Programs & Examples On #Renice

Easiest way to mask characters in HTML(5) text input

A little late, but a useful plugin that will actually use a mask to give a bit more restriction on user input.

<div class="col-sm-3 col-md-6 col-lg-4">
  <div class="form-group">
     <label for="addPhone">Phone Number *</label>
      <input id="addPhone" name="addPhone" type="text" class="form-control 
       required" data-mask="(999) 999-9999"placeholder>
    <span class="help-block">(999) 999-9999</span>
  </div>
</div>

 <!-- Input Mask -->
 <script src="js/plugins/jasny/jasny-bootstrap.min.js"></script>

enter image description here

More info on the plugin https://www.jasny.net/bootstrap/2.3.1/javascript.html#inputmask

How to split one string into multiple strings separated by at least one space in bash shell?

For checking spaces just with bash:

[[ "$str" = "${str% *}" ]] && echo "no spaces" || echo "has spaces"

How to get name of dataframe column in pyspark?

I found the answer is very very simple...

// It is in java, but it should be same in pyspark
Column col = ds.col("colName"); //the column object
String theNameOftheCol = col.toString();

The variable "theNameOftheCol" is "colName"

Installation of SQL Server Business Intelligence Development Studio

It sounds like you have installed SQL Server 2005 Express Edition, which does not include SSIS or the Business Intelligence Development Studio.

BIDS is only provided with the (not free) Standard, Enterprise and Developer Editions.

EDIT

This information was correct for SQL Server 2005. Since SQL Server 2014, Developer Edition has been free. BIDS has been replaced by SQL Server Data Tools, a free plugin for Visual Studio (including the free Visual Studio Community Edition).

Unresolved reference issue in PyCharm

Although all the answers are really helpful, there's one tiny piece of information that should be explained explicitly:

  • Essentially, a project with multiple hierarchical directories work as a package with some attributes.
  • To import custom local created Classes, we need to navigate to the directory containing .py file and create an __init__.py (empty) file there.

Why this helps is because this file is required to make Python treat the directory as containing packages. Cheers!

Zipping a file in bash fails

Run dos2unix or similar utility on it to remove the carriage returns (^M).

This message indicates that your file has dos-style lineendings:

-bash: /backup/backup.sh: /bin/bash^M: bad interpreter: No such file or directory 

Utilities like dos2unix will fix it:

 dos2unix <backup.bash >improved-backup.sh 

Or, if no such utility is installed, you can accomplish the same thing with translate:

tr -d "\015\032" <backup.bash >improved-backup.sh 

As for how those characters got there in the first place, @MadPhysicist had some good comments.

Getting binary (base64) data from HTML5 Canvas (readAsBinaryString)

Short answer:

const base64Canvas = canvas.toDataURL("image/jpeg").split(';base64,')[1];

How can I use a for each loop on an array?

what about this simple inArray function:

Function isInArray(ByRef stringToBeFound As String, ByRef arr As Variant) As Boolean
For Each element In arr
    If element = stringToBeFound Then
        isInArray = True
        Exit Function
    End If
Next element
End Function

ASP.NET Core configuration for .NET Core console application

Install these packages:

  • Microsoft.Extensions.Configuration
  • Microsoft.Extensions.Configuration.Binder
  • Microsoft.Extensions.Configuration.EnvironmentVariables
  • Microsoft.Extensions.Configuration.FileExtensions
  • Microsoft.Extensions.Configuration.Json

Code:

static void Main(string[] args)
    {
        var environmentName = Environment.GetEnvironmentVariable("ENVIRONMENT");
        Console.WriteLine("ENVIRONMENT: " + environmentName);

        var builder = new ConfigurationBuilder()
           .SetBasePath(Directory.GetCurrentDirectory())
           .AddJsonFile("appsettings.json", false)
           .AddJsonFile($"appsettings.{environmentName}.json", true)
           .AddEnvironmentVariables();

        IConfigurationRoot configuration = builder.Build();
        var mySettingsConfig = configuration.Get<MySettingsConfig>();

        Console.WriteLine("URL: " + mySettingsConfig.Url);
        Console.WriteLine("NAME: " + mySettingsConfig.Name);

        Console.ReadKey();
    }

MySettingsConfig Class:

public class MySettingsConfig
{
    public string Url { get; set; }
    public string Name { get; set; }
}

Your appsettings can be as simple as this: enter image description here

Also, set the appsettings files to Content / Copy if newer: content

How do you stop MySQL on a Mac OS install?

Use:

sudo mysqladmin shutdown --user=*user* --password=*password*

One could probably get away with not using sudo. The user could be root for example (that is, the MySQL root user).

splitting a string into an array in C++ without using vector

#include <iostream>
#include <sstream>
#include <iterator>
#include <string>

using namespace std;

template <size_t N>
void splitString(string (&arr)[N], string str)
{
    int n = 0;
    istringstream iss(str);
    for (auto it = istream_iterator<string>(iss); it != istream_iterator<string>() && n < N; ++it, ++n)
        arr[n] = *it;
}

int main()
{
    string line = "test one two three.";
    string arr[4];

    splitString(arr, line);

    for (int i = 0; i < 4; i++)
       cout << arr[i] << endl;
}

Java, How to get number of messages in a topic in apache kafka

If you have access to server's JMX interface, the start & end offsets are present at:

kafka.log:type=Log,name=LogStartOffset,topic=TOPICNAME,partition=PARTITIONNUMBER
kafka.log:type=Log,name=LogEndOffset,topic=TOPICNAME,partition=PARTITIONNUMBER

(you need to replace TOPICNAME & PARTITIONNUMBER). Bear in mind you need to check for each of the replicas of given partition, or you need to find out which one of the brokers is the leader for a given partition (and this can change over time).

Alternatively, you can use Kafka Consumer methods beginningOffsets and endOffsets.

Alphanumeric, dash and underscore but no spaces regular expression check JavaScript

Don't escape the underscore. Might be causing some whackness.

Python script header

The /usr/bin/env python becomes very useful when your scripts depend on environment settings for example using scripts which rely on python virtualenv. Each virtualenv has its own version of python binary which is required for adding packages installed in virtualenv to python path (without touching PYTHONPATH env).

As more and more people have started to used virtualenv for python development prefer to use /usr/bin/env python unless you don't want people to use their custom python binary.

Note: You should also understand that there are potential security issues (in multiuser environments) when you let people run your scripts in their custom environments. You can get some ideas from here.

Apply CSS styles to an element depending on its child elements

On top of @kp's answer:

I'm dealing with this and in my case, I have to show a child element and correct the height of the parent object accordingly (auto-sizing is not working in a bootstrap header for some reason I don't have time to debug).

But instead of using javascript to modify the parent, I think I'll dynamically add a CSS class to the parent and CSS-selectively show the children accordingly. This will maintain the decisions in the logic and not based on a CSS state.

tl;dr; apply the a and b styles to the parent <div>, not the child (of course, not everyone will be able to do this. i.e. Angular components making decisions of their own).

<style>
  .parent            { height: 50px; }
  .parent div        { display: none; }
  .with-children     { height: 100px; }
  .with-children div { display: block; }
</style>

<div class="parent">
  <div>child</div>
</div>

<script>
  // to show the children
  $('.parent').addClass('with-children');
</script>

How can I remove file extension from a website address?

Tony, your script is ok, but if you have 100 files? Need add this code in all these :

include_once('scripts.php');
strip_php_extension();

I think you include a menu in each php file (probably your menu is showed in all your web pages), so you can add these 2 lines of code only in your menu file. This work for me :D

Mock a constructor with parameter

With mockito you can use withSettings(), for example if the CounterService required 2 dependencies, you can pass them as a mock:

UserService userService = Mockito.mock(UserService.class); SearchService searchService = Mockito.mock(SearchService.class); CounterService counterService = Mockito.mock(CounterService.class, withSettings().useConstructor(userService, searchService));

How to get MAC address of your machine using a C program?

netlink socket is possible

man netlink(7) netlink(3) rtnetlink(7) rtnetlink(3)

#include <assert.h>
#include <stdio.h>
#include <linux/if.h>
#include <linux/rtnetlink.h>
#include <unistd.h>

#define SZ 8192

int main(){

  // Send
  typedef struct {
    struct nlmsghdr nh;
    struct ifinfomsg ifi;
  } Req_getlink;
  assert(NLMSG_LENGTH(sizeof(struct ifinfomsg))==sizeof(Req_getlink));
  int fd=-1;
  fd=socket(AF_NETLINK,SOCK_RAW,NETLINK_ROUTE);
  assert(0==bind(fd,(struct sockaddr*)(&(struct sockaddr_nl){
    .nl_family=AF_NETLINK,
    .nl_pad=0,
    .nl_pid=getpid(),
    .nl_groups=0
  }),sizeof(struct sockaddr_nl)));
  assert(sizeof(Req_getlink)==send(fd,&(Req_getlink){
    .nh={
      .nlmsg_len=NLMSG_LENGTH(sizeof(struct ifinfomsg)),
      .nlmsg_type=RTM_GETLINK,
      .nlmsg_flags=NLM_F_REQUEST|NLM_F_ROOT,
      .nlmsg_seq=0,
      .nlmsg_pid=0
    },
    .ifi={
      .ifi_family=AF_UNSPEC,
      // .ifi_family=AF_INET,
      .ifi_type=0,
      .ifi_index=0,
      .ifi_flags=0,
      .ifi_change=0,
    }
  },sizeof(Req_getlink),0));

  // Receive
  char recvbuf[SZ]={};
  int len=0;
  for(char *p=recvbuf;;){
    const int seglen=recv(fd,p,sizeof(recvbuf)-len,0);
    assert(seglen>=1);
    len += seglen;
    if(((struct nlmsghdr*)p)->nlmsg_type==NLMSG_DONE||((struct nlmsghdr*)p)->nlmsg_type==NLMSG_ERROR)
      break;
    p += seglen;
  }

  struct nlmsghdr *nh=(struct nlmsghdr*)recvbuf;
  for(;NLMSG_OK(nh,len);nh=NLMSG_NEXT(nh,len)){
    if(nh->nlmsg_type==NLMSG_DONE)
      break;

    struct ifinfomsg *ifm=(struct ifinfomsg*)NLMSG_DATA(nh);

    printf("#%d ",ifm->ifi_index);
    #ifdef _NET_IF_H
    #pragma GCC error "include <linux/if.h> instead of <net/if.h>"
    #endif

    // Part 3 rtattr
    struct rtattr *rta=IFLA_RTA(ifm); // /usr/include/linux/if_link.h
    int rtl=RTM_PAYLOAD(nh);

    for(;RTA_OK(rta,rtl);rta=RTA_NEXT(rta,rtl))switch(rta->rta_type){
    case IFLA_IFNAME:printf("%s ",(const char*)RTA_DATA(rta));break;
    case IFLA_ADDRESS:
      printf("hwaddr ");
      for(int i=0;i<5;++i)
        printf("%02X:",*((unsigned char*)RTA_DATA(rta)+i));
      printf("%02X ",*((unsigned char*)RTA_DATA(rta)+5));
      break;
    case IFLA_BROADCAST:
      printf("bcast ");
      for(int i=0;i<5;++i)
        printf("%02X:",*((unsigned char*)RTA_DATA(rta)+i));
      printf("%02X ",*((unsigned char*)RTA_DATA(rta)+5));
      break;
    case IFLA_PERM_ADDRESS:
      printf("perm ");
      for(int i=0;i<5;++i)
        printf("%02X:",*((unsigned char*)RTA_DATA(rta)+i));
      printf("%02X ",*((unsigned char*)RTA_DATA(rta)+5));
      break;
    }

    printf("\n");

  }

  close(fd);
  fd=-1;
  return 0;

}

Example

#1 lo hwaddr 00:00:00:00:00:00 bcast 00:00:00:00:00:00
#2 eth0 hwaddr 57:da:52:45:5b:1a bcast ff:ff:ff:ff:ff:ff perm 57:da:52:45:5b:1a
#3 wlan0 hwaddr 3c:7f:46:47:58:c2 bcast ff:ff:ff:ff:ff:ff perm 3c:7f:46:47:58:c2

TypeScript static classes

Defining static properties and methods of a class is described in 8.2.1 of the Typescript Language Specification:

class Point { 
  constructor(public x: number, public y: number) { 
    throw new Error('cannot instantiate using a static class');
  } 
  public distance(p: Point) { 
    var dx = this.x - p.x; 
    var dy = this.y - p.y; 
    return Math.sqrt(dx * dx + dy * dy); 
  } 
  static origin = new Point(0, 0); 
  static distance(p1: Point, p2: Point) { 
    return p1.distance(p2); 
  } 
}

where Point.distance() is a static (or "class") method.

How to prove that a problem is NP complete?

You need to reduce an NP-Complete problem to the problem you have. If the reduction can be done in polynomial time then you have proven that your problem is NP-complete, if the problem is already in NP, because:

It is not easier than the NP-complete problem, since it can be reduced to it in polynomial time which makes the problem NP-Hard.

See the end of http://www.ics.uci.edu/~eppstein/161/960312.html for more.

How can I copy columns from one sheet to another with VBA in Excel?

Selecting is often unnecessary. Try this

Sub OneCell()
    Sheets("Sheet2").range("B1:B3").value = Sheets("Sheet1").range("A1:A3").value
End Sub

Mocking a function to raise an Exception to test an except block

Your mock is raising the exception just fine, but the error.resp.status value is missing. Rather than use return_value, just tell Mock that status is an attribute:

barMock.side_effect = HttpError(mock.Mock(status=404), 'not found')

Additional keyword arguments to Mock() are set as attributes on the resulting object.

I put your foo and bar definitions in a my_tests module, added in the HttpError class so I could use it too, and your test then can be ran to success:

>>> from my_tests import foo, HttpError
>>> import mock
>>> with mock.patch('my_tests.bar') as barMock:
...     barMock.side_effect = HttpError(mock.Mock(status=404), 'not found')
...     result = my_test.foo()
... 
404 - 
>>> result is None
True

You can even see the print '404 - %s' % error.message line run, but I think you wanted to use error.content there instead; that's the attribute HttpError() sets from the second argument, at any rate.

running php script (php function) in linux bash

php test.php

should do it, or

php -f test.php

to be explicit.

How do you plot bar charts in gnuplot?

I would just like to expand upon the top answer, which uses GNUPlot to create a bar graph, for absolute beginners because I read the answer and was still confused from the deluge of syntax.

We begin by writing a text file of GNUplot commands. Lets call it commands.txt:

set term png
set output "graph.png"
set boxwidth 0.5
set style fill solid
plot "data.dat" using 1:3:xtic(2) with boxes

set term png will set GNUplot to output a .png file and set output "graph.png" is the name of the file it will output to.

The next two lines are rather self explanatory. The fifth line contains a lot of syntax.

plot "data.dat" using 1:3:xtic(2) with boxes

"data.dat" is the data file we are operating on. 1:3 indicates we will be using column 1 of data.dat for the x-coordinates and column 3 of data.dat for the y-coordinates. xtic() is a function that is responsible for numbering/labeling the x-axis. xtic(2), therefore, indicates that we will be using column 2 of data.dat for labels.

"data.dat" looks like this:

0 label       100
1 label2      450
2 "bar label" 75

To plot the graph, enter gnuplot commands.txt in terminal.

Common Header / Footer with static HTML

There are three ways to do what you want

Server Script

This includes something like php, asp, jsp.... But you said no to that

Server Side Includes

Your server is serving up the pages so why not take advantage of the built in server side includes? Each server has its own way to do this, take advantage of it.

Client Side Include

This solutions has you calling back to the server after page has already been loaded on the client.

How can I find the link URL by link text with XPath?

For case insensitive contains, use the following:

//a[contains(translate(text(),'PROGRAMMING','programming'), 'programming')]/@href

translate converts capital letters in PROGRAMMING to lower case programming.

SQL Server 2008 - IF NOT EXISTS INSERT ELSE UPDATE

As others have suggested that you should look into MERGE statement but nobody provided a solution using it I'm adding my own answer with this particular TSQL construct. I bet you'll like it.

Important note

Your code has a typo in your if statement in not exists(select...) part. Inner select statement has only one where condition while UserName condition is excluded from the not exists due to invalid brace completion. In any case you cave too many closing braces.

I assume this based on the fact that you're using two where conditions in update statement later on in your code.

Let's continue to my answer...

SQL Server 2008+ support MERGE statement

MERGE statement is a beautiful TSQL gem very well suited for "insert or update" situations. In your case it would look similar to the following code. Take into consideration that I'm declaring variables what are likely stored procedure parameters (I suspect).

declare @clockDate date = '08/10/2012';
declare @userName = 'test';

merge Clock as target
using (select @clockDate, @userName) as source (ClockDate, UserName)
on (target.ClockDate = source.ClockDate and target.UserName = source.UserName)
when matched then
    update
    set BreakOut = getdate()
when not matched then
    insert (ClockDate, UserName, BreakOut)
    values (getdate(), source.UserName, getdate());

Get checkbox values using checkbox name using jquery

$('[name="CheckboxName"]:checked').each(function () {
    // do stuff
});

Differences between key, superkey, minimal superkey, candidate key and primary key

Here I copy paste some of the information that I have collected

Key A key is a single or combination of multiple fields. Its purpose is to access or retrieve data rows from table according to the requirement. The keys are defined in tables to access or sequence the stored data quickly and smoothly. They are also used to create links between different tables.

Types of Keys

Primary Key The attribute or combination of attributes that uniquely identifies a row or record in a relation is known as primary key.

Secondary key A field or combination of fields that is basis for retrieval is known as secondary key. Secondary key is a non-unique field. One secondary key value may refer to many records.

Candidate Key or Alternate key A relation can have only one primary key. It may contain many fields or combination of fields that can be used as primary key. One field or combination of fields is used as primary key. The fields or combination of fields that are not used as primary key are known as candidate key or alternate key.

Composite key or concatenate key A primary key that consists of two or more attributes is known as composite key.

Sort Or control key A field or combination of fields that is used to physically sequence the stored data called sort key. It is also known s control key.

A superkey is a combination of attributes that can be uniquely used to identify a database record. A table might have many superkeys. Candidate keys are a special subset of superkeys that do not have any extraneous information in them.

Example for super key: Imagine a table with the fields <Name>, <Age>, <SSN> and <Phone Extension>. This table has many possible superkeys. Three of these are <SSN>, <Phone Extension, Name> and <SSN, Name>. Of those listed, only <SSN> is a candidate key, as the others contain information not necessary to uniquely identify records.

Foreign Key A foreign key is an attribute or combination of attribute in a relation whose value match a primary key in another relation. The table in which foreign key is created is called as dependent table. The table to which foreign key is refers is known as parent table.

Convert string to int if string is a number

Here are a three functions that might be useful. First checks the string for a proper numeric format, second and third function converts a string to Long or Double.

Function IsValidNumericEntry(MyString As String) As Boolean
'********************************************************************************
'This function checks the string entry to make sure that valid digits are in the string.
'It checks to make sure the + and - are the first character if entered and no duplicates.
'Valid charcters are 0 - 9, + - and the .
'********************************************************************************
Dim ValidEntry As Boolean
Dim CharCode As Integer
Dim ValidDigit As Boolean
Dim ValidPlus As Boolean
Dim ValidMinus As Boolean
Dim ValidDecimal As Boolean
Dim ErrMsg As String

ValidDigit = False
ValidPlus = False
ValidMinus = False
ValidDecimal = False

ValidEntry = True
For x = 1 To Len(MyString)
    CharCode = Asc(Mid(MyString, x, 1))
    Select Case CharCode

    Case 48 To 57 ' Digits 0 - 9
        ValidDigit = True

    Case 43 ' Plus sign

    If ValidPlus Then 'One has already been detected and this is a duplicate
        ErrMsg = "Invalid entry....too many plus signs!"
        ValidEntry = False
        Exit For
    ElseIf x = 1 Then 'if in the first positon it is valide
        ValidPlus = True
    Else 'Not in first position and it is invalid
        ErrMsg = "Invalide entry....Plus sign not in the correct position! "
        ValidEntry = False
        Exit For
    End If

    Case 45 ' Minus sign

    If ValidMinus Then 'One has already been detected and this is a duplicate
        ErrMsg = "Invalide entry....too many minus signs! "
        ValidEntry = False
        Exit For
    ElseIf x = 1 Then 'if in the first position it is valid
        ValidMinus = True
    Else 'Not in first position and it is invalid
        ErrMsg = "Invalide entry....Minus sign not in the correct position! "
        ValidEntry = False
        Exit For
    End If

    Case 46 ' Period

    If ValidDecimal Then 'One has already been detected and this is a duplicate
        ErrMsg = "Invalide entry....too many decimals!"
        ValidEntry = False
        Exit For
    Else
        ValidDecimal = True
    End If

    Case Else
        ErrMsg = "Invalid numerical entry....Only digits 0-9 and the . + - characters are valid!"
        ValidEntry = False
        Exit For

    End Select

Next

    If ValidEntry And ValidDigit Then
        IsValidNumericEntry = True
    Else
        If ValidDigit = False Then
            ErrMsg = "Text string contains an invalid numeric format." & vbCrLf _
            & "Use only one of the following formats!" & vbCrLf _
            & "(+dd.dd  -dd.dd  +dd  -dd  dd.d or dd)! "
        End If
        MsgBox (ErrMsg & vbCrLf & vbCrLf & "You Entered:   " & MyString)
        IsValidNumericEntry = False
    End If

End Function

Function ConvertToLong(stringVal As String) As Long
'Assumes the user has verified the string contains a valide numeric entry.
'User should call the function IsValidNumericEntry first especially after any user input
'to verify that the user has entered a proper number.

 ConvertToLong = CLng(stringVal)


End Function
Function ConvertToDouble(stringVal As String) As Double
'Assumes the user has verified the string contains a valide numeric entry.
'User should call the function IsValidNumericEntry first especially after any user input
'to verify that the user has entered a proper number.

    ConvertToDouble = CDbl(stringVal)

End Function

Regular expression to find URLs within a string

I use this Regex:

/((\w+:\/\/\S+)|(\w+[\.:]\w+\S+))[^\s,\.]/ig

It works fine for many URLs, like: http://google.com, https://dev-site.io:8080/home?val=1&count=100, www.regexr.com, localhost:8080/path, ...

Combine multiple results in a subquery into a single comma-separated value

In MySQL there is a group_concat function that will return what you're asking for.

SELECT TableA.ID, TableA.Name, group_concat(TableB.SomeColumn) 
as SomColumnGroup FROM TableA LEFT JOIN TableB ON 
TableB.TableA_ID = TableA.ID

Getting RAW Soap Data from a Web Reference Client running in ASP.net

I would prefer to have the framework do the logging for you by hooking in a logging stream which logs as the framework processes that underlying stream. The following isn't as clean as I would like it, since you can't decide between request and response in the ChainStream method. The following is how I handle it. With thanks to Jon Hanna for the overriding a stream idea

public class LoggerSoapExtension : SoapExtension
{
    private static readonly string LOG_DIRECTORY = ConfigurationManager.AppSettings["LOG_DIRECTORY"];
    private LogStream _logger;

    public override object GetInitializer(LogicalMethodInfo methodInfo, SoapExtensionAttribute attribute)
    {
        return null;
    }
    public override object GetInitializer(Type serviceType)
    {
        return null;
    }
    public override void Initialize(object initializer)
    {
    }
    public override System.IO.Stream ChainStream(System.IO.Stream stream)
    {
        _logger = new LogStream(stream);
        return _logger;
    }
    public override void ProcessMessage(SoapMessage message)
    {
        if (LOG_DIRECTORY != null)
        {
            switch (message.Stage)
            {
                case SoapMessageStage.BeforeSerialize:
                    _logger.Type = "request";
                    break;
                case SoapMessageStage.AfterSerialize:
                    break;
                case SoapMessageStage.BeforeDeserialize:
                    _logger.Type = "response";
                    break;
                case SoapMessageStage.AfterDeserialize:
                    break;
            }
        }
    }
    internal class LogStream : Stream
    {
        private Stream _source;
        private Stream _log;
        private bool _logSetup;
        private string _type;

        public LogStream(Stream source)
        {
            _source = source;
        }
        internal string Type
        {
            set { _type = value; }
        }
        private Stream Logger
        {
            get
            {
                if (!_logSetup)
                {
                    if (LOG_DIRECTORY != null)
                    {
                        try
                        {
                            DateTime now = DateTime.Now;
                            string folder = LOG_DIRECTORY + now.ToString("yyyyMMdd");
                            string subfolder = folder + "\\" + now.ToString("HH");
                            string client = System.Web.HttpContext.Current != null && System.Web.HttpContext.Current.Request != null && System.Web.HttpContext.Current.Request.UserHostAddress != null ? System.Web.HttpContext.Current.Request.UserHostAddress : string.Empty;
                            string ticks = now.ToString("yyyyMMdd'T'HHmmss.fffffff");
                            if (!Directory.Exists(folder))
                                Directory.CreateDirectory(folder);
                            if (!Directory.Exists(subfolder))
                                Directory.CreateDirectory(subfolder);
                            _log = new FileStream(new System.Text.StringBuilder(subfolder).Append('\\').Append(client).Append('_').Append(ticks).Append('_').Append(_type).Append(".xml").ToString(), FileMode.Create);
                        }
                        catch
                        {
                            _log = null;
                        }
                    }
                    _logSetup = true;
                }
                return _log;
            }
        }
        public override bool CanRead
        {
            get
            {
                return _source.CanRead;
            }
        }
        public override bool CanSeek
        {
            get
            {
                return _source.CanSeek;
            }
        }

        public override bool CanWrite
        {
            get
            {
                return _source.CanWrite;
            }
        }

        public override long Length
        {
            get
            {
                return _source.Length;
            }
        }

        public override long Position
        {
            get
            {
                return _source.Position;
            }
            set
            {
                _source.Position = value;
            }
        }

        public override void Flush()
        {
            _source.Flush();
            if (Logger != null)
                Logger.Flush();
        }

        public override long Seek(long offset, SeekOrigin origin)
        {
            return _source.Seek(offset, origin);
        }

        public override void SetLength(long value)
        {
            _source.SetLength(value);
        }

        public override int Read(byte[] buffer, int offset, int count)
        {
            count = _source.Read(buffer, offset, count);
            if (Logger != null)
                Logger.Write(buffer, offset, count);
            return count;
        }

        public override void Write(byte[] buffer, int offset, int count)
        {
            _source.Write(buffer, offset, count);
            if (Logger != null)
                Logger.Write(buffer, offset, count);
        }
        public override int ReadByte()
        {
            int ret = _source.ReadByte();
            if (ret != -1 && Logger != null)
                Logger.WriteByte((byte)ret);
            return ret;
        }
        public override void Close()
        {
            _source.Close();
            if (Logger != null)
                Logger.Close();
            base.Close();
        }
        public override int ReadTimeout
        {
            get { return _source.ReadTimeout; }
            set { _source.ReadTimeout = value; }
        }
        public override int WriteTimeout
        {
            get { return _source.WriteTimeout; }
            set { _source.WriteTimeout = value; }
        }
    }
}
[AttributeUsage(AttributeTargets.Method)]
public class LoggerSoapExtensionAttribute : SoapExtensionAttribute
{
    private int priority = 1;
    public override int Priority
    {
        get
        {
            return priority;
        }
        set
        {
            priority = value;
        }
    }
    public override System.Type ExtensionType
    {
        get
        {
            return typeof(LoggerSoapExtension);
        }
    }
}

The program can't start because libgcc_s_dw2-1.dll is missing

Add path to that dll into PATH environment variable.

How to write a multidimensional array to a text file?

ndarray.tofile() should also work

e.g. if your array is called a:

a.tofile('yourfile.txt',sep=" ",format="%s")

Not sure how to get newline formatting though.

Edit (credit Kevin J. Black's comment here):

Since version 1.5.0, np.tofile() takes an optional parameter newline='\n' to allow multi-line output. https://docs.scipy.org/doc/numpy-1.13.0/reference/generated/numpy.savetxt.html

Display a tooltip over a button using Windows Forms

For default tooltip this can be used -

System.Windows.Forms.ToolTip ToolTip1 = new System.Windows.Forms.ToolTip();
ToolTip1.SetToolTip(this.textBox1, "Hello world");

A customized tooltip can also be used in case if formatting is required for tooltip message. This can be created by custom formatting the form and use it as tooltip dialog on mouse hover event of the control. Please check following link for more details -

http://newapputil.blogspot.in/2015/08/create-custom-tooltip-dialog-from-form.html

ViewBag, ViewData and TempData

TempData in Asp.Net MVC is one of the very useful feature. It is used to pass data from current request to subsequent request. In other words if we want to send data from one page to another page while redirection occurs, we can use TempData, but we need to do some consideration in code to achieve this feature in MVC. Because the life of TempData is very short and lies only till the target view is fully loaded. But, we can use Keep() method to persist data in TempData.

Read More

DISTINCT clause with WHERE

May be by :

SELECT DISTINCT email,id FROM table where id='2';

accepting HTTPS connections with self-signed certificates

This is problem resulting from lack of SNI(Server Name Identification) support inA,ndroid 2.x. I was struggling with this problem for a week until I came across the following question, which not only gives a good background of the problem but also provides a working and effective solution devoid of any security holes.

'No peer certificate' error in Android 2.3 but NOT in 4

What is Unicode, UTF-8, UTF-16?

UTF stands for stands for Unicode Transformation Format.Basically in today's world there are scripts written in hundreds of other languages, formats not covered by the basic ASCII used earlier. Hence, UTF came into existence.

UTF-8 has character encoding capabilities and its code unit is 8 bits while that for UTF-16 it is 16 bits.

Proper way to get page content

The wp_trim_words function can limit the characters too by changing the $num_words variable. For anyone who might find useful.

<?php 
$id=58; 
$post = get_post($id); 
$content = apply_filters('the_content', $post->post_content); 

$customExcerpt = wp_trim_words( $content, $num_words = 26, $more = '' );
echo $customExcerpt;  
?>

base64 encoded images in email signatures

The image should be embedded in the message as an attachment like this:

--boundary
Content-Type: image/png; name="sig.png"
Content-Disposition: inline; filename="sig.png"
Content-Transfer-Encoding: base64
Content-ID: <0123456789>
Content-Location: sig.png

base64 data

--boundary

And, the HTML part would reference the image like this:

<img src="cid:0123456789">

In some clients, src="sig.png" will work too.

You'd basically have a multipart/mixed, multipart/alternative, multipart/related message where the image attachment is in the related part.

Clients shouldn't block this image either as it isn't remote.

Or, here's a multipart/alternative, multipart/related example as an mbox file (save as windows newline format and put a blank line at the end. And, use no extension or the .mbs extension):

From 
From: [email protected]
To: [email protected]
Subject: HTML Messages with Embedded Pic in Signature
MIME-Version: 1.0
Content-Type: multipart/alternative; boundary="alternative_boundary"

This is a message with multiple parts in MIME format.

--alternative_boundary
Content-Type: text/plain; charset="utf-8"
Content-Transfer-Encoding: 8bit

test

-- 
[Picture of a Christmas Tree]

--alternative_boundary
Content-Type: multipart/related; boundary="related_boundary"

--related_boundary
Content-Type: text/html; charset="utf-8"
Content-Transfer-Encoding: 8bit

<!DOCTYPE html>
<html>
    <head>
        <meta charset="utf-8">
        <title></title>
    </head>
    <body>
        <p>test</p>
        <p class="sig">-- <br><img src="cid:0123456789"></p>
    </body>
</html>

--related_boundary
Content-Type: image/png; name="sig.png"
Content-Disposition: inline; filename="sig.png"
Content-Location: sig.png
Content-ID: <0123456789>
Content-Transfer-Encoding: base64

R0lGODlhKAA8AIMLAAD//wAhAABKAABrAACUAAC1AADeAAD/AGsAAP8zM///AP//
///M//////+ZAMwAACH/C05FVFNDQVBFMi4wAwGgDwAh+QQJFAALACwAAAAAKAA8
AAME+3DJSWt1Nuu9Mf+g5IzK6IXopaxn6orlKy/jMc6vQRy4GySABK+HAiaIoQdg
uUSCBAKAYTBwbgyGA2AgsGqo0wMh7K0YEuj0sUxRoAfqB1vycBN21Ki8vOofBndR
c1AKgH8ETE1lBgo7O2JaU2UFAgRoDGoAXV4PD2qYagl7Vp0JDKenfwado0QCAQOQ
DIcDBgIFVgYBAlOxswR5r1VIUbCHwH8HlQWFRLYABVOWamACCkiJAAehaX0rPZ1B
oQSg3Z04AuFqB2IMd+atLwUBtpAHqKdUtbwGM1BTOgA5YhBr374ZAxhAqRVLzA53
OwTEAjhDIZYs09aBASYq+94HfAq3cRt57sWDct2EvEsTpBMVF6sYeEpDQIFDdo62
BHwZApjEhjW94RyQTWK/FPx+Ahpg09GdOzoJ/ESx0JaOQ42e2tsiEYpCEFwAGi04
8g6gSgNOovD0gBeVjCPR2BIAkgOrmSNxPo3rbhgHZiMFPnLkBg2BAuQ2XdmlwK1Z
ooZu1sRz6xWlxd4U9GIHwOmdzFgCFKCERYNoeo2BZsPp0KY+A/OAfZDYWKJZLZBo
1mQXdlojvxNYiXrD8I+2uEvTdFJQksID0XjXiUwjJm6CzBVeBQgwBop1ZPpC8RKt
YN5RCpS6XiyMht093o8KcFFf/vKE0dCmaLeWYhQMwbeQaHLRfNk9o5Q13lQGklFQ
aMLFRLcwcN5qSWmGxS2jKQQFL9nEAgxsDEiwlAHaPPJWIfroo6FVEun0VkL4UABA
CAjUiIAFM2YQogzcoLCjC3HNsYB1aSBB5JFrZBABACH5BAkUAAsALAAAAAAoADwA
AwT7cMlJa3U2670x/6DkjKQXnleJrqnJruMxvq8xHDQbJEyC5yheAnh6MI5HYkgg
YNgGSo7BcGAMBNHNYGA7ELpZiyFBLg/DFvLArEBPHoAEgXDYChQP90IAoNYJCoGB
aACFhX8HBwoGegYAdHReijZoBXxmPWRYYQ8PZmSZZHmcnqBITp2jSgIBN5BVBFwC
BVkGAQJPiVV2rFCrCq1/sXUHAgQFAL45BncFNgSfW8wASoKBB59lhoVAnQqfDNCf
AJ05At5msHPiCeSqLwUBzF6nVnXSuIwvTDYGsXPhiMmSRUOWAC436HmZU+yGDQYF
81FhV+aevzUM3oHoZBD7W7Zs9VaUIhOn4pwE38p0srLCQCqSciBFUuBFGgEryj7E
Ojhg2yOG1hQMIMCEy4p8PB8llKmAIReiW040keUvmUygiexcwbWJwxUrzBDW+Thn
qLEB5UDUe0LxYwJmAhKk+pAqVLZE69qWGZpTQwG7ZISuw7uwzDFAXTXYYoJraKym
Q/HSASDpiiUFljbYitfYRtCF635yMRBUn4UA8aYclCw0shefW7gUgPxBKGPHA5pK
MpwsKy5AcmNZSIVHjdjI2eLwVZlK44IHQT8lkq7XTDznrAIEWMTErZwbsT/hQj1L
noXLV6YwS5eIJqIDf4tyLZB5Av1ZNrLzQSplrXVkOgxItBU1E+DCwC2xFZUME5dZ
c5AB9aw2jXkSQLhFIrj4xAx9szGWzwABdkGATwuAeEokW4wY24oK8MMViAjxxcc8
E0CUAYETIKAjAifgWGMI2ehBgVtCeleGEkYmeUYGEQAAIfkECRQACwAsAAAAACgA
PAADBPtwyUlrdTbrvTH/oOSMpBeeV4muqcmu4zG+r6EcNBskSoLnJ4VQCAw9ErzE
oxgSCBSGwYDJMRgOhIGAupFGsVEG12JAmpHicaU3QDPe6fHjoSAQDlIBY6leDIUD
dnp9C04DdXh3eAaEUTeKdwJRagUCBGdnW3JHmJh8XHNmWAeLDwCfRQIBA6MMiQMG
AgBcBgGSUgeuWQMAvb1MAgWruXAMrJYAUkU2wVGXDGZeAIxMCgVfaJhOVkB/PWeX
nXM5AnScSKR2dmZzqCwFUAKjo1l4XpLULNuwWXYHAHgWCYD15AXBgV+wEACg7sDA
A45oaLFy5ZKvXvYMEPCGYvvOwQOYAHRCQufFuU7/wp2Zo2AKCgPtwN3xR8/LLpcg
kg1khaVlQyw8GRAwlC8nvp2HeM5UR8CYxp05L8ay8YcplmLGtmniwCtKLFhJR9oR
amnAuBAiH9wK9G1kAgaxBCg5u6HdSUzp1LlNCqJAgZGBaC41Q6DAUAUfajm5ZUdK
v7z08ATjmKGWAltecaVTqE5oFisB/EIpSiH06IcKpQTa3JSVagPCWm7wZsgOwJkg
3xaTrJFkFgvtFHDywmt1J2iB2pC0C9x0yItnsLx1K8xdoQDYCcQ9I5KwaynaalUS
RnpBpYH4YiXoTipgIlIFtLSUFKwSBb/NtGCnb2Zl51fHo8hnhRZbSfCEKkgZkkcw
TgBgyVdxeQNRMNNMoMBOpBxFUSx+ObgYPgS1BBRss/jxxzwAqsbLRfwh1VJyF5WI
2AkIAIAAAiiUKMGMICDRXQIn6IiCW4Qs4NYZTByppBkbRAAAIf4ZQm95J3MgSGFw
cHkgSG9saWRheXMgUGFnZQA7

--related_boundary--

--alternative_boundary--

You can import that into Sylpheed or Thunderbird (with the Import/Export tools extension) or Opera's built-in mail client. Then, in Opera for example, you can toggle "prefer plain text" to see the difference between the HTML and text version. Anyway, you'll see the HTML version makes use of the embedded pic in the sig.

How do I use the ternary operator ( ? : ) in PHP as a shorthand for "if / else"?

Ternary Operator is basically shorthand for if/else statement. We can use to reduce few lines of code and increases readability.

Your code looks cleaner to me. But we can add more cleaner way as follows-

$test = (empty($address['street2'])) ? 'Yes <br />' : 'No <br />';

Another way-

$test = ((empty($address['street2'])) ? 'Yes <br />' : 'No <br />');

Note- I have added bracket to whole expression to make it cleaner. I used to do this usually to increase readability. With PHP7 we can use Null Coalescing Operator / php 7 ?? operator for better approach. But your requirement it does not fit.

How to append a jQuery variable value inside the .html tag

HTML :

<div id="myDiv">
    <form id="myForm">
    </form> 
</div>

jQuery :

var chbx='<input type="checkbox" id="Mumbai" name="Mumbai" value="Mumbai" />Mumbai<br /> <input type="checkbox" id=" Delhi" name=" Delhi" value=" Delhi" /> Delhi<br/><input type="checkbox" id=" Bangalore" name=" Bangalore" value=" Bangalore"/>Bangalore<br />';

$("#myDiv form#myForm").html(chbx);

//to insert dynamically created form 
$("#myDiv").html("<form id='dynamicForm'>" +chbx + "'</form>");

Demo

File input 'accept' attribute - is it useful?

Yes, it is extremely useful in browsers that support it, but the "limiting" is as a convenience to users (so they are not overwhelmed with irrelevant files) rather than as a way to prevent them from uploading things you don't want them uploading.

It is supported in

  • Chrome 16 +
  • Safari 6 +
  • Firefox 9 +
  • IE 10 +
  • Opera 11 +

Here is a list of content types you can use with it, followed by the corresponding file extensions (though of course you can use any file extension):

application/envoy   evy
application/fractals    fif
application/futuresplash    spl
application/hta hta
application/internet-property-stream    acx
application/mac-binhex40    hqx
application/msword  doc
application/msword  dot
application/octet-stream    *
application/octet-stream    bin
application/octet-stream    class
application/octet-stream    dms
application/octet-stream    exe
application/octet-stream    lha
application/octet-stream    lzh
application/oda oda
application/olescript   axs
application/pdf pdf
application/pics-rules  prf
application/pkcs10  p10
application/pkix-crl    crl
application/postscript  ai
application/postscript  eps
application/postscript  ps
application/rtf rtf
application/set-payment-initiation  setpay
application/set-registration-initiation setreg
application/vnd.ms-excel    xla
application/vnd.ms-excel    xlc
application/vnd.ms-excel    xlm
application/vnd.ms-excel    xls
application/vnd.ms-excel    xlt
application/vnd.ms-excel    xlw
application/vnd.ms-outlook  msg
application/vnd.ms-pkicertstore sst
application/vnd.ms-pkiseccat    cat
application/vnd.ms-pkistl   stl
application/vnd.ms-powerpoint   pot
application/vnd.ms-powerpoint   pps
application/vnd.ms-powerpoint   ppt
application/vnd.ms-project  mpp
application/vnd.ms-works    wcm
application/vnd.ms-works    wdb
application/vnd.ms-works    wks
application/vnd.ms-works    wps
application/winhlp  hlp
application/x-bcpio bcpio
application/x-cdf   cdf
application/x-compress  z
application/x-compressed    tgz
application/x-cpio  cpio
application/x-csh   csh
application/x-director  dcr
application/x-director  dir
application/x-director  dxr
application/x-dvi   dvi
application/x-gtar  gtar
application/x-gzip  gz
application/x-hdf   hdf
application/x-internet-signup   ins
application/x-internet-signup   isp
application/x-iphone    iii
application/x-javascript    js
application/x-latex latex
application/x-msaccess  mdb
application/x-mscardfile    crd
application/x-msclip    clp
application/x-msdownload    dll
application/x-msmediaview   m13
application/x-msmediaview   m14
application/x-msmediaview   mvb
application/x-msmetafile    wmf
application/x-msmoney   mny
application/x-mspublisher   pub
application/x-msschedule    scd
application/x-msterminal    trm
application/x-mswrite   wri
application/x-netcdf    cdf
application/x-netcdf    nc
application/x-perfmon   pma
application/x-perfmon   pmc
application/x-perfmon   pml
application/x-perfmon   pmr
application/x-perfmon   pmw
application/x-pkcs12    p12
application/x-pkcs12    pfx
application/x-pkcs7-certificates    p7b
application/x-pkcs7-certificates    spc
application/x-pkcs7-certreqresp p7r
application/x-pkcs7-mime    p7c
application/x-pkcs7-mime    p7m
application/x-pkcs7-signature   p7s
application/x-sh    sh
application/x-shar  shar
application/x-shockwave-flash   swf
application/x-stuffit   sit
application/x-sv4cpio   sv4cpio
application/x-sv4crc    sv4crc
application/x-tar   tar
application/x-tcl   tcl
application/x-tex   tex
application/x-texinfo   texi
application/x-texinfo   texinfo
application/x-troff roff
application/x-troff t
application/x-troff tr
application/x-troff-man man
application/x-troff-me  me
application/x-troff-ms  ms
application/x-ustar ustar
application/x-wais-source   src
application/x-x509-ca-cert  cer
application/x-x509-ca-cert  crt
application/x-x509-ca-cert  der
application/ynd.ms-pkipko   pko
application/zip zip
audio/basic au
audio/basic snd
audio/mid   mid
audio/mid   rmi
audio/mpeg  mp3
audio/x-aiff    aif
audio/x-aiff    aifc
audio/x-aiff    aiff
audio/x-mpegurl m3u
audio/x-pn-realaudio    ra
audio/x-pn-realaudio    ram
audio/x-wav wav
image/bmp   bmp
image/cis-cod   cod
image/gif   gif
image/ief   ief
image/jpeg  jpe
image/jpeg  jpeg
image/jpeg  jpg
image/pipeg jfif
image/svg+xml   svg
image/tiff  tif
image/tiff  tiff
image/x-cmu-raster  ras
image/x-cmx cmx
image/x-icon    ico
image/x-portable-anymap pnm
image/x-portable-bitmap pbm
image/x-portable-graymap    pgm
image/x-portable-pixmap ppm
image/x-rgb rgb
image/x-xbitmap xbm
image/x-xpixmap xpm
image/x-xwindowdump xwd
message/rfc822  mht
message/rfc822  mhtml
message/rfc822  nws
text/css    css
text/h323   323
text/html   htm
text/html   html
text/html   stm
text/iuls   uls
text/plain  bas
text/plain  c
text/plain  h
text/plain  txt
text/richtext   rtx
text/scriptlet  sct
text/tab-separated-values   tsv
text/webviewhtml    htt
text/x-component    htc
text/x-setext   etx
text/x-vcard    vcf
video/mpeg  mp2
video/mpeg  mpa
video/mpeg  mpe
video/mpeg  mpeg
video/mpeg  mpg
video/mpeg  mpv2
video/quicktime mov
video/quicktime qt
video/x-la-asf  lsf
video/x-la-asf  lsx
video/x-ms-asf  asf
video/x-ms-asf  asr
video/x-ms-asf  asx
video/x-msvideo avi
video/x-sgi-movie   movie
x-world/x-vrml  flr
x-world/x-vrml  vrml
x-world/x-vrml  wrl
x-world/x-vrml  wrz
x-world/x-vrml  xaf
x-world/x-vrml  xof

Can RDP clients launch remote applications and not desktops

RDP will not do that natively.

As other answers have said -- you'll need to do some scripting and make policy changes as a kludge to make it hard for RDP logins to run anything but the intended application.

However, as of 2008, Microsoft has released application virtualization technology via Terminal Services that will allow you to do this seamlessly.

Display / print all rows of a tibble (tbl_df)

I prefer to turn the tibble to data.frame. It shows everything and you're done

df %>% data.frame 

How to list only top level directories in Python?

Just to add that using os.listdir() does not "take a lot of processing vs very simple os.walk().next()[1]". This is because os.walk() uses os.listdir() internally. In fact if you test them together:

>>>> import timeit
>>>> timeit.timeit("os.walk('.').next()[1]", "import os", number=10000)
1.1215229034423828
>>>> timeit.timeit("[ name for name in os.listdir('.') if os.path.isdir(os.path.join('.', name)) ]", "import os", number=10000)
1.0592019557952881

The filtering of os.listdir() is very slightly faster.

How to use SortedMap interface in Java?

TreeMap, which is an implementation of the SortedMap interface, would work.

How do I use it ?

Map<Float, MyObject> map = new TreeMap<Float, MyObject>();

Warning: Attempt to present * on * whose view is not in the window hierarchy - swift

For swift 3.0 and above

public static func getTopViewController() -> UIViewController?{
if var topController = UIApplication.shared.keyWindow?.rootViewController
{
  while (topController.presentedViewController != nil)
  {
    topController = topController.presentedViewController!
  }
  return topController
}
return nil}

Adding days to a date in Python

Here is a function of getting from now + specified days

import datetime

def get_date(dateFormat="%d-%m-%Y", addDays=0):

    timeNow = datetime.datetime.now()
    if (addDays!=0):
        anotherTime = timeNow + datetime.timedelta(days=addDays)
    else:
        anotherTime = timeNow

    return anotherTime.strftime(dateFormat)

Usage:

addDays = 3 #days
output_format = '%d-%m-%Y'
output = get_date(output_format, addDays)
print output

Force browser to refresh css, javascript, etc

<script src="foo.js?<?php echo date('YmdHis',filemtime('foo.js'));?>"></script>

It will refresh if modify.

Get HTML source of WebElement in Selenium WebDriver using Python

You can read the innerHTML attribute to get the source of the content of the element or outerHTML for the source with the current element.

Python:

element.get_attribute('innerHTML')

Java:

elem.getAttribute("innerHTML");

C#:

element.GetAttribute("innerHTML");

Ruby:

element.attribute("innerHTML")

JavaScript:

element.getAttribute('innerHTML');

PHP:

$element->getAttribute('innerHTML');

It was tested and worked with the ChromeDriver.

send bold & italic text on telegram bot with html

For italic you can use the 'i' tag, for bold try the 'b' tag

_x000D_
_x000D_
    <i> italic </i>_x000D_
    <b> bold </b>
_x000D_
_x000D_
_x000D_

Python equivalent of D3.js

I would suggest using mpld3 which combines D3js javascript visualizations with matplotlib of python.

The installation and usage is really simple and it has some cool plugins and interactive stuffs.

http://mpld3.github.io/

Show pop-ups the most elegant way

It's funny because I'm learning Angular myself and was watching some video's from their channel on Youtube. The speaker mentions your exact problem in this video https://www.youtube.com/watch?v=ZhfUv0spHCY#t=1681 around the 28:30 minute mark.

It comes down to placing that particular piece of code in a service rather then a controller.

My guess would be to inject new popup elements into the DOM and handle them separate instead of showing and hiding the same element. This way you can have multiple popups.

The whole video is very interesting to watch as well :-)

How is TeamViewer so fast?

The most fundamental thing here probably is that you don't want to transmit static images but only changes to the images, which essentially is analogous to video stream.

My best guess is some very efficient (and heavily specialized and optimized) motion compensation algorithm, because most of the actual change in generic desktop usage is linear movement of elements (scrolling text, moving windows, etc. opposed to transformation of elements).

The DirectX 3D performance of 1 FPS seems to confirm my guess to some extent.

What is a classpath and how do I set it?

Setting the CLASSPATH System Variable

To display the current CLASSPATH variable, use these commands in Windows and UNIX (Bourne shell): In Windows: C:\> set CLASSPATH In UNIX: % echo $CLASSPATH

To delete the current contents of the CLASSPATH variable, use these commands: In Windows: C:\> set CLASSPATH= In UNIX: % unset CLASSPATH; export CLASSPATH

To set the CLASSPATH variable, use these commands (for example): In Windows: C:\> set CLASSPATH=C:\users\george\java\classes In UNIX: % CLASSPATH=/home/george/java/classes; export CLASSPATH

Entity Framework vs LINQ to SQL

Is LINQ to SQL Truly Dead? by Jonathan Allen for InfoQ.com

Matt Warren describes [LINQ to SQL] as something that "was never even supposed to exist." Essentially, it was just supposed to be stand-in to help them develop LINQ until the real ORM was ready.

...

The scale of Entity Framework caused it to miss the .NET 3.5/Visual Studio 2008 deadline. It was completed in time for the unfortunately named ".NET 3.5 Service Pack 1", which was more like a major release than a service pack.

...

Developers do not like [ADO.NET Entity Framework] because of the complexity.

...

as of .NET 4.0, LINQ to Entities will be the recommended data access solution for LINQ to relational scenarios.

PHP: merge two arrays while keeping keys instead of reindexing?

While this question is quite old I just want to add another possibility of doing a merge while keeping keys.

Besides adding key/values to existing arrays using the + sign you could do an array_replace.

$a = array('foo' => 'bar', 'some' => 'string');
$b = array(42 => 'answer to the life and everything', 1337 => 'leet');

$merged = array_replace($a, $b);

The result will be:

Array
(
  [foo] => bar
  [some] => string
  [42] => answer to the life and everything
  [1337] => leet
)

Same keys will be overwritten by the latter array.
There is also an array_replace_recursive, which do this for subarrays, too.

Live example on 3v4l.org

Read file-contents into a string in C++

Here's an iterator-based method.

ifstream file("file", ios::binary);
string fileStr;

istreambuf_iterator<char> inputIt(file), emptyInputIt
back_insert_iterator<string> stringInsert(fileStr);

copy(inputIt, emptyInputIt, stringInsert);

How to remove element from an array in JavaScript?

For a more flexible solution, use the splice() function. It allows you to remove any item in an Array based on Index Value:

var indexToRemove = 0;
var numberToRemove = 1;

arr.splice(indexToRemove, numberToRemove);

How to correct indentation in IntelliJ

You can also try out ctrl + alt + I even though you can also use l as well.

Cannot load 64-bit SWT libraries on 32-bit JVM ( replacing SWT file )

i removed C:\ProgramData\Oracle\Java\javapath from my path, and it worked for me.

and make sure you include x64 JDK and JRE addresses in your path.

What is the best way to compare floats for almost-equality in Python?

I liked @Sesquipedal 's suggestion but with modification (a special use case when both values are 0 returns False). In my case I was on Python 2.7 and just used a simple function:

if f1 ==0 and f2 == 0:
    return True
else:
    return abs(f1-f2) < tol*max(abs(f1),abs(f2))

Create Test Class in IntelliJ

*IntelliJ 13 * (its paid for) We found you have to have the cursor in the actual class before ctrl+Shift+T worked.

Which seems a bit restrictive if its the only way to generate a test class. Although in retrospect it would force developers to create a test class when they write a functional class.

Get selected value of a dropdown's item using jQuery

$("#dropDownId").val('2');
var SelectedValue= $("#dropDownId option:selected").text();
$(".ParentClass .select-value").html(SelectedValue);


<p class="inline-large-label button-height ParentClass" >
     <label for="large-label-2" class="label">Country <span style="color: Red;">*</span><small></small></label>
     <asp:DropDownList runat="server" ID="dropDownId " CssClass="select" Width="200px">          
    </asp:DropDownList>
</p>

How can I set an SQL Server connection string?

You can use the connection string as follows and you only need to add your database name.

string connetionString = "Data Source=.;Initial Catalog=DB name;Integrated Security=True;MultipleActiveResultSets=True";

What are the differences between .so and .dylib on osx?

Just an observation I just made while building naive code on OSX with cmake:

cmake ... -DBUILD_SHARED_LIBS=OFF ...

creates .so files

while

cmake ... -DBUILD_SHARED_LIBS=ON ...

creates .dynlib files.

Perhaps this helps anyone.

Failed to start mongod.service: Unit mongod.service not found

$service mongodb start
$service mongodb status

the status is active when I started using above command

How do I output coloured text to a Linux terminal?

on OSX shell, this works for me (including 2 spaces in front of "red text"):

$ printf "\e[033;31m  red text\n"
$ echo "$(tput setaf 1)  red text"

How to add a line break within echo in PHP?

You may want to try \r\n for carriage return / line feed

Google Spreadsheet, Count IF contains a string

It will likely have been solved by now, but I ran accross this and figured to give my input

=COUNTIF(a2:a51;"*iPad*")

The important thing is that separating parameters in google docs is using a ; and not a ,

Installing Numpy on 64bit Windows 7 with Python 2.7.3

You may also try this, anaconda http://continuum.io/downloads

But you need to modify your environment variable PATH, so that the anaconda folder is before the original Python folder.

java.lang.RuntimeException: Can't create handler inside thread that has not called Looper.prepare();

runOnUiThread(new Runnable(){
   public void run() {
     Toast.makeText(getApplicationContext(), "Status = " + message.getBody() , Toast.LENGTH_LONG).show();
   }
 });

this works for me

How to do a SOAP Web Service call from Java class?

I understand your problem boils down to how to call a SOAP (JAX-WS) web service from Java and get its returning object. In that case, you have two possible approaches:

  1. Generate the Java classes through wsimport and use them; or
  2. Create a SOAP client that:
    1. Serializes the service's parameters to XML;
    2. Calls the web method through HTTP manipulation; and
    3. Parse the returning XML response back into an object.


About the first approach (using wsimport):

I see you already have the services' (entities or other) business classes, and it's a fact that the wsimport generates a whole new set of classes (that are somehow duplicates of the classes you already have).

I'm afraid, though, in this scenario, you can only either:

  • Adapt (edit) the wsimport generated code to make it use your business classes (this is difficult and somehow not worth it - bear in mind everytime the WSDL changes, you'll have to regenerate and readapt the code); or
  • Give up and use the wsimport generated classes. (In this solution, you business code could "use" the generated classes as a service from another architectural layer.)

About the second approach (create your custom SOAP client):

In order to implement the second approach, you'll have to:

  1. Make the call:
    • Use the SAAJ (SOAP with Attachments API for Java) framework (see below, it's shipped with Java SE 1.6 or above) to make the calls; or
    • You can also do it through java.net.HttpUrlconnection (and some java.io handling).
  2. Turn the objects into and back from XML:
    • Use an OXM (Object to XML Mapping) framework such as JAXB to serialize/deserialize the XML from/into objects
    • Or, if you must, manually create/parse the XML (this can be the best solution if the received object is only a little bit differente from the sent one).

Creating a SOAP client using classic java.net.HttpUrlConnection is not that hard (but not that simple either), and you can find in this link a very good starting code.

I recommend you use the SAAJ framework:

SOAP with Attachments API for Java (SAAJ) is mainly used for dealing directly with SOAP Request/Response messages which happens behind the scenes in any Web Service API. It allows the developers to directly send and receive soap messages instead of using JAX-WS.

See below a working example (run it!) of a SOAP web service call using SAAJ. It calls this web service.

import javax.xml.soap.*;

public class SOAPClientSAAJ {

    // SAAJ - SOAP Client Testing
    public static void main(String args[]) {
        /*
            The example below requests from the Web Service at:
             https://www.w3schools.com/xml/tempconvert.asmx?op=CelsiusToFahrenheit


            To call other WS, change the parameters below, which are:
             - the SOAP Endpoint URL (that is, where the service is responding from)
             - the SOAP Action

            Also change the contents of the method createSoapEnvelope() in this class. It constructs
             the inner part of the SOAP envelope that is actually sent.
         */
        String soapEndpointUrl = "https://www.w3schools.com/xml/tempconvert.asmx";
        String soapAction = "https://www.w3schools.com/xml/CelsiusToFahrenheit";

        callSoapWebService(soapEndpointUrl, soapAction);
    }

    private static void createSoapEnvelope(SOAPMessage soapMessage) throws SOAPException {
        SOAPPart soapPart = soapMessage.getSOAPPart();

        String myNamespace = "myNamespace";
        String myNamespaceURI = "https://www.w3schools.com/xml/";

        // SOAP Envelope
        SOAPEnvelope envelope = soapPart.getEnvelope();
        envelope.addNamespaceDeclaration(myNamespace, myNamespaceURI);

            /*
            Constructed SOAP Request Message:
            <SOAP-ENV:Envelope xmlns:SOAP-ENV="http://schemas.xmlsoap.org/soap/envelope/" xmlns:myNamespace="https://www.w3schools.com/xml/">
                <SOAP-ENV:Header/>
                <SOAP-ENV:Body>
                    <myNamespace:CelsiusToFahrenheit>
                        <myNamespace:Celsius>100</myNamespace:Celsius>
                    </myNamespace:CelsiusToFahrenheit>
                </SOAP-ENV:Body>
            </SOAP-ENV:Envelope>
            */

        // SOAP Body
        SOAPBody soapBody = envelope.getBody();
        SOAPElement soapBodyElem = soapBody.addChildElement("CelsiusToFahrenheit", myNamespace);
        SOAPElement soapBodyElem1 = soapBodyElem.addChildElement("Celsius", myNamespace);
        soapBodyElem1.addTextNode("100");
    }

    private static void callSoapWebService(String soapEndpointUrl, String soapAction) {
        try {
            // Create SOAP Connection
            SOAPConnectionFactory soapConnectionFactory = SOAPConnectionFactory.newInstance();
            SOAPConnection soapConnection = soapConnectionFactory.createConnection();

            // Send SOAP Message to SOAP Server
            SOAPMessage soapResponse = soapConnection.call(createSOAPRequest(soapAction), soapEndpointUrl);

            // Print the SOAP Response
            System.out.println("Response SOAP Message:");
            soapResponse.writeTo(System.out);
            System.out.println();

            soapConnection.close();
        } catch (Exception e) {
            System.err.println("\nError occurred while sending SOAP Request to Server!\nMake sure you have the correct endpoint URL and SOAPAction!\n");
            e.printStackTrace();
        }
    }

    private static SOAPMessage createSOAPRequest(String soapAction) throws Exception {
        MessageFactory messageFactory = MessageFactory.newInstance();
        SOAPMessage soapMessage = messageFactory.createMessage();

        createSoapEnvelope(soapMessage);

        MimeHeaders headers = soapMessage.getMimeHeaders();
        headers.addHeader("SOAPAction", soapAction);

        soapMessage.saveChanges();

        /* Print the request message, just for debugging purposes */
        System.out.println("Request SOAP Message:");
        soapMessage.writeTo(System.out);
        System.out.println("\n");

        return soapMessage;
    }

}

About using JAXB for serializing/deserializing, it is very easy to find information about it. You can start here: http://www.mkyong.com/java/jaxb-hello-world-example/.

jQuery Clone table row

Is very simple to clone the last row with jquery pressing a button:

Your Table HTML:

<table id="tableExample">
    <thead>
        <tr>
            <th>ID</th>
            <th>Header 1</th>
        </tr>
    </thead>
    <tbody>
        <tr>
            <td>1</td>
            <td>Line 1</td>
        </tr>
    </tbody>
    <tfoot>
        <tr>
            <td colspan="2"><button type="button" id="addRowButton">Add row</button></td>
        </tr>
    </tfoot>
</table>

JS:

$(document).on('click', '#addRowButton', function() {
    var table = $('#tableExample'),
        lastRow = table.find('tbody tr:last'),
        rowClone = lastRow.clone();

    table.find('tbody').append(rowClone);
});

Regards!

json.decoder.JSONDecodeError: Extra data: line 2 column 1 (char 190)

You have two records in your json file, and json.loads() is not able to decode more than one. You need to do it record by record.

See Python json.loads shows ValueError: Extra data

OR you need to reformat your json to contain an array:

{
    "foo" : [
       {"name": "XYZ", "address": "54.7168,94.0215", "country_of_residence": "PQR", "countries": "LMN;PQRST", "date": "28-AUG-2008", "type": null},
       {"name": "OLMS", "address": null, "country_of_residence": null, "countries": "Not identified;No", "date": "23-FEB-2017", "type": null}
    ]
}

would be acceptable again. But there cannot be several top level objects.

Find duplicate entries in a column

Try this query.. It uses the Analytic function SUM:

SELECT * FROM
(  
 SELECT SUM(1) OVER(PARTITION BY ctn_no) cnt, A.*
 FROM table1 a 
 WHERE s_ind ='Y'   
)
WHERE cnt > 2

Am not sure why you are identifying a record as a duplicate if the ctn_no repeats more than 2 times. FOr me it repeats more than once it is a duplicate. In this case change the las part of the query to WHERE cnt > 1

Javascript: How to generate formatted easy-to-read JSON straight from an object?

JSON.stringify takes more optional arguments.

Try:

 JSON.stringify({a:1,b:2,c:{d:1,e:[1,2]}}, null, 4); // Indented 4 spaces
 JSON.stringify({a:1,b:2,c:{d:1,e:[1,2]}}, null, "\t"); // Indented with tab

From:

How can I beautify JSON programmatically?

Should work in modern browsers, and it is included in json2.js if you need a fallback for browsers that don't support the JSON helper functions. For display purposes, put the output in a <pre> tag to get newlines to show.

How to create a list of objects?

I have some hacky answers that are likely to be terrible... but I have very little experience at this point.

a way:

class myClass():
    myInstances = []
    def __init__(self, myStr01, myStr02):
        self.myStr01 = myStr01
        self.myStr02 = myStr02
        self.__class__.myInstances.append(self)

myObj01 = myClass("Foo", "Bar")
myObj02 = myClass("FooBar",  "Baz")

for thisObj in myClass.myInstances:
    print(thisObj.myStr01)
    print(thisObj.myStr02)

A hack way to get this done:

import sys
class myClass():
    def __init__(self, myStr01, myStr02):
        self.myStr01 = myStr01
        self.myStr02 = myStr02

myObj01 = myClass("Foo", "Bar")
myObj02 = myClass("FooBar",  "Baz")

myInstances = []
myLocals = str(locals()).split("'")
thisStep = 0
for thisLocalsLine in myLocals:
    thisStep += 1
    if "myClass object at" in thisLocalsLine:
        print(thisLocalsLine)
        print(myLocals[(thisStep - 2)])
        #myInstances.append(myLocals[(thisStep - 2)])
        print(myInstances)
        myInstances.append(getattr(sys.modules[__name__], myLocals[(thisStep - 2)]))

for thisObj in myInstances:
    print(thisObj.myStr01)
    print(thisObj.myStr02)

Another more 'clever' hack:

import sys
class myClass():
    def __init__(self, myStr01, myStr02):
        self.myStr01 = myStr01
        self.myStr02 = myStr02

myInstances = []
myClasses = {
    "myObj01": ["Foo", "Bar"],
    "myObj02": ["FooBar",  "Baz"]
    }

for thisClass in myClasses.keys():
    exec("%s = myClass('%s', '%s')" % (thisClass, myClasses[thisClass][0], myClasses[thisClass][1]))
    myInstances.append(getattr(sys.modules[__name__], thisClass))

for thisObj in myInstances:
    print(thisObj.myStr01)
    print(thisObj.myStr02)

makefile execute another target

If you removed the make all line from your "fresh" target:

fresh :
    rm -f *.o $(EXEC)
    clear

You could simply run the command make fresh all, which will execute as make fresh; make all.

Some might consider this as a second instance of make, but it's certainly not a sub-instance of make (a make inside of a make), which is what your attempt seemed to result in.

onchange event for input type="number"

Because $("input[type='number']") doesn't work on IE, we should use a class name or id, for example, $('.input_quantity').

And don't use .bind() method. The .on() method is the preferred method for attaching event handlers to a document.

So, my version is:

HTML

<input type="number" value="5" step=".5" min="1" max="999" id="txt_quantity" name="txt_quantity" class="input_quantity">

jQuery

<script>
$(document).ready(function(){
    $('.input_quantity').on('change keyup', function() {
        console.log('nice');
    }); 
});
</script>

Twitter bootstrap scrollable modal

Your modal is being hidden in firefox, and that is because of the negative margin declaration you have inside your general stylesheet:

.modal {
    margin-top: -45%; /* remove this */
    max-height: 90%;
    overflow-y: auto;
}

Remove the negative margin and everything works just fine.

How to mention C:\Program Files in batchfile

use this as somethink

"C:/Program Files (x86)/Nox/bin/nox_adb" install -r app.apk

where

"path_to_executable" commands_argument

insert/delete/update trigger in SQL server

I agree with @Vishnu's answer. I would like to add that if you want to use the application user in your trigger you can use "context_info" to pass the info to the trigger.

I found following very helpful in doing that: http://jasondentler.com/blog/2010/01/exploiting-context_info-for-fun-and-audit

Debugging with command-line parameters in Visual Studio

Microsoft Visual Studio Ultima 2013.

You can just go to the DEBUG menu ? Main Properties ? Configuration properties ? Debugging and then you will see the box for the command line arguments.

Actually, you can set the same input arguments for all the different configurations and not only for debugging.

From the pull down menu of configuration select: All Configurations and insert the input arguments (each argument separated by space).

Now, you can execute your program in different modes without having to change the input arguments every time.

Anaconda-Navigator - Ubuntu16.04

I am running Anaconda Navigator on Kubuntu 17.04 & getting a successful launch of the navigator window. Not knowing any of your error messages or statement; you could try reinstalling with command: conda install -c anaconda anaconda-navigator

How do I debug error ECONNRESET in Node.js?

I had the same issue and it appears that the Node.js version was the problem.

I installed the previous version of Node.js (10.14.2) and everything was ok using nvm (allow you to install several version of Node.js and quickly switch from a version to another).

It is not a "clean" solution, but it can serve you temporarly.

Find unique rows in numpy.array

None of these answers worked for me. I'm assuming as my unique rows contained strings and not numbers. However this answer from another thread did work:

Source: https://stackoverflow.com/a/38461043/5402386

You can use .count() and .index() list's methods

coor = np.array([[10, 10], [12, 9], [10, 5], [12, 9]])
coor_tuple = [tuple(x) for x in coor]
unique_coor = sorted(set(coor_tuple), key=lambda x: coor_tuple.index(x))
unique_count = [coor_tuple.count(x) for x in unique_coor]
unique_index = [coor_tuple.index(x) for x in unique_coor]

Returning IEnumerable<T> vs. IQueryable<T>

A lot has been said previously, but back to the roots, in a more technical way:

  1. IEnumerable is a collection of objects in memory that you can enumerate - an in-memory sequence that makes it possible to iterate through (makes it way easy for within foreach loop, though you can go with IEnumerator only). They reside in the memory as is.
  2. IQueryable is an expression tree that will get translated into something else at some point with ability to enumerate over the final outcome. I guess this is what confuses most people.

They obviously have different connotations.

IQueryable represents an expression tree (a query, simply) that will be translated to something else by the underlying query provider as soon as release APIs are called, like LINQ aggregate functions (Sum, Count, etc.) or ToList[Array, Dictionary,...]. And IQueryable objects also implement IEnumerable, IEnumerable<T> so that if they represent a query the result of that query could be iterated. It means IQueryable don't have to be queries only. The right term is they are expression trees.

Now how those expressions are executed and what they turn to is all up to so called query providers (expression executors we can think them of).

In the Entity Framework world (which is that mystical underlying data source provider, or the query provider) IQueryable expressions are translated into native T-SQL queries. Nhibernate does similar things with them. You can write your own one following the concepts pretty well described in LINQ: Building an IQueryable Provider link, for example, and you might want to have a custom querying API for your product store provider service.

So basically, IQueryable objects are getting constructed all the way long until we explicitly release them and tell the system to rewrite them into SQL or whatever and send down the execution chain for onward processing.

As if to deferred execution it's a LINQ feature to hold up the expression tree scheme in the memory and send it into the execution only on demand, whenever certain APIs are called against the sequence (the same Count, ToList, etc.).

The proper usage of both heavily depends on the tasks you're facing for the specific case. For the well-known repository pattern I personally opt for returning IList, that is IEnumerable over Lists (indexers and the like). So it is my advice to use IQueryable only within repositories and IEnumerable anywhere else in the code. Not saying about the testability concerns that IQueryable breaks down and ruins the separation of concerns principle. If you return an expression from within repositories consumers may play with the persistence layer as they would wish.

A little addition to the mess :) (from a discussion in the comments)) None of them are objects in memory since they're not real types per se, they're markers of a type - if you want to go that deep. But it makes sense (and that's why even MSDN put it this way) to think of IEnumerables as in-memory collections whereas IQueryables as expression trees. The point is that the IQueryable interface inherits the IEnumerable interface so that if it represents a query, the results of that query can be enumerated. Enumeration causes the expression tree associated with an IQueryable object to be executed. So, in fact, you can't really call any IEnumerable member without having the object in the memory. It will get in there if you do, anyways, if it's not empty. IQueryables are just queries, not the data.

List of ANSI color escape sequences

The ANSI escape sequences you're looking for are the Select Graphic Rendition subset. All of these have the form

\033[XXXm

where XXX is a series of semicolon-separated parameters.

To say, make text red, bold, and underlined (we'll discuss many other options below) in C you might write:

printf("\033[31;1;4mHello\033[0m");

In C++ you'd use

std::cout<<"\033[31;1;4mHello\033[0m";

In Python3 you'd use

print("\033[31;1;4mHello\033[0m")

and in Bash you'd use

echo -e "\033[31;1;4mHello\033[0m"

where the first part makes the text red (31), bold (1), underlined (4) and the last part clears all this (0).

As described in the table below, there are a large number of text properties you can set, such as boldness, font, underlining, &c. (Isn't it silly that StackOverflow doesn't allow you to put proper tables in answers?)

Font Effects

Code Effect Note
0 Reset / Normal all attributes off
1 Bold or increased intensity
2 Faint (decreased intensity) Not widely supported.
3 Italic Not widely supported. Sometimes treated as inverse.
4 Underline
5 Slow Blink less than 150 per minute
6 Rapid Blink MS-DOS ANSI.SYS; 150+ per minute; not widely supported
7 [[reverse video]] swap foreground and background colors
8 Conceal Not widely supported.
9 Crossed-out Characters legible, but marked for deletion. Not widely supported.
10 Primary(default) font
11–19 Alternate font Select alternate font n-10
20 Fraktur hardly ever supported
21 Bold off or Double Underline Bold off not widely supported; double underline hardly ever supported.
22 Normal color or intensity Neither bold nor faint
23 Not italic, not Fraktur
24 Underline off Not singly or doubly underlined
25 Blink off
27 Inverse off
28 Reveal conceal off
29 Not crossed out
30–37 Set foreground color See color table below
38 Set foreground color Next arguments are 5;<n> or 2;<r>;<g>;<b>, see below
39 Default foreground color implementation defined (according to standard)
40–47 Set background color See color table below
48 Set background color Next arguments are 5;<n> or 2;<r>;<g>;<b>, see below
49 Default background color implementation defined (according to standard)
51 Framed
52 Encircled
53 Overlined
54 Not framed or encircled
55 Not overlined
60 ideogram underline hardly ever supported
61 ideogram double underline hardly ever supported
62 ideogram overline hardly ever supported
63 ideogram double overline hardly ever supported
64 ideogram stress marking hardly ever supported
65 ideogram attributes off reset the effects of all of 60-64
90–97 Set bright foreground color aixterm (not in standard)
100–107 Set bright background color aixterm (not in standard)

2-bit Colours

You've got this already!

4-bit Colours

The standards implementing terminal colours began with limited (4-bit) options. The table below lists the RGB values of the background and foreground colours used for these by a variety of terminal emulators:

Table of ANSI colours implemented by various terminal emulators

Using the above, you can make red text on a green background (but why?) using:

\033[31;42m

11 Colours (An Interlude)

In their book "Basic Color Terms: Their Universality and Evolution", Brent Berlin and Paul Kay used data collected from twenty different languages from a range of language families to identify eleven possible basic color categories: white, black, red, green, yellow, blue, brown, purple, pink, orange, and gray.

Berlin and Kay found that, in languages with fewer than the maximum eleven color categories, the colors followed a specific evolutionary pattern. This pattern is as follows:

  1. All languages contain terms for black (cool colours) and white (bright colours).
  2. If a language contains three terms, then it contains a term for red.
  3. If a language contains four terms, then it contains a term for either green or yellow (but not both).
  4. If a language contains five terms, then it contains terms for both green and yellow.
  5. If a language contains six terms, then it contains a term for blue.
  6. If a language contains seven terms, then it contains a term for brown.
  7. If a language contains eight or more terms, then it contains terms for purple, pink, orange or gray.

This may be why story Beowulf only contains the colours black, white, and red. It may also be why the Bible does not contain the colour blue. Homer's Odyssey contains black almost 200 times and white about 100 times. Red appears 15 times, while yellow and green appear only 10 times. (More information here)

Differences between languages are also interesting: note the profusion of distinct colour words used by English vs. Chinese. However, digging deeper into these languages shows that each uses colour in distinct ways. (More information)

Chinese vs English colour names. Image adapted from "muyueh.com"

Generally speaking, the naming, use, and grouping of colours in human languages is fascinating. Now, back to the show.

8-bit (256) colours

Technology advanced, and tables of 256 pre-selected colours became available, as shown below.

256-bit colour mode for ANSI escape sequences

Using these above, you can make pink text like so:

\033[38;5;206m     #That is, \033[38;5;<FG COLOR>m

And make an early-morning blue background using

\033[48;5;57m      #That is, \033[48;5;<BG COLOR>m

And, of course, you can combine these:

\033[38;5;206;48;5;57m

The 8-bit colours are arranged like so:

0x00-0x07:  standard colors (same as the 4-bit colours)
0x08-0x0F:  high intensity colors
0x10-0xE7:  6 × 6 × 6 cube (216 colors): 16 + 36 × r + 6 × g + b (0 = r, g, b = 5)
0xE8-0xFF:  grayscale from black to white in 24 steps

ALL THE COLOURS

Now we are living in the future, and the full RGB spectrum is available using:

\033[38;2;<r>;<g>;<b>m     #Select RGB foreground color
\033[48;2;<r>;<g>;<b>m     #Select RGB background color

So you can put pinkish text on a brownish background using

\033[38;2;255;82;197;48;2;155;106;0mHello

Support for "true color" terminals is listed here.

Much of the above is drawn from the Wikipedia page "ANSI escape code".

A Handy Script to Remind Yourself

Since I'm often in the position of trying to remember what colours are what, I have a handy script called: ~/bin/ansi_colours:

#!/usr/bin/python

print "\\033[XXm"

for i in range(30,37+1):
    print "\033[%dm%d\t\t\033[%dm%d" % (i,i,i+60,i+60);

print "\033[39m\\033[39m - Reset colour"
print "\\033[2K - Clear Line"
print "\\033[<L>;<C>H OR \\033[<L>;<C>f puts the cursor at line L and column C."
print "\\033[<N>A Move the cursor up N lines"
print "\\033[<N>B Move the cursor down N lines"
print "\\033[<N>C Move the cursor forward N columns"
print "\\033[<N>D Move the cursor backward N columns"
print "\\033[2J Clear the screen, move to (0,0)"
print "\\033[K Erase to end of line"
print "\\033[s Save cursor position"
print "\\033[u Restore cursor position"
print " "
print "\\033[4m  Underline on"
print "\\033[24m Underline off"
print "\\033[1m  Bold on"
print "\\033[21m Bold off"

This prints

Simple ANSI colours

Application.WorksheetFunction.Match method

You are getting this error because the value cannot be found in the range. String or integer doesn't matter. Best thing to do in my experience is to do a check first to see if the value exists.

I used CountIf below, but there is lots of different ways to check existence of a value in a range.

Public Sub test()

Dim rng As Range
Dim aNumber As Long

aNumber = 666

Set rng = Sheet5.Range("B16:B615")

    If Application.WorksheetFunction.CountIf(rng, aNumber) > 0 Then

        rowNum = Application.WorksheetFunction.Match(aNumber, rng, 0)

    Else
        MsgBox aNumber & " does not exist in range " & rng.Address
    End If

End Sub

ALTERNATIVE WAY

Public Sub test()
    Dim rng As Range
    Dim aNumber As Variant
    Dim rowNum As Long

    aNumber = "2gg"

    Set rng = Sheet5.Range("B1:B20")

    If Not IsError(Application.Match(aNumber, rng, 0)) Then
        rowNum = Application.Match(aNumber, rng, 0)
        MsgBox rowNum
    Else
        MsgBox "error"
    End If
End Sub

OR

Public Sub test()
    Dim rng As Range
    Dim aNumber As Variant
    Dim rowNum As Variant

    aNumber = "2gg"

    Set rng = Sheet5.Range("B1:B20")

    rowNum = Application.Match(aNumber, rng, 0)

    If Not IsError(rowNum) Then
        MsgBox rowNum
    Else
        MsgBox "error"
    End If
End Sub

jquery <a> tag click event

<a href="javascript:void(0)" class="aaf" id="users_id">add as a friend</a>

on jquery

$('.aaf').on("click",function(){
  var usersid =  $(this).attr("id");
  //post code
})

//other method is to use the data attribute

<a href="javascript:void(0)" class="aaf" data-id="102" data-username="sample_username">add as a friend</a>

on jquery

$('.aaf').on("click",function(){
    var usersid =  $(this).data("id");
    var username = $(this).data("username");
})

Showing percentages above bars on Excel column graph

Either

  1. Use a line series to show the %
  2. Update the data labels above the bars to link back directly to other cells

Method 2 by step

  • add data-lables
  • right-click the data lable
  • goto the edit bar and type in a refence to a cell (C4 in this example)
  • this changes the data lable from the defulat value (2000) to a linked cell with the 15%

enter image description here

JSON Java 8 LocalDateTime format in Spring Boot

simply use:

@JsonFormat(pattern="10/04/2019")

or you can use pattern as you like for e.g: ('-' in place of '/')

How to beautify JSON in Python?

The cli command I've used with python for this is:

cat myfile.json | python -mjson.tool

You should be able to find more info here:

http://docs.python.org/library/json.html

What is the difference between vmalloc and kmalloc?

One of other differences is kmalloc will return logical address (else you specify GPF_HIGHMEM). Logical addresses are placed in "low memory" (in the first gigabyte of physical memory) and are mapped directly to physical addresses (use __pa macro to convert it). This property implies kmalloced memory is continuous memory.

In other hand, Vmalloc is able to return virtual addresses from "high memory". These addresses cannot be converted in physical addresses in a direct fashion (you have to use virt_to_page function).

ASP.NET IIS Web.config [Internal Server Error]

I had a problem with runAllManagedModulesForAllRequests, code 0x80070021 and http error 500.19 and managed to solve it

With command prompt launched as Admnistrator, go to : C:\Windows\Microsoft.NET\Framework64\v4.0.30319>

execute

aspnet_regiis -i

bingo!

.htaccess: Invalid command 'RewriteEngine', perhaps misspelled or defined by a module not included in the server configuration

or defined by a module not included in the server configuration

Check to make sure you have mod_rewrite enabled.

From: https://webdevdoor.com/php/mod_rewrite-windows-apache-url-rewriting

  1. Find the httpd.conf file (usually you will find it in a folder called conf, config or something along those lines)
  2. Inside the httpd.conf file uncomment the line LoadModule rewrite_module modules/mod_rewrite.so (remove the pound '#' sign from in front of the line)
  3. Also find the line ClearModuleList is uncommented then find and make sure that the line AddModule mod_rewrite.c is not commented out.

If the LoadModule rewrite_module modules/mod_rewrite.so line is missing from the httpd.conf file entirely, just add it.

Sample command

To enable the module in a standard ubuntu do this:

a2enmod rewrite
systemctl restart apache2

MongoDB logging all queries

db.setProfilingLevel(2,-1)

This worked! it logged all query info in mongod log file

How do I loop through a date range?

DateTime begindate = Convert.ToDateTime("01/Jan/2018");
DateTime enddate = Convert.ToDateTime("12 Feb 2018");
 while (begindate < enddate)
 {
    begindate= begindate.AddDays(1);
    Console.WriteLine(begindate + "  " + enddate);
 }

How can I get phone serial number (IMEI)

try this

 final TelephonyManager tm =(TelephonyManager)getBaseContext().getSystemService(Context.TELEPHONY_SERVICE);

  String deviceid = tm.getDeviceId();

how to hide the content of the div in css

#mybox:hover { display: none; }
#mybox:hover { visibility: hidden; }
#mybox:hover { background: none; }
#mybox:hover { color: green; }

though it should be noted that IE6 and below wont listen to the hover when it's not on an A tag. For that you have to incorporate JavaScript to add a class to the div during the hover.

How can I read Chrome Cache files?

The JPEXS Free Flash Decompiler has Java code to do this at in the source tree for both Chrome and Firefox (no support for Firefox's more recent cache2 though).

What's the best way to get the current URL in Spring MVC?

If you need the URL till hostname and not the path use Apache's Common Lib StringUtil, and from URL extract the substring till third indexOf /.

public static String getURL(HttpServletRequest request){
   String fullURL = request.getRequestURL().toString();
   return fullURL.substring(0,StringUtils.ordinalIndexOf(fullURL, "/", 3)); 
}

Example: If fullURL is https://example.com/path/after/url/ then Output will be https://example.com

How to set margin of ImageView using code, not xml

All the above examples will actually REPLACE any params already present for the View, which may not be desired. The below code will just extend the existing params, without replacing them:

ImageView myImage = (ImageView) findViewById(R.id.image_view);
MarginLayoutParams marginParams = (MarginLayoutParams) image.getLayoutParams();
marginParams.setMargins(left, top, right, bottom);

ArrayList of int array in java

The setup:

    List<int[]> intArrays=new ArrayList<>();
    int anExample[]={1,2,3};
    intArrays.add(anExample);

To retrieve a single int[] array in the ArrayList by index:

    int[] anIntArray = intArrays.get(0); //'0' is the index
    //iterate the retrieved array an print the individual elements
    for (int aNumber : anIntArray ) { 
        System.out.println("Arraylist contains:" + aNumber );
    }

To retrieve all int[] arrays in the ArrayList:

    //iterate the ArrayList, get and print the elements of each int[] array  
    for(int[] anIntArray:intArrays) {
       //iterate the retrieved array an print the individual elements
       for (int aNumber : anIntArray) {
           System.out.println("Arraylist contains:" + aNumber);
       }
}

Output formatting can be performed based on this logic. Goodluck!!

Rails :include vs. :joins

In addition to a performance considerations, there's a functional difference too. When you join comments, you are asking for posts that have comments- an inner join by default. When you include comments, you are asking for all posts- an outer join.

Add number of days to a date

//Set time zone
date_default_timezone_set("asia/kolkata");
$pastdate='2016-07-20';
$addYear=1;
$addMonth=3;
$addWeek=2;
$addDays=5;
$newdate=date('Y-m-d', strtotime($pastdate.' +'.$addYear.' years +'.$addMonth. ' months +'.$addWeek.' weeks +'.$addDays.' days'));
echo $newdate;

"No cached version... available for offline mode."

Just happened to me after upgrading to Android Studio 3.1. The Offline Work checkbox was unchecked, so no luck there.

I went to Settings > Build, Execution, Deployment > Compiler and the Command-line Options textfield contained --offline, so I just deleted that and everything worked.

setting screenshot

Python: How to check a string for substrings from a list?

Try this test:

any(substring in string for substring in substring_list)

It will return True if any of the substrings in substring_list is contained in string.

Note that there is a Python analogue of Marc Gravell's answer in the linked question:

from itertools import imap
any(imap(string.__contains__, substring_list)) 

In Python 3, you can use map directly instead:

any(map(string.__contains__, substring_list))

Probably the above version using a generator expression is more clear though.

Twitter Bootstrap Form File Element Upload Button

Im surprised there was no mention of the <label> element.

Solution:

<label class="btn btn-primary" for="my-file-selector">
    <input id="my-file-selector" type="file" class="d-none">
    Button Text Here
</label>

No need for any JS, or funky css...

Solution for including the filename:

<label class="btn btn-primary" for="my-file-selector">
    <input id="my-file-selector" type="file" style="display:none" 
    onchange="$('#upload-file-info').text(this.files[0].name)">
    Button Text Here
</label>
<span class='label label-info' id="upload-file-info"></span>

The solution above requires jQuery.

Note: use $.text() when displaying user-supplied content on the page. An earlier version of this answer used $.html() which is not safe – filenames can contain HTML markup.

round up to 2 decimal places in java?

seems like you are hit by integer arithmetic: in some languages (int)/(int) will always be evaluated as integer arithmetic. in order to force floating-point arithmetic, make sure that at least one of the operands is non-integer:

double roundOff = Math.round(a*100)/100.f;

Get the index of a certain value in an array in PHP

Other folks have suggested array_search() which gives the key of the array element where the value is found. You can ensure that the array keys are contiguous integers by using array_values():

$list = array(0=>'string1', 'foo'=>'string2', 42=>'string3');
$index = array_search('string2', array_values($list));
print "$index\n";

// result: 1

You said in your question that array_search() was no use. Can you explain why? What did you try and how did it not meet your needs?

Get DOS path instead of Windows path

if via a batch file use:

set SHORT_DIR=%~dsp0%

you can use the echo command to check:

echo %SHORT_DIR%

How can I execute Shell script in Jenkinsfile?

Based on the number of views this question has, it looks like a lot of people are visiting this to see how to set up a job that executes a shell script.

These are the steps to execute a shell script in Jenkins:

  • In the main page of Jenkins select New Item.
  • Enter an item name like "my shell script job" and chose Freestyle project. Press OK.
  • On the configuration page, in the Build block click in the Add build step dropdown and select Execute shell.
  • In the textarea you can either paste a script or indicate how to run an existing script. So you can either say:

    #!/bin/bash
    
    echo "hello, today is $(date)" > /tmp/jenkins_test
    

    or just

    /path/to/your/script.sh
    
  • Click Save.

Now the newly created job should appear in the main page of Jenkins, together with the other ones. Open it and select Build now to see if it works. Once it has finished pick that specific build from the build history and read the Console output to see if everything happened as desired.

You can get more details in the document Create a Jenkins shell script job in GitHub.

Allow a div to cover the whole page instead of the area within the container

Add position:fixed. Then the cover is fixed over the whole screen, also when you scroll.
And add maybe also margin: 0; padding:0; so it wont have some space's around the cover.

#dimScreen
{
    position:fixed;
    padding:0;
    margin:0;

    top:0;
    left:0;

    width: 100%;
    height: 100%;
    background:rgba(255,255,255,0.5);
}

And if it shouldn't stick on the screen fixed, use position:absolute;

CSS Tricks have also an interesting article about fullscreen property.

Edit:
Just came across this answer, so I wanted to add some additional things.
Like Daniel Allen Langdon mentioned in the comment, add top:0; left:0; to be sure, the cover sticks on the very top and left of the screen.

If you some elements are at the top of the cover (so it doesn't cover everything), then add z-index. The higher the number, the more levels it covers.

Is it possible to have multiple styles inside a TextView?

The list of supported tags is:

If you use a string resource, you can add some simple styling, such as bold or italic using HTML notation. The currently supported tags are: B (bold), I (italic), U (underline), TT (monospace), BIG, SMALL, SUP (superscript), SUB (subscript), and STRIKE (strikethrough). So, for example, in res/values/strings.xml you could declare this:

<resource>
    <string id="@+id/styled_welcome_message">We are <b><i>so</i></b> glad to see you.</string>
</resources>

(From http://developer.android.com/guide/faq/commontasks.html#selectingtext — Web Archive link, <resource> typo is in original!)

It also shows that Html.fromHtml isn't really needed in simple cases.

Missing artifact com.sun:tools:jar

As other posters have stated the issue here has to do with the JRE that eclipse is using not being able to find the tools jar. I solved the issue by going in a bit of a different direction than what was stated above, and it was because of the way that my projects and environment.

Eclipse 4.5 requires at least Java 7 for runtime, so I've got my system setup to use a Java 8 JRE located at C:\java\jre1.8.0_45.

Next, I'm using a POM file that assumes that I'm running with a Java 6 JDK.

  <profiles>
    <profile>
      <id>default-profile</id>
      <activation>
        <activeByDefault>true</activeByDefault>
        <file>
          <exists>${java.home}/../lib/tools.jar</exists>
        </file>
      </activation>
      <properties>
        <toolsjar>${java.home}/../lib/tools.jar</toolsjar>
      </properties>
    </profile>
    <profile>
      <id>osx_profile</id>
      <activation>
        <activeByDefault>false</activeByDefault>
        <os>
          <family>mac</family>
        </os>
      </activation>
      <properties>
        <toolsjar>${java.home}/../Classes/classes.jar</toolsjar>
      </properties>
    </profile>
  </profiles>

  <dependencies>
    <dependency>
      <groupId>com.sun</groupId>
      <artifactId>tools</artifactId>
      <version>1.6.0</version>
      <scope>system</scope>
      <systemPath>${toolsjar}</systemPath>
    </dependency>
  </dependencies>

I'm not allowed to change the POM file, so I had to do some jiggery pokery. I copied the tools.jar from my Java 6 JDK, created the directory C:\java\lib and pasted it there. I then restarted eclipse and cleaned my project. And VOILA errors are gone.

It's not an elegant solution, and I would think that the proper solution would be to change the way the POM is setup, but as I was not able to, this works.

Python sockets error TypeError: a bytes-like object is required, not 'str' with send function

An alternative solution is to introduce a method to the file instance that would do the explicit conversion.

import types

def _write_str(self, ascii_str):
    self.write(ascii_str.encode('ascii'))

source_file = open("myfile.bin", "wb")
source_file.write_str = types.MethodType(_write_str, source_file)

And then you can use it as source_file.write_str("Hello World").

Gradle's dependency cache may be corrupt (this sometimes occurs after a network connection timeout.)

If you using Ubuntu, So firstly you have unhide all files from your home directory or where located your android studio folder :

  1. Go to your home directory and unhide all files by using ctrl+h
  2. You found .gradle folder
  3. Inside .gradle -> wrapper
  4. You can found dists folder, So delete this dists folder
  5. Create a New Project than your Gradle file re-downloaded
  6. Congo you successfully build project

How to style icon color, size, and shadow of Font Awesome Icons

I had the same problem when I tried to use the icons directly from BootstrapCDN (the easiest way). Then I downloaded the CSS file and copied it to my site's CSS folder the CSS file (Described under the 'easy way' in font awesome documentation), and everything started working as they should.

Can regular JavaScript be mixed with jQuery?

You can, but be aware of the return types with jQuery functions. jQuery won't always use the exact same JavaScript object type, although generally they will return subclasses of what you would expect to be returned from a similar JavaScript function.

Deserialize JSON array(or list) in C#

This code works for me:

using System;
using System.Collections.Generic;
using System.Linq;
using System.Text;
using System.Web.Script.Serialization;

namespace Json
{
    class Program
    {
        static void Main(string[] args)
        {
            Console.WriteLine(DeserializeNames());
            Console.ReadLine();
        }

        public static string DeserializeNames()
        {
            var jsonData = "{\"name\":[{\"last\":\"Smith\"},{\"last\":\"Doe\"}]}";

            JavaScriptSerializer ser = new JavaScriptSerializer();

            nameList myNames = ser.Deserialize<nameList>(jsonData);

            return ser.Serialize(myNames);
        }

        //Class descriptions

        public class name
        {
            public string last { get; set; }
        }

        public class nameList
        {
            public List<name> name { get; set; }
        }
    }
}

How to fix warning from date() in PHP"

You need to set the default timezone smth like this :

date_default_timezone_set('Europe/Bucharest');

More info about this in http://php.net/manual/en/function.date-default-timezone-set.php

Or you could use @ in front of date to suppress the warning however as the warning states it's not safe to rely on the servers default timezone

How to take off line numbers in Vi?

For turning off line numbers, any of these commands will work:

  1. :set nu!
  2. :set nonu
  3. :set number!
  4. :set nonumber

All inclusive Charset to avoid "java.nio.charset.MalformedInputException: Input length = 1"?

ISO_8859_1 Worked for me! I was reading text file with comma separated values

What do &lt; and &gt; stand for?

Others have noted the correct answer, but have not clearly explained the all-important reason:

  • why do we need this?

What do < and > stand for?

  • &lt; stands for the < sign. Just remember: lt == less than
  • &gt; stands for the > Just remember: gt == greater than

Why can’t we simply use the < and > characters in HTML?

  • This is because the > and < characters are ‘reserved’ characters in HTML.
  • HTML is a mark up language: The < and > are used to denote the starting and ending of different elements: e.g. <h1> and not for the displaying of the greater than or less than symbols. But what if you wanted to actually display those symbols? You would simply use &lt; and &gt; and the browser will know exactly how to display it.

In Unix, how do you remove everything in the current directory and below it?

This simplest safe & general solution is probably:

find -mindepth 1 -maxdepth 1 -print0 | xargs -0 rm -rf

Manifest Merger failed with multiple errors in Android Studio

In my case i was using some annotations from jetbrains library. I removed those annotations and dependencies and it worked fine.

So please check the libraries in android code and dependencies carefully.

Tkinter understanding mainloop

I'm using an MVC / MVA design pattern, with multiple types of "views". One type is a "GuiView", which is a Tk window. I pass a view reference to my window object which does things like link buttons back to view functions (which the adapter / controller class also calls).

In order to do that, the view object constructor needed to be completed prior to creating the window object. After creating and displaying the window, I wanted to do some initial tasks with the view automatically. At first I tried doing them post mainloop(), but that didn't work because mainloop() blocked!

As such, I created the window object and used tk.update() to draw it. Then, I kicked off my initial tasks, and finally started the mainloop.

import Tkinter as tk

class Window(tk.Frame):
    def __init__(self, master=None, view=None ):
        tk.Frame.__init__( self, master )
        self.view_ = view       
        """ Setup window linking it to the view... """

class GuiView( MyViewSuperClass ):

    def open( self ):
        self.tkRoot_ = tk.Tk()
        self.window_ = Window( master=None, view=self )
        self.window_.pack()
        self.refresh()
        self.onOpen()
        self.tkRoot_.mainloop()         

    def onOpen( self ):        
        """ Do some initial tasks... """

    def refresh( self ):        
        self.tkRoot_.update()

Android: install .apk programmatically

For ICS I´ve implemented your code and made a class that extends AsyncTask. I hope you appreciate it! Thanks for your code and solution.

public class UpdateApp extends AsyncTask<String,Void,Void>{
    private Context context;
    public void setContext(Context contextf){
        context = contextf;
    }

    @Override
    protected Void doInBackground(String... arg0) {
        try {
            URL url = new URL(arg0[0]);
            HttpURLConnection c = (HttpURLConnection) url.openConnection();
            c.setRequestMethod("GET");
            c.setDoOutput(true);
            c.connect();

            String PATH = "/mnt/sdcard/Download/";
            File file = new File(PATH);
            file.mkdirs();
            File outputFile = new File(file, "update.apk");
            if(outputFile.exists()){
                outputFile.delete();
            }
            FileOutputStream fos = new FileOutputStream(outputFile);

            InputStream is = c.getInputStream();

            byte[] buffer = new byte[1024];
            int len1 = 0;
            while ((len1 = is.read(buffer)) != -1) {
                fos.write(buffer, 0, len1);
            }
            fos.close();
            is.close();

            Intent intent = new Intent(Intent.ACTION_VIEW);
            intent.setDataAndType(Uri.fromFile(new File("/mnt/sdcard/Download/update.apk")), "application/vnd.android.package-archive");
            intent.setFlags(Intent.FLAG_ACTIVITY_NEW_TASK); // without this flag android returned a intent error!
            context.startActivity(intent);


        } catch (Exception e) {
            Log.e("UpdateAPP", "Update error! " + e.getMessage());
        }
        return null;
    }
}   

To use it, in your main activity call by this way:

atualizaApp = new UpdateApp();
atualizaApp.setContext(getApplicationContext());
atualizaApp.execute("http://serverurl/appfile.apk");

How to stop asynctask thread in android?

declare your asyncTask in your activity:

private YourAsyncTask mTask;

instantiate it like this:

mTask = new YourAsyncTask().execute();

kill/cancel it like this:

mTask.cancel(true);

How to find the index of an element in an int array?

/**
     * Method to get the index of the given item from the list
     * @param stringArray
     * @param name
     * @return index of the item if item exists else return -1
     */
    public static int getIndexOfItemInArray(String[] stringArray, String name) {
        if (stringArray != null && stringArray.length > 0) {
            ArrayList<String> list = new ArrayList<String>(Arrays.asList(stringArray));
            int index = list.indexOf(name);
            list.clear();
            return index;
        }
        return -1;
    }

How to pass a form input value into a JavaScript function

There are several ways to approach this. Personally, I would avoid in-line scripting. Since you've tagged jQuery, let's use that.

HTML:

<form>
    <input type="text" id="formValueId" name="valueId"/>
    <input type="button" id="myButton" />
</form>

JavaScript:

$(document).ready(function() {
    $('#myButton').click(function() {
      foo($('#formValueId').val());
    });
});

Using external images for CSS custom cursors

Originally from a Codepen pen by Chris Coyier of Codepen/CSS-Tricks

_x000D_
_x000D_
.auto            { cursor: auto; }
.default         { cursor: default; }
.none            { cursor: none; }
.context-menu    { cursor: context-menu; }
.help            { cursor: help; }
.pointer         { cursor: pointer; }
.progress        { cursor: progress; }
.wait            { cursor: wait; }
.cell            { cursor: cell; }
.crosshair       { cursor: crosshair; }
.text            { cursor: text; }
.vertical-text   { cursor: vertical-text; }
.alias           { cursor: alias; }
.copy            { cursor: copy; }
.move            { cursor: move; }
.no-drop         { cursor: no-drop; }
.not-allowed     { cursor: not-allowed; }
.all-scroll      { cursor: all-scroll; }
.col-resize      { cursor: col-resize; }
.row-resize      { cursor: row-resize; }
.n-resize        { cursor: n-resize; }
.e-resize        { cursor: e-resize; }
.s-resize        { cursor: s-resize; }
.w-resize        { cursor: w-resize; }
.ns-resize       { cursor: ns-resize; }
.ew-resize       { cursor: ew-resize; }
.ne-resize       { cursor: ne-resize; }
.nw-resize       { cursor: nw-resize; }
.se-resize       { cursor: se-resize; }
.sw-resize       { cursor: sw-resize; }
.nesw-resize     { cursor: nesw-resize; }
.nwse-resize     { cursor: nwse-resize; }

body {
  text-align: center;
font-family: -apple-system, BlinkMacSystemFont, "Segoe UI", Roboto, Helvetica, Arial, sans-serif, "Apple Color Emoji", "Segoe UI Emoji", "Segoe UI Symbol";

}
.cursors {
  display: flex;
  flex-wrap: wrap;
}
.cursors > div {
  flex: 150px;
  padding: 10px 2px;
  white-space: nowrap;
  border: 1px solid #eee;
  border-radius: 5px;
  margin: 0 5px 5px 0;
}
.cursors > div:hover {
  background: #eee;
}

HTML CSSResult
EDIT ON
.svg {
  cursor: url(https://s3-us-west-2.amazonaws.com/s.cdpn.io/9632/heart.svg), auto;
}

.svg-base64 {
  cursor: url(data:text/html;base64,PHN2ZyB2ZXJzaW9uPSIxLjEiIHhtbG5zPSJodHRwOi8vd3d3LnczLm9yZy8yMDAwL3N2ZyIgeG1sbnM6eGxpbms9Imh0dHA6Ly93d3cudzMub3JnLzE5OTkveGxpbmsiIHg9IjBweCIgeT0iMHB4Ig0KCSB2aWV3Qm94PSItMjQxIDI0MyAxNiAxNiIgeG1sOnNwYWNlPSJwcmVzZXJ2ZSI+DQo8c3R5bGUgdHlwZT0idGV4dC9jc3MiPg0KCS5zdDB7ZmlsbDojRkYwMDAwO30NCjwvc3R5bGU+DQo8cGF0aCBjbGFzcz0ic3QwIiBkPSJNLTIyOS4yLDI0NGMtMS43LDAtMy4xLDEuNC0zLjgsMi44Yy0wLjctMS40LTIuMS0yLjgtMy44LTIuOGMtMi4zLDAtNC4yLDEuOS00LjIsNC4yYzAsNC43LDQuOCw2LDgsMTAuNg0KCWMzLjEtNC42LDgtNi4xLDgtMTAuNkMtMjI1LDI0NS45LTIyNi45LDI0NC0yMjkuMiwyNDRMLTIyOS4yLDI0NHoiLz4NCjwvc3ZnPg0K), auto;
}

.png-base64 {
  cursor: url("data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAGQAAABkCAYAAABw4pVUAAAAGXRFWHRTb2Z0d2FyZQBBZG9iZSBJbWFnZVJlYWR5ccllPAAAAyhpVFh0WE1MOmNvbS5hZG9iZS54bXAAAAAAADw/eHBhY2tldCBiZWdpbj0i77u/IiBpZD0iVzVNME1wQ2VoaUh6cmVTek5UY3prYzlkIj8+IDx4OnhtcG1ldGEgeG1sbnM6eD0iYWRvYmU6bnM6bWV0YS8iIHg6eG1wdGs9IkFkb2JlIFhNUCBDb3JlIDUuNi1jMDY3IDc5LjE1Nzc0NywgMjAxNS8wMy8zMC0yMzo0MDo0MiAgICAgICAgIj4gPHJkZjpSREYgeG1sbnM6cmRmPSJodHRwOi8vd3d3LnczLm9yZy8xOTk5LzAyLzIyLXJkZi1zeW50YXgtbnMjIj4gPHJkZjpEZXNjcmlwdGlvbiByZGY6YWJvdXQ9IiIgeG1sbnM6eG1wPSJodHRwOi8vbnMuYWRvYmUuY29tL3hhcC8xLjAvIiB4bWxuczp4bXBNTT0iaHR0cDovL25zLmFkb2JlLmNvbS94YXAvMS4wL21tLyIgeG1sbnM6c3RSZWY9Imh0dHA6Ly9ucy5hZG9iZS5jb20veGFwLzEuMC9zVHlwZS9SZXNvdXJjZVJlZiMiIHhtcDpDcmVhdG9yVG9vbD0iQWRvYmUgUGhvdG9zaG9wIENDIDIwMTUgKE1hY2ludG9zaCkiIHhtcE1NOkluc3RhbmNlSUQ9InhtcC5paWQ6M0EwMEYyRjlDMjZFMTFFNUI4QkRFMkRBRDg3QkNFRUQiIHhtcE1NOkRvY3VtZW50SUQ9InhtcC5kaWQ6M0EwMEYyRkFDMjZFMTFFNUI4QkRFMkRBRDg3QkNFRUQiPiA8eG1wTU06RGVyaXZlZEZyb20gc3RSZWY6aW5zdGFuY2VJRD0ieG1wLmlpZDozQTAwRjJGN0MyNkUxMUU1QjhCREUyREFEODdCQ0VFRCIgc3RSZWY6ZG9jdW1lbnRJRD0ieG1wLmRpZDozQTAwRjJGOEMyNkUxMUU1QjhCREUyREFEODdCQ0VFRCIvPiA8L3JkZjpEZXNjcmlwdGlvbj4gPC9yZGY6UkRGPiA8L3g6eG1wbWV0YT4gPD94cGFja2V0IGVuZD0iciI/Pi/X/ugAAAY6SURBVHja7J1bbBVFHMZ3pVajTQoxCCgaNECqJiJV41NFCdF6CRKrvrRcXkyMD6gQE16MMSbESx9INCYkeHkywRhNiJFUoK3EqDVoRVQIiBpoQDFKC4jYtK7fZP+L0+2e6V7ncvx/ydc953S7Z+b7dWbP7O6Z9YMg8Fj26AKOgIGwGAgDYTEQBsKqQA3yE9/3C28wCLd5C3wnfCPcAl8NN8GNtNrv8M/wN/BuuAfvfNxkECj3HCzuhm+ncs+DL6Nfj8Jn4CPwASp3H7wH5R4r/N7y0EM8iVygMj7cBm+BhwOx2Wweh3fCDwYaW614L3rPnVSGrOUepjqLuvtFgJxnUAQIgVgBD+aoTC0fhDuKVDBluTvovcoq9yBl4RsBgrUXwZ+VWKG4xX/ttRXAuIa2XVW5RSaLtAHBWtPgZ+GxCisV+QzcVSKMLtpm1eUeo4ymVQoEa8yEd2moUNyb0lZO8U+0yUC5RVYzKwGC386F9xuoVOT3g/8+pWWB0Uh/a6rcIrO5pQIhGEMGKxV5WxYoBGObBeUeUkHJBASvzoC/s6BSkd9J031RN7XVonKLDGcUAkIfD3ssqlTkF1MAecHCcvckfSzOAmSDhZWK/IgCxkMWl3tDLiB41gKPWlyxkSA8vBEv97ycRwt0WWTakgfIDosrFblP7gKoi93lQLl3ZAKCR+0OVCryGqncaxwqd3sSEF8GER3txSv9WCxx5Ij1r/ACenwInuVIuT9G2nfEj/Y2JPTBrQ7B8AjAeumxK1oisgaUr2qeDyGtdPC8zpOOno8SWU8AMqHLoj7rGDybz91p0S/wFXKfFT8ZdAPD0KrZlHnNc+pLOSPtWqoCspjz0a7FKiALOR/tWqgCMp/z0a75KiBNnI92Nak+9vJ3E0woCPxaLYRlWAzEvP5RARnhfLRrRAXkBOejXScYiF0aUgE5zPlo10EVkP2cj3Z9qwKyl/PRri9VA8Nm/DzpVfhVANYE/QlPx8BwLLGF+OFHMG4l+tQb/wZW0sDwA85Jm96LvzDpqhM8uxkP93BWlUt8b3EOWsgfMoNJLcQPdzIHOK/K9a6AEX+x1rGsLZxX5Xot6cVaF8pNpxHkpZxbJfoESbdFT5RdFnVbw1hs5twq0/O1fpHYQqiViKsAD3MrKV0f+eEEBV7qFkKtRFwz2835lSox5livWmGqE1QveeEUGKxy1O3Hjl2l7rKkruseLD7kLAtLHLgVF1efm5Rxmi5L6rq2Y/EG51l4ENiZBCNrlxXpKfhHzjW3ngaMwTQrTtllSV3XTVh8Dl/E+WbS20i1U7VCpi5L6rq+xuIxzjeTxDHBR7P8QabLgADlLSxe5pxT6Si8HJmdzZRx2i5L6rrELApb4Q7OvKbEjHltfspT4rm6LKmVjHthn9jPuSfqNHyfn/P6hFxXLuLN/sZiBfwF5z9Bf4lckM9A3g3kvpSUTve2e3wyS4ZxP3LpLbKRQtf2+uEFEcu4pXin4HuLwji/QylhVtJmeMChWRTKnnPlttIYlAGEoFwC9/7PYPwG31pqoygLCEG52PB0ejp9ND6rj3VAonEK/Hqdw/h+qnkUrQFCUMR34zbWKYyBNDONWgVEAvNEzim8bfV2sa8sPSddQAiKmG7vXB3AeDNInqzHLSAERUxWf9JhGBsrnYteNxCCcj18xDEQortdW/Wo0ggQgnIlvNcRGKOqmU/rAog0qu9zYPS9TNdxF6NACEqjZbNOx0ffrToPhBkHQlDE3W1etQyGmKN9ge4jk1YAkcA8ZwmMH+CrjGRgExCCstYwjH3w5cbqbxsQgtJlaFQ/QF+/8BjIZCidmqEIGM3G620rEILygKabAFgBw3ogBGV5xVCsgeEEkIqh7DO9z3ASCEF5uOR9ivhoa91E0c4AISirS4JxXNxU0so6ugSEoKwrCONUYPEk0c4BISjdBe66eZfVdXMUiE+3zMsK5HHPcjkJhKCIy4w+zQDjFc8BOQuEoMxKeeZxN3whA9EDpRU+q4BxLHDoPijOAyEoqxTnwducqks9ACEomxOAPONcPeoIiNjJD0ow+ovcd52BlAPlOtqfnLZ1JJ4FSIPnuPzwBvLr8HAcj39yvj6utox6Fd+ugoGwGAgDYeXVvwIMAGCAb3XkplDRAAAAAElFTkSuQmCC"), auto;
}

.png {
  cursor: url("https://s3-us-west-2.amazonaws.com/s.cdpn.io/9632/heart.png"), auto;
}

.gif {
  cursor: url("https://s3-us-west-2.amazonaws.com/s.cdpn.io/9632/tina.gif"), auto;
}

.cursors {
  display: flex;
  justify-content: flex-start;
  align-items: stretch;
  height: 100vh;
}

.cursors > div {
  display: flex;
  justify-content: center;
  align-items: center;
  flex-grow: 1;
  box-sizing: border-box;
  padding: 10px 2px;
  text-align: center;
}
_x000D_
<h1>The Cursors of CSS</h1>

<div class="cursors">
    <div class="auto">auto</div>
    <div class="default">default</div>
    <div class="none">none</div>
    <div class="context-menu">context-menu</div>
    <div class="help">help</div>
    <div class="pointer">pointer</div>
    <div class="progress">progress</div>
    <div class="wait">wait</div>
    <div class="cell">cell</div>
    <div class="crosshair">crosshair</div>
    <div class="text">text</div>
    <div class="vertical-text">vertical-text</div>
    <div class="alias">alias</div>
    <div class="copy">copy</div>
    <div class="move">move</div>
    <div class="no-drop">no-drop</div>
    <div class="not-allowed">not-allowed</div>
    <div class="all-scroll">all-scroll</div>
    <div class="col-resize">col-resize</div>
    <div class="row-resize">row-resize</div>
    <div class="n-resize">n-resize</div>
    <div class="s-resize">s-resize</div>
    <div class="e-resize">e-resize</div>
    <div class="w-resize">w-resize</div>
    <div class="ns-resize">ns-resize</div>
    <div class="ew-resize">ew-resize</div>
    <div class="ne-resize">ne-resize</div>
    <div class="nw-resize">nw-resize</div>
    <div class="se-resize">se-resize</div>
    <div class="sw-resize">sw-resize</div>
    <div class="nesw-resize">nesw-resize</div>
    <div class="nwse-resize">nwse-resize</div>
</div>
<br><br><br><br><br><br><br><br><br>
<h1>Custom Image</h1>
<div class="cursors">
  <div class="svg"><p>SVG</p></div>
  <div class="svg-base64">Base 64 SVG</div>
  <div class="png-base64">Base 64 PNG</div>
  <div class="png">PNG</div>
  <div class="gif">GIF</div>
</div>
_x000D_
_x000D_
_x000D_

Showing loading animation in center of page while making a call to Action method in ASP .NET MVC

I defined two functions in Site.Master:

    <script type="text/javascript">
    var spinnerVisible = false;
    function showProgress() {
        if (!spinnerVisible) {
            $("div#spinner").fadeIn("fast");
            spinnerVisible = true;
        }
    };
    function hideProgress() {
        if (spinnerVisible) {
            var spinner = $("div#spinner");
            spinner.stop();
            spinner.fadeOut("fast");
            spinnerVisible = false;
        }
    };
</script>

And special section:

    <div id="spinner">
        Loading...
    </div>

Visual style is defined in CSS:

div#spinner
{
    display: none;
    width:100px;
    height: 100px;
    position: fixed;
    top: 50%;
    left: 50%;
    background:url(spinner.gif) no-repeat center #fff;
    text-align:center;
    padding:10px;
    font:normal 16px Tahoma, Geneva, sans-serif;
    border:1px solid #666;
    margin-left: -50px;
    margin-top: -50px;
    z-index:2;
    overflow: auto;
}

Understanding typedefs for function pointers in C

This is the simplest example of function pointers and function pointer arrays that I wrote as an exercise.

    typedef double (*pf)(double x);  /*this defines a type pf */

    double f1(double x) { return(x+x);}
    double f2(double x) { return(x*x);}

    pf pa[] = {f1, f2};


    main()
    {
        pf p;

        p = pa[0];
        printf("%f\n", p(3.0));
        p = pa[1];
        printf("%f\n", p(3.0));
    }

Setting dynamic scope variables in AngularJs - scope.<some_string>

Please keep in mind: this is just a JavaScript thing and has nothing to do with Angular JS. So don't be confused about the magical '$' sign ;)

The main problem is that this is an hierarchical structure.

console.log($scope.life.meaning);  // <-- Nope! This is undefined.
=> a.b.c

This is undefined because "$scope.life" is not existing but the term above want to solve "meaning".

A solution should be

var the_string = 'lifeMeaning';
$scope[the_string] = 42;
console.log($scope.lifeMeaning);
console.log($scope['lifeMeaning']);

or with a little more efford.

var the_string_level_one = 'life';
var the_string_level_two = the_string_level_one + '.meaning';
$scope[the_string_level_two ] = 42;
console.log($scope.life.meaning);
console.log($scope['the_string_level_two ']);

Since you can access a structural objecte with

var a = {};
a.b = "ab";
console.log(a.b === a['b']);

There are several good tutorials about this which guide you well through the fun with JavaScript.

There is something about the

$scope.$apply();
do...somthing...bla...bla

Go and search the web for 'angular $apply' and you will find information about the $apply function. And you should use is wisely more this way (if you are not alreay with a $apply phase).

$scope.$apply(function (){
    do...somthing...bla...bla
})

Sort a Custom Class List<T>

You are correct that your cTag class must implement IComparable<T> interface. Then you can just call Sort() on your list.

To implement IComparable<T> interface, you must implement CompareTo(T other) method. The easiest way to do this is to call CompareTo method of the field you want to compare, which in your case is date.

public class cTag:IComparable<cTag> {
    public int id { get; set; }
    public int regnumber { get; set; }
    public string date { get; set; }
    public int CompareTo(cTag other) {
        return date.CompareTo(other.date);
    }
}

However, this wouldn't sort well, because this would use classic sorting on strings (since you declared date as string). So I think the best think to do would be to redefine the class and to declare date not as string, but as DateTime. The code would stay almost the same:

public class cTag:IComparable<cTag> {
    public int id { get; set; }
    public int regnumber { get; set; }
    public DateTime date { get; set; }
    public int CompareTo(cTag other) {
        return date.CompareTo(other.date);
    }
}

Only thing you'd have to do when creating the instance of the class to convert your string containing the date into DateTime type, but it can be done easily e.g. by DateTime.Parse(String) method.

cpp / c++ get pointer value or depointerize pointer

To get the value of a pointer, just de-reference the pointer.

int *ptr;
int value;
*ptr = 9;

value = *ptr;

value is now 9.

I suggest you read more about pointers, this is their base functionality.

How to create cron job using PHP?

In the same way you are trying to run cron.php, you can run another PHP script. You will have to do so via the CLI interface though.

#!/usr/bin/env php
<?php
# This file would be say, '/usr/local/bin/run.php'
// code
echo "this was run from CRON";

Then, add an entry to the crontab:

* * * * * /usr/bin/php -f /usr/local/bin/run.php &> /dev/null

If the run.php script had executable permissions, it could be listed directly in the crontab, without the /usr/bin/php part as well. The 'env php' part, in the script, would find the appropriate program to actually run the PHP code. So, for the 'executable' version - add executable permission to the file:

chmod +x /usr/local/bin/run.php

and then, add the following entry into crontab:

* * * * * /usr/local/bin/run.php &> /dev/null

Bootstrap: Use .pull-right without having to hardcode a negative margin-top

just put #login-box before <h2>Welcome</h2> will be ok.

<div class='container'>
    <div class='hero-unit'>
        <div id='login-box' class='pull-right control-group'>
            <div class='clearfix'>
                <input type='text' placeholder='Username' />
            </div>
            <div class='clearfix'>
                <input type='password' placeholder='Password' />
            </div>
            <button type='button' class='btn btn-primary'>Log in</button>
        </div>
        <h2>Welcome</h2>

        <p>Please log in</p>

    </div>
</div>

here is jsfiddle http://jsfiddle.net/SyjjW/4/

find index of an int in a list

List<string> accountList = new List<string> {"123872", "987653" , "7625019", "028401"};

int i = accountList.FindIndex(x => x.StartsWith("762"));
//This will give you index of 7625019 in list that is 2. value of i will become 2.
//delegate(string ac)
//{
//    return ac.StartsWith(a.AccountNumber);
//}
//);

Exception is: InvalidOperationException - The current type, is an interface and cannot be constructed. Are you missing a type mapping?

Below code will be helpful for you

public static IUnityContainer Initialise(IUnityContainer container = null)
{
    if (container == null)
    {
        container = new UnityContainer();
    }
    container.RegisterType<ISettingsManager, SettingsManager>();
    container.Resolve<SettingsManager>();
    container.RegisterType<SettingsManagerController>(new InjectionProperty("_SettingManagerProvider", new ResolvedParameter<ISettingManager>()));
    return container;
}

Fast way to get the min/max values among properties of object

Using the lodash library you can write shorter

_({ "a":4, "b":0.5 , "c":0.35, "d":5 }).values().max();

How to generate an openSSL key using a passphrase from the command line?

If you don't use a passphrase, then the private key is not encrypted with any symmetric cipher - it is output completely unprotected.

You can generate a keypair, supplying the password on the command-line using an invocation like (in this case, the password is foobar):

openssl genrsa -aes128 -passout pass:foobar 3072

However, note that this passphrase could be grabbed by any other process running on the machine at the time, since command-line arguments are generally visible to all processes.

A better alternative is to write the passphrase into a temporary file that is protected with file permissions, and specify that:

openssl genrsa -aes128 -passout file:passphrase.txt 3072

Or supply the passphrase on standard input:

openssl genrsa -aes128 -passout stdin 3072

You can also used a named pipe with the file: option, or a file descriptor.


To then obtain the matching public key, you need to use openssl rsa, supplying the same passphrase with the -passin parameter as was used to encrypt the private key:

openssl rsa -passin file:passphrase.txt -pubout

(This expects the encrypted private key on standard input - you can instead read it from a file using -in <file>).


Example of creating a 3072-bit private and public key pair in files, with the private key pair encrypted with password foobar:

openssl genrsa -aes128 -passout pass:foobar -out privkey.pem 3072
openssl rsa -in privkey.pem -passin pass:foobar -pubout -out privkey.pub

Should I use 'border: none' or 'border: 0'?

In my point,

border:none is working but not valid w3c standard

so better we can use border:0;

Should Gemfile.lock be included in .gitignore?

The Bundler docs address this question as well:

ORIGINAL: http://gembundler.com/v1.3/rationale.html

EDIT: http://web.archive.org/web/20160309170442/http://bundler.io/v1.3/rationale.html

See the section called "Checking Your Code into Version Control":

After developing your application for a while, check in the application together with the Gemfile and Gemfile.lock snapshot. Now, your repository has a record of the exact versions of all of the gems that you used the last time you know for sure that the application worked. Keep in mind that while your Gemfile lists only three gems (with varying degrees of version strictness), your application depends on dozens of gems, once you take into consideration all of the implicit requirements of the gems you depend on.

This is important: the Gemfile.lock makes your application a single package of both your own code and the third-party code it ran the last time you know for sure that everything worked. Specifying exact versions of the third-party code you depend on in your Gemfile would not provide the same guarantee, because gems usually declare a range of versions for their dependencies.

The next time you run bundle install on the same machine, bundler will see that it already has all of the dependencies you need, and skip the installation process.

Do not check in the .bundle directory, or any of the files inside it. Those files are specific to each particular machine, and are used to persist installation options between runs of the bundle install command.

If you have run bundle pack, the gems (although not the git gems) required by your bundle will be downloaded into vendor/cache. Bundler can run without connecting to the internet (or the RubyGems server) if all the gems you need are present in that folder and checked in to your source control. This is an optional step, and not recommended, due to the increase in size of your source control repository.

Unique on a dataframe with only selected columns

Ok, if it doesn't matter which value in the non-duplicated column you select, this should be pretty easy:

dat <- data.frame(id=c(1,1,3),id2=c(1,1,4),somevalue=c("x","y","z"))
> dat[!duplicated(dat[,c('id','id2')]),]
  id id2 somevalue
1  1   1         x
3  3   4         z

Inside the duplicated call, I'm simply passing only those columns from dat that I don't want duplicates of. This code will automatically always select the first of any ambiguous values. (In this case, x.)

How can I find script's directory?

Here's what I ended up with. This works for me if I import my script in the interpreter, and also if I execute it as a script:

import os
import sys

# Returns the directory the current script (or interpreter) is running in
def get_script_directory():
    path = os.path.realpath(sys.argv[0])
    if os.path.isdir(path):
        return path
    else:
        return os.path.dirname(path)

Response to preflight request doesn't pass access control check

It's easy to solve this issue just with few steps easily,without worrying about anything. Kindly,Follow the steps to solve it .

  1. open (https://www.npmjs.com/package/cors#enabling-cors-pre-flight)
  2. go to installation and copy the command npm install cors to install via node terminal
  3. go to Simple Usage (Enable All CORS Requests) by scrolling.then copy and paste the complete declartion in ur project and run it...that will work for sure.. copy the comment code and paste in ur app.js or any other project and give a try ..this will work.this will unlock every cross origin resource sharing..so we can switch between serves for your use

What is the canonical way to check for errors using the CUDA runtime API?

talonmies' answer above is a fine way to abort an application in an assert-style manner.

Occasionally we may wish to report and recover from an error condition in a C++ context as part of a larger application.

Here's a reasonably terse way to do that by throwing a C++ exception derived from std::runtime_error using thrust::system_error:

#include <thrust/system_error.h>
#include <thrust/system/cuda/error.h>
#include <sstream>

void throw_on_cuda_error(cudaError_t code, const char *file, int line)
{
  if(code != cudaSuccess)
  {
    std::stringstream ss;
    ss << file << "(" << line << ")";
    std::string file_and_line;
    ss >> file_and_line;
    throw thrust::system_error(code, thrust::cuda_category(), file_and_line);
  }
}

This will incorporate the filename, line number, and an English language description of the cudaError_t into the thrown exception's .what() member:

#include <iostream>

int main()
{
  try
  {
    // do something crazy
    throw_on_cuda_error(cudaSetDevice(-1), __FILE__, __LINE__);
  }
  catch(thrust::system_error &e)
  {
    std::cerr << "CUDA error after cudaSetDevice: " << e.what() << std::endl;

    // oops, recover
    cudaSetDevice(0);
  }

  return 0;
}

The output:

$ nvcc exception.cu -run
CUDA error after cudaSetDevice: exception.cu(23): invalid device ordinal

A client of some_function can distinguish CUDA errors from other kinds of errors if desired:

try
{
  // call some_function which may throw something
  some_function();
}
catch(thrust::system_error &e)
{
  std::cerr << "CUDA error during some_function: " << e.what() << std::endl;
}
catch(std::bad_alloc &e)
{
  std::cerr << "Bad memory allocation during some_function: " << e.what() << std::endl;
}
catch(std::runtime_error &e)
{
  std::cerr << "Runtime error during some_function: " << e.what() << std::endl;
}
catch(...)
{
  std::cerr << "Some other kind of error during some_function" << std::endl;

  // no idea what to do, so just rethrow the exception
  throw;
}

Because thrust::system_error is a std::runtime_error, we can alternatively handle it in the same manner of a broad class of errors if we don't require the precision of the previous example:

try
{
  // call some_function which may throw something
  some_function();
}
catch(std::runtime_error &e)
{
  std::cerr << "Runtime error during some_function: " << e.what() << std::endl;
}

data.table vs dplyr: can one do something well the other can't or does poorly?

We need to cover at least these aspects to provide a comprehensive answer/comparison (in no particular order of importance): Speed, Memory usage, Syntax and Features.

My intent is to cover each one of these as clearly as possible from data.table perspective.

Note: unless explicitly mentioned otherwise, by referring to dplyr, we refer to dplyr's data.frame interface whose internals are in C++ using Rcpp.


The data.table syntax is consistent in its form - DT[i, j, by]. To keep i, j and by together is by design. By keeping related operations together, it allows to easily optimise operations for speed and more importantly memory usage, and also provide some powerful features, all while maintaining the consistency in syntax.

1. Speed

Quite a few benchmarks (though mostly on grouping operations) have been added to the question already showing data.table gets faster than dplyr as the number of groups and/or rows to group by increase, including benchmarks by Matt on grouping from 10 million to 2 billion rows (100GB in RAM) on 100 - 10 million groups and varying grouping columns, which also compares pandas. See also updated benchmarks, which include Spark and pydatatable as well.

On benchmarks, it would be great to cover these remaining aspects as well:

  • Grouping operations involving a subset of rows - i.e., DT[x > val, sum(y), by = z] type operations.

  • Benchmark other operations such as update and joins.

  • Also benchmark memory footprint for each operation in addition to runtime.

2. Memory usage

  1. Operations involving filter() or slice() in dplyr can be memory inefficient (on both data.frames and data.tables). See this post.

    Note that Hadley's comment talks about speed (that dplyr is plentiful fast for him), whereas the major concern here is memory.

  2. data.table interface at the moment allows one to modify/update columns by reference (note that we don't need to re-assign the result back to a variable).

    # sub-assign by reference, updates 'y' in-place
    DT[x >= 1L, y := NA]
    

    But dplyr will never update by reference. The dplyr equivalent would be (note that the result needs to be re-assigned):

    # copies the entire 'y' column
    ans <- DF %>% mutate(y = replace(y, which(x >= 1L), NA))
    

    A concern for this is referential transparency. Updating a data.table object by reference, especially within a function may not be always desirable. But this is an incredibly useful feature: see this and this posts for interesting cases. And we want to keep it.

    Therefore we are working towards exporting shallow() function in data.table that will provide the user with both possibilities. For example, if it is desirable to not modify the input data.table within a function, one can then do:

    foo <- function(DT) {
        DT = shallow(DT)          ## shallow copy DT
        DT[, newcol := 1L]        ## does not affect the original DT 
        DT[x > 2L, newcol := 2L]  ## no need to copy (internally), as this column exists only in shallow copied DT
        DT[x > 2L, x := 3L]       ## have to copy (like base R / dplyr does always); otherwise original DT will 
                                  ## also get modified.
    }
    

    By not using shallow(), the old functionality is retained:

    bar <- function(DT) {
        DT[, newcol := 1L]        ## old behaviour, original DT gets updated by reference
        DT[x > 2L, x := 3L]       ## old behaviour, update column x in original DT.
    }
    

    By creating a shallow copy using shallow(), we understand that you don't want to modify the original object. We take care of everything internally to ensure that while also ensuring to copy columns you modify only when it is absolutely necessary. When implemented, this should settle the referential transparency issue altogether while providing the user with both possibilties.

    Also, once shallow() is exported dplyr's data.table interface should avoid almost all copies. So those who prefer dplyr's syntax can use it with data.tables.

    But it will still lack many features that data.table provides, including (sub)-assignment by reference.

  3. Aggregate while joining:

    Suppose you have two data.tables as follows:

    DT1 = data.table(x=c(1,1,1,1,2,2,2,2), y=c("a", "a", "b", "b"), z=1:8, key=c("x", "y"))
    #    x y z
    # 1: 1 a 1
    # 2: 1 a 2
    # 3: 1 b 3
    # 4: 1 b 4
    # 5: 2 a 5
    # 6: 2 a 6
    # 7: 2 b 7
    # 8: 2 b 8
    DT2 = data.table(x=1:2, y=c("a", "b"), mul=4:3, key=c("x", "y"))
    #    x y mul
    # 1: 1 a   4
    # 2: 2 b   3
    

    And you would like to get sum(z) * mul for each row in DT2 while joining by columns x,y. We can either:

    • 1) aggregate DT1 to get sum(z), 2) perform a join and 3) multiply (or)

      # data.table way
      DT1[, .(z = sum(z)), keyby = .(x,y)][DT2][, z := z*mul][]
      
      # dplyr equivalent
      DF1 %>% group_by(x, y) %>% summarise(z = sum(z)) %>% 
          right_join(DF2) %>% mutate(z = z * mul)
      
    • 2) do it all in one go (using by = .EACHI feature):

      DT1[DT2, list(z=sum(z) * mul), by = .EACHI]
      

    What is the advantage?

    • We don't have to allocate memory for the intermediate result.

    • We don't have to group/hash twice (one for aggregation and other for joining).

    • And more importantly, the operation what we wanted to perform is clear by looking at j in (2).

    Check this post for a detailed explanation of by = .EACHI. No intermediate results are materialised, and the join+aggregate is performed all in one go.

    Have a look at this, this and this posts for real usage scenarios.

    In dplyr you would have to join and aggregate or aggregate first and then join, neither of which are as efficient, in terms of memory (which in turn translates to speed).

  4. Update and joins:

    Consider the data.table code shown below:

    DT1[DT2, col := i.mul]
    

    adds/updates DT1's column col with mul from DT2 on those rows where DT2's key column matches DT1. I don't think there is an exact equivalent of this operation in dplyr, i.e., without avoiding a *_join operation, which would have to copy the entire DT1 just to add a new column to it, which is unnecessary.

    Check this post for a real usage scenario.

To summarise, it is important to realise that every bit of optimisation matters. As Grace Hopper would say, Mind your nanoseconds!

3. Syntax

Let's now look at syntax. Hadley commented here:

Data tables are extremely fast but I think their concision makes it harder to learn and code that uses it is harder to read after you have written it ...

I find this remark pointless because it is very subjective. What we can perhaps try is to contrast consistency in syntax. We will compare data.table and dplyr syntax side-by-side.

We will work with the dummy data shown below:

DT = data.table(x=1:10, y=11:20, z=rep(1:2, each=5))
DF = as.data.frame(DT)
  1. Basic aggregation/update operations.

    # case (a)
    DT[, sum(y), by = z]                       ## data.table syntax
    DF %>% group_by(z) %>% summarise(sum(y)) ## dplyr syntax
    DT[, y := cumsum(y), by = z]
    ans <- DF %>% group_by(z) %>% mutate(y = cumsum(y))
    
    # case (b)
    DT[x > 2, sum(y), by = z]
    DF %>% filter(x>2) %>% group_by(z) %>% summarise(sum(y))
    DT[x > 2, y := cumsum(y), by = z]
    ans <- DF %>% group_by(z) %>% mutate(y = replace(y, which(x > 2), cumsum(y)))
    
    # case (c)
    DT[, if(any(x > 5L)) y[1L]-y[2L] else y[2L], by = z]
    DF %>% group_by(z) %>% summarise(if (any(x > 5L)) y[1L] - y[2L] else y[2L])
    DT[, if(any(x > 5L)) y[1L] - y[2L], by = z]
    DF %>% group_by(z) %>% filter(any(x > 5L)) %>% summarise(y[1L] - y[2L])
    
    • data.table syntax is compact and dplyr's quite verbose. Things are more or less equivalent in case (a).

    • In case (b), we had to use filter() in dplyr while summarising. But while updating, we had to move the logic inside mutate(). In data.table however, we express both operations with the same logic - operate on rows where x > 2, but in first case, get sum(y), whereas in the second case update those rows for y with its cumulative sum.

      This is what we mean when we say the DT[i, j, by] form is consistent.

    • Similarly in case (c), when we have if-else condition, we are able to express the logic "as-is" in both data.table and dplyr. However, if we would like to return just those rows where the if condition satisfies and skip otherwise, we cannot use summarise() directly (AFAICT). We have to filter() first and then summarise because summarise() always expects a single value.

      While it returns the same result, using filter() here makes the actual operation less obvious.

      It might very well be possible to use filter() in the first case as well (does not seem obvious to me), but my point is that we should not have to.

  2. Aggregation / update on multiple columns

    # case (a)
    DT[, lapply(.SD, sum), by = z]                     ## data.table syntax
    DF %>% group_by(z) %>% summarise_each(funs(sum)) ## dplyr syntax
    DT[, (cols) := lapply(.SD, sum), by = z]
    ans <- DF %>% group_by(z) %>% mutate_each(funs(sum))
    
    # case (b)
    DT[, c(lapply(.SD, sum), lapply(.SD, mean)), by = z]
    DF %>% group_by(z) %>% summarise_each(funs(sum, mean))
    
    # case (c)
    DT[, c(.N, lapply(.SD, sum)), by = z]     
    DF %>% group_by(z) %>% summarise_each(funs(n(), mean))
    
    • In case (a), the codes are more or less equivalent. data.table uses familiar base function lapply(), whereas dplyr introduces *_each() along with a bunch of functions to funs().

    • data.table's := requires column names to be provided, whereas dplyr generates it automatically.

    • In case (b), dplyr's syntax is relatively straightforward. Improving aggregations/updates on multiple functions is on data.table's list.

    • In case (c) though, dplyr would return n() as many times as many columns, instead of just once. In data.table, all we need to do is to return a list in j. Each element of the list will become a column in the result. So, we can use, once again, the familiar base function c() to concatenate .N to a list which returns a list.

    Note: Once again, in data.table, all we need to do is return a list in j. Each element of the list will become a column in result. You can use c(), as.list(), lapply(), list() etc... base functions to accomplish this, without having to learn any new functions.

    You will need to learn just the special variables - .N and .SD at least. The equivalent in dplyr are n() and .

  3. Joins

    dplyr provides separate functions for each type of join where as data.table allows joins using the same syntax DT[i, j, by] (and with reason). It also provides an equivalent merge.data.table() function as an alternative.

    setkey(DT1, x, y)
    
    # 1. normal join
    DT1[DT2]            ## data.table syntax
    left_join(DT2, DT1) ## dplyr syntax
    
    # 2. select columns while join    
    DT1[DT2, .(z, i.mul)]
    left_join(select(DT2, x, y, mul), select(DT1, x, y, z))
    
    # 3. aggregate while join
    DT1[DT2, .(sum(z) * i.mul), by = .EACHI]
    DF1 %>% group_by(x, y) %>% summarise(z = sum(z)) %>% 
        inner_join(DF2) %>% mutate(z = z*mul) %>% select(-mul)
    
    # 4. update while join
    DT1[DT2, z := cumsum(z) * i.mul, by = .EACHI]
    ??
    
    # 5. rolling join
    DT1[DT2, roll = -Inf]
    ??
    
    # 6. other arguments to control output
    DT1[DT2, mult = "first"]
    ??
    
    • Some might find a separate function for each joins much nicer (left, right, inner, anti, semi etc), whereas as others might like data.table's DT[i, j, by], or merge() which is similar to base R.

    • However dplyr joins do just that. Nothing more. Nothing less.

    • data.tables can select columns while joining (2), and in dplyr you will need to select() first on both data.frames before to join as shown above. Otherwise you would materialiase the join with unnecessary columns only to remove them later and that is inefficient.

    • data.tables can aggregate while joining (3) and also update while joining (4), using by = .EACHI feature. Why materialse the entire join result to add/update just a few columns?

    • data.table is capable of rolling joins (5) - roll forward, LOCF, roll backward, NOCB, nearest.

    • data.table also has mult = argument which selects first, last or all matches (6).

    • data.table has allow.cartesian = TRUE argument to protect from accidental invalid joins.

Once again, the syntax is consistent with DT[i, j, by] with additional arguments allowing for controlling the output further.

  1. do()...

    dplyr's summarise is specially designed for functions that return a single value. If your function returns multiple/unequal values, you will have to resort to do(). You have to know beforehand about all your functions return value.

    DT[, list(x[1], y[1]), by = z]                 ## data.table syntax
    DF %>% group_by(z) %>% summarise(x[1], y[1]) ## dplyr syntax
    DT[, list(x[1:2], y[1]), by = z]
    DF %>% group_by(z) %>% do(data.frame(.$x[1:2], .$y[1]))
    
    DT[, quantile(x, 0.25), by = z]
    DF %>% group_by(z) %>% summarise(quantile(x, 0.25))
    DT[, quantile(x, c(0.25, 0.75)), by = z]
    DF %>% group_by(z) %>% do(data.frame(quantile(.$x, c(0.25, 0.75))))
    
    DT[, as.list(summary(x)), by = z]
    DF %>% group_by(z) %>% do(data.frame(as.list(summary(.$x))))
    
    • .SD's equivalent is .

    • In data.table, you can throw pretty much anything in j - the only thing to remember is for it to return a list so that each element of the list gets converted to a column.

    • In dplyr, cannot do that. Have to resort to do() depending on how sure you are as to whether your function would always return a single value. And it is quite slow.

Once again, data.table's syntax is consistent with DT[i, j, by]. We can just keep throwing expressions in j without having to worry about these things.

Have a look at this SO question and this one. I wonder if it would be possible to express the answer as straightforward using dplyr's syntax...

To summarise, I have particularly highlighted several instances where dplyr's syntax is either inefficient, limited or fails to make operations straightforward. This is particularly because data.table gets quite a bit of backlash about "harder to read/learn" syntax (like the one pasted/linked above). Most posts that cover dplyr talk about most straightforward operations. And that is great. But it is important to realise its syntax and feature limitations as well, and I am yet to see a post on it.

data.table has its quirks as well (some of which I have pointed out that we are attempting to fix). We are also attempting to improve data.table's joins as I have highlighted here.

But one should also consider the number of features that dplyr lacks in comparison to data.table.

4. Features

I have pointed out most of the features here and also in this post. In addition:

  • fread - fast file reader has been available for a long time now.

  • fwrite - a parallelised fast file writer is now available. See this post for a detailed explanation on the implementation and #1664 for keeping track of further developments.

  • Automatic indexing - another handy feature to optimise base R syntax as is, internally.

  • Ad-hoc grouping: dplyr automatically sorts the results by grouping variables during summarise(), which may not be always desirable.

  • Numerous advantages in data.table joins (for speed / memory efficiency and syntax) mentioned above.

  • Non-equi joins: Allows joins using other operators <=, <, >, >= along with all other advantages of data.table joins.

  • Overlapping range joins was implemented in data.table recently. Check this post for an overview with benchmarks.

  • setorder() function in data.table that allows really fast reordering of data.tables by reference.

  • dplyr provides interface to databases using the same syntax, which data.table does not at the moment.

  • data.table provides faster equivalents of set operations (written by Jan Gorecki) - fsetdiff, fintersect, funion and fsetequal with additional all argument (as in SQL).

  • data.table loads cleanly with no masking warnings and has a mechanism described here for [.data.frame compatibility when passed to any R package. dplyr changes base functions filter, lag and [ which can cause problems; e.g. here and here.


Finally:

  • On databases - there is no reason why data.table cannot provide similar interface, but this is not a priority now. It might get bumped up if users would very much like that feature.. not sure.

  • On parallelism - Everything is difficult, until someone goes ahead and does it. Of course it will take effort (being thread safe).

    • Progress is being made currently (in v1.9.7 devel) towards parallelising known time consuming parts for incremental performance gains using OpenMP.

T-SQL - function with default parameters

you have to call it like this

SELECT dbo.CheckIfSFExists(23, default)

From Technet:

When a parameter of the function has a default value, the keyword DEFAULT must be specified when the function is called in order to retrieve the default value. This behaviour is different from using parameters with default values in stored procedures in which omitting the parameter also implies the default value. An exception to this behaviour is when invoking a scalar function by using the EXECUTE statement. When using EXECUTE, the DEFAULT keyword is not required.

awk - concatenate two string variable and assign to a third

Concatenating strings in awk can be accomplished by the print command AWK manual page, and you can do complicated combination. Here I was trying to change the 16 char to A and used string concatenation:

echo    CTCTCTGAAATCACTGAGCAGGAGAAAGATT | awk -v w=15 -v BA=A '{OFS=""; print substr($0, 1, w), BA, substr($0,w+2)}'
Output: CTCTCTGAAATCACTAAGCAGGAGAAAGATT

I used the substr function to extract a portion of the input (STDIN). I passed some external parameters (here I am using hard-coded values) that are usually shell variable. In the context of shell programming, you can write -v w=$width -v BA=$my_charval. The key is the OFS which stands for Output Field Separate in awk. Print function take a list of values and write them to the STDOUT and glue them with the OFS. This is analogous to the perl join function.

It looks that in awk, string can be concatenated by printing variable next to each other:

echo xxx | awk -v a="aaa" -v b="bbb" '{ print a b $1 "string literal"}'
# will produce: aaabbbxxxstring literal

Bootstrap: how do I change the width of the container?

Set your own content container class with 1000px width property and then use container-fluid boostrap class instead of container.

Works but might not be the best solution.

How to prevent Google Colab from disconnecting?

You can also use Python to press the arrow keys. I added a little bit of randomness in the following code as well.

from pyautogui import press, typewrite, hotkey
import time
from random import shuffle

array = ["left", "right", "up", "down"]

while True:
    shuffle(array)
    time.sleep(10)
    press(array[0])
    press(array[1])
    press(array[2])
    press(array[3])

psql: FATAL: role "postgres" does not exist

The key is "I installed the postgres.app for mac." This application sets up the local PostgreSQL installation with a database superuser whose role name is the same as your login (short) name.

When Postgres.app first starts up, it creates the $USER database, which is the default database for psql when none is specified. The default user is $USER, with no password.

Some scripts (e.g., a database backup created with pgdump on a Linux systsem) and tutorials will assume the superuser has the traditional role name of postgres.

You can make your local install look a bit more traditional and avoid these problems by doing a one time:

/Applications/Postgres.app/Contents/Versions/9.*/bin/createuser -s postgres

which will make those FATAL: role "postgres" does not exist go away.

What's the best UML diagramming tool?

You might want to take a look at MagicDraw or Visual Paradigm for UML. Both offer community editions that, of course, don't span the full feature range, but may well be sufficient if you want to create diagrams only and not generate code or do full round-trip engineering.

Android: Create a toggle button with image and no text

create toggle_selector.xml in res/drawable

<?xml version="1.0" encoding="utf-8"?> 
<selector xmlns:android="http://schemas.android.com/apk/res/android">
  <item android:drawable="@drawable/toggle_on" android:state_checked="true"/>
  <item android:drawable="@drawable/toggle_off" android:state_checked="false"/>
</selector>

apply the selector to your toggle button

<ToggleButton
            android:id="@+id/chkState"
            android:layout_width="wrap_content"
            android:layout_height="wrap_content"
            android:background="@drawable/toggle_selector"
            android:textOff=""
            android:textOn=""/>

Note: for removing the text i used following in above code

textOff=""
textOn=""

chai test array equality doesn't work as expected

This is how to use chai to deeply test associative arrays.

I had an issue trying to assert that two associative arrays were equal. I know that these shouldn't really be used in javascript but I was writing unit tests around legacy code which returns a reference to an associative array. :-)

I did it by defining the variable as an object (not array) prior to my function call:

var myAssocArray = {};   // not []
var expectedAssocArray = {};  // not []

expectedAssocArray['myKey'] = 'something';
expectedAssocArray['differentKey'] = 'something else';

// legacy function which returns associate array reference
myFunction(myAssocArray);

assert.deepEqual(myAssocArray, expectedAssocArray,'compare two associative arrays');

Counting inversions in an array

Use mergesort, in merge step incremeant counter if the number copied to output is from right array.

What is a monad?

Let the below "{| a |m}" represent some piece of monadic data. A data type which advertises an a:

        (I got an a!)
          /        
    {| a |m}

Function, f, knows how to create a monad, if only it had an a:

       (Hi f! What should I be?)
                      /
(You?. Oh, you'll be /
 that data there.)  /
 /                 /  (I got a b.)
|    --------------      |
|  /                     |
f a                      |
  |--later->       {| b |m}

Here we see function, f, tries to evaluate a monad but gets rebuked.

(Hmm, how do I get that a?)
 o       (Get lost buddy.
o         Wrong type.)
o       /
f {| a |m}

Funtion, f, finds a way to extract the a by using >>=.

        (Muaahaha. How you 
         like me now!?)       
    (Better.)      \
        |     (Give me that a.)
(Fine, well ok.)    |
         \          |
   {| a |m}   >>=   f

Little does f know, the monad and >>= are in collusion.

            (Yah got an a for me?)       
(Yeah, but hey    | 
 listen. I got    |
 something to     |
 tell you first   |
 ...)   \        /
         |      /
   {| a |m}   >>=   f

But what do they actually talk about? Well, that depends on the monad. Talking solely in the abstract has limited use; you have to have some experience with particular monads to flesh out the understanding.

For instance, the data type Maybe

 data Maybe a = Nothing | Just a

has a monad instance which will acts like the following...

Wherein, if the case is Just a

            (Yah what is it?)       
(... hm? Oh,      |
forget about it.  |
Hey a, yr up.)    | 
            \     |
(Evaluation  \    |
time already? \   |
Hows my hair?) |  |
      |       /   |
      |  (It's    |
      |  fine.)  /
      |   /     /    
   {| a |m}   >>=   f

But for the case of Nothing

        (Yah what is it?)       
(... There      |
is no a. )      |
  |        (No a?)
(No a.)         |
  |        (Ok, I'll deal
  |         with this.)
   \            |
    \      (Hey f, get lost.) 
     \          |   ( Where's my a? 
      \         |     I evaluate a)
       \    (Not any more  |
        \    you don't.    |
         |   We're returning
         |   Nothing.)   /
         |      |       /
         |      |      /
         |      |     /
   {| a |m}   >>=   f      (I got a b.)
                    |  (This is   \
                    |   such a     \
                    |   sham.) o o  \
                    |               o|
                    |--later-> {| b |m}

So the Maybe monad lets a computation continue if it actually contains the a it advertises, but aborts the computation if it doesn't. The result, however is still a piece of monadic data, though not the output of f. For this reason, the Maybe monad is used to represent the context of failure.

Different monads behave differently. Lists are other types of data with monadic instances. They behave like the following:

(Ok, here's your a. Well, its
 a bunch of them, actually.)
  |
  |    (Thanks, no problem. Ok
  |     f, here you go, an a.)
  |       |
  |       |        (Thank's. See
  |       |         you later.)
  |  (Whoa. Hold up f,      |
  |   I got another         |
  |   a for you.)           |
  |       |      (What? No, sorry.
  |       |       Can't do it. I 
  |       |       have my hands full
  |       |       with all these "b" 
  |       |       I just made.) 
  |  (I'll hold those,      |
  |   you take this, and   /
  |   come back for more  /
  |   when you're done   / 
  |   and we'll do it   / 
  |   again.)          /
   \      |  ( Uhhh. All right.)
    \     |       /    
     \    \      /
{| a |m}   >>=  f  

In this case, the function knew how to make a list from it's input, but didn't know what to do with extra input and extra lists. The bind >>=, helped f out by combining the multiple outputs. I include this example to show that while >>= is responsible for extracting a, it also has access to the eventual bound output of f. Indeed, it will never extract any a unless it knows the eventual output has the same type of context.

There are other monads which are used to represent different contexts. Here's some characterizations of a few more. The IO monad doesn't actually have an a, but it knows a guy and will get that a for you. The State st monad has a secret stash of st that it will pass to f under the table, even though f just came asking for an a. The Reader r monad is similar to State st, although it only lets f look at r.

The point in all this is that any type of data which is declared itself to be a Monad is declaring some sort of context around extracting a value from the monad. The big gain from all this? Well, its easy enough to couch a calculation with some sort of context. It can get messy, however, when stringing together multiple context laden calculations. The monad operations take care of resolving the interactions of context so that the programmer doesn't have to.

Note, that use of the >>= eases a mess by by taking some of the autonomy away from f. That is, in the above case of Nothing for instance, f no longer gets to decide what to do in the case of Nothing; it's encoded in >>=. This is the trade off. If it was necessary for f to decide what to do in the case of Nothing, then f should have been a function from Maybe a to Maybe b. In this case, Maybe being a monad is irrelevant.

Note, however, that sometimes a data type does not export it's constructors (looking at you IO), and if we want to work with the advertised value we have little choice but to work with it's monadic interface.

Display milliseconds in Excel

Right click on Cell B1 and choose Format Cells. In Custom, put the following in the text box labeled Type:

[h]:mm:ss.000 

To set this in code, you can do something like:

Range("A1").NumberFormat = "[h]:mm:ss.000"

That should give you what you're looking for.

NOTE: Specially formatted fields often require that the column width be wide enough for the entire contents of the formatted text. Otherwise, the text will display as ######.

ALTER TABLE on dependent column

If your constraint is on a user type, then don't forget to see if there is a Default Constraint, usually something like DF__TableName__ColumnName__6BAEFA67, if so then you will need to drop the Default Constraint, like this:

ALTER TABLE TableName DROP CONSTRAINT [DF__TableName__ColumnName__6BAEFA67]

For more info see the comments by the brilliant Aaron Bertrand on this answer.

Get all attributes of an element using jQuery

The attributes property contains them all:

$(this).each(function() {
  $.each(this.attributes, function() {
    // this.attributes is not a plain object, but an array
    // of attribute nodes, which contain both the name and value
    if(this.specified) {
      console.log(this.name, this.value);
    }
  });
});

What you can also do is extending .attr so that you can call it like .attr() to get a plain object of all attributes:

(function(old) {
  $.fn.attr = function() {
    if(arguments.length === 0) {
      if(this.length === 0) {
        return null;
      }

      var obj = {};
      $.each(this[0].attributes, function() {
        if(this.specified) {
          obj[this.name] = this.value;
        }
      });
      return obj;
    }

    return old.apply(this, arguments);
  };
})($.fn.attr);

Usage:

var $div = $("<div data-a='1' id='b'>");
$div.attr();  // { "data-a": "1", "id": "b" }

Hot deploy on JBoss - how do I make JBoss "see" the change?

Start the server in debug mode and It will track changes inside methods. Other changes It will ask to restart the module.

HTML5 Email input pattern attribute

I have tested the following regex which gives the same result as Chrome Html email input validation.

[a-z0-9!#$%&'*+\/=?^_`{|}~.-]+@[a-z0-9-]+(\.[a-z0-9-]+)*

You can test it out on this website: regex101

Update a local branch with the changes from a tracked remote branch

You don't use the : syntax - pull always modifies the currently checked-out branch. Thus:

git pull origin my_remote_branch

while you have my_local_branch checked out will do what you want.

Since you already have the tracking branch set, you don't even need to specify - you could just do...

git pull

while you have my_local_branch checked out, and it will update from the tracked branch.

How to add headers to a multicolumn listbox in an Excel userform using VBA

Just use two Listboxes, one for header and other for data

  1. for headers - set RowSource property to top row e.g. Incidents!Q4:S4

  2. for data - set Row Source Property to Incidents!Q5:S10

SpecialEffects to "3-frmSpecialEffectsEtched" enter image description here

How to create a JPA query with LEFT OUTER JOIN

If you have entities A and B without any relation between them and there is strictly 0 or 1 B for each A, you could do:

select a, (select b from B b where b.joinProperty = a.joinProperty) from A a

This would give you an Object[]{a,b} for a single result or List<Object[]{a,b}> for multiple results.

Extract elements of list at odd positions

Solution

Yes, you can:

l = L[1::2]

And this is all. The result will contain the elements placed on the following positions (0-based, so first element is at position 0, second at 1 etc.):

1, 3, 5

so the result (actual numbers) will be:

2, 4, 6

Explanation

The [1::2] at the end is just a notation for list slicing. Usually it is in the following form:

some_list[start:stop:step]

If we omitted start, the default (0) would be used. So the first element (at position 0, because the indexes are 0-based) would be selected. In this case the second element will be selected.

Because the second element is omitted, the default is being used (the end of the list). So the list is being iterated from the second element to the end.

We also provided third argument (step) which is 2. Which means that one element will be selected, the next will be skipped, and so on...

So, to sum up, in this case [1::2] means:

  1. take the second element (which, by the way, is an odd element, if you judge from the index),
  2. skip one element (because we have step=2, so we are skipping one, as a contrary to step=1 which is default),
  3. take the next element,
  4. Repeat steps 2.-3. until the end of the list is reached,

EDIT: @PreetKukreti gave a link for another explanation on Python's list slicing notation. See here: Explain Python's slice notation

Extras - replacing counter with enumerate()

In your code, you explicitly create and increase the counter. In Python this is not necessary, as you can enumerate through some iterable using enumerate():

for count, i in enumerate(L):
    if count % 2 == 1:
        l.append(i)

The above serves exactly the same purpose as the code you were using:

count = 0
for i in L:
    if count % 2 == 1:
        l.append(i)
    count += 1

More on emulating for loops with counter in Python: Accessing the index in Python 'for' loops

CFLAGS, CCFLAGS, CXXFLAGS - what exactly do these variables control?

According to the GNU make manual:

CFLAGS: Extra flags to give to the C compiler.
CXXFLAGS: Extra flags to give to the C++ compiler.
CPPFLAGS: Extra flags to give to the C preprocessor and programs that use it (the C and Fortran compilers).

src: https://www.gnu.org/software/make/manual/make.html#index-CFLAGS
note: PP stands for PreProcessor (and not Plus Plus), i.e.

CPP: Program for running the C preprocessor, with results to standard output; default ‘$(CC) -E’.

These variables are used by the implicit rules of make

Compiling C programs
n.o is made automatically from n.c with a recipe of the form
‘$(CC) $(CPPFLAGS) $(CFLAGS) -c’.

Compiling C++ programs
n.o is made automatically from n.cc, n.cpp, or n.C with a recipe of the form
‘$(CXX) $(CPPFLAGS) $(CXXFLAGS) -c’.
We encourage you to use the suffix ‘.cc’ for C++ source files instead of ‘.C’.

src: https://www.gnu.org/software/make/manual/make.html#Catalogue-of-Rules

Convert seconds to Hour:Minute:Second

If you don't like accepted answer or popular ones, then try this one

function secondsToTime($seconds_time)
{
    if ($seconds_time < 24 * 60 * 60) {
        return gmdate('H:i:s', $seconds_time);
    } else {
        $hours = floor($seconds_time / 3600);
        $minutes = floor(($seconds_time - $hours * 3600) / 60);
        $seconds = floor($seconds_time - ($hours * 3600) - ($minutes * 60));
        return "$hours:$minutes:$seconds";
    }
}

secondsToTime(108620); // 30:10:20

Remove decimal values using SQL query

Since all your values end with ".00", there will be no rounding issues, this will work

SELECT CAST(columnname AS INT) AS columnname from tablename

to update

UPDATE tablename
SET columnname = CAST(columnname AS INT)
WHERE .....

What is the max size of localStorage values?

Once I developed Chrome (desktop browser) extension and tested Local Storage real max size for this reason.

My results:

Ubuntu 18.04.1 LTS (64-bit)
Chrome 71.0.3578.98 (Official Build) (64-bit)
Local Storage content size 10240 KB (10 MB)

More than 10240 KB usage returned me the error:

Uncaught DOMException: Failed to execute 'setItem' on 'Storage': Setting the value of 'notes' exceeded the quota.

Edit on Oct 23, 2020

For a Chrome extensions available chrome.storage API. If you declare the "storage" permission in manifest.js:

{
    "name": "My extension",
    ...
    "permissions": ["storage"],
    ...
}

You can access it like this:

chrome.storage.local.QUOTA_BYTES // 5242880 (in bytes)

SQL - Create view from multiple tables

Are you using MySQL or PostgreSQL?

You want to use JOIN syntax, not UNION. For example, using INNER JOIN:

CREATE VIEW V AS
SELECT POP.country, POP.year, POP.pop, FOOD.food, INCOME.income
FROM POP
INNER JOIN FOOD ON (POP.country=FOOD.country) AND (POP.year=FOOD.year)
INNER JOIN INCOME ON (POP.country=INCOME.country) AND (POP.year=INCOME.year)

However, this will only show results when each country and year are present in all three tables. If this is not what you want, look into left outer joins (using the same link above).

Submit button not working in Bootstrap form

Your problem is this

<button type="button" value=" Send" class="btn btn-success" type="submit" id="submit" />

You've set the type twice. Your browser is only accepting the first, which is "button".

<button type="submit" value=" Send" class="btn btn-success" id="submit" />

How to print the values of slices

You could use a for loop to print the []Project as shown in @VonC excellent answer.

package main

import "fmt"

type Project struct{ name string }

func main() {
    projects := []Project{{"p1"}, {"p2"}}
    for i := range projects {
        p := projects[i]
        fmt.Println(p.name) //p1, p2
    }
}

Duplicate Entire MySQL Database

Once upon a time in MySQL you could just copy all the table files to another directory in the mysql tree

mysql cli - create database db2

linux cli - cp db1 db2

CSS white space at bottom of page despite having both min-height and height tag

I faced this issue because my web page was zoomed out to 90% and as I was viewing my page in responsive mode through the browser developer tools, I did not notice it right away.

Why is lock(this) {...} bad?

Because any chunk of code that can see the instance of your class can also lock on that reference. You want to hide (encapsulate) your locking object so that only code that needs to reference it can reference it. The keyword this refers to the current class instance, so any number of things could have reference to it and could use it to do thread synchronization.

To be clear, this is bad because some other chunk of code could use the class instance to lock, and might prevent your code from obtaining a timely lock or could create other thread sync problems. Best case: nothing else uses a reference to your class to lock. Middle case: something uses a reference to your class to do locks and it causes performance problems. Worst case: something uses a reference of your class to do locks and it causes really bad, really subtle, really hard-to-debug problems.

Is arr.__len__() the preferred way to get the length of an array in Python?

The way you take a length of anything for which that makes sense (a list, dictionary, tuple, string, ...) is to call len on it.

l = [1,2,3,4]
s = 'abcde'
len(l) #returns 4
len(s) #returns 5

The reason for the "strange" syntax is that internally python translates len(object) into object.__len__(). This applies to any object. So, if you are defining some class and it makes sense for it to have a length, just define a __len__() method on it and then one can call len on those instances.

Tensorflow import error: No module named 'tensorflow'

I had same issues on Windows 64-bit processor but manage to solve them. Check if your Python is for 32- or 64-bit installation. If it is for 32-bit, then you should download the executable installer (for e.g. you can choose latest Python version - for me is 3.7.3) https://www.python.org/downloads/release/python-373/ -> Scroll to the bottom in Files section and select “Windows x86-64 executable installer”. Download and install it.

The tensorflow installation steps check here : https://www.tensorflow.org/install/pip . I hope this helps somehow ...

Could not load file or assembly 'log4net, Version=1.2.10.0, Culture=neutral, PublicKeyToken=692fbea5521e1304'

To configure IIS to run 32-bit applications you must follow these steps:

Open IIS
Go to current server – > Application Pools
Select the application pool your 32-bit application will run under
Click Advanced setting or Application Pool Default
Set Enable 32-bit Applications to True

If this option is not available to you, follow these next steps:

Go to %windir%\system32\inetsrv\
Execute the appcmd.exe tool:

onKeyDown event not working on divs in React

You're missing the binding of the method in the constructor. This is how React suggests that you do it:

class Whatever {
  constructor() {
    super();
    this.onKeyPressed = this.onKeyPressed.bind(this);
  }

  onKeyPressed(e) {
    // your code ...
  }

  render() {
    return (<div onKeyDown={this.onKeyPressed} />);
  }
}

There are other ways of doing this, but this will be the most efficient at runtime.

What does string::npos mean in this code?

size_t is an unsigned variable, thus 'unsigned value = - 1' automatically makes it the largest possible value for size_t: 18446744073709551615

Scroll Position of div with "overflow: auto"

You need to use the scrollTop property.

document.getElementById('box').scrollTop

How to place two divs next to each other?

My approach:

<div class="left">Left</div>
<div class="right">Right</div>

CSS:

.left {
    float: left;
    width: calc(100% - 200px);
    background: green;
}

.right {
    float: right;
    width: 200px;
    background: yellow;
}

How to find the duration of difference between two dates in java?

   // calculating the difference b/w startDate and endDate
        String startDate = "01-01-2016";
        String endDate = simpleDateFormat.format(currentDate);

        date1 = simpleDateFormat.parse(startDate);
        date2 = simpleDateFormat.parse(endDate);

        long getDiff = date2.getTime() - date1.getTime();

        // using TimeUnit class from java.util.concurrent package
        long getDaysDiff = TimeUnit.MILLISECONDS.toDays(getDiff);

How to calculate difference between two dates in Java

The authorization mechanism you have provided is not supported. Please use AWS4-HMAC-SHA256

Code for Flask (boto3)

Don't forget to import Config. Also If you have your own config class, then change its name.

from botocore.client import Config

s3 = boto3.client('s3',config=Config(signature_version='s3v4'),region_name=app.config["AWS_REGION"],aws_access_key_id=app.config['AWS_ACCESS_KEY'], aws_secret_access_key=app.config['AWS_SECRET_KEY'])
s3.upload_fileobj(file,app.config["AWS_BUCKET_NAME"],file.filename)
url = s3.generate_presigned_url('get_object', Params = {'Bucket':app.config["AWS_BUCKET_NAME"] , 'Key': file.filename}, ExpiresIn = 10000)

Can't start hostednetwork

Let alone enabling the network adapter under Device Manager may not help. The following helped me resolved the issue.

I tried Disabling and Enabling the Wifi Adapter (i.e. the actual Wifi device adapter not the virtual adapters) in Control Panel -> Network and Internet -> Network Connections altogether worked for me. The same can be done from the Device Manager too. This surely resets the adapter settings and for the Wifi Adapter and the Virtual Miniport adapters.

However, please make sure that the mode is set to allow as in the below example before you run the start command.

netsh wlan set hostednetwork mode=allow ssid=ssidOfUrChoice key=keyOfUrChoice

and after that run the command netsh wlan start hostednetwork.

Also once the usage is over with the Miniport adapter connection, it is a good practice to stop it using the following command.

netsh wlan stop hostednetwork

Hope it helps.

Read and write a text file in typescript

import { readFileSync } from 'fs';

const file = readFileSync('./filename.txt', 'utf-8');

This worked for me. You may need to wrap the second command in any function or you may need to declare inside a class without keyword const.