatsheet for ggplot2 makes this quite clear visually. Here is a small section of that cheatsheet:

Distributed under CC BY.

For Some reason it is not working so we can do this by another way

just remove the line and add this :-

<a onclick="window.open ('http://www.foracure.org.au', ''); return false" href="javascript:void(0);"></a>

Good luck.

To get the new id, all you have to do is flush the entity manager. See getNext() method below:

@Entity
@SequenceGenerator(name = "sequence", sequenceName = "mySequence")
public class SequenceFetcher
{
    @Id
    @GeneratedValue(strategy = GenerationType.SEQUENCE, generator = "sequence")
    private long id;

    public long getId() {
        return id;
    }

    public static long getNext(EntityManager em) {
        SequenceFetcher sf = new SequenceFetcher();
        em.persist(sf);
        em.flush();
        return sf.getId();
    }
}

I think you're confused about types here. You'll only get that result if you're multiplying a string. Start the interpreter and try this:

>>> print "1" * 9
111111111
>>> print 1 * 9
9
>>> print int("1") * 9
9

So make sure the first operand is an integer (and not a string), and it will work.

None of the above worked for me. I needed to use the Buffer object:

  const chunks = [];

  readStream.on("data", function (chunk) {
    chunks.push(chunk);
  });

  // Send the buffer or you can put it into a var
  readStream.on("end", function () {
    res.send(Buffer.concat(chunks));
  });

Per Debian policy, python refers to Python 2 and python3 refers to Python 3. Don't try to change this system-wide or you are in for the sort of trouble you already discovered.

Virtual environments allow you to run an isolated Python installation with whatever version of Python and whatever libraries you need without messing with the system Python install.

With recent Python 3, venv is part of the standard library; with older versions, you might need to install python3-venv or a similar package.

$HOME~$ python --version
Python 2.7.11

$HOME~$ python3 -m venv myenv
... stuff happens ...

$HOME~$ . ./myenv/bin/activate

(myenv) $HOME~$ type python   # "type" is preferred over which; see POSIX
python is /home/you/myenv/bin/python

(myenv) $HOME~$ python --version
Python 3.5.1

A common practice is to have a separate environment for each project you work on, anyway; but if you want this to look like it's effectively system-wide for your own login, you could add the activation stanza to your .profile or similar.

array=(z 'b c'); { set "${array[@]}"; printf '%s\n' "$@"; } \
    | sort \
    | mapfile -t array; declare -p array
declare -a array=([0]="b c" [1]="z")

• Open an inline function {...} to get a fresh set of positional arguments (e.g. $1, $2, etc).
• Copy the array to the positional arguments. (e.g. set "${array[@]}" will copy the nth array argument to the nth positional argument. Note the quotes preserve whitespace that may be contained in an array element).
• Print each positional argument (e.g. printf '%s\n' "$@" will print each positional argument on its own line. Again, note the quotes preserve whitespace that may be contained in each positional argument).
• Then sort does its thing.
• Read the stream into an array with mapfile (e.g. mapfile -t array reads each line into the variable array and the -t ignores the \n in each line).
• Dump the array to show its been sorted.

As a function:

set +m
shopt -s lastpipe

sort_array() { 
    declare -n ref=$1
    set "${ref[@]}"
    printf '%s\n' "$@"
    | sort \
    | mapfile -t $ref
}

then

array=(z y x); sort_array array; declare -p array
declare -a array=([0]="x" [1]="y" [2]="z")

I look forward to being ripped apart by all the UNIX gurus! :)

This means your array is missing the key you're looking for. I handle this with a function which either returns the value if it exists or it returns a default value instead.

def keyCheck(key, arr, default):
    if key in arr.keys():
        return arr[key]
    else:
        return default


myarray = {'key1':1, 'key2':2}

print keyCheck('key1', myarray, '#default')
print keyCheck('key2', myarray, '#default')
print keyCheck('key3', myarray, '#default')

Output:

1
2
#default

I know that is late to answer but could be useful for someone else You can use sub-query and convert the null to 0

SELECT *
FROM (SELECT CASE WHEN id_field IS NULL 
                THEN 0 
                ELSE id_field 
            END AS id_field
      FROM tbl_name) AS tbl
WHERE tbl.id_field IN ('value1', 'value2', 'value3', 0)

Use -Xms1024m -Xmx1024m to control your heap size (1024m is only for demonstration, the exact number depends your system memory). Setting minimum and maximum heap size to the same is usually a best practice since JVM doesn't have to increase heap size at runtime.

Neither main() or void main() are standard C. The former is allowed as it has an implicit int return value, making it the same as int main(). The purpose of main's return value is to return an exit status to the operating system.

In standard C, the only valid signatures for main are:

int main(void)

and

int main(int argc, char **argv)

The form you're using: int main() is an old style declaration that indicates main takes an unspecified number of arguments. Don't use it - choose one of those above.

If you HAVE to, and you don't mind a hack, you could let serialization do the work for you.

Given these classes:

public class ParentObj
{
    public string Name { get; set; }
}

public class ChildObj : ParentObj
{
    public string Value { get; set; }
}

You can create a child instance from a parent instance like so:

var parent = new ParentObj() { Name = "something" };
var serialized = JsonConvert.SerializeObject(parent);
var child = JsonConvert.DeserializeObject<ChildObj>(serialized);

This assumes your objects play nice with serialization, obv.

Be aware that this is probably going to be slower than an explicit converter.

Use ?:

<form action="?" method="post">

It will send the user back to the same page.

I navigated to C:\wamp\bin\apache\Apache2.4.4\bin run httpd and the apache (pink and white icon) loads into the system tray. The orange W also turned green.

The apacheapache service wasn't running, it wasn't on the services list (start > type services) which is why it's orange not green.

Solution: A re-install worked for me.

My version is: WAMPSERVER (64Bits & PHP 5.4) 2.4 Apache : 2.4.4 MySQL : 5.6.12 PHP : 5.4.12 PHPMyAdmin : 4.0.4 SqlBuddy : 1.3.3 XDebug : 2.2.3 http://www.wampserver.com/en/

One simple way using subplots:

import matplotlib.pyplot as plt

fig, axes = plt.subplots(3, 4, sharex=True, sharey=True)
# add a big axes, hide frame
fig.add_subplot(111, frameon=False)
# hide tick and tick label of the big axes
plt.tick_params(labelcolor='none', top=False, bottom=False, left=False, right=False)
plt.grid(False)
plt.xlabel("common X")
plt.ylabel("common Y")

Simple object hasher:

(function () {
    Number.prototype.toHex = function () {
        var ret = ((this<0?0x8:0)+((this >> 28) & 0x7)).toString(16) + (this & 0xfffffff).toString(16);
        while (ret.length < 8) ret = '0'+ret;
        return ret;
    };
    Object.hashCode = function hashCode(o, l) {
        l = l || 2;
        var i, c, r = [];
        for (i=0; i<l; i++)
            r.push(i*268803292);
        function stringify(o) {
            var i,r;
            if (o === null) return 'n';
            if (o === true) return 't';
            if (o === false) return 'f';
            if (o instanceof Date) return 'd:'+(0+o);
            i=typeof o;
            if (i === 'string') return 's:'+o.replace(/([\\\\;])/g,'\\$1');
            if (i === 'number') return 'n:'+o;
            if (o instanceof Function) return 'm:'+o.toString().replace(/([\\\\;])/g,'\\$1');
            if (o instanceof Array) {
                r=[];
                for (i=0; i<o.length; i++) 
                    r.push(stringify(o[i]));
                return 'a:'+r.join(';');
            }
            r=[];
            for (i in o) {
                r.push(i+':'+stringify(o[i]))
            }
            return 'o:'+r.join(';');
        }
        o = stringify(o);
        for (i=0; i<o.length; i++) {
            for (c=0; c<r.length; c++) {
                r[c] = (r[c] << 13)-(r[c] >> 19);
                r[c] += o.charCodeAt(i) << (r[c] % 24);
                r[c] = r[c] & r[c];
            }
        }
        for (i=0; i<r.length; i++) {
            r[i] = r[i].toHex();
        }
        return r.join('');
    }
}());

The meat here is the stringifier, which simply converts any object into a unique string. hashCode then runs over the object, hashing together the characters of the stringified object.

For extra points, export the stringifier and create a parser.

My Solution :

db.collection("name of collection").find({}, {limit: 1}).sort({$natural: -1})

Following code is a simple example that worked for me.Let me call the function main as parent function and divide as child function.
Basically i am throwing a new exception with my custom message (for the parent's call) if an exception occurs in child function by catching the Exception in the child first.

class Main {
    public static void main(String args[]) {
        try{
            long ans=divide(0);
            System.out.println("answer="+ans);
        }
        catch(Exception e){
            System.out.println("got exception:"+e.getMessage());

        }

    }
    public static long divide(int num) throws Exception{
        long x=-1;
        try {
            x=5/num;
        }
        catch (Exception e){
            throw new Exception("Error occured in divide for number:"+num+"Error:"+e.getMessage());
        }
        return x;
    }
}  

the last line return x will not run if error occurs somewhere in between.