Embedding the YouTube player in Android is very simple & it hardly takes you 10 minutes,

1) Enable YouTube API from Google API console
2) Download YouTube player Jar file
3) Start using it in Your app

Here are the detailed steps http://www.feelzdroid.com/2017/01/embed-youtube-video-player-android-app-example.html.

Just refer it & if you face any problem, let me know, ill help you

It's creating the file in the same directory as your script. Try this instead.

$content = "some text here";
$fp = fopen($_SERVER['DOCUMENT_ROOT'] . "/myText.txt","wb");
fwrite($fp,$content);
fclose($fp);

The classes of problem that are well suited for a mapreduce style solution are problems of aggregation. Of extracting data from a dataset. In C#, one could take advantage of LINQ to program in this style.

From the following article: http://codecube.net/2009/02/mapreduce-in-c-using-linq/

the GroupBy method is acting as the map, while the Select method does the job of reducing the intermediate results into the final list of results.

var wordOccurrences = words
                .GroupBy(w => w)
                .Select(intermediate => new
                {
                    Word = intermediate.Key,
                    Frequency = intermediate.Sum(w => 1)
                })
                .Where(w => w.Frequency > 10)
                .OrderBy(w => w.Frequency);

For the distributed portion, you could check out DryadLINQ: http://research.microsoft.com/en-us/projects/dryadlinq/default.aspx

Here's another variant of the script, but meant to give more readable output (you need to run this as root to get exact results):

#!/bin/bash

    # find-out-what-is-using-your-swap.sh
    # -- Get current swap usage for all running processes
    # --
    # -- rev.0.3, 2012-09-03, Jan Smid          - alignment and intendation, sorting
    # -- rev.0.2, 2012-08-09, Mikko Rantalainen - pipe the output to "sort -nk3" to get sorted output
    # -- rev.0.1, 2011-05-27, Erik Ljungstrom   - initial version


SCRIPT_NAME=`basename $0`;
SORT="kb";                 # {pid|kB|name} as first parameter, [default: kb]
[ "$1" != "" ] && { SORT="$1"; }

[ ! -x `which mktemp` ] && { echo "ERROR: mktemp is not available!"; exit; }
MKTEMP=`which mktemp`;
TMP=`${MKTEMP} -d`;
[ ! -d "${TMP}" ] && { echo "ERROR: unable to create temp dir!"; exit; }

>${TMP}/${SCRIPT_NAME}.pid;
>${TMP}/${SCRIPT_NAME}.kb;
>${TMP}/${SCRIPT_NAME}.name;

SUM=0;
OVERALL=0;
    echo "${OVERALL}" > ${TMP}/${SCRIPT_NAME}.overal;

for DIR in `find /proc/ -maxdepth 1 -type d -regex "^/proc/[0-9]+"`;
do
    PID=`echo $DIR | cut -d / -f 3`
    PROGNAME=`ps -p $PID -o comm --no-headers`

    for SWAP in `grep Swap $DIR/smaps 2>/dev/null| awk '{ print $2 }'`
    do
        let SUM=$SUM+$SWAP
    done

    if (( $SUM > 0 ));
    then
        echo -n ".";
        echo -e "${PID}\t${SUM}\t${PROGNAME}" >> ${TMP}/${SCRIPT_NAME}.pid;
        echo -e "${SUM}\t${PID}\t${PROGNAME}" >> ${TMP}/${SCRIPT_NAME}.kb;
        echo -e "${PROGNAME}\t${SUM}\t${PID}" >> ${TMP}/${SCRIPT_NAME}.name;
    fi
    let OVERALL=$OVERALL+$SUM
    SUM=0
done
echo "${OVERALL}" > ${TMP}/${SCRIPT_NAME}.overal;
echo;
echo "Overall swap used: ${OVERALL} kB";
echo "========================================";
case "${SORT}" in
    name )
        echo -e "name\tkB\tpid";
        echo "========================================";
        cat ${TMP}/${SCRIPT_NAME}.name|sort -r;
        ;;

    kb )
        echo -e "kB\tpid\tname";
        echo "========================================";
        cat ${TMP}/${SCRIPT_NAME}.kb|sort -rh;
        ;;

    pid | * )
        echo -e "pid\tkB\tname";
        echo "========================================";
        cat ${TMP}/${SCRIPT_NAME}.pid|sort -rh;
        ;;
esac
rm -fR "${TMP}/";

If pip doesn't come with your installation of python 3.6, this may work:

wget https://bootstrap.pypa.io/get-pip.py
sudo python3.6 get-pip.py

then you can python -m install

In this case you could use basename assuming you have the same suffix on the files you want to remove.

Example:

basename -s .rtf "some string.rtf"

This will return "some string"

If you don't know the suffix, and want it to remove everything after and including the last dot:

f=file.whateverthisis
basename "${f%.*}"

outputs "file"

% means chop, . is what you are chopping, * is wildcard

Just to add to RichieHindle's answer, check out Floatutorial, which walks you through how CSS floating and clearing works.

In Axis webservice and if you have to disable the certificate checking then use below code:

AxisProperties.setProperty("axis.socketSecureFactory","org.apache.axis.components.net.SunFakeTrustSocketFactory");

you can add this code :

[class*="col-"] {
    padding-top: 1rem;
    padding-bottom: 1rem;
}

Lua is lightweight scripting language which want to smaller as possible. For example, many unary operation such as pre/post increment is not available

Instead of continue, you can use goto like

arr = {1,2,3,45,6,7,8}
for key,val in ipairs(arr) do
  if val > 6 then
     goto skip_to_next
  end
     # perform some calculation
  ::skip_to_next::
end

  function CheckImageLoadingState()
  {
     var counter = 0;
     var length = 0;

     jQuery('#siteContent img').each(function() 
     {
        if(jQuery(this).attr('src').match(/(gif|png|jpg|jpeg)$/))
          length++;
     });

     jQuery('#siteContent img').each(function() 
     {  
        if(jQuery(this).attr('src').match(/(gif|png|jpg|jpeg)$/))
        {
           jQuery(this).load(function() 
           {
           }).each(function() {
              if(this.complete) jQuery(this).load();
            });
        }
        jQuery(this).load(function()
        {
           counter++;
           if(counter === length) 
           {  
              //function to call when all the images have been loaded
              DisplaySiteContent();
           }
        });
     });
  }

Use this to transform a moment object into a date object:

From http://momentjs.com/docs/#/displaying/as-javascript-date/

moment().toDate();

Yields:

Tue Nov 04 2014 14:04:01 GMT-0600 (CST)

This article Time Period Library for .NET describes the relation of two time periods by the enumeration PeriodRelation:

// ------------------------------------------------------------------------
public enum PeriodRelation
{
    After,
    StartTouching,
    StartInside,
    InsideStartTouching,
    EnclosingStartTouching,
    Enclosing,
    EnclosingEndTouching,
    ExactMatch,
    Inside,
    InsideEndTouching,
    EndInside,
    EndTouching,
    Before,
} // enum PeriodRelation

The css to modify the spinner arrows is obtuse and unreliable cross-browser.

The most stable option I have found, is to absolutely position an image with pointer-events: none; on top of the spinners.

Untested in Edge but works in all other browsers.

Try:

1. open the page that you want to debug

2. while on that page, in the address bar of a stock Android browser, type:

   about:debug 
   

   (Note nothing happens, but some new options have been enabled.)

Works on the devices I have tried. Read more on Android browser's about:debug, what do those settings do?

Edit: What also helps to retrieve more information like line number is to add this code to your script:

window.onerror = function (message, url, lineNo){
    console.log('Error: ' + message + '\n' + 'Line Number: ' + lineNo);
    return true;
}

async is used for binding to Observables and Promises, but it seems like you're binding to a regular object. You can just remove both async keywords and it should probably work.

I had the same problem and executing npm config delete prefix did not help me.

But this did:

After installing nvm using brew, create ~/.nvm directory:
$ mkdir ~/.nvm

and add following lines into ~/.bash_profile:

export NVM_DIR=~/.nvm
. $(brew --prefix nvm)/nvm.sh

(Check that you have no other nvm related command in any ~/.bashrc or ~/.profile or ~/.bash_profile)

Open a new terminal and this time it should not print any warning message.
Check that nvm is working by executing nvm --version command.
After that, install/reinstall NodeJS using nvm install node && nvm alias default node.

More Info

I installed nvm using homebrew and after that I got this notification:

Please note that upstream has asked us to make explicit managing nvm via Homebrew is unsupported by them and you should check any problems against the standard nvm install method prior to reporting.

You should create NVM's working directory if it doesn't exist:

 mkdir ~/.nvm

Add the following to ~/.bash_profile or your desired shell configuration file:

 export NVM_DIR=~/.nvm
 . $(brew --prefix nvm)/nvm.sh

You can set $NVM_DIR to any location, but leaving it unchanged from /usr/local/Cellar/nvm/0.31.0 will destroy any nvm-installed Node installations upon upgrade/reinstall.

Ignoring it brought me to this error message:

nvm is not compatible with the npm config "prefix" option: currently set to "/usr/local/Cellar/nvm/0.31.0/versions/node/v5.7.1"
Run nvm use --delete-prefix v5.7.1 --silent to unset it.

I followed an earlier guide (from homebrew/nvm) and after that I found that I needed to reinstall NodeJS. So I did:

nvm install node && nvm alias default node

and it was fixed.

Update: Using brew to install NVM causes slow startup of the Terminal. You can follow this instruction to resolve it.

You can use this and then you can add just a class form from bootstrap. ^{(does not matter which version)}

<div class="form-group">
 <label >Begin voorverkoop periode</label>
 <input type="date" name="bday" max="3000-12-31" 
        min="1000-01-01" class="form-control">
</div>
<div class="form-group">
 <label >Einde voorverkoop periode</label>
 <input type="date" name="bday" min="1000-01-01"
        max="3000-12-31" class="form-control">
</div>

Dictionary is a key value pair. Catch Key by

dic["cat"] 

and assign its value like

dic["cat"] = 5

What is the proper #include for the function 'sleep()'?

sleep() isn't Standard C, but POSIX so it should be:

#include <unistd.h>

Since the originating port 4200 is different than 8080,So before angular sends a create (PUT) request,it will send an OPTIONS request to the server to check what all methods and what all access-controls are in place. Server has to respond to that OPTIONS request with list of allowed methods and allowed origins.

Since you are using spring boot, the simple solution is to add ".allowedOrigins("http://localhost:4200");"

In your spring config,class

@Configuration
@EnableWebMvc
public class SpringConfig implements WebMvcConfigurer {

    @Override
    public void addCorsMappings(CorsRegistry registry) {
        registry.addMapping("/**").allowedOrigins("http://localhost:4200");
    }
}

However a better approach will be to write a Filter(interceptor) which adds the necessary headers to each response.

I recently needed to spawn processes for unit testing. This post was useful as I created a simple class to do that with either code as a string or code from my project. To build this class, you'll need the ICSharpCode.Decompiler and Microsoft.CodeAnalysis NuGet packages. Here's the class:

using ICSharpCode.Decompiler;
using ICSharpCode.Decompiler.CSharp;
using ICSharpCode.Decompiler.TypeSystem;
using Microsoft.CodeAnalysis;
using Microsoft.CodeAnalysis.CSharp;
using System;
using System.Collections.Generic;
using System.IO;
using System.Linq;
using System.Reflection;

public static class CSharpRunner
{
   public static object Run(string snippet, IEnumerable<Assembly> references, string typeName, string methodName, params object[] args) =>
      Invoke(Compile(Parse(snippet), references), typeName, methodName, args);

   public static object Run(MethodInfo methodInfo, params object[] args)
   {
      var refs = methodInfo.DeclaringType.Assembly.GetReferencedAssemblies().Select(n => Assembly.Load(n));
      return Invoke(Compile(Decompile(methodInfo), refs), methodInfo.DeclaringType.FullName, methodInfo.Name, args);
   }

   private static Assembly Compile(SyntaxTree syntaxTree, IEnumerable<Assembly> references = null)
   {
      if (references is null) references = new[] { typeof(object).Assembly, typeof(Enumerable).Assembly };
      var mrefs = references.Select(a => MetadataReference.CreateFromFile(a.Location));
      var compilation = CSharpCompilation.Create(Path.GetRandomFileName(), new[] { syntaxTree }, mrefs, new CSharpCompilationOptions(OutputKind.DynamicallyLinkedLibrary));

      using (var ms = new MemoryStream())
      {
         var result = compilation.Emit(ms);
         if (result.Success)
         {
            ms.Seek(0, SeekOrigin.Begin);
            return Assembly.Load(ms.ToArray());
         }
         else
         {
            throw new InvalidOperationException(string.Join("\n", result.Diagnostics.Where(diagnostic => diagnostic.IsWarningAsError || diagnostic.Severity == DiagnosticSeverity.Error).Select(d => $"{d.Id}: {d.GetMessage()}")));
         }
      }
   }

   private static SyntaxTree Decompile(MethodInfo methodInfo)
   {
      var decompiler = new CSharpDecompiler(methodInfo.DeclaringType.Assembly.Location, new DecompilerSettings());
      var typeInfo = decompiler.TypeSystem.MainModule.Compilation.FindType(methodInfo.DeclaringType).GetDefinition();
      return Parse(decompiler.DecompileTypeAsString(typeInfo.FullTypeName));
   }

   private static object Invoke(Assembly assembly, string typeName, string methodName, object[] args)
   {
      var type = assembly.GetType(typeName);
      var obj = Activator.CreateInstance(type);
      return type.InvokeMember(methodName, BindingFlags.Default | BindingFlags.InvokeMethod, null, obj, args);
   }

   private static SyntaxTree Parse(string snippet) => CSharpSyntaxTree.ParseText(snippet);
}

To use it, call the Run methods as below:

void Demo1()
{
   const string code = @"
   public class Runner
   {
      public void Run() { System.IO.File.AppendAllText(@""C:\Temp\NUnitTest.txt"", System.DateTime.Now.ToString(""o"") + ""\n""); }
   }";

   CSharpRunner.Run(code, null, "Runner", "Run");
}

void Demo2()
{
   CSharpRunner.Run(typeof(Runner).GetMethod("Run"));
}

public class Runner
{
   public void Run() { System.IO.File.AppendAllText(@"C:\Temp\NUnitTest.txt", System.DateTime.Now.ToString("o") + "\n"); }
}

In my case the issue seemed due to ajax delays but was related to internal iframes inside the main page. In seleminum it is possible to switch to internal frames with:

    driver.switchTo().frame("body");
    driver.switchTo().frame("bodytab");

I use java. After that I was able to locate the element

    driver.findElement(By.id("e_46")).click();

For Intellij IDEA Community 2019.1 you will need to follow these steps :

File -> New -> Edit File Templates.. -> Class -> /* Created by ${USER} on ${DATE} */

Think of it like an archive. MyDB.Bak contains MyDB.mdf and MyDB.ldf.

Restore with Move to say HerDB basically grabs MyDB.mdf (and ldf) from the back up, and copies them as HerDB.mdf and ldf.

So if you already had a MyDb on the server instance you are restoring to it wouldn't be touched.

You can use Attlasian Source Tree (Windows) (https://www.atlassian.com/software/sourcetree/overview). Just select files from tree and push button "Remove" at the top. Files will be deleted from local repository and local git database. Then Commit, then push.

if (element.nodeName == "A") {
 ...
} else if (element.nodeName == "TD") {
 ...
}

From the "View" menu, select "Workspaces". You'll see all of the workspaces you've created. Select the workspaces you want to delete and click "Edit" -> "Delete Workspace", or right-click and select "Delete Workspace". If the workspace is "locked" to prevent changes, you'll get an error message.

To unlock the workspace, click "Edit" (or right-click and click "Edit Workspace") to pull up the workspace editor, uncheck the "locked" checkbox, and save your changes. You can delete the workspace once it's unlocked.

In my experience, the workspace will continue to be shown in the drop-down list until you click on it, at which point p4v will figure out you've deleted it and remove it from the list.

In python 3

>>> from pathlib import Path    
>>> Path("/tmp/d/a.dat").name
'a.dat'

For me the problem was solved by changing the import sequence :

One with I got the error :

imports: [ 
 BrowserModule, HttpClientModule, AppRoutingModule, 
 CommonModule
],

Changed this to :

   imports: [
    BrowserModule, CommonModule, HttpClientModule,
    AppRoutingModule
  ],

I was getting a corrupt loose object error as well.

./objects/x/x

I successfully fixed it by going into the directory of the corrupt object. I saw that the users assigned to that object was not my git user's. I don't know how it happened, but I ran a chown git:git on that file and then it worked again.

This may be a potential fix for some peoples' issues but not necessary all of them.

Starting with MongoDB v3.4 (released in 2016), the $lookup aggregation pipeline stage can also work directly with an array. There is no need for $unwind any more.

This was tracked in SERVER-22881.

.. ELSE a.Country ...

I suppose

This annotation must be specified for persistent fields or properties of type java.util.Date and java.util.Calendar. It may only be specified for fields or properties of these types.

The Temporal annotation may be used in conjunction with the Basic annotation, the Id annotation, or the ElementCollection annotation (when the element collection value is of such a temporal type.

In plain Java APIs, the temporal precision of time is not defined. When dealing with temporal data, you might want to describe the expected precision in database. Temporal data can have DATE, TIME, or TIMESTAMP precision (i.e., the actual date, only the time, or both). Use the @Temporal annotation to fine tune that.

The temporal data is the data related to time. For example, in a content management system, the creation-date and last-updated date of an article are temporal data. In some cases, temporal data needs precision and you want to store precise date/time or both (TIMESTAMP) in database table.

The temporal precision is not specified in core Java APIs. @Temporal is a JPA annotation that converts back and forth between timestamp and java.util.Date. It also converts time-stamp into time. For example, in the snippet below, @Temporal(TemporalType.DATE) drops the time value and only preserves the date.

@Temporal(TemporalType.DATE)
private java.util.Date creationDate;

As per javadocs,

Annotation to declare an appropriate {@code TemporalType} on query method parameters. Note that this annotation can only be used on parameters of type {@link Date} with default TemporalType.DATE

[Information above collected from various sources]

Color.parseColor("#rrggbb")

instead of #rrggbb you should be using hex values 0 to F for rr, gg and bb:

e.g. Color.parseColor("#000000") or Color.parseColor("#FFFFFF")

Source

From documentation:

public static int parseColor (String colorString):

Parse the color string, and return the corresponding color-int. If the string cannot be parsed, throws an IllegalArgumentException exception. Supported formats are: #RRGGBB #AARRGGBB 'red', 'blue', 'green', 'black', 'white', 'gray', 'cyan', 'magenta', 'yellow', 'lightgray', 'darkgray', 'grey', 'lightgrey', 'darkgrey', 'aqua', 'fuschia', 'lime', 'maroon', 'navy', 'olive', 'purple', 'silver', 'teal'

So I believe that if you are using #rrggbb you are getting IllegalArgumentException in your logcat

Source

Alternative:

Color mColor = new Color();
mColor.red(redvalue);
mColor.green(greenvalue);
mColor.blue(bluevalue);
li.setBackgroundColor(mColor);

Source

Check out the manual: http://www.php.net/manual/en/datetime.format.php

<?php
$date = new DateTime('2000-01-01');
echo $date->format('Y-m-d H:i:s');
?>

Will output: 2000-01-01 00:00:00

Here's an article in devx.com that says:

Creating a non-clustered index that contains all the columns used in a SQL query, a technique called index covering

I can only suppose that a covered query is a query that has an index that covers all the columns in its returned recordset. One caveat - the index and query would have to be built as to allow the SQL server to actually infer from the query that the index is useful.

For example, a join of a table on itself might not benefit from such an index (depending on the intelligence of the SQL query execution planner):

PersonID ParentID Name
1        NULL     Abe
2        NULL     Bob
3        1        Carl
4        2        Dave

Let's assume there's an index on PersonID,ParentID,Name - this would be a covering index for a query like:

SELECT PersonID, ParentID, Name FROM MyTable

But a query like this:

SELECT PersonID, Name FROM MyTable LEFT JOIN MyTable T ON T.PersonID=MyTable.ParentID

Probably wouldn't benifit so much, even though all of the columns are in the index. Why? Because you're not really telling it that you want to use the triple index of PersonID,ParentID,Name.

Instead, you're building a condition based on two columns - PersonID and ParentID (which leaves out Name) and then you're asking for all the records, with the columns PersonID, Name. Actually, depending on implementation, the index might help the latter part. But for the first part, you're better off having other indexes.

you're using jQuery UI dialog, you could just style the modal to appear with the position fixed in the window so it doesn't pop-up out of view, negating the need to scroll. Other

Kaz Kylheku here

I benchmarked two approaches for this over 63 bit numbers (the long long type on gcc x86_64), staying away from the sign bit.

(I happen to need this "find highest bit" for something, you see.)

I implemented the data-driven binary search (closely based on one of the above answers). I also implemented a completely unrolled decision tree by hand, which is just code with immediate operands. No loops, no tables.

The decision tree (highest_bit_unrolled) benchmarked to be 69% faster, except for the n = 0 case for which the binary search has an explicit test.

The binary-search's special test for 0 case is only 48% faster than the decision tree, which does not have a special test.

Compiler, machine: (GCC 4.5.2, -O3, x86-64, 2867 Mhz Intel Core i5).

int highest_bit_unrolled(long long n)
{
  if (n & 0x7FFFFFFF00000000) {
    if (n & 0x7FFF000000000000) {
      if (n & 0x7F00000000000000) {
        if (n & 0x7000000000000000) {
          if (n & 0x4000000000000000)
            return 63;
          else
            return (n & 0x2000000000000000) ? 62 : 61;
        } else {
          if (n & 0x0C00000000000000)
            return (n & 0x0800000000000000) ? 60 : 59;
          else
            return (n & 0x0200000000000000) ? 58 : 57;
        }
      } else {
        if (n & 0x00F0000000000000) {
          if (n & 0x00C0000000000000)
            return (n & 0x0080000000000000) ? 56 : 55;
          else
            return (n & 0x0020000000000000) ? 54 : 53;
        } else {
          if (n & 0x000C000000000000)
            return (n & 0x0008000000000000) ? 52 : 51;
          else
            return (n & 0x0002000000000000) ? 50 : 49;
        }
      }
    } else {
      if (n & 0x0000FF0000000000) {
        if (n & 0x0000F00000000000) {
          if (n & 0x0000C00000000000)
            return (n & 0x0000800000000000) ? 48 : 47;
          else
            return (n & 0x0000200000000000) ? 46 : 45;
        } else {
          if (n & 0x00000C0000000000)
            return (n & 0x0000080000000000) ? 44 : 43;
          else
            return (n & 0x0000020000000000) ? 42 : 41;
        }
      } else {
        if (n & 0x000000F000000000) {
          if (n & 0x000000C000000000)
            return (n & 0x0000008000000000) ? 40 : 39;
          else
            return (n & 0x0000002000000000) ? 38 : 37;
        } else {
          if (n & 0x0000000C00000000)
            return (n & 0x0000000800000000) ? 36 : 35;
          else
            return (n & 0x0000000200000000) ? 34 : 33;
        }
      }
    }
  } else {
    if (n & 0x00000000FFFF0000) {
      if (n & 0x00000000FF000000) {
        if (n & 0x00000000F0000000) {
          if (n & 0x00000000C0000000)
            return (n & 0x0000000080000000) ? 32 : 31;
          else
            return (n & 0x0000000020000000) ? 30 : 29;
        } else {
          if (n & 0x000000000C000000)
            return (n & 0x0000000008000000) ? 28 : 27;
          else
            return (n & 0x0000000002000000) ? 26 : 25;
        }
      } else {
        if (n & 0x0000000000F00000) {
          if (n & 0x0000000000C00000)
            return (n & 0x0000000000800000) ? 24 : 23;
          else
            return (n & 0x0000000000200000) ? 22 : 21;
        } else {
          if (n & 0x00000000000C0000)
            return (n & 0x0000000000080000) ? 20 : 19;
          else
            return (n & 0x0000000000020000) ? 18 : 17;
        }
      }
    } else {
      if (n & 0x000000000000FF00) {
        if (n & 0x000000000000F000) {
          if (n & 0x000000000000C000)
            return (n & 0x0000000000008000) ? 16 : 15;
          else
            return (n & 0x0000000000002000) ? 14 : 13;
        } else {
          if (n & 0x0000000000000C00)
            return (n & 0x0000000000000800) ? 12 : 11;
          else
            return (n & 0x0000000000000200) ? 10 : 9;
        }
      } else {
        if (n & 0x00000000000000F0) {
          if (n & 0x00000000000000C0)
            return (n & 0x0000000000000080) ? 8 : 7;
          else
            return (n & 0x0000000000000020) ? 6 : 5;
        } else {
          if (n & 0x000000000000000C)
            return (n & 0x0000000000000008) ? 4 : 3;
          else
            return (n & 0x0000000000000002) ? 2 : (n ? 1 : 0);
        }
      }
    }
  }
}

int highest_bit(long long n)
{
  const long long mask[] = {
    0x000000007FFFFFFF,
    0x000000000000FFFF,
    0x00000000000000FF,
    0x000000000000000F,
    0x0000000000000003,
    0x0000000000000001
  };
  int hi = 64;
  int lo = 0;
  int i = 0;

  if (n == 0)
    return 0;

  for (i = 0; i < sizeof mask / sizeof mask[0]; i++) {
    int mi = lo + (hi - lo) / 2;

    if ((n >> mi) != 0)
      lo = mi;
    else if ((n & (mask[i] << lo)) != 0)
      hi = mi;
  }

  return lo + 1;
}

Quick and dirty test program:

#include <stdio.h>
#include <time.h>
#include <stdlib.h>

int highest_bit_unrolled(long long n);
int highest_bit(long long n);

main(int argc, char **argv)
{
  long long n = strtoull(argv[1], NULL, 0);
  int b1, b2;
  long i;
  clock_t start = clock(), mid, end;

  for (i = 0; i < 1000000000; i++)
    b1 = highest_bit_unrolled(n);

  mid = clock();

  for (i = 0; i < 1000000000; i++)
    b2 = highest_bit(n);

  end = clock();

  printf("highest bit of 0x%llx/%lld = %d, %d\n", n, n, b1, b2);

  printf("time1 = %d\n", (int) (mid - start));
  printf("time2 = %d\n", (int) (end - mid));
  return 0;
}

Using only -O2, the difference becomes greater. The decision tree is almost four times faster.

I also benchmarked against the naive bit shifting code:

int highest_bit_shift(long long n)
{
  int i = 0;
  for (; n; n >>= 1, i++)
    ; /* empty */
  return i;
}

This is only fast for small numbers, as one would expect. In determining that the highest bit is 1 for n == 1, it benchmarked more than 80% faster. However, half of randomly chosen numbers in the 63 bit space have the 63rd bit set!

On the input 0x3FFFFFFFFFFFFFFF, the decision tree version is quite a bit faster than it is on 1, and shows to be 1120% faster (12.2 times) than the bit shifter.

I will also benchmark the decision tree against the GCC builtins, and also try a mixture of inputs rather than repeating against the same number. There may be some sticking branch prediction going on and perhaps some unrealistic caching scenarios which makes it artificially faster on repetitions.

I had same issue after installing nvm-windows on top of existing Node installation. Solution was just to follow the instructions:

You should also delete the existing npm install location (e.g. "C:\Users\AppData\Roaming\npm") so that the nvm install location will be correctly used instead.

Installation & Upgrades

Just wanted to add my two cents to this. I tried doing as @Kieveli suggested for non win32 (repeated below) but it didn't work for me (on CentOS with Eclipse: Luna):

java -cp startup.jar -noSplash -data "D:\Source\MyProject\workspace" -application org.eclipse.jdt.apt.core.aptBuild

On my particular setup on CentOS using Eclipse (Luna) this worked:

$ECLIPSE_HOME/eclipse -nosplash -application org.eclipse.jdt.apt.core.aptBuild  startup.jar -data ~/workspace

The output should look something like this:

Building workspace
Building '/RemoteSystemsTempFiles'
Building '/test'
Invoking 'Java Builder' on '/test'.
Cleaning output folder for test
Build done
Building workspace
Building '/RemoteSystemsTempFiles'
Building '/test'
Invoking 'Java Builder' on '/test'.
Preparing to build test
Cleaning output folder for test
Copying resources to the output folder
Analyzing sources
Compiling test/src/com/company/test/tool
Build done

Not quite sure why it apparently did it twice, but it seems to work.

Insert an item in the beginning of an associative array with string/custom key

<?php

$array = ['keyOne'=>'valueOne', 'keyTwo'=>'valueTwo'];

$array = array_reverse($array);

$array['newKey'] = 'newValue';

$array = array_reverse($array);

RESULT

[
  'newKey' => 'newValue',
  'keyOne' => 'valueOne',
  'keyTwo' => 'valueTwo'
]

After looking in question, you should not use 404 why?

Based on RFC 7231 the correct status code is 204

In the anwsers above I noticed 1 small missunderstanding:

1.- the resource is: /users

2.- /users/8 is not the resource, this is: the resource /users with route parameter 8, consumer maybe cannot notice it and does not know the difference, but publisher does and must know this!... so he must return an accurate response for consumers. period.

so:

Based on the RFC: 404 is incorrect because the resources /users is found, but the logic executed using the parameter 8 did not found any content to return as a response, so the correct answer is: 204

The main point here is: 404 not even the resource was found to process the internal logic

204 is a: I found the resource, the logic was executed but I did not found any data using your criteria given in the route parameter so I cant return anything to you. Im sorry, verify your criteria and call me again.

200: ok i found the resource, the logic was executed (even when Im not forced to return anything) take this and use it at your will.

205: (the best option of a GET response) I found the resource, the logic was executed, I have some content for you, use it well, oh by the way if your are going to share this in a view please refresh the view to display it.

Hope it helps.

I feel like this is the simplest way. (Feel free to change the width and height values).

<a href="http://www.google.com" 
target="popup" 
onclick="window.open('http://www.google.com','popup','width=600,height=600'); return false;">
Link Text goes here...
</a>

You're declaring (some of) your event handlers incorrectly:

$('.menuOption').click(function( event ){ // <---- "event" parameter here

    event.preventDefault();
    var categories = $(this).attr('rel');
    $('.pages').hide();
    $(categories).fadeIn();


});

You need "event" to be a parameter to the handlers. WebKit follows IE's old behavior of using a global symbol for "event", but Firefox doesn't. When you're using jQuery, that library normalizes the behavior and ensures that your event handlers are passed the event parameter.

edit — to clarify: you have to provide some parameter name; using event makes it clear what you intend, but you can call it e or cupcake or anything else.

Note also that the reason you probably should use the parameter passed in from jQuery instead of the "native" one (in Chrome and IE and Safari) is that that one (the parameter) is a jQuery wrapper around the native event object. The wrapper is what normalizes the event behavior across browsers. If you use the global version, you don't get that.

I would recommend using Wireshark, which has a "Follow TCP Stream" option that makes it very easy to see the full requests and responses for a particular TCP connection. If you would prefer to use the command line, you can try tcpflow, a tool dedicated to capturing and reconstructing the contents of TCP streams.

Other options would be using an HTTP debugging proxy, like Charles or Fiddler as EricLaw suggests. These have the advantage of having specific support for HTTP to make it easier to deal with various sorts of encodings, and other features like saving requests to replay them or editing requests.

You could also use a tool like Firebug (Firefox), Web Inspector (Safari, Chrome, and other WebKit-based browsers), or Opera Dragonfly, all of which provide some ability to view the request and response headers and bodies (though most of them don't allow you to see the exact byte stream, but instead how the browsers parsed the requests).

And finally, you can always construct requests by hand, using something like telnet, netcat, or socat to connect to port 80 and type the request in manually, or a tool like htty to help easily construct a request and inspect the response.

This post was helpful to solve my problem which has a little different XML format... my XML contains a list of keys like the following example and I store the XML in the SourceKeys column in a table named DeleteBatch:

<k>1</k>
<k>2</k>
<k>3</k>

Create the table and populate it with some data:

CREATE TABLE dbo.DeleteBatch (
    ExecutionKey INT PRIMARY KEY,
    SourceKeys XML)

INSERT INTO dbo.DeleteBatch ( ExecutionKey, SourceKeys )
SELECT 1, 
    (CAST('<k>1</k><k>2</k><k>3</k>' AS XML))

INSERT INTO dbo.DeleteBatch ( ExecutionKey, SourceKeys )
SELECT 2, 
    (CAST('<k>100</k><k>101</k>' AS XML))

Here's my SQL to select the keys from the XML:

SELECT ExecutionKey, p.value('.', 'int') AS [Key]
FROM dbo.DeleteBatch
    CROSS APPLY SourceKeys.nodes('/k') t(p)

Here's the query results...

ExecutionKey    Key
1   1
1   2
1   3
2   100
2   101

I do prefer this one (from solutions above):

truncate -s 0 /var/lib/docker/containers/*/*-json.log

However I'm running several systems (Ubuntu 18.x Bionic for example), where this path does not work as expected. Docker is installed through Snap, so the path to containers is more like:

truncate -s 0 /var/snap/docker/common/var-lib-docker/containers/*/*-json.log

Try putting your text in another div inside your span:

i.e.

<span><div>some text</div></span>

Suppose there's a file test.txt in Root Folder, and want to move it to \TxtFolder,

You can try

move %~dp0\test.txt %~dp0\TxtFolder

.

reference answer: relative path in BAT script

Even though this question is very old and I stumbled upon it for my own issues with JPA 2.0 and Oracle sequences.

Want to share my research on some of the things -

Relationship between @SequenceGenerator(allocationSize) of GenerationType.SEQUENCE and INCREMENT BY in database sequence definition

Make sure @SequenceGenerator(allocationSize) is set to same value as INCREMENT BY in Database sequence definition to avoid problems (the same applies to the initial value).

For example, if we define the sequence in database with a INCREMENT BY value of 20, set the allocationsize in SequenceGenerator also to 20. In this case the JPA will not make a call to database until it reaches the next 20 mark while it increments each value by 1 internally. This saves database calls to get the next sequence number each time. The side effect of this is - Whenever the application is redeployed or the server is restarted in between, it'll call database to get the next batch and you'll see jumps in the sequence values. Also we need to make sure the database definition and the application setting to be in-sync which may not be possible all the time as both of them are managed by different groups and you can quickly lose control of. If database value is less than the allocationsize, you'll see PrimaryKey constraint errors due to duplicate values of Id. If the database value is higher than the allocationsize, you'll see jumps in the values of Id.

If the database sequence INCREMENT BY is set to 1 (which is what DBAs generally do), set the allocationSize as also 1 so that they are in-sync but the JPA calls database to get next sequence number each time.

If you don't want the call to database each time, use GenerationType.IDENTITY strategy and have the @Id value set by database trigger. With GenerationType.IDENTITY as soon as we call em.persist the object is saved to DB and a value to id is assigned to the returned object so we don't have to do a em.merge or em.flush. (This may be JPA provider specific..Not sure)

Another important thing -

JPA 2.0 automatically runs ALTER SEQUENCE command to sync the allocationSize and INCREMENT BY in database sequence. As mostly we use a different Schema name(Application user name) rather than the actual Schema where the sequence exists and the application user name will not have ALTER SEQUENCE privileges, you might see the below warning in the logs -

000004c1 Runtime W CWWJP9991W: openjpa.Runtime: Warn: Unable to cache sequence values for sequence "RECORD_ID_SEQ". Your application does not have permission to run an ALTER SEQUENCE command. Ensure that it has the appropriate permission to run an ALTER SEQUENCE command.

As the JPA could not alter the sequence, JPA calls database everytime to get next sequence number irrespective of the value of @SequenceGenerator.allocationSize. This might be a unwanted consequence which we need to be aware of.

To let JPA not to run this command, set this value - in persistence.xml. This ensures that JPA will not try to run ALTER SEQUENCE command. It writes a different warning though -

00000094 Runtime W CWWJP9991W: openjpa.Runtime: Warn: The property "openjpa.jdbc.DBDictionary=disableAlterSeqenceIncrementBy" is set to true. This means that the 'ALTER SEQUENCE...INCREMENT BY' SQL statement will not be executed for sequence "RECORD_ID_SEQ". OpenJPA executes this command to ensure that the sequence's INCREMENT BY value defined in the database matches the allocationSize which is defined in the entity's sequence. With this SQL statement disabled, it is the responsibility of the user to ensure that the entity's sequence definition matches the sequence defined in the database.

As noted in the warning, important here is we need to make sure @SequenceGenerator.allocationSize and INCREMENT BY in database sequence definition are in sync including the default value of @SequenceGenerator(allocationSize) which is 50. Otherwise it'll cause errors.

SELECT *,concat_ws(' ',first_name,last_name) AS whole_name FROM users HAVING whole_name LIKE '%$search_term%'

...is probably what you want.

Since you are using bootstrap and you want alternating row colors for every screen sizes you need to write separate style rules for all the screen sizes.

/* For small screen */
.row :nth-child(even){
  background-color: #dcdcdc;
}
.row :nth-child(odd){
  background-color: #aaaaaa;
}

/* For medium screen */    
@media (min-width: 768px) {
    .row :nth-child(4n), .row :nth-child(4n-1) {
        background: #dcdcdc;
    }
    .row :nth-child(4n-2), .row :nth-child(4n-3) {
        background: #aaaaaa;
    }
}

/* For large screen */
@media (min-width: 992px) {
    .row :nth-child(6n), .row :nth-child(6n-1), .row :nth-child(6n-2) {
        background: #dcdcdc;
    }
    .row :nth-child(6n-3), .row :nth-child(6n-4), .row :nth-child(6n-5) {
        background: #aaaaaa;
    }
}

Working FIDDLE
I have also included the bootstrap CSS here.

I tried many GUI's, and the best for me continue being "SQLyog-comunity" by using wine. Is complete, is nice, and is intuitive. (and in wine work perfect)

I wrote this little script that takes the guess work out of the copy/paste commands.

The Linux version of the script relies on xclip being already installed in your system. The script is called clipboard.

#!/bin/bash
# Linux version
# Use this script to pipe in/out of the clipboard
#
# Usage: someapp | clipboard     # Pipe someapp's output into clipboard
#        clipboard | someapp     # Pipe clipboard's content into someapp
#

if command -v xclip 1>/dev/null; then
    if [[ -p /dev/stdin ]] ; then
        # stdin is a pipe
        # stdin -> clipboard
        xclip -i -selection clipboard
    else
        # stdin is not a pipe
        # clipboard -> stdout
        xclip -o -selection clipboard
    fi
else
    echo "Remember to install xclip"
fi

The OS X version of the script relies on pbcopy and pbpaste which are preinstalled on all Macs.

#!/bin/bash
# OS X version
# Use this script to pipe in/out of the clipboard
#
# Usage: someapp | clipboard     # Pipe someapp's output into clipboard
#        clipboard | someapp     # Pipe clipboard's content into someapp
#

if [[ -p /dev/stdin ]] ; then
    # stdin is a pipe
    # stdin -> clipboard
    pbcopy
else
    # stdin is not a pipe
    # clipboard -> stdout
    pbpaste
fi

Using the script is very simple since you simply pipe in or out of clipboard as shown in these two examples.

$ cat file | clipboard

$ clipboard | less

PDFs may contain binary data and chances are it's getting mangled when you do ToString. It seems to me that you want this:

        FileInputStream inputStream = new FileInputStream(sourcePath);

        int numberBytes = inputStream .available();
        byte bytearray[] = new byte[numberBytes];

        inputStream .read(bytearray);

You want to read raw lines to avoid problems with backslashes in the input (use -r):

while read -r line; do
   printf "<%s>\n" "$line"
done < file.txt

This will keep whitespace within the line, but removes leading and trailing whitespace. To keep those as well, set the IFS empty, as in

while IFS= read -r line; do
   printf "%s\n" "$line"
done < file.txt

This now is an equivalent of cat < file.txt as long as file.txt ends with a newline.

Note that you must double quote "$line" in order to keep word splitting from splitting the line into separate words--thus losing multiple whitespace sequences.

The problem here is that the length of your array is undefined, and this confuses VBA if the array is explicitly defined as a string. Variants, however, seem to be able to resize as needed (because they hog a bunch of memory, and people generally avoid them for a bunch of reasons).

The following code works just fine, but it's a bit manual compared to some of the other languages out there:

Dim SomeArray(3) As String

SomeArray(0) = "Zero"
SomeArray(1) = "One"
SomeArray(2) = "Two"
SomeArray(3) = "Three"

The transmission delay is the amount of time required for the router to push out the packet, it has nothing to do with the distance between the two routers. The propagation delay is the time taken by a bit to to propagate form one router to the next

function stringToBool($string){
    return ( mb_strtoupper( trim( $string)) === mb_strtoupper ("true")) ? TRUE : FALSE;
}

or

function stringToBool($string) {
    return filter_var($string, FILTER_VALIDATE_BOOLEAN);
}

Have a look at this sample:

public class A {
  //statements
}

public class B extends A {
  public void foo() { }
}

A a=new B();

//To execute **foo()** method.

((B)a).foo();

I think you should be able to use the HTML escape character (&). They can be found at http://www.theukwebdesigncompany.com/articles/entity-escape-characters.php

I had the same error and I had not made any changes to the application config or the web.xml. Multiple tries to revert back some minor changes to code was not clearing the exceptions. Finally it worked after restarting STS.

You can also try this one.

override fun registerWith( registry: PluginRegistry) {
        GeneratedPluginRegistrant.registerWith(registry as FlutterEngine)       
    //registry.registrarFor("io.flutter.plugins.firebasemessaging.FirebaseMessagingPlugin")
    }

I think this one is far better solution than creating a new class.

Not an answer to the original question, however it might be useful for someone

There is no proper way to add multiple jar libraries from the folder using Maven. If there are only few dependencies, it is probably easier to configure maven-install-plugin as mentioned in the answers above.

However for my particular case, I had a lib folder with more than 100 proprietary jar files which I had to add somehow. And for me it was much easier for me to convert my Maven project to Gradle.

plugins {
    id 'org.springframework.boot' version '2.2.2.RELEASE'
    id 'io.spring.dependency-management' version '1.0.8.RELEASE'
    id 'java'
}

group = 'com.example'
version = '0.0.1-SNAPSHOT'
sourceCompatibility = '1.8'

repositories {
    mavenCentral()
    flatDir {
       dirs 'libs' // local libs folder
   }
}

dependencies {
    implementation 'org.springframework.boot:spring-boot-starter-web'
    testImplementation('org.springframework.boot:spring-boot-starter-test') {
        exclude group: 'org.junit.vintage', module: 'junit-vintage-engine'
    }
    
    implementation 'io.grpc:grpc-netty-shaded:1.29.0'
    implementation 'io.grpc:grpc-protobuf:1.29.0'
    implementation 'io.grpc:grpc-stub:1.29.0' // dependecies from maven central

    implementation name: 'akka-actor_2.12-2.6.1' // dependecies from lib folder
    implementation name: 'akka-protobuf-v3_2.12-2.6.1'
    implementation name: 'akka-stream_2.12-2.6.1'

 }

When I had similar problem gem update --system helped me. Run this before bundle install

Most guides I've seen suggest that you should use

if A:

unless you have a reason to be more specific.

There are some slight differences. There are values other than None that return False, for example empty lists, or 0, so have a think about what it is you're really testing for.

Try

onsubmit="return checkRegistration()"

For gentoo, it's in the main repository: emerge --ask scipy

Wrap the <form> element inside a div container and apply css to the div instead which makes things easier.

#aDiv{width: 300px; height: 300px; margin: 0 auto;}

<html>_x000D_
_x000D_
<head></head>_x000D_
_x000D_
<body>_x000D_
  <div>_x000D_
    <form>_x000D_
      <div id="aDiv">_x000D_
        <table>_x000D_
          <tr>_x000D_
            <td>Name :</td>_x000D_
            <td>_x000D_
              <input type="text" name="name">_x000D_
            </td>_x000D_
            <br>_x000D_
          </tr>_x000D_
          <tr>_x000D_
            <td>Email :</td>_x000D_
            <td>_x000D_
              <input type="text" name="email">_x000D_
            </td>_x000D_
            <br>_x000D_
          </tr>_x000D_
          <tr>_x000D_
            <td>Password :</td>_x000D_
            <td>_x000D_
              <input type="password" name="pwd">_x000D_
            </td>_x000D_
            <br>_x000D_
          </tr>_x000D_
          <tr>_x000D_
            <td>Confirm Password :</td>_x000D_
            <td>_x000D_
              <input type="password" name="cpwd">_x000D_
              <br>_x000D_
          </tr>_x000D_
          <tr>_x000D_
            <td>_x000D_
              <input type="submit" value="Submit">_x000D_
            </td>_x000D_
          </tr>_x000D_
        </table>_x000D_
      </div>_x000D_
    </form>_x000D_
  </div>_x000D_
</body>_x000D_
_x000D_
</html>

Use find with a wildcard:

find . -name 'mystring*'

This is almost certainly going to be true given that SSL requires an extra step of encryption that simply isn't required by non-SLL HTTP.

Swift 4+

extension UIButton {
    override open var isEnabled: Bool {
        didSet {
            DispatchQueue.main.async {
                if self.isEnabled {
                    self.alpha = 1.0
                }
                else {
                    self.alpha = 0.6
                }
            }
        }
    }
}

How to use

myButton.isEnabled = false

Try this regex:

[5-9]\d+|\d{3,}

Since there is discussion about performance I figured I'd add in a comparison that included StringBuilder. It is in fact faster than the concat and, naturally the String.format option.

To make this a sort of apples to apples comparison I instantiate a new StringBuilder in the loop rather than outside (this is actually faster than doing just one instantiation most likely due to the overhead of re-allocating space for the looping append at the end of one builder).

    String formatString = "Hi %s; Hi to you %s";

    long start = System.currentTimeMillis();
    for (int i = 0; i < 1000000; i++) {
        String s = String.format(formatString, i, +i * 2);
    }

    long end = System.currentTimeMillis();
    log.info("Format = " + ((end - start)) + " millisecond");

    start = System.currentTimeMillis();

    for (int i = 0; i < 1000000; i++) {
        String s = "Hi " + i + "; Hi to you " + i * 2;
    }

    end = System.currentTimeMillis();

    log.info("Concatenation = " + ((end - start)) + " millisecond");

    start = System.currentTimeMillis();

    for (int i = 0; i < 1000000; i++) {
        StringBuilder bldString = new StringBuilder("Hi ");
        bldString.append(i).append("; Hi to you ").append(i * 2);
    }

    end = System.currentTimeMillis();

    log.info("String Builder = " + ((end - start)) + " millisecond");

• 2012-01-11 16:30:46,058 INFO [TestMain] - Format = 1416 millisecond
• 2012-01-11 16:30:46,190 INFO [TestMain] - Concatenation = 134 millisecond
• 2012-01-11 16:30:46,313 INFO [TestMain] - String Builder = 117 millisecond

Not sure this answers the question but I believe it's worth mentioning here. There is one more way for selecting single field (and not multiple) using db.collection_name.distinct();

e.g.,db.student.distinct('roll',{});

Or, 2nd way: Using db.collection_name.find().forEach(); (multiple fields can be selected here by concatenation)

e.g., db.collection_name.find().forEach(function(c1){print(c1.roll);});

I had the same problem: MVC3 Project MyCore.Web was referencing to MyCore.DBLayer namespace from another project in the same solution (with assembly name MyCoreDBLayer). All objects from MyCore.DBLayer worked perfectly in Controllers and Models but failed in Razor views with an error 'The type or namespace name 'DBLayer' does not exist in the namespace 'MyCore' (are you missing an assembly reference?)' which was obviously not the case.

• Copy Local option was set to true.
• Adding "using..." statements in Razor views was useless
• Adding namespaces to system.web.webPages.razor section was useless as well

Adding assembly referecene to system.web/compilation/assemblies section of the root web.config file fixed the issue. The section now looks like:

<system.web>
    <compilation debug="true" targetFramework="4.0">
      <assemblies>
        <add assembly="System.Web.Abstractions, Version=4.0.0.0, Culture=neutral, PublicKeyToken=31BF3856AD364E35" />
        <add assembly="System.Web.Helpers, Version=1.0.0.0, Culture=neutral, PublicKeyToken=31BF3856AD364E35" />
        <add assembly="System.Web.Routing, Version=4.0.0.0, Culture=neutral, PublicKeyToken=31BF3856AD364E35" />
        <add assembly="System.Web.Mvc, Version=3.0.0.0, Culture=neutral, PublicKeyToken=31BF3856AD364E35" />
        <add assembly="System.Web.WebPages, Version=1.0.0.0, Culture=neutral, PublicKeyToken=31BF3856AD364E35" />
        **<add assembly="MyCoreDBLayer" />**
      </assemblies>
    </compilation>
...
</system.web>

Omitting version, culture, token was OK for now, but should be fixed in the future.

Without using a formula you can do this with 'Text to columns'.

• Select the column that has the trailing spaces in the cells.
• Click 'Text to columns' from the 'Data' tab, then choose option 'Fixed width'.
• Set a break line so the longest text will fit. If your largest cell has 100 characters you can set the breakline on 200 or whatever you want.
• Finish the operation.
• You can now delete the new column Excel has created.

The 'side-effect' is that Excel has removed all trailing spaces in the original column.

you can use ExecuteScalar() in place of ExecuteNonQuery() to get a single result use it like this

Int32 result= (Int32) command.ExecuteScalar();
Console.WriteLine(String.Format("{0}", result));

It will execute the query, and returns the first column of the first row in the result set returned by the query. Additional columns or rows are ignored.

As you want only one row in return, remove this use of SqlDataReader from your code

using (SqlDataReader reader = command.ExecuteReader())
{
    // iterate your results here
    Console.WriteLine(String.Format("{0}",reader["id"]));
}

because it will again execute your command and effect your page performance.

group - is a reserved word in MySQL, that's why you see such error.

#1064 - You have an error in your SQL syntax; check the manual that corresponds
        to your MySQL server version for the right syntax to use near 'group 
        RENAME TO member' at line 1

You need to wrap table name into backticks:

RENAME TABLE `group` TO `member`;

Defining a constructor with public or internal storage class in an inheritable concrete class Thing effectively defines two methods:

• A method (which I'll call InitializeThing) which acts upon this, has no return value, and can only be called from Thing's CreateThing and InitializeThing methods, and subclasses' InitializeXXX methods.

• A method (which I'll call CreateThing) which returns an object of the constructor's designated type, and essentially behaves as:

  Thing CreateThing(int whatever)
  {
      Thing result = AllocateObject<Thing>();
      Thing.initializeThing(whatever);
  }
  

Abstract classes effectively create methods of only the first form. Conceptually, there's no reason why the two "methods" described above should need to have the same access specifiers; in practice, however, there's no way to specify their accessibility differently. Note that in terms of actual implementation, at least in .NET, CreateThing isn't really implemented as a callable method, but instead represents a code sequence which gets inserted at a newThing = new Thing(23); statement.

You should escape the special characters using the \ character.

This is Ashok's Pen.

Becomes:

This is Ashok\'s Pen.

I've had a go at putting together a multiprocessing example of file text searching. This is my first effort at using the multiprocessing module; and I'm a python n00b. Comments quite welcome. I'll have to wait until at work to test on really big files. It should be faster on multi core systems than single core searching. Bleagh! How do I stop the processes once the text has been found and reliably report line number?

import multiprocessing, os, time
NUMBER_OF_PROCESSES = multiprocessing.cpu_count()

def FindText( host, file_name, text):
    file_size = os.stat(file_name ).st_size 
    m1 = open(file_name, "r")

    #work out file size to divide up to farm out line counting

    chunk = (file_size / NUMBER_OF_PROCESSES ) + 1
    lines = 0
    line_found_at = -1

    seekStart = chunk * (host)
    seekEnd = chunk * (host+1)
    if seekEnd > file_size:
        seekEnd = file_size

    if host > 0:
        m1.seek( seekStart )
        m1.readline()

    line = m1.readline()

    while len(line) > 0:
        lines += 1
        if text in line:
            #found the line
            line_found_at = lines
            break
        if m1.tell() > seekEnd or len(line) == 0:
            break
        line = m1.readline()
    m1.close()
    return host,lines,line_found_at

# Function run by worker processes
def worker(input, output):
    for host,file_name,text in iter(input.get, 'STOP'):
        output.put(FindText( host,file_name,text ))

def main(file_name,text):
    t_start = time.time()
    # Create queues
    task_queue = multiprocessing.Queue()
    done_queue = multiprocessing.Queue()
    #submit file to open and text to find
    print 'Starting', NUMBER_OF_PROCESSES, 'searching workers'
    for h in range( NUMBER_OF_PROCESSES ):
        t = (h,file_name,text)
        task_queue.put(t)

    #Start worker processes
    for _i in range(NUMBER_OF_PROCESSES):
        multiprocessing.Process(target=worker, args=(task_queue, done_queue)).start()

    # Get and print results

    results = {}
    for _i in range(NUMBER_OF_PROCESSES):
        host,lines,line_found = done_queue.get()
        results[host] = (lines,line_found)

    # Tell child processes to stop
    for _i in range(NUMBER_OF_PROCESSES):
        task_queue.put('STOP')
#        print "Stopping Process #%s" % i

    total_lines = 0
    for h in range(NUMBER_OF_PROCESSES):
        if results[h][1] > -1:
            print text, 'Found at', total_lines + results[h][1], 'in', time.time() - t_start, 'seconds'
            break
        total_lines += results[h][0]

if __name__ == "__main__":
    main( file_name = 'testFile.txt', text = 'IPI1520' )

os.system('command') returns a 16 bit number, which first 8 bits from left(lsb) talks about signal used by os to close the command, Next 8 bits talks about return code of command.

00000000    00000000
exit code   signal num

Example 1 - command exit with code 1

os.system('command') #it returns 256
256 in 16 bits -  00000001 00000000
Exit code is 00000001 which means 1

Example 2 - command exit with code 3

os.system('command') # it returns 768
768 in 16 bits  - 00000011 00000000
Exit code is 00000011 which means 3

Now try with signal - Example 3 - Write a program which sleep for long time use it as command in os.system() and then kill it by kill -15 or kill -9

os.system('command') #it returns signal num by which it is killed
15 in bits - 00000000 00001111
Signal num is 00001111 which means 15

You can have a python program as command = 'python command.py'

import sys
sys.exit(n)  # here n would be exit code

In case of c or c++ program you can use return from main() or exit(n) from any function #

Note - This is applicable on unix

On Unix, the return value is the exit status of the process encoded in the format specified for wait(). Note that POSIX does not specify the meaning of the return value of the C system() function, so the return value of the Python function is system-dependent.

os.wait()

Wait for completion of a child process, and return a tuple containing its pid and exit status indication: a 16-bit number, whose low byte is the signal number that killed the process, and whose high byte is the exit status (if the signal number is zero); the high bit of the low byte is set if a core file was produced.

Availability: Unix

.

1. Try parsing or executing the Tomcat_home/bin directory and look for a script named version.sh or version.bat depending on your operating system.
2. Execute the script ./version.sh or version.bat

If there are no version.bat or version.sh then use a tool to unzipping JAR files (\tomcat\server\lib\catalina.jar) and look in the file org\apache\catalina\util\lib\ServerInfo.properties. the version defined under "server.info=".

There is also the solution of using CDATA. Example:

<string name="test"><![CDATA[Hello          world]]></string>

But in general I think \u0020 is good enough.

i like the bootstrap3 style as the device width of bootstrap4
so i modify the css as below
<pre>
.visible-xs, .visible-sm, .visible-md, .visible-lg { display:none !important; }
.visible-xs-block, .visible-xs-inline, .visible-xs-inline-block,
.visible-sm-block, .visible-sm-inline, .visible-sm-inline-block,
.visible-md-block, .visible-md-inline, .visible-md-inline-block,
.visible-lg-block, .visible-lg-inline, .visible-lg-inline-block { display:none !important; }
@media (max-width:575px) {
table.visible-xs                { display:table !important; }
tr.visible-xs                   { display:table-row !important; }
th.visible-xs, td.visible-xs    { display:table-cell !important; }

.visible-xs                 { display:block !important; }
.visible-xs-block { display:block !important; }
.visible-xs-inline { display:inline !important; }
.visible-xs-inline-block { display:inline-block !important; }
}

@media (min-width:576px) and (max-width:767px) {
table.visible-sm { display:table !important; }
tr.visible-sm { display:table-row !important; }
th.visible-sm,
td.visible-sm { display:table-cell !important; }

.visible-sm { display:block !important; }
.visible-sm-block { display:block !important; }
.visible-sm-inline { display:inline !important; }
.visible-sm-inline-block { display:inline-block !important; }
}

@media (min-width:768px) and (max-width:991px) {
table.visible-md { display:table !important; }
tr.visible-md { display:table-row !important; }
th.visible-md,
td.visible-md { display:table-cell !important; }

.visible-md { display:block !important; }
.visible-md-block { display:block !important; }
.visible-md-inline { display:inline !important; }
.visible-md-inline-block { display:inline-block !important; }
}

@media (min-width:992px) and (max-width:1199px) {
table.visible-lg { display:table !important; }
tr.visible-lg { display:table-row !important; }
th.visible-lg,
td.visible-lg { display:table-cell !important; }

.visible-lg { display:block !important; }
.visible-lg-block { display:block !important; }
.visible-lg-inline { display:inline !important; }
.visible-lg-inline-block { display:inline-block !important; }
}

@media (min-width:1200px) {
table.visible-xl { display:table !important; }
tr.visible-xl { display:table-row !important; }
th.visible-xl,
td.visible-xl { display:table-cell !important; }

.visible-xl { display:block !important; }
.visible-xl-block { display:block !important; }
.visible-xl-inline { display:inline !important; }
.visible-xl-inline-block { display:inline-block !important; }
}

@media (max-width:575px)                        { .hidden-xs{display:none !important;} }
@media (min-width:576px) and (max-width:767px)  { .hidden-sm{display:none !important;} }
@media (min-width:768px) and (max-width:991px)  { .hidden-md{display:none !important;} }
@media (min-width:992px) and (max-width:1199px) { .hidden-lg{display:none !important;} }
@media (min-width:1200px)                       { .hidden-xl{display:none !important;} }
</pre>

I would suggest looking at the javadoc for Thread class.

You have multiple mechanisms for thread manipulation.

• Your main thread could join() the three threads serially, and would then not proceed until all three are done.

• Poll the thread state of the spawned threads at intervals.

• Put all of the spawned threads into a separate ThreadGroup and poll the activeCount() on the ThreadGroup and wait for it to get to 0.

• Setup a custom callback or listener type of interface for inter-thread communication.

I'm sure there are plenty of other ways I'm still missing.

I think:

np.column_stack((a, zeros(shape(a)[0])))

is more elegant.

The Scanner should be closed. It is a good practice to close Readers, Streams...and this kind of objects to free up resources and aovid memory leaks; and doing so in a finally block to make sure that they are closed up even if an exception occurs while handling those objects.

You could modify you model to look like this:

$scope.options = {
    "AL" : "Alabama",
    "AK" : "Alaska",
    "AS" : "American Samoa"
  };

Then use

<select ng-options="k as v for (k,v) in options"></select>

anyview.getRootView(); will be the easiest way.

Not sure if you want jQuery.

var form;

form.onsubmit = function (e) {
  // stop the regular form submission
  e.preventDefault();

  // collect the form data while iterating over the inputs
  var data = {};
  for (var i = 0, ii = form.length; i < ii; ++i) {
    var input = form[i];
    if (input.name) {
      data[input.name] = input.value;
    }
  }

  // construct an HTTP request
  var xhr = new XMLHttpRequest();
  xhr.open(form.method, form.action, true);
  xhr.setRequestHeader('Content-Type', 'application/json; charset=UTF-8');

  // send the collected data as JSON
  xhr.send(JSON.stringify(data));

  xhr.onloadend = function () {
    // done
  };
};

For Apache Cassandra 2.0 you need to take into account the following TCP ports: (See EC2 security group configuration and Apache Cassandra FAQ)

Cassandra

• 7199 JMX monitoring port
• 1024 - 65355 Random port required by JMX. Starting with Java 7u4 a specific port can be specified using the com.sun.management.jmxremote.rmi.port property.
• 7000 Inter-node cluster
• 7001 SSL inter-node cluster
• 9042 CQL Native Transport Port
• 9160 Thrift

DataStax OpsCenter

• 61620 opscenterd daemon
• 61621 Agent
• 8888 Website

Architecture

A possible architecture with Cassandra + OpsCenter on EC2 could look like this:

Something along the lines of (using JSTL):

<p>Selected Values:
<ul>
  <c:forEach items="${paramValues['select2']}" var="selectedValue">
    <li><c:out value="${selectedValue}" /></li>
  </c:forEach>
</ul>
</p>

I noticed it myself, and found the files inside the backup folder. You can check where it is using Menu:Settings -> Preferences -> Backup. Note : My NPP installation is portable, and on Windows, so YMMV.

It Doesn't work in Laravel 5.3+ if you want to try to access the value from the controller like below. It always returns null

<?php

    $value = env('MY_VALUE', 'default_value');

SOLUTION: Rather, you need to create a file in the configuration folder, say values.php and then write the code like below

File values.php

<?php

    return [

        'myvalue' => env('MY_VALUE',null),

        // Add other values as you wish

Then access the value in your controller with the following code

<?php

    $value = \Config::get('values.myvalue')

Where "values" is the filename followed by the key "myvalue".

@echo off

Setlocal enabledelayedexpansion

Set 1=%1

Set 1=!1:"=!

Echo !1!

Echo "!1!"

Set 1=

Demonstrates with or without quotes reguardless of whether original parameter has quotes or not.

And if you want to test the existence of a parameter which may or may not be in quotes, put this line before the echos above:

If '%1'=='' goto yoursub

But if checking for existence of a file that may or may not have quotes then it's:

If EXIST "!1!" goto othersub

Note the use of single quotes and double quotes are different.

Mac OS X

I had this problem too (encountered through Macports compilers). Previous versions of Xcode would let you install command line tools through xcode/Preferences, but xcode5 doesn't give a command line tools option in the GUI, that so I assumed it was automatically included now. Try running this command:

xcode-select --install

Ubuntu

(as per this answer)

sudo apt-get install libc6-dev

Alpine Linux

(as per this comment)

apk add libc-dev

Three years later, there is now a solution in Ruby 2.3: The squiggly heredoc.

class Subscription
  def warning_message
    <<~HEREDOC
      Subscription expiring soon!
      Your free trial will expire in #{days_until_expiration} days.
      Please update your billing information.
    HEREDOC
  end
end

Blog post link: https://infinum.co/the-capsized-eight/articles/multiline-strings-ruby-2-3-0-the-squiggly-heredoc

The indentation of the least-indented line will be removed from each line of the content.

Update your current Android Studio to Android Studio 2.0 And also update system images.

Android Studio 2.0 emulator runs ~3x faster than Android’s previous emulator, and with ADB enhancements you can now push apps and data 10x faster to the emulator than to a physical device. Like a physical device, the official Android emulator also includes Google Play Services built-in, so you can test out more API functionality. Finally, the new emulator has rich new features to manage calls, battery, network, GPS, and more.

As of version 17.0, you can format with the dt accessor:

dates.dt.strftime('%Y-%m-%d')

Reference

Under TARGETS in your project, right-click on your project target (should be the same name as your project) and choose GET INFO, then on GENERAL tab you will see DIRECT DEPENDENCIES, simply click the [+] and select SoundCloudAPI.

You can find your sample code completely here: http://www.java2s.com/Code/Java/Hibernate/OneToManyMappingbasedonSet.htm

Have a look and check the differences. specially the even_id in :

<set name="attendees" cascade="all">
    <key column="event_id"/>
    <one-to-many class="Attendee"/>
</set> 

Your error

Notice: Trying to get property of non-object in C:\wamp\www\phone\pages\init.php on line 22

Your comment

@22 is <?php echo $sidemenu->mname."<br />";?>

$sidemenu is not an object, and you are trying to access one of its properties.

That is the reason for your error.

If you are getting error like

• branch master -> FETCH_HEAD error: The following untracked working tree files would be overwritten by merge: src/dj/abc.html Please move or remove them before you merge. Aborting

Try removing the above file manually(Careful). Git will merge this file from master branch.

If you want to know what properties (and methods) there are:

Get-WmiObject -Class "Win32_computersystem" | Get-Member

Just an update on this for anyone else who stumbles across this question.

Starting in .NET 4.5 you are able to compress a directory using System.IO.Compression into a zip file. You have to add System.IO.Compression.FileSystem as a reference as it is not referenced by default. Then you can write:

System.IO.Compression.ZipFile.CreateFromDirectory(dirPath, zipFile);

The only potential problem is that this assembly is not available for Windows Store Apps.

You can use the new Bootstrap cards:

<link rel="stylesheet" href="https://maxcdn.bootstrapcdn.com/bootstrap/4.0.0-alpha.6/css/bootstrap.min.css" integrity="sha384-rwoIResjU2yc3z8GV/NPeZWAv56rSmLldC3R/AZzGRnGxQQKnKkoFVhFQhNUwEyJ" crossorigin="anonymous">_x000D_
<script src="https://code.jquery.com/jquery-3.1.1.slim.min.js" integrity="sha384-A7FZj7v+d/sdmMqp/nOQwliLvUsJfDHW+k9Omg/a/EheAdgtzNs3hpfag6Ed950n" crossorigin="anonymous"></script>_x000D_
<script src="https://cdnjs.cloudflare.com/ajax/libs/tether/1.4.0/js/tether.min.js" integrity="sha384-DztdAPBWPRXSA/3eYEEUWrWCy7G5KFbe8fFjk5JAIxUYHKkDx6Qin1DkWx51bBrb" crossorigin="anonymous"></script>_x000D_
<script src="https://maxcdn.bootstrapcdn.com/bootstrap/4.0.0-alpha.6/js/bootstrap.min.js" integrity="sha384-vBWWzlZJ8ea9aCX4pEW3rVHjgjt7zpkNpZk+02D9phzyeVkE+jo0ieGizqPLForn" crossorigin="anonymous"></script>_x000D_
_x000D_
<div class="card-group">_x000D_
  <div class="card">_x000D_
    <img class="card-img-top" src="..." alt="Card image cap">_x000D_
    <div class="card-block">_x000D_
      <h4 class="card-title">Card title</h4>_x000D_
      <p class="card-text">This is a wider card with supporting text below as a natural lead-in to additional content. This content is a little bit longer.</p>_x000D_
    </div>_x000D_
    <div class="card-footer">_x000D_
      <small class="text-muted">Last updated 3 mins ago</small>_x000D_
    </div>_x000D_
  </div>_x000D_
  <div class="card">_x000D_
    <img class="card-img-top" src="..." alt="Card image cap">_x000D_
    <div class="card-block">_x000D_
      <h4 class="card-title">Card title</h4>_x000D_
      <p class="card-text">This card has supporting text below as a natural lead-in to additional content.</p>_x000D_
    </div>_x000D_
    <div class="card-footer">_x000D_
      <small class="text-muted">Last updated 3 mins ago</small>_x000D_
    </div>_x000D_
  </div>_x000D_
  <div class="card">_x000D_
    <img class="card-img-top" src="..." alt="Card image cap">_x000D_
    <div class="card-block">_x000D_
      <h4 class="card-title">Card title</h4>_x000D_
      <p class="card-text">This is a wider card with supporting text below as a natural lead-in to additional content. This card has even longer content than the first to show that equal height action.</p>_x000D_
    </div>_x000D_
    <div class="card-footer">_x000D_
      <small class="text-muted">Last updated 3 mins ago</small>_x000D_
    </div>_x000D_
  </div>_x000D_
</div>

Link: Click here

regards,

Your code is OK. Note though that if you return a pointer to an array, and that array goes out of scope, you should not use that pointer anymore. Example:

int* test (void)
{
    int out[5];
    return out;
}

The above will never work, because out does not exist anymore when test() returns. The returned pointer must not be used anymore. If you do use it, you will be reading/writing to memory you shouldn't.

In your original code, the arr array goes out of scope when main() returns. Obviously that's no problem, since returning from main() also means that your program is terminating.

If you want something that will stick around and cannot go out of scope, you should allocate it with new:

int* test (void)
{
    int* out = new int[5];
    return out;
}

The returned pointer will always be valid. Remember do delete it again when you're done with it though, using delete[]:

int* array = test();
// ...
// Done with the array.
delete[] array;

Deleting it is the only way to reclaim the memory it uses.

As explained in this thread on the cxf-user mailing list, rather than having the CXFServlet load its own spring context from user-webservice-servlet.xml, you can just load the whole lot into the root context. Rename your existing user-webservice-servlet.xml to some other name (e.g. user-webservice-beans.xml) then change your contextConfigLocation parameter to something like:

<servlet>
  <servlet-name>myservlet</servlet-name>
  <servlet-class>org.springframework.web.servlet.DispatcherServlet</servlet-class>
  <load-on-startup>1</load-on-startup>
</servlet>

<servlet-mapping>
  <servlet-name>myservlet</servlet-name>
  <url-pattern>*.htm</url-pattern>
</servlet-mapping>

<context-param>
  <param-name>contextConfigLocation</param-name>
  <param-value>
    /WEB-INF/applicationContext.xml
    /WEB-INF/user-webservice-beans.xml
  </param-value>
</context-param>

<servlet>
  <servlet-name>user-webservice</servlet-name>
  <servlet-class>org.apache.cxf.transport.servlet.CXFServlet</servlet-class>
  <load-on-startup>2</load-on-startup>
</servlet>

<servlet-mapping>
  <servlet-name>user-webservice</servlet-name>
  <url-pattern>/UserService/*</url-pattern>
</servlet-mapping>

Simply follow the instructions given here:

Example install:

sudo apt-get install python-software-properties python g++ make
sudo add-apt-repository ppa:chris-lea/node.js
sudo apt-get update
sudo apt-get install nodejs

It installs current stable Node on the current stable Ubuntu. Quantal (12.10) users may need to install the software-properties-common package for the add-apt-repository command to work: sudo apt-get install software-properties-common

As of Node.js v0.10.0, the nodejs package from Chris Lea's repo includes both npm and nodejs-dev.

Don't give sudo apt-get install nodejs npm. Just sudo apt-get install nodejs.

I was facing the same issue in eclipse maven project, all i did was
right click on the project
maven --> update project
or just press ALT+ F5

You can set the border color in IE however there are some issues.

Argh... I could have sworn you could do this... just tested and realized I wasn't correct. The notes below still apply though.

1. in IE8 (Beta1 -> RC1) changing the border color or the background color/image causes a de-theming of the control in WindowsXP (the drop arrow and box look like Windows 95)

2. you still can't style the options within the select control very well because IE doesn't support it. (see bug #291)

One caveat! If you want to compose this via OR or AND you cannot use it in this form:

-myfield:*

but you must use

(*:* NOT myfield:*)

This form is perfectly composable. Apparently SOLR will expand the first form to the second, but only when it is a top node. Hope this saves you some time!

add in manifiest file ,

  android:theme="@android:style/Theme.Translucent.NoTitleBar"

add following line into ur java file,

  this.requestWindowFeature(Window.FEATURE_NO_TITLE);

Vectors and matrices can only be of a single type and cbind and rbind on vectors will give matrices. In these cases, the numeric values will be promoted to character values since that type will hold all the values.

(Note that in your rbind example, the promotion happens within the c call:

> c(10, "[]", "[[1,2]]")
[1] "10"      "[]"      "[[1,2]]"

If you want a rectangular structure where the columns can be different types, you want a data.frame. Any of the following should get you what you want:

> x = data.frame(v1=c(10, 20), v2=c("[]", "[]"), v3=c("[[1,2]]","[[1,3]]"))
> x
  v1 v2      v3
1 10 [] [[1,2]]
2 20 [] [[1,3]]
> str(x)
'data.frame':   2 obs. of  3 variables:
 $ v1: num  10 20
 $ v2: Factor w/ 1 level "[]": 1 1
 $ v3: Factor w/ 2 levels "[[1,2]]","[[1,3]]": 1 2

or (using specifically the data.frame version of cbind)

> x = cbind.data.frame(c(10, 20), c("[]", "[]"), c("[[1,2]]","[[1,3]]"))
> x
  c(10, 20) c("[]", "[]") c("[[1,2]]", "[[1,3]]")
1        10            []                 [[1,2]]
2        20            []                 [[1,3]]
> str(x)
'data.frame':   2 obs. of  3 variables:
 $ c(10, 20)              : num  10 20
 $ c("[]", "[]")          : Factor w/ 1 level "[]": 1 1
 $ c("[[1,2]]", "[[1,3]]"): Factor w/ 2 levels "[[1,2]]","[[1,3]]": 1 2

or (using cbind, but making the first a data.frame so that it combines as data.frames do):

> x = cbind(data.frame(c(10, 20)), c("[]", "[]"), c("[[1,2]]","[[1,3]]"))
> x
  c.10..20. c("[]", "[]") c("[[1,2]]", "[[1,3]]")
1        10            []                 [[1,2]]
2        20            []                 [[1,3]]
> str(x)
'data.frame':   2 obs. of  3 variables:
 $ c.10..20.              : num  10 20
 $ c("[]", "[]")          : Factor w/ 1 level "[]": 1 1
 $ c("[[1,2]]", "[[1,3]]"): Factor w/ 2 levels "[[1,2]]","[[1,3]]": 1 2

I got this from Secure Code Guideline for Java

The examples in this section use java.util.Date extensively as it is an example of a mutable API class. In an application, it would be preferable to use the new Java Date and Time API (java.time.*) which has been designed to be immutable.

XML:

<foo>
   <bar>
      <type foobar="1"/>
      <type foobar="2"/>
   </bar>
</foo>

Python code:

import xml.etree.cElementTree as ET

tree = ET.parse("foo.xml")
root = tree.getroot() 
root_tag = root.tag
print(root_tag) 

for form in root.findall("./bar/type"):
    x=(form.attrib)
    z=list(x)
    for i in z:
        print(x[i])

Output:

foo
1
2

See this reference for information on how to bind/unbind your solution or project from source control. NOTE: this doesn't apply if you are using GIT and may not apply to versions later than VS2008.

Quoting from the reference:

To disconnect a solution or project from source control

1. In Visual Studio, open Solution Explorer and select the item(s) to disconnect.

2. On the File menu, click Source Control, then Change Source Control.

3. In the Change Source Control dialog box, click Disconnect.

4. Click OK.

A SqlDataAdapter is typically used to fill a DataSet or DataTable and so you will have access to the data after your connection has been closed (disconnected access).

The SqlDataReader is a fast forward-only and connected cursor which tends to be generally quicker than filling a DataSet/DataTable.

Furthermore, with a SqlDataReader, you deal with your data one record at a time, and don't hold any data in memory. Obviously with a DataTable or DataSet, you do have a memory allocation overhead.

If you don't need to keep your data in memory, so for rendering stuff only, go for the SqlDataReader. If you want to deal with your data in a disconnected fashion choose the DataAdapter to fill either a DataSet or DataTable.

I had trouble with all of the other code examples above. In Chrome, this was the condition that worked for me:

typeof possiblyUndefinedVariable !== "undefined"

I will have to test that in other browsers and see how things go I suppose.

Example for postgres:

string sql = "SELECT * FROM SomeTable WHERE id = ANY(@ids)"
var results = conn.Query(sql, new { ids = new[] { 1, 2, 3, 4, 5 }});

pickling is recursive, not sequential. Thus, to pickle a list, pickle will start to pickle the containing list, then pickle the first element… diving into the first element and pickling dependencies and sub-elements until the first element is serialized. Then moves on to the next element of the list, and so on, until it finally finishes the list and finishes serializing the enclosing list. In short, it's hard to treat a recursive pickle as sequential, except for some special cases. It's better to use a smarter pattern on your dump, if you want to load in a special way.

The most common pickle, it to pickle everything with a single dump to a file -- but then you have to load everything at once with a single load. However, if you open a file handle and do multiple dump calls (e.g. one for each element of the list, or a tuple of selected elements), then your load will mirror that… you open the file handle and do multiple load calls until you have all the list elements and can reconstruct the list. It's still not easy to selectively load only certain list elements, however. To do that, you'd probably have to store your list elements as a dict (with the index of the element or chunk as the key) using a package like klepto, which can break up a pickled dict into several files transparently, and enables easy loading of specific elements.

Saving and loading multiple objects in pickle file?

I want to work with exec_query of the ActiveRecord class, because it returns the mapping of the query transforming into object, so it gets very practical and productive to iterate with the objects when the subject is Raw SQL.

Example:

values = ActiveRecord::Base.connection.exec_query("select * from clients")
p values

and return this complete query:

[{"id": 1, "name": "user 1"}, {"id": 2, "name": "user 2"}, {"id": 3, "name": "user 3"}]

To get only list of values

p values.rows

[[1, "user 1"], [2, "user 2"], [3, "user 3"]]

To get only fields columns

p values.columns

["id", "name"]

Webpack config used by create-react-app is here: https://github.com/facebook/create-react-app/tree/master/packages/react-scripts/config

I have struggled to get a query to return fields from Table 1 that do not exist in Table 2 and tried most of the answers above until I found a very simple way to obtain the results that I wanted.

I set the join properties between table 1 and table 2 to the third setting (3) (All fields from Table 1 and only those records from Table 2 where the joined fields are equal) and placed a Is Null in the criteria field of the query in Table 2 in the field that I was testing for. It works perfectly.

Thanks to all above though.

Suppose you have below String.

Our Deluxe cabins are warm, cozy & comfortable

var str = $("p").text(); // get the text from <p> tag
$('p').html(str).text();  // Now,decode html entities in your variable i.e 

str and assign back to

tag.

that's it.

To me the key thing about this is: an InterruptedException is not anything going wrong, it is the thread doing what you told it to do. Therefore rethrowing it wrapped in a RuntimeException makes zero sense.

In many cases it makes sense to rethrow an exception wrapped in a RuntimeException when you say, I don't know what went wrong here and I can't do anything to fix it, I just want it to get out of the current processing flow and hit whatever application-wide exception handler I have so it can log it. That's not the case with an InterruptedException, it's just the thread responding to having interrupt() called on it, it's throwing the InterruptedException in order to help cancel the thread's processing in a timely way.

So propagate the InterruptedException, or eat it intelligently (meaning at a place where it will have accomplished what it was meant to do) and reset the interrupt flag. Note that the interrupt flag gets cleared when the InterruptedException gets thrown; the assumption the Jdk library developers make is that catching the exception amounts to handling it, so by default the flag is cleared.

So definitely the first way is better, the second posted example in the question is not useful unless you don't expect the thread to actually get interrupted, and interrupting it amounts to an error.

Here's an answer I wrote describing how interrupts work, with an example. You can see in the example code where it is using the InterruptedException to bail out of a while loop in the Runnable's run method.

Use Location Listener Method

@Override
public void onLocationChanged(Location loc) {
Double lat = loc.getLatitude();
Double lng = loc.getLongitude();
}

Check out the answer I gave here

Fluent NHibernate one-to-one mapping with synthetic keys

Well ya you can do that in this way.

    <input type="text" name="address" id="address">
        <div id="map_canvas" style="width: 500px; height: 300px"></div>
    <input type="button" onclick="showAddress(address.value)" value="ShowMap"/>

Java Script

function showAddress(address){

    alert("This is address :"+address)

}

That is one example for the same. and that will run.

Your task declaration is incorrectly combining the Copy task type and project.copy method, resulting in a task that has nothing to copy and thus never runs. Besides, Copy isn't the right choice for renaming a directory. There is no Gradle API for renaming, but a bit of Groovy code (leveraging Java's File API) will do. Assuming Project1 is the project directory:

task renABCToXYZ {     doLast {         file("ABC").renameTo(file("XYZ"))     } } 

Looking at the bigger picture, it's probably better to add the renaming logic (i.e. the doLast task action) to the task that produces ABC.

Using flexbox:

HTML:

<div class="wrapper">
    <img src="pikachu.gif"/>
</div>

CSS:

.wrapper {
    height: 300px;
    width: 300px;
    display: flex;
    align-items: flex-end;
}

As requested in some comments on another answer, the image can also be horizontally centred with justify-content: center;

Replace

onclick="changeLink();"

by

onclick="changeLink(); return false;"

to cancel its default action

Your query should work fine, but you have to use the alias parent to show the values of the parent table like this:

select 
  CONCAT(user.user_fname, ' ', user.user_lname) AS 'User Name',
  CONCAT(parent.user_fname, ' ', parent.user_lname) AS 'Parent Name'
from users as user
inner join users as parent on parent.user_parent_id = user.user_id
where user.user_id = $_GET[id];

Copy-paste the following into your current terminal:

gsettings set org.gnome.desktop.default-applications.terminal exec /usr/bin/terminator
gsettings set org.gnome.desktop.default-applications.terminal exec-arg "-x"

This modifies the dconf to make terminator the default program. You could also use dconf-editor (a GUI-based tool) to make changes to the dconf, as another answer has suggested. If you would like to learn and understand more about this topic, this may help you.

A library implements functionality for a narrowly-scoped purpose whereas a framework tends to be a collection of libraries providing support for a wider range of features. For example, the library System.Drawing.dll handles drawing functionality, but is only one part of the overall .NET framework.

Old Thread, But in VS 2015 Console.WriteLine does not Write to Output Window If "Enable the Visual Studio Hosting Process" does not Checked or its Disabled in Project Properties -> Debug tab

You need to use the Thread.sleep() method.

This is used to pause the execution of current thread for specified time in milliseconds. The argument value for milliseconds can’t be negative, else it throws IllegalArgumentException.

FYI (Summary taken from here)

Java Thread Sleep important points

• It always pause the current thread execution.
• Thread sleep doesn’t lose any monitors or locks current thread has acquired.
• Any other thread can interrupt the current thread in sleep, in that case InterruptedException is thrown.

Go to the start menu. Open up cmd (command prompt) and type in the following.

wmic process list brief | find /i "tomcat"

This would tell you if the tomcat is running or not.

<?php
function generateRandomString($length = 11) {
    $characters = '0123456789abcdefghijklmnopqrstuvwxyzABCDEFGHIJKLMNOPQRSTUVWXYZ';
    $charactersLength = strlen($characters);
    $randomString = '';
    for ($i = 0; $i < $length; $i++) {
        $randomString .= $characters[rand(0, $charactersLength - 1)];
    }
    return $randomString;

}

?>

above function will generate you a random string which is length of 11 characters.

Creates n dimensional matrix array for Java Script, filling with initial default of value 0.

function arr (arg, def = 0){
      if (arg.length > 2){
        return Array(arg[0]).fill().map(()=>arr(arg.slice(1)));
      } else {
        return Array(arg[0]).fill().map(()=>Array(arg[1]).fill(def));
      }
    }

// Simple Usage of 4 dimensions
var s = arr([3,8,4,6])

// Use null default value with 2 dimensions
var k = arr([5,6] , null)

@Egidius, when creating an XMLHttpRequest, you should use

var xhr = new XMLHttpRequest({mozSystem: true});

What is mozSystem?

mozSystem Boolean: Setting this flag to true allows making cross-site connections without requiring the server to opt-in using CORS. Requires setting mozAnon: true, i.e. this can't be combined with sending cookies or other user credentials. This only works in privileged (reviewed) apps; it does not work on arbitrary webpages loaded in Firefox.

Changes to your Manifest

On your manifest, do not forget to include this line on your permissions:

"permissions": {
       "systemXHR" : {},
}

Use this:

public class TestNG
{
        @BeforeTest
        public void setUp() 
        {
                   /*--Initialize broowsers--*/

        }

        @Test(priority=0)
        public void Login() 
        {

        }

        @Test(priority=2)
        public void Logout() 
        {

        }

        @AfterTest
        public void tearDown() 
        {
                //--Close driver--//

        }

}

Usually TestNG provides number of annotations, We can use @BeforeSuite, @BeforeTest, @BeforeClass for initializing browsers/setup.

We can assign priority if you have written number of test cases in your script and want to execute as per assigned priority then use: @Test(priority=0) starting from 0,1,2,3....

Meanwhile we can group number of test cases and execute it by grouping. for that we will use @Test(Groups='Regression')

At the end like closing the browsers we can use @AfterTest, @AfterSuite, @AfterClass annotations.

use the following rule for validating radio button group selection

myRadioGroupName : {required :true}

myRadioGroupName is the value you have given to name attribute

If the modulus is a power of 2 then you can use a bitmask:

int i = -1 & ~-2; // -1 MOD 2 is 1

By comparison the Pascal language provides two operators; REM takes the sign of the numerator (x REM y is x - (x DIV y) * y where x DIV y is TRUNC(x / y)) and MOD requires a positive denominator and returns a positive result.

you need to mark your directory as source root (right click on the parent directory)

and then compile the plugin (it is important )

as result you will be able to add classes and more

Set

dgv.CurrentCell = null;

when user clicks on a blank part of the dgv.

That only means that an undefined column or parameter name was detected. The errror that DB2 gives should point what that may be:

DB2 SQL Error: SQLCODE=-206, SQLSTATE=42703, SQLERRMC=[THE_UNDEFINED_COLUMN_OR_PARAMETER_NAME], DRIVER=4.8.87

Double check your table definition. Maybe you just missed adding something.

I also tried google-ing this problem and saw this:

http://www.coderanch.com/t/515475/JDBC/databases/sql-insert-statement-giving-sqlcode

If you want to check all of your input matches,

>>> all(x in ['b', 'a', 'foo', 'bar'] for x in ['a', 'b'])

if you want to check at least one match,

>>> any(x in ['b', 'a', 'foo', 'bar'] for x in ['a', 'b'])

The Microsoft naming standard for C# says variables and parameters should use the lower camel case form IE: paramName. The standard also calls for fields to follow the same form but this can lead to unclear code so many teams call for an underscore prefix to improve clarity IE: _fieldName.

If it is not defined in the web service or application or server (apache or IIS) that is hosting the web service consumable then you could create infinite connections until failure

Yes, %d is for decimal (integer), double expect %f. But simply using %f will default to up to precision 6. To print all of the precision digits for a double, you can pass it via string as:

System.out.printf("%s \r\n",String.valueOf(d));

or

System.out.printf("%s \r\n",Double.toString(d));

This is what println do by default:

System.out.println(d) 

(and terminates the line)

The following worked for me against a SQL Azure backend (using SQL Server Management Studio), so YMMV, but, if it works for you, it's waaaaay simpler than the other solutions.

ALTER TABLE MyTable
    DROP CONSTRAINT FK_MyColumn
    CONSTRAINT DK_MyColumn
    -- etc...
    COLUMN MyColumn
GO

Just replace

<iframe width="465" height="315" src="videos/example.mp4"></iframe>

by

<video src="videos/example.mp4" controls></video>

Here is an example using bootstrap 4:

 <div class="embed-responsive embed-responsive-4by3">
      <video src="videos/example.mp4" controls></video>
 </div>

I believe all the existing answers contain the relevant information, but I would like to summarize.

The response object that is returned by requests get and post operations contains two useful attributes:

Response attributes

• response.text - Contains str with the response text.
• response.content - Contains bytes with the raw response content.

You should choose one or other of these attributes depending on the type of response you expect.

• For text-based responses (html, json, yaml, etc) you would use response.text
• For binary-based responses (jpg, png, zip, xls, etc) you would use response.content.

Writing response to file

When writing responses to file you need to use the open function with the appropriate file write mode.

• For text responses you need to use "w" - plain write mode.
• For binary responses you need to use "wb" - binary write mode.

Examples

Text request and save

# Request the HTML for this web page:
response = requests.get("https://stackoverflow.com/questions/31126596/saving-response-from-requests-to-file")
with open("response.txt", "w") as f:
    f.write(response.text)

Binary request and save

# Request the profile picture of the OP:
response = requests.get("https://i.stack.imgur.com/iysmF.jpg?s=32&g=1")
with open("response.jpg", "wb") as f:
    f.write(response.content)

Answering the original question

The original code should work by using wb and response.content:

import requests

files = {'f': ('1.pdf', open('1.pdf', 'rb'))}
response = requests.post("https://pdftables.com/api?&format=xlsx-single",files=files)
response.raise_for_status() # ensure we notice bad responses
file = open("out.xls", "wb")
file.write(response.content)
file.close()

But I would go further and use the with context manager for open.

import requests

with open('1.pdf', 'rb') as file:
    files = {'f': ('1.pdf', file)}
    response = requests.post("https://pdftables.com/api?&format=xlsx-single",files=files)

response.raise_for_status() # ensure we notice bad responses

with open("out.xls", "wb") as file:
    file.write(response.content)

You can use the ant-contrib task "for" to iterate on the list of files separate by any delimeter, default delimeter is ",".

Following is the sample file which shows this:

<project name="modify-files" default="main" basedir=".">
    <taskdef resource="net/sf/antcontrib/antlib.xml"/>
    <target name="main">
        <for list="FileA,FileB,FileC,FileD,FileE" param="file">
          <sequential>
            <echo>Updating file: @{file}</echo>
            <!-- Do something with file here -->
          </sequential>
        </for>                         
    </target>
</project>

If you are using PHP 5.6, the command is:

sudo apt-get install php5.6-pgsql

To break out from a ruby block simply use return keyword return if value.nil?

Use 3 curly braces if you want to echo

{{{ $usersType or '' }}}

You need to use

$(this).parents('form').submit()

Is there something special with that directory or are you really just asking how to copy directories?

Copy recursively via CLI:

cp -R <sourcedir> <destdir>

If you're only seeing the files under the sourcedir being copied (instead of sourcedir as well), that's happening because you kept the trailing slash for sourcedir:

cp -R <sourcedir>/ <destdir>

The above only copies the files and their directories inside of sourcedir. Typically, you want to include the directory you're copying, so drop the trailing slash:

cp -R <sourcedir> <destdir>

If you mean you want to sort by date first then by names

SELECT id, name, form_id, DATE(updated_at) as date
  FROM wp_frm_items
  WHERE user_id = 11 && form_id=9
  ORDER BY updated_at DESC,name ASC

This will sort the records by date first, then by names

Simple, make a simple asp page with the designer (just for the beginning) Lets say the body is something like this:

<body>
    <form id="form1" runat="server">
    <div>
        <asp:TextBox ID="TextBox2" runat="server"></asp:TextBox>
        <br />
        <asp:TextBox ID="TextBox1" runat="server"></asp:TextBox>
    </div>
    <p>
        <asp:Button ID="Button1" runat="server" Text="Button" />
    </p>
    </form>
</body>

Great, now every asp object IS an object. So you can access it in the asp's CS code. The asp's CS code is triggered by events (mostly). The class will probably inherit from System.Web.UI.Page

If you go to the cs file of the asp page, you'll see a protected void Page_Load(object sender, EventArgs e) ... That's the load event, you can use that to populate data into your objects when the page loads.

Now, go to the button in your designer (Button1) and look at its properties, you can design it, or add events from there. Just change to the events view, and create a method for the event.

The button is a web control Button Add a Click event to the button call it Button1Click:

void Button1Click(Object sender,EventArgs e) { }

Now when you click the button, this method will be called. Because ASP is object oriented, you can think of the page as the actual class, and the objects will hold the actual current data.

So if for example you want to access the text in TextBox1 you just need to call that object in the C# code:

String firstBox = TextBox1.Text;

In the same way you can populate the objects when event occur.

Now that you have the data the user posted in the textboxes , you can use regular C# SQL connections to add the data to your database.

As this is one of the top questions about external redirect in WebView, here is a "modern" solution on Kotlin:

webView.webViewClient = object : WebViewClient() {
        override fun shouldOverrideUrlLoading(
            view: WebView?,
            request: WebResourceRequest?
        ): Boolean {
            val url = request?.url ?: return false
            //you can do checks here e.g. url.host equals to target one
            startActivity(Intent(Intent.ACTION_VIEW, url))
            return true
        }
    }

With POST you can also do multipart mime encoding which means you can attach files as well. Also if you are using post variables across navigation of pages, the user will get a warning asking if they want to resubmit the post parameter. Typically they look the same in an HTTP request, but you should just stick to POST if you need to "POST" something TO a server and "GET" if you need to GET something FROM a server as that's the way they were intended.

Until we get SERVER-863 keeping the field names as short as possible is advisable especially where you have a lot of records.

Depending on your use case, field names can have a huge impact on storage. Cant understand why this is not a higher priority for MongoDb, as this will have a positive impact on all users. If nothing else, we can start being more descriptive with our field names, without thinking twice about bandwidth & storage costs.

Please do vote.

A rework of impementation by @D'Nabre for C++. Don't forget to compile with -lcrypto at the end: gcc md5.c -o md5 -lcrypto.

#include <iostream>
#include <iomanip>
#include <fstream>
#include <string>

#include <openssl/md5.h>
using namespace std;

unsigned char result[MD5_DIGEST_LENGTH];

// function to print MD5 correctly
void printMD5(unsigned char* md, long size = MD5_DIGEST_LENGTH) {
    for (int i=0; i<size; i++) {
        cout<< hex << setw(2) << setfill('0') << (int) md[i];
    }
}

int main(int argc, char *argv[]) {

if(argc != 2) {
    cout << "Specify the file..." << endl;
    return 0;
}

ifstream::pos_type fileSize;
char * memBlock;

ifstream file (argv[1], ios::ate);

//check if opened
if (file.is_open() ) { cout<< "Using file\t"<< argv[1]<<endl; }
else {
    cout<< "Unnable to open\t"<< argv[1]<<endl;
    return 0;
}

//get file size & copy file to memory
//~ file.seekg(-1,ios::end); // exludes EOF
fileSize = file.tellg();
cout << "File size \t"<< fileSize << endl;
memBlock = new char[fileSize];
file.seekg(0,ios::beg);
file.read(memBlock, fileSize);
file.close();

//get md5 sum
MD5((unsigned char*) memBlock, fileSize, result);

//~ cout << "MD5_DIGEST_LENGTH = "<< MD5_DIGEST_LENGTH << endl;
printMD5(result);
cout<<endl;

return 0;
}

Merge - HEAD branch will generate a new commit, preserving the ancestry of each commit history. History can become polluted if merge commits are made by multiple people who work on the same branch in parallel.

Rebase - Re-writes the changes of one branch onto another without creating a new commit. The code history is simplified, linear and readable but it doesn't work with pull requests, because you can't see what minor changes someone made.

I would use git merge when dealing with feature-based workflow or if I am not familiar with rebase. But, if I want a more a clean, linear history then git rebase is more appropriate. For more details be sure to check out this merge or rebase article.

I use ajaxcontrol toolkit's AutoComplete

Can you use date as a factor?

Yes, but you probably shouldn't.

...or should you use as.Date on a date column?

Yes.

Which leads us to this:

library(scales)
df$Month <- as.Date(df$Month)
ggplot(df, aes(x = Month, y = AvgVisits)) + 
  geom_bar(stat = "identity") +
  theme_bw() +
  labs(x = "Month", y = "Average Visits per User") +
  scale_x_date(labels = date_format("%m-%Y"))

in which I've added stat = "identity" to your geom_bar call.

In addition, the message about the binwidth wasn't an error. An error will actually say "Error" in it, and similarly a warning will always say "Warning" in it. Otherwise it's just a message.

Have you tried this ?

<input type="submit" style="visibility: hidden;" />

Since most browsers understand visibility:hidden and it doesn't really work like display:none, I'm guessing that it should be fine, though. Haven't really tested it myself, so CMIIW.

Update

See my other SO answer.

Original

var request = (HttpWebRequest)WebRequest.Create("https://example.com/endpoint");

string stringData = ""; // place body here
var data = Encoding.Default.GetBytes(stringData); // note: choose appropriate encoding

request.Method = "PUT";
request.ContentType = ""; // place MIME type here
request.ContentLength = data.Length;

var newStream = request.GetRequestStream(); // get a ref to the request body so it can be modified
newStream.Write(data, 0, data.Length);
newStream.Close();

I found very good link for JSON: http://code.google.com/p/json-simple/wiki/EncodingExamples#Example_1-1_-_Encode_a_JSON_object

Here's code to add multiple JSONObjects to JSONArray.

JSONArray Obj = new JSONArray();
try {
    for(int i = 0; i < 3; i++) {
        // 1st object
        JSONObject list1 = new JSONObject();
        list1.put("val1",i+1);
        list1.put("val2",i+2);
        list1.put("val3",i+3);
        obj.put(list1);
    }

} catch (JSONException e1) {
    // TODO Auto-generated catch block
    e1.printStackTrace();
}             
Toast.makeText(MainActivity.this, ""+obj, Toast.LENGTH_LONG).show();

For-loops:

For-loop in C:

for(int x = 0; x<=3; x++)
{
    //Do something!
}

The same loop in 8086 assembler:

        xor cx,cx   ; cx-register is the counter, set to 0
loop1   nop         ; Whatever you wanna do goes here, should not change cx
        inc cx      ; Increment
        cmp cx,3    ; Compare cx to the limit
        jle loop1   ; Loop while less or equal

That is the loop if you need to access your index (cx). If you just wanna to something 0-3=4 times but you do not need the index, this would be easier:

        mov cx,4    ; 4 iterations
loop1   nop         ; Whatever you wanna do goes here, should not change cx
        loop loop1  ; loop instruction decrements cx and jumps to label if not 0

If you just want to perform a very simple instruction a constant amount of times, you could also use an assembler-directive which will just hardcore that instruction

times 4 nop

Do-while-loops

Do-while-loop in C:

int x=1;
do{
    //Do something!
}
while(x==1)

The same loop in assembler:

        mov ax,1
loop1   nop         ; Whatever you wanna do goes here
        cmp ax,1    ; Check wether cx is 1
        je loop1    ; And loop if equal

While-loops

While-loop in C:

while(x==1){
    //Do something
}

The same loop in assembler:

        jmp loop1   ; Jump to condition first
cloop1  nop         ; Execute the content of the loop
loop1   cmp ax,1    ; Check the condition
        je cloop1   ; Jump to content of the loop if met

For the for-loops you should take the cx-register because it is pretty much standard. For the other loop conditions you can take a register of your liking. Of course replace the no-operation instruction with all the instructions you wanna perform in the loop.

To generate a shared library you need first to compile your C code with the -fPIC (position independent code) flag.

gcc -c -fPIC hello.c -o hello.o

This will generate an object file (.o), now you take it and create the .so file:

gcc hello.o -shared -o libhello.so

EDIT: Suggestions from the comments:

You can use

gcc -shared -o libhello.so -fPIC hello.c

to do it in one step. – Jonathan Leffler

I also suggest to add -Wall to get all warnings, and -g to get debugging information, to your gcc commands. – Basile Starynkevitch

This may be the easiest method

• Right click on the project and select "Add Service Reference..."
• In the Address: box, enter the physical path (C:\test\project....) of the downloaded/Modified wsdl.
• Hit Go

To resolve this issue, you have to delete the .snap file located in the directory:

<workspace-directory>\.metadata\.plugins\org.eclipse.core.resources.

After deleting this file, you could start Eclipse with no problem.

export class Dashboard {
    innerHeight: any;
    innerWidth: any;
    constructor() {
        this.innerHeight = (window.screen.height) + "px";
        this.innerWidth = (window.screen.width) + "px";
    }
}

You can set the "value" property

dateTimePicker1.Value = DateTime.Today;

Make sure, you've run composer update on your server instance.

You can use templates.

template <typename T> const char* typeof(T&) { return "unknown"; }    // default
template<> const char* typeof(int&) { return "int"; }
template<> const char* typeof(float&) { return "float"; }

In the example above, when the type is not matched it will print "unknown".

JSONObject obj=(JSONObject)JSONValue.parse(content); 
JSONArray arr=(JSONArray)obj.get("units"); 
System.out.println(arr.get(1));  //this will print {"id":42,...sities ..}

@cyberz is right but explain it reverse

I recommend you to use an unordered list for your image gallery.

You should use my code unless you want the image to gain instantly 50% opacity after you hover out. You will have a smoother transition.

#photos li {
    opacity: .5;
    transition: opacity .5s ease-out;
    -moz-transition: opacity .5s ease-out;
    -webkit-transition: opacity .5s ease-out;
    -o-transition: opacity .5s ease-out;
}

#photos li:hover {
    opacity: 1;
}

Greg Beech posted an unsafe option that is indeed as fast as it gets (it's an in-place reversal); but, as he indicated in his answer, it's a completely disastrous idea.

That said, I'm surprised there is so much of a consensus that Array.Reverse is the fastest method. There's still an unsafe approach that returns a reversed copy of a string (no in-place reversal shenanigans) significantly faster than the Array.Reverse method for small strings:

public static unsafe string Reverse(string text)
{
    int len = text.Length;

    // Why allocate a char[] array on the heap when you won't use it
    // outside of this method? Use the stack.
    char* reversed = stackalloc char[len];

    // Avoid bounds-checking performance penalties.
    fixed (char* str = text)
    {
        int i = 0;
        int j = i + len - 1;
        while (i < len)
        {
            reversed[i++] = str[j--];
        }
    }

    // Need to use this overload for the System.String constructor
    // as providing just the char* pointer could result in garbage
    // at the end of the string (no guarantee of null terminator).
    return new string(reversed, 0, len);
}

Here are some benchmark results.

You can see that the performance gain shrinks and then disappears against the Array.Reverse method as the strings get larger. For small- to medium-sized strings, though, it's tough to beat this method.

I too had this error. But in my case, and I'm sure I'll be a one off here, I had accidentally deleted main.m when I hit the delete key after the app had crashed on the iPhone simulator.

After a crash, Xcode shows the main.m file and when I had hit delete, I had accidentally deleted the main.m file from my project, as it is easy to do when a file name is highlighted, not the code in the detail view.

Main.m normally resides in a group or folder named supporting files in the project file manager. I had not noticed this happened until it failed to build and run next time around and then I had to re-read the error message more closely and saw it said main.m is missing.

Thank you all for your input, but just in case there is someone in my position check for any file names in red showing missing files and restore them from a backup if you have it.

You put the declaration in a header file, e.g.

 extern int my_global;

In one of your .c files you define it at global scope.

int my_global;

Every .c file that wants access to my_global includes the header file with the extern in.

for block elements:

<textarea style="width:100px; word-wrap:break-word;">_x000D_
  ACTGATCGAGCTGAAGCGCAGTGCGATGCTTCGATGATGCTGACGATGCTACGATGCGAGCATCTACGATCAGTC_x000D_
</textarea>

for inline elements:

<span style="width:100px; word-wrap:break-word; display:inline-block;"> _x000D_
   ACTGATCGAGCTGAAGCGCAGTGCGATGCTTCGATGATGCTGACGATGCTACGATGCGAGCATCTACGATCAGTC_x000D_
</span>

You can add the onclick for JavaScript into the div.

<div onclick="location.href='newurl.html';">&nbsp;</div>

EDIT: for new window

<div onclick="window.open('newurl.html','mywindow');" style="cursor: pointer;">&nbsp;</div>

This is all perfectly normal. Microsoft added sequences in SQL Server 2012, finally, i might add and changed the way identity keys are generated. Have a look here for some explanation.

If you want to have the old behaviour, you can:

1. use trace flag 272 - this will cause a log record to be generated for each generated identity value. The performance of identity generation may be impacted by turning on this trace flag.
2. use a sequence generator with the NO CACHE setting (http://msdn.microsoft.com/en-us/library/ff878091.aspx)

This is to ensure some other site can't do nasty tricks to try to steal your data. For example, by replacing the array constructor, then including this JSON URL via a <script> tag, a malicious third-party site could steal the data from the JSON response. By putting a while(1); at the start, the script will hang instead.

A same-site request using XHR and a separate JSON parser, on the other hand, can easily ignore the while(1); prefix.

No need to divert stdout. Here is better way to do it:

import logging
class MyLogHandler(logging.Handler):
    def emit(self, record):
        pass

logging.getLogger().addHandler(MyLogHandler())

An even simpler way is:

logging.getLogger().setLevel(100)

You don't need to use GROUP BY but using it won't change the outcome. Just add an ORDER BY line at the end to sort your results.

SELECT player_name, player_salary, SUM(player_salary*1.1) AS NewSalary
FROM players
GROUP BY player_salary, player_name;
ORDER BY SUM(player_salary*1.1) DESC

This should work (where enquiryId is the id you need to match against):

vehicles.RemoveAll(vehicle => vehicle.EnquiryID == enquiryId);

What this does is passes each vehicle in the list into the lambda predicate, evaluating the predicate. If the predicate returns true (ie. vehicle.EnquiryID == enquiryId), then the current vehicle will be removed from the list.

If you know the types of the objects in your collections, then using the generic collections is a better approach. It avoids casting when retrieving objects from the collections, but can also avoid boxing if the items in the collection are value types (which can cause performance issues).

You need to put the last() indexing on the nodelist result, rather than as part of the selection criteria. Try:

(//element[@name='D'])[last()]