You need to set interval in main div as data-interval tag .
so it is working fine and you can give different time to different slides.
<!--main div -->
<div data-ride="carousel" class="carousel slide" data-interval="100" id="carousel-example-generic">
<!-- Indicators -->
<ol class="carousel-indicators">
<li data-target="#carousel-example-generic" data-slide-to="0" class=""></li>
i>
</ol>
<!-- Wrapper for slides -->
<div role="listbox" class="carousel-inner">
<div class="item">
<a class="carousel-image" href="#">
<img alt="image" src="image.jpg">
</a>
</div>
</div>
</div>
I was having a problem building notifications (only developing for Android 4.0+). This link showed me exactly what I was doing wrong and says the following:
Required notification contents
A Notification object must contain the following:
A small icon, set by setSmallIcon()
A title, set by setContentTitle()
Detail text, set by setContentText()
Basically I was missing one of these. Just as a basis for troubleshooting with this, make sure you have all of these at the very least. Hopefully this will save someone else a headache.
AF_INET = Address Format, Internet = IP Addresses
PF_INET = Packet Format, Internet = IP, TCP/IP or UDP/IP
AF_INET is the address family that is used for the socket you're creating (in this case an Internet Protocol address). The Linux kernel, for example, supports 29 other address families such as UNIX sockets and IPX, and also communications with IRDA and Bluetooth (AF_IRDA and AF_BLUETOOTH, but it is doubtful you'll use these at such a low level).
For the most part sticking with AF_INET for socket programming over a network is the safest option.
Meaning, AF_INET refers to addresses from the internet, IP addresses specifically.
PF_INET refers to anything in the protocol, usually sockets/ports.
There are many ways how you can fix this issue, if you know the root of the issue.
Problem 1
Firstly, it may be a problem with your apache not having the mod_rewrite.c module installed or enabled.
For this reason, you would have to enable it as follows
Open up your console and type into it, this:
sudo a2enmod rewrite
Restart your apache server.
service apache2 restart
Problem 2
You may also, in addition to the above, if it does not work, have to change the override rule from the apache conf file (either apache2.conf, http.conf , or 000-default file).
Locate "Directory /var/www/"
Change the "Override None" to "Override All"
Problem 3
If you get an error stating rewrite module is not found, then probably your userdir module is not enabled. For this reason you need to enable it.
Type this into the console:
sudo a2enmod userdir
Then try enabling the rewrite module if still not enabled (as mentioned above).
To read further on this, you can visit this site: http://seventhsoulmountain.blogspot.com/2014/02/wordpress-permalink-ubuntu-problem-solutions.html
The problem is how 100% height is being calculated. Two ways to deal with this.
Add 20px to the body padding-bottom
body {
padding-bottom: 20px;
}
or add a transparent border to body
body {
border: 1px solid transparent;
}
Both worked for me in firebug
Below are some comments regarding the correctness of my answer to this question. These kinds of discussions are exactly why stackoverflow is so great. Many different people have different opinions on how best to solve the problem. I've learned some incredible coding style that I would not have thought of myself. And I've been told that readers have learned something from my style from time to time. Social coding has really encouraged me to be a better programmer.
Social coding can, at times, be disturbing. I hate it when I spend 30 minutes flushing out an answer with a jsfiddle and detailed explanation only to submit and find 10 other answers all saying the same thing in less detail. And the author accepts someone else's answer. How frustrating! I think that this has happend to my fellow contributors–in particular thirtydot.
Thirtydot's answer is completely legit. The p
around the script
is the culprit in this problem. Remove it and the space goes away. It also is a good answer to this question.
But why? Shouldn't the p
tag's height, padding and margin be calculated into the height of the body?
And it is! If you remove the padding-bottom style that I've suggested and then set the body's background to black, you will see that the body's height includes this extra p
space accurately (you see the strip at the bottom turn to black). But the gradient fails to include it when finding where to start. This is the real problem.
The two solutions that I've offered are ways to tell the browser to calculate the gradient properly. In fact, the padding-bottom could just be 1px. The value isn't important, but the setting is. It makes the browser take a look at where the body ends. Setting the border will have the same effect.
In my opinion, a padding setting of 20px looks the best for this page and that is why I answered it this way. It is addressing the problem of where the gradient starts.
Now, if I were building this page. I would have avoided wrapping the script in a p tag. But I must assume that author of the page either can't change it or has a good reason for putting it in there. I don't know what that script does. Will it write something that needs a p tag? Again, I would avoid this practice and it is fine to question its presence, but also I accept that there are cases where it must be there.
My hope in writing this "defense" is that the people who marked down this answer might consider that decision. My answer is thought out, purposeful, and relevant. The author thought so. However, in this social environment, I respect that you disagree and have a right to degrade my answer. I just hope that your choice is motivated by disagreement with my answer and not that author chose mine over yours.
.CER
files are certificates and don't have the private key. The private key is provided with a .PFX keystore
file normally.
If you really authenticate is because you already had imported the private key.You normally can import .CER
certificates without any problems with
keytool -importcert -file certificate.cer -keystore keystore.jks -alias "Alias"
Checkout this out. It takes care of daylight saving , leap year as it used iOS calendar to calculate.You can change the string and conditions to includes minutes with hours and days.
+(NSString*)remaningTime:(NSDate*)startDate endDate:(NSDate*)endDate
{
NSDateComponents *components;
NSInteger days;
NSInteger hour;
NSInteger minutes;
NSString *durationString;
components = [[NSCalendar currentCalendar] components: NSCalendarUnitDay|NSCalendarUnitHour|NSCalendarUnitMinute fromDate: startDate toDate: endDate options: 0];
days = [components day];
hour = [components hour];
minutes = [components minute];
if(days>0)
{
if(days>1)
durationString=[NSString stringWithFormat:@"%d days",days];
else
durationString=[NSString stringWithFormat:@"%d day",days];
return durationString;
}
if(hour>0)
{
if(hour>1)
durationString=[NSString stringWithFormat:@"%d hours",hour];
else
durationString=[NSString stringWithFormat:@"%d hour",hour];
return durationString;
}
if(minutes>0)
{
if(minutes>1)
durationString = [NSString stringWithFormat:@"%d minutes",minutes];
else
durationString = [NSString stringWithFormat:@"%d minute",minutes];
return durationString;
}
return @"";
}
Try this out:
sudo ldconfig
sudo nano /etc/ld.so.conf.d/opencv.conf
and add this following line in the opencv.conf
not in the command window
/usr/local/lib
Then:
sudo ldconfig
sudo nano /etc/bash.bashrc
and add this two lines in the bash.bashrc
not in the command window
PKG_CONFIG_PATH=$PKG_CONFIG_PATH:/usr/local/lib/pkgconfig
export PKG_CONFIG_PATH
at last reboot your Pi sudo reboot now
and try import cv2
just you need to pass true as an argument to IsHTML() function.
.navbar-default .navbar-nav > li > a{_x000D_
color: #e9b846;_x000D_
}_x000D_
.navbar-default .navbar-nav > li > a:hover{_x000D_
background-color: #e9b846;_x000D_
color: #FFFFFF;_x000D_
}
_x000D_
Here is how you can get a number of table columns using Python 3, sqlite3 and pragma statement:
con = sqlite3.connect(":memory:")
con.execute("CREATE TABLE tablename (d1 VARCHAR, d2 VARCHAR)")
cur = con.cursor()
cur.execute("PRAGMA table_info(tablename)")
print(len(cur.fetchall()))
This worked in my case (only tested in modern browsers):
.textthatneedstobecentered {
margin: auto;
top: 0; bottom: 0;
}
I'm working on this right now as well. You should also add a datetime of the comment. You'll need this later when you want to sort by most recent.
Here are some of the db fields i'm using.
id (auto incremented)
name
email
text
datetime
approved
I also had the same problem, as a quick workaround, I used blend to determine how much padding was being added. In my case it was 12, so I used a negative margin to get rid of it. Now everything can now be centered properly
Limit - 30 symbols. Username must contains only letters, numbers, periods and underscores.
Run
php -m -c
in your terminal, and then look for [Zend Modules]
. It should be somewhere there if it is loaded!
NB
If you're using Ubuntu, it may not show up here because you need to add the xdebug settings from /etc/php5/apache2/php.ini
into /etc/php5/cli/php.ini
. Mine are
[xdebug]
zend_extension = /usr/lib/php5/20121212/xdebug.so
xdebug.remote_enable=on
xdebug.remote_handler=dbgp
xdebug.remote_mode=req
xdebug.remote_host=localhost
xdebug.remote_port=9000
We got an error because we have missing vendor folder in our project, The vendor directory contains our Composer dependencies.
Need /vendor
folder because all packages are there and including all the classes Laravel uses, A problem can be solved after following just two steps:
composer update --no-scripts
composer update
composer.json
composer.json
file, it will replace the previous version installed. The composer.lock
file will be updated to reflect these changes.These two commands, we will Recreate the vendor folder in our project and after that our project will be working smoothly.
In Sublime Text (confirmed in both v2.x and v3.x) there is a menu command:
View -> Syntax -> Open all with current extension as ...
I just found something in the TypeScript language specification, it's fairly easy. I was pretty close.
the syntax is the following:
public myCallback: (name: type) => returntype;
In my example, it would be
class CallbackTest
{
public myCallback: () => void;
public doWork(): void
{
//doing some work...
this.myCallback(); //calling callback
}
}
To be able to use a lib project you need to include it in your application's settings.gradle add:
include '..:ExpandableButtonMenu:library'
and then in your build.gradle add:
compile project(':..:ExpandableButtonMenu:library')
place ExpandableButtonMenu project along side your own (same folder)
see this How to build an android library with Android Studio and gradle? for more details.
This article explains that your sequence might be out of sync and that you have to manually bring it back in sync.
An excerpt from the article in case the URL changes:
If you get this message when trying to insert data into a PostgreSQL database:
ERROR: duplicate key violates unique constraint
That likely means that the primary key sequence in the table you're working with has somehow become out of sync, likely because of a mass import process (or something along those lines). Call it a "bug by design", but it seems that you have to manually reset the a primary key index after restoring from a dump file. At any rate, to see if your values are out of sync, run these two commands:
SELECT MAX(the_primary_key) FROM the_table; SELECT nextval('the_primary_key_sequence');
If the first value is higher than the second value, your sequence is out of sync. Back up your PG database (just in case), then run thisL
SELECT setval('the_primary_key_sequence', (SELECT MAX(the_primary_key) FROM the_table)+1);
That will set the sequence to the next available value that's higher than any existing primary key in the sequence.
Use the LayoutInflater as I shown below.
public View myView() {
View v; // Creating an instance for View Object
LayoutInflater inflater = (LayoutInflater) getContext().getSystemService(Context.LAYOUT_INFLATER_SERVICE);
v = inflater.inflate(R.layout.myview, null);
TextView text1 = v.findViewById(R.id.dolphinTitle);
Button btn1 = v.findViewById(R.id.dolphinMinusButton);
TextView text2 = v.findViewById(R.id.dolphinValue);
Button btn2 = v.findViewById(R.id.dolphinPlusButton);
return v;
}
See this table.
A 101x101 QR code, with high level error correction, can hold 3248 bits, or 406 bytes. Probably not enough for any meaningful SVG/XML data.
A 177x177 grid, depending on desired level of error correction, can store between 1273 and 2953 bytes. Maybe enough to store something small.
FOR MVC
-- WEB.CONFIG CODE IN APP SETTING --
<add key="PhaseLevel" value="1" />
-- ON VIEWS suppose you want to show or hide something based on web.config Value--
-- WRITE THIS ON TOP OF YOUR PAGE--
@{
var phase = System.Configuration.ConfigurationManager.AppSettings["PhaseLevel"].ToString();
}
-- USE ABOVE VALUE WHERE YOU WANT TO SHOW OR HIDE.
@if (phase != "1")
{
@Html.Partial("~/Views/Shared/_LeftSideBarPartial.cshtml")
}
A project's build path defines which resources from your source folders are copied to your output folders. Usually this is set to Include all files.
New run configurations default to using the project directory for the working directory, though this can also be changed.
This code shows the difference between the working directory, and the location of where the class was loaded from:
public class TellMeMyWorkingDirectory {
public static void main(String[] args) {
System.out.println(new java.io.File("").getAbsolutePath());
System.out.println(TellMeMyWorkingDirectory.class.getClassLoader().getResource("").getPath());
}
}
The output is likely to be something like:
C:\your\project\directory
/C:/your/project/directory/bin/
Java is strongly typed. 0 and 1 are numbers, which is a different type than a boolean. A number will never be equal to a boolean.
Python's power operator is **
and Euler's number is math.e
, so:
from math import e
x.append(1-e**(-value1**2/2*value2**2))
Just searched for the docs, and found this:
Containment Operator: The in operator performs containment test. It returns true if the left operand is contained in the right:
{# returns true #}
{{ 1 in [1, 2, 3] }}
{{ 'cd' in 'abcde' }}
Solution with JSON aggregation:
CREATE TEMP TABLE t (
section text
, status text
, ct integer -- don't use "count" as column name.
);
INSERT INTO t VALUES
('A', 'Active', 1), ('A', 'Inactive', 2)
, ('B', 'Active', 4), ('B', 'Inactive', 5)
, ('C', 'Inactive', 7);
SELECT section,
(obj ->> 'Active')::int AS active,
(obj ->> 'Inactive')::int AS inactive
FROM (SELECT section, json_object_agg(status,ct) AS obj
FROM t
GROUP BY section
)X
What are you using to compile this? If there's an undefined reference error, usually it's because the .o file (which gets created from the .cpp file) doesn't exist and your compiler/build system is not able to link it.
Also, in your card.cpp, the function should be Card::Card()
instead of void Card
. The Card::
is scoping; it means that your Card()
function is a member of the Card class (which it obviously is, since it's the constructor for that class). Without this, void Card is just a free function. Similarly,
void Card(Card::Rank rank, Card::Suit suit)
should be
Card::Card(Card::Rank rank, Card::Suit suit)
Also, in deck.cpp, you are saying #include "Deck.h"
even though you referred to it as deck.h. The includes are case sensitive.
This worked for me:
// Change default JQuery validation Messages.
$("#addnewcadidateform").validate({
rules: {
firstname: "required",
lastname: "required",
email: "required email",
},
messages: {
firstname: "Enter your First Name",
lastname: "Enter your Last Name",
email: {
required: "Enter your Email",
email: "Please enter a valid email address.",
}
}
})
I have 2 accounts on my windows machine and I was experiencing this problem with one of them. I did not want to use the sa
account, I wanted to use Windows login. It was not immediately obvious to me that I needed to simply sign into the other account that I used to install SQL Server, and add the permissions for the new account from there
(SSMS > Security > Logins > Add a login there)
Easy way to get the full domain name you need to add there open cmd echo each one.
echo %userdomain%\%username%
Add a login for that user and give it all the permissons for master db and other databases you want. When I say "all permissions" make sure NOT to check of any of the "deny" permissions since that will do the opposite.
While using Django with postgres 10.6, logging was enabled by default, and I was able to simply do:
tail -f /var/log/postgresql/*
Ubuntu 18.04, django 2+, python3+
I'm not trying to provide a yet another alternative solution, but a "meta view" to this problem.
Answers already provided by Oded and Dimitre Novatchev are correct but what people really might mean with phrase "value is a number" is, how would I say it, open to interpretation.
In a way it all comes to this bizarre sounding question: "how do you want to express your numeric values?"
XPath function number()
processes numbers that have
Note that this doesn't include expressions for numerical values that
These are not just made up criteria. An element with content that is according to schema a valid xs:float
value might contain any of the above mentioned characteristics. Yet number()
would return value NaN
.
So answer to your question "How i can check with XPath if a node value is number?" is either "Use already mentioned solutions using number()
" or "with a single XPath 1.0 expression, you can't". Think about the possible number formats you might encounter, and if needed, write some kind of logic for validation/number parsing. Within XSLT processing, this can be done with few suitable extra templates, for example.
PS. If you only care about non-zero numbers, the shortest test is
<xsl:if test="number(myNode)">
<!-- myNode is a non-zero number -->
</xsl:if>
Try
xargs -n2 printf "%-20s%s\n"
or even
xargs printf "%-20s%s\n"
if input is not very large.
To undo: C-_
To redo after a undo: C-g C-_
Type multiple times on C-_ to redo what have been undone by C-_ To redo an emacs command multiple times, execute your command then type C-xz and then type many times on z key to repeat the command (interesting when you want to execute multiple times a macro)
If you're using C# 7, you can use a handy wrapper method like this...
public static class TaskEx
{
public static async Task<(T1, T2)> WhenAll<T1, T2>(Task<T1> task1, Task<T2> task2)
{
return (await task1, await task2);
}
}
...to enable convenient syntax like this when you want to wait on multiple tasks with different return types. You'd have to make multiple overloads for different numbers of tasks to await, of course.
var (someInt, someString) = await TaskEx.WhenAll(GetIntAsync(), GetStringAsync());
However, see Marc Gravell's answer for some optimizations around ValueTask and already-completed tasks if you intend to turn this example into something real.
I've developed an almost flawless try & catch implementation in bash, that allows you to write code like:
try
echo 'Hello'
false
echo 'This will not be displayed'
catch
echo "Error in $__EXCEPTION_SOURCE__ at line: $__EXCEPTION_LINE__!"
You can even nest the try-catch blocks inside themselves!
try {
echo 'Hello'
try {
echo 'Nested Hello'
false
echo 'This will not execute'
} catch {
echo "Nested Caught (@ $__EXCEPTION_LINE__)"
}
false
echo 'This will not execute too'
} catch {
echo "Error in $__EXCEPTION_SOURCE__ at line: $__EXCEPTION_LINE__!"
}
The code is a part of my bash boilerplate/framework. It further extends the idea of try & catch with things like error handling with backtrace and exceptions (plus some other nice features).
Here's the code that's responsible just for try & catch:
set -o pipefail
shopt -s expand_aliases
declare -ig __oo__insideTryCatch=0
# if try-catch is nested, then set +e before so the parent handler doesn't catch us
alias try="[[ \$__oo__insideTryCatch -gt 0 ]] && set +e;
__oo__insideTryCatch+=1; ( set -e;
trap \"Exception.Capture \${LINENO}; \" ERR;"
alias catch=" ); Exception.Extract \$? || "
Exception.Capture() {
local script="${BASH_SOURCE[1]#./}"
if [[ ! -f /tmp/stored_exception_source ]]; then
echo "$script" > /tmp/stored_exception_source
fi
if [[ ! -f /tmp/stored_exception_line ]]; then
echo "$1" > /tmp/stored_exception_line
fi
return 0
}
Exception.Extract() {
if [[ $__oo__insideTryCatch -gt 1 ]]
then
set -e
fi
__oo__insideTryCatch+=-1
__EXCEPTION_CATCH__=( $(Exception.GetLastException) )
local retVal=$1
if [[ $retVal -gt 0 ]]
then
# BACKWARDS COMPATIBILE WAY:
# export __EXCEPTION_SOURCE__="${__EXCEPTION_CATCH__[(${#__EXCEPTION_CATCH__[@]}-1)]}"
# export __EXCEPTION_LINE__="${__EXCEPTION_CATCH__[(${#__EXCEPTION_CATCH__[@]}-2)]}"
export __EXCEPTION_SOURCE__="${__EXCEPTION_CATCH__[-1]}"
export __EXCEPTION_LINE__="${__EXCEPTION_CATCH__[-2]}"
export __EXCEPTION__="${__EXCEPTION_CATCH__[@]:0:(${#__EXCEPTION_CATCH__[@]} - 2)}"
return 1 # so that we may continue with a "catch"
fi
}
Exception.GetLastException() {
if [[ -f /tmp/stored_exception ]] && [[ -f /tmp/stored_exception_line ]] && [[ -f /tmp/stored_exception_source ]]
then
cat /tmp/stored_exception
cat /tmp/stored_exception_line
cat /tmp/stored_exception_source
else
echo -e " \n${BASH_LINENO[1]}\n${BASH_SOURCE[2]#./}"
fi
rm -f /tmp/stored_exception /tmp/stored_exception_line /tmp/stored_exception_source
return 0
}
Feel free to use, fork and contribute - it's on GitHub.
If you are looking inside dockerfile while creating image, add this line:
RUN apk add --update yourPackageName
A way to be able to use {% break %}
or {% continue %}
is to write TokenParser
s for them.
I did it for the {% break %}
token in the code below. You can, without much modifications, do the same thing for the {% continue %}
.
AppBundle\Twig\AppExtension.php:
namespace AppBundle\Twig;
class AppExtension extends \Twig_Extension
{
function getTokenParsers() {
return array(
new BreakToken(),
);
}
public function getName()
{
return 'app_extension';
}
}
AppBundle\Twig\BreakToken.php:
namespace AppBundle\Twig;
class BreakToken extends \Twig_TokenParser
{
public function parse(\Twig_Token $token)
{
$stream = $this->parser->getStream();
$stream->expect(\Twig_Token::BLOCK_END_TYPE);
// Trick to check if we are currently in a loop.
$currentForLoop = 0;
for ($i = 1; true; $i++) {
try {
// if we look before the beginning of the stream
// the stream will throw a \Twig_Error_Syntax
$token = $stream->look(-$i);
} catch (\Twig_Error_Syntax $e) {
break;
}
if ($token->test(\Twig_Token::NAME_TYPE, 'for')) {
$currentForLoop++;
} else if ($token->test(\Twig_Token::NAME_TYPE, 'endfor')) {
$currentForLoop--;
}
}
if ($currentForLoop < 1) {
throw new \Twig_Error_Syntax(
'Break tag is only allowed in \'for\' loops.',
$stream->getCurrent()->getLine(),
$stream->getSourceContext()->getName()
);
}
return new BreakNode();
}
public function getTag()
{
return 'break';
}
}
AppBundle\Twig\BreakNode.php:
namespace AppBundle\Twig;
class BreakNode extends \Twig_Node
{
public function compile(\Twig_Compiler $compiler)
{
$compiler
->write("break;\n")
;
}
}
Then you can simply use {% break %}
to get out of loops like this:
{% for post in posts %}
{% if post.id == 10 %}
{% break %}
{% endif %}
<h2>{{ post.heading }}</h2>
{% endfor %}
To go even further, you may write token parsers for {% continue X %}
and {% break X %}
(where X is an integer >= 1) to get out/continue multiple loops like in PHP.
Copy your source folder to somedir
:
cp -r srcdir
somedir
Remove all unneeded files:
find somedir -name '.svn' -exec rm -rf {} \+
launch scp from somedir
Here's a jsfiddle with a function call: https://jsfiddle.net/8282emwn/
var marker = new L.Marker([46.947, 7.4448]).on('click', markerOnClick).addTo(map);
function markerOnClick(e)
{
alert("hi. you clicked the marker at " + e.latlng);
}
Go to the start menu. Open up cmd (command prompt) and type in the following.
wmic process list brief | find /i "tomcat"
This would tell you if the tomcat is running or not.
As of Mac OS X v10.6 (Snow Leopard), you can run Java 6 in 32-bit mode on either 32-bit or 64-bit Intel processor equipped Macs.
If you cannot upgrade to Snow Leopard, Soy Latte is a pre-compiled version of Java 6 for Intel 32-bit.
If you are using C++ and don't want/can't use Boost, you can print backtrace with demangled names using the following code [link to the original site].
Note, this solution is specific to Linux. It uses GNU's libc functions backtrace()/backtrace_symbols() (from execinfo.h) to get the backtraces and then uses __cxa_demangle() (from cxxabi.h) for demangling the backtrace symbol names.
// stacktrace.h (c) 2008, Timo Bingmann from http://idlebox.net/
// published under the WTFPL v2.0
#ifndef _STACKTRACE_H_
#define _STACKTRACE_H_
#include <stdio.h>
#include <stdlib.h>
#include <execinfo.h>
#include <cxxabi.h>
/** Print a demangled stack backtrace of the caller function to FILE* out. */
static inline void print_stacktrace(FILE *out = stderr, unsigned int max_frames = 63)
{
fprintf(out, "stack trace:\n");
// storage array for stack trace address data
void* addrlist[max_frames+1];
// retrieve current stack addresses
int addrlen = backtrace(addrlist, sizeof(addrlist) / sizeof(void*));
if (addrlen == 0) {
fprintf(out, " <empty, possibly corrupt>\n");
return;
}
// resolve addresses into strings containing "filename(function+address)",
// this array must be free()-ed
char** symbollist = backtrace_symbols(addrlist, addrlen);
// allocate string which will be filled with the demangled function name
size_t funcnamesize = 256;
char* funcname = (char*)malloc(funcnamesize);
// iterate over the returned symbol lines. skip the first, it is the
// address of this function.
for (int i = 1; i < addrlen; i++)
{
char *begin_name = 0, *begin_offset = 0, *end_offset = 0;
// find parentheses and +address offset surrounding the mangled name:
// ./module(function+0x15c) [0x8048a6d]
for (char *p = symbollist[i]; *p; ++p)
{
if (*p == '(')
begin_name = p;
else if (*p == '+')
begin_offset = p;
else if (*p == ')' && begin_offset) {
end_offset = p;
break;
}
}
if (begin_name && begin_offset && end_offset
&& begin_name < begin_offset)
{
*begin_name++ = '\0';
*begin_offset++ = '\0';
*end_offset = '\0';
// mangled name is now in [begin_name, begin_offset) and caller
// offset in [begin_offset, end_offset). now apply
// __cxa_demangle():
int status;
char* ret = abi::__cxa_demangle(begin_name,
funcname, &funcnamesize, &status);
if (status == 0) {
funcname = ret; // use possibly realloc()-ed string
fprintf(out, " %s : %s+%s\n",
symbollist[i], funcname, begin_offset);
}
else {
// demangling failed. Output function name as a C function with
// no arguments.
fprintf(out, " %s : %s()+%s\n",
symbollist[i], begin_name, begin_offset);
}
}
else
{
// couldn't parse the line? print the whole line.
fprintf(out, " %s\n", symbollist[i]);
}
}
free(funcname);
free(symbollist);
}
#endif // _STACKTRACE_H_
HTH!
The S parameter does not do anything on its own.
/S Modifies the treatment of string after /C or /K (see below)
/C Carries out the command specified by string and then terminates
/K Carries out the command specified by string but remains
Try something like this instead
Call Shell("cmd.exe /S /K" & "perl a.pl c:\temp", vbNormalFocus)
You may not even need to add "cmd.exe" to this command unless you want a command window to open up when this is run. Shell should execute the command on its own.
Shell("perl a.pl c:\temp")
-Edit-
To wait for the command to finish you will have to do something like @Nate Hekman shows in his answer here
Dim wsh As Object
Set wsh = VBA.CreateObject("WScript.Shell")
Dim waitOnReturn As Boolean: waitOnReturn = True
Dim windowStyle As Integer: windowStyle = 1
wsh.Run "cmd.exe /S /C perl a.pl c:\temp", windowStyle, waitOnReturn
A simple solution is encapsulate code of button event in a function, and call it when you add TRs too:
var i = 1;
$("#addbutton").click(function() {
$("table tr:first").clone().find("input").each(function() {
$(this).val('').attr({
'id': function(_, id) {return id + i },
'name': function(_, name) { return name + i },
'value': ''
});
}).end().appendTo("table");
i++;
applyRemoveEvent();
});
function applyRemoveEvent(){
$('button.removebutton').on('click',function() {
alert("aa");
$(this).closest( 'tr').remove();
return false;
});
};
applyRemoveEvent();
If column A contains the amounts to be reimbursed, and column B contains the "yes/no" indicating whether the reimbursement has been made, then either of the following will work, though the first option is recommended:
=SUMIF(B:B,"No",A:A)
or
=SUMIFS(A:A,B:B,"No")
Here is an example that will display the amounts paid and outstanding for a small set of sample data.
A B C D
Amount Reimbursed? Total Paid: =SUMIF(B:B,"Yes",A:A)
$100 Yes Total Outstanding: =SUMIF(B:B,"No",A:A)
$200 No
$300 No
$400 Yes
$500 No
>>> class X(object):
... pass
...
>>> type(X)
<type 'type'>
>>> isinstance(X,type)
True
If for example your html code contain this code:
<select id="selectId"><option>Test1</option><option>Test2</option></select>
In order to change the list of option inside your select, you can use this code bellow. when your name select named selectId.
var option = $('<option></option>').attr("value", "option value").text("Text");
$("#selectId").html(option);
in this example above i change the old list of option by only one new option.
In angular using material design sidenav I had to use the following:
let ele = document.getElementsByClassName('md-sidenav-content');
let eleArray = <Element[]>Array.prototype.slice.call(ele);
eleArray.map( val => {
val.scrollTop = val.scrollHeight;
});
Find out the process ID (PID) which is occupying the port number (e.g., 5955) you would like to free
sudo lsof -i :5955
Kill the process which is currently using the port using its PID
sudo kill -9 PID
try
System.IO.Path.GetFileNameWithoutExtension(path);
demo
string fileName = @"C:\mydir\myfile.ext";
string path = @"C:\mydir\";
string result;
result = Path.GetFileNameWithoutExtension(fileName);
Console.WriteLine("GetFileNameWithoutExtension('{0}') returns '{1}'",
fileName, result);
result = Path.GetFileName(path);
Console.WriteLine("GetFileName('{0}') returns '{1}'",
path, result);
// This code produces output similar to the following:
//
// GetFileNameWithoutExtension('C:\mydir\myfile.ext') returns 'myfile'
// GetFileName('C:\mydir\') returns ''
It is a syntax sugar for faster query writing. Its implementation in pseudocode:
def filter_by(self, **kwargs):
return self.filter(sql.and_(**kwargs))
For AND you can simply write:
session.query(db.users).filter_by(name='Joe', surname='Dodson')
btw
session.query(db.users).filter(or_(db.users.name=='Ryan', db.users.country=='England'))
can be written as
session.query(db.users).filter((db.users.name=='Ryan') | (db.users.country=='England'))
Also you can get object directly by PK via get
method:
Users.query.get(123)
# And even by a composite PK
Users.query.get(123, 321)
When using get
case its important that object can be returned without database request from identity map
which can be used as cache(associated with transaction)
If you want to print in the tabular form with, then you can use this:
echo "<tr> <td><h3> ".$cat['id']."</h3></td><td><h3> ".$cat['title']."<h3></</td><td> <h3>".$cat['desc']."</h3></td><td><h3> ".$cat['process']."%"."<a href='taskUpdate.php' >Update</a>"."</h3></td></tr>" ;
So I finally got it(http://jsfiddle.net/ncapito/eYtU5/):
.centerWrapper:before {
content:'';
height: 100%;
display: inline-block;
vertical-align: middle;
}
.center {
display:inline-block;
vertical-align: middle;
}
<div class='row'>
<div class='login-icon'>
<div class='centerWrapper'>
<div class='center'> <i class='icon-user'></i></div>
</div>
</div>
<input type="text" placeholder="Email" />
</div>
Sometimes you don't control the target machine (e.g. your library needs to run on a locked-down enterprise system). In such a case you will need to recompile your code using the version of GCC that corresponds to their GLIBCXX version. In that case, you can do the following:
strings /usr/lib/libstdc++.so.6 | grep GLIBC
... Say the version is 3.4.19
.[4.8.3, 4.9.0)
.In addition, for those looking to replace more than one character in a column, you can do it using regular expressions:
import re
chars_to_remove = ['.', '-', '(', ')', '']
regular_expression = '[' + re.escape (''. join (chars_to_remove)) + ']'
df['string_col'].str.replace(regular_expression, '', regex=True)
Arrays in Java start indexing at 0. So in your example you are referring to an element that is outside the array by one.
It should probably be something like freq[Global.iParameter[2]-1]=false;
You would need to loop through the array to initialize all of it, this line only initializes the last element.
Actually, I'm pretty sure that false is default for booleans in Java, so you might not need to initialize at all.
Best Regards
Personnaly I encountered this issue while migrating a IIS6 website into IIS7, in order to fix this issue I used this command line :
%windir%\System32\inetsrv\appcmd migrate config "MyWebSite\"
Make sure to backup your web.config
Remove the file from the index, but keep it versioned and left with uncommitted changes in working copy:
git reset head <file>
Reset the file to the last state from HEAD, undoing changes and removing them from the index:
git reset HEAD <file>
git checkout <file>
# If you have a `<branch>` named like `<file>`, use:
git checkout -- <file>
This is needed since git reset --hard HEAD
won't work with single files.
Remove <file>
from index and versioning, keeping the un-versioned file with changes in working copy:
git rm --cached <file>
Remove <file>
from working copy and versioning completely:
git rm <file>
Have added ErrorHandler to this in case the user hits the cancel button instead of selecting a folder. So instead of getting a horrible error message you get a message that a folder must be selected and then the routine ends. Below code also stores the folder path in a range name (Which is just linked to cell A1 on a sheet).
Sub SelectFolder()
Dim diaFolder As FileDialog
'Open the file dialog
On Error GoTo ErrorHandler
Set diaFolder = Application.FileDialog(msoFileDialogFolderPicker)
diaFolder.AllowMultiSelect = False
diaFolder.Title = "Select a folder then hit OK"
diaFolder.Show
Range("IC_Files_Path").Value = diaFolder.SelectedItems(1)
Set diaFolder = Nothing
Exit Sub
ErrorHandler:
Msg = "No folder selected, you must select a folder for program to run"
Style = vbError
Title = "Need to Select Folder"
Response = MsgBox(Msg, Style, Title)
End Sub
If you want to just accept defaults you can use:
\n | ./shell_being_run
I was getting the same exception, whenever a page was getting loaded,
NFO: Error parsing HTTP request header
Note: further occurrences of HTTP header parsing errors will be logged at DEBUG level.
java.lang.IllegalArgumentException: Invalid character found in method name. HTTP method names must be tokens
at org.apache.coyote.http11.InternalInputBuffer.parseRequestLine(InternalInputBuffer.java:139)
at org.apache.coyote.http11.AbstractHttp11Processor.process(AbstractHttp11Processor.java:1028)
at org.apache.coyote.AbstractProtocol$AbstractConnectionHandler.process(AbstractProtocol.java:637)
at org.apache.tomcat.util.net.JIoEndpoint$SocketProcessor.run(JIoEndpoint.java:316)
at java.util.concurrent.ThreadPoolExecutor.runWorker(ThreadPoolExecutor.java:1149)
at java.util.concurrent.ThreadPoolExecutor$Worker.run(ThreadPoolExecutor.java:624)
at org.apache.tomcat.util.threads.TaskThread$WrappingRunnable.run(TaskThread.java:61)
at java.lang.Thread.run(Thread.java:748)
I found that one of my page URL was https instead of http, when I changed the same, error was gone.
I used Custom Action separately coded in C++ DLL and used the DLL to call appropriate function on Uninstalling using this syntax :
<CustomAction Id="Uninstall" BinaryKey="Dll_Name"
DllEntry="Function_Name" Execute="deferred" />
Using the above code block, I was able to run any function defined in C++ DLL on uninstall. FYI, my uninstall function had code regarding Clearing current user data and registry entries.
Using NotificationCenter and UIDevice's beginGeneratingDeviceOrientationNotifications
Swift 4.2+
override func viewDidLoad() {
super.viewDidLoad()
NotificationCenter.default.addObserver(self, selector: #selector(ViewController.rotated), name: UIDevice.orientationDidChangeNotification, object: nil)
}
deinit {
NotificationCenter.default.removeObserver(self, name: UIDevice.orientationDidChangeNotification, object: nil)
}
func rotated() {
if UIDevice.current.orientation.isLandscape {
print("Landscape")
} else {
print("Portrait")
}
}
Swift 3
override func viewDidLoad() {
super.viewDidLoad()
NotificationCenter.default.addObserver(self, selector: #selector(ViewController.rotated), name: NSNotification.Name.UIDeviceOrientationDidChange, object: nil)
}
deinit {
NotificationCenter.default.removeObserver(self)
}
func rotated() {
if UIDevice.current.orientation.isLandscape {
print("Landscape")
} else {
print("Portrait")
}
}
This answer I've got following tips here, so it is not really mine. It works for me using LATIN1 or UTF-8. If you use other charsets, you probably should add them to mb_detect_encoding
function. Correct environment set is probably needed also.
function NoAccents($s){
return iconv(mb_detect_encoding($s,'UTF-8, ASCII, ISO-8859-1'),'ASCII//TRANSLIT//INGORE',$s);
}
I am having a similar problem while updating from 2.3.2 to 2.3.3.
Go to the bin
folder of your Android Studio installation folder:
e.g.
cd opt/android-studio/bin
Provide run permission for studio.sh file: chmod +x studio.sh
Run Android Studio from here: ./studio.sh
and try "update and restart"
from android studio.
You can use Sorted Set in redis to get a TTL container with timestamp as score.
For example, whenever you insert a event string into the set you can set its score to the event time.
Thus you can get data of any time window by calling
zrangebyscore "your set name" min-time max-time
Moreover, we can do expire by using zremrangebyscore "your set name" min-time max-time
to remove old events.
The only drawback here is you have to do housekeeping from an outsider process to maintain the size of the set.
Your error is also shown when trying to access the sizeof()
of an non-initialized extern array:
extern int a[];
sizeof(a);
>> error: invalid application of 'sizeof' to incomplete type 'int[]'
Note that you would get an array size missing
error without the extern
keyword.
Without seeing said object list, I believe you should be binding to the DataGrid's ItemsSource
property, not its DataContext
.
<DataGrid x:Name="Imported" VerticalAlignment="Top" ItemsSource="{Binding Source=list}" AutoGenerateColumns="False" CanUserResizeColumns="True">
<DataGrid.Columns>
<DataGridTextColumn Header="ID" Binding="{Binding ID}"/>
<DataGridTextColumn Header="Date" Binding="{Binding Date}"/>
</DataGrid.Columns>
</DataGrid>
(This assumes that the element [UserControl, etc.] that contains the DataGrid has its DataContext bound to an object that contains the list
collection. The DataGrid is derived from ItemsControl
, which relies on its ItemsSource
property to define the collection it binds its rows to. Hence, if list
isn't a property of an object bound to your control's DataContext, you might need to set both DataContext={Binding list}
and ItemsSource={Binding list}
on the DataGrid...)
In order to avoid ORDER BY items must appear in the select list if SELECT DISTINCT
error, the best should be
var results = (
from ta in DBContext.TestAddresses
select ta.Name
)
.Distinct()
.OrderBy( x => 1);
printf("%0k.yf" float_variable_name)
Here k
is the total number of characters you want to get printed. k = x + 1 + y
(+ 1
for the dot) and float_variable_name
is the float variable that you want to get printed.
Suppose you want to print x digits before the decimal point and y digits after it. Now, if the number of digits before float_variable_name is less than x, then it will automatically prepend that many zeroes before it.
I guess you're learning how to Python. The other answers are right. But I am going to answer your main question: "how to calculate percentage in python"
Although it works the way you did it, it doesn´t look very pythonic. Also, what happens if you need to add a new subject? You'll have to add another variable, use another input, etc. I guess you want the average of all marks, so you will also have to modify the count of the subjects everytime you add a new one! Seems a mess...
I´ll throw a piece of code where the only thing you'll have to do is to add the name of the new subject in a list. If you try to understand this simple piece of code, your Python coding skills will experiment a little bump.
#!/usr/local/bin/python2.7
marks = {} #a dictionary, it's a list of (key : value) pairs (eg. "Maths" : 34)
subjects = ["Tamil","English","Maths","Science","Social"] # this is a list
#here we populate the dictionary with the marks for every subject
for subject in subjects:
marks[subject] = input("Enter the " + subject + " marks: ")
#and finally the calculation of the total and the average
total = sum(marks.itervalues())
average = float(total) / len(marks)
print ("The total is " + str(total) + " and the average is " + str(average))
Here you can test the code and experiment with it.
Sometimes PostgreSQL fails to make the best choice of indexes for a particular condition. As an example, suppose there is a transactions table with several million rows, of which there are several hundred for any given day, and the table has four indexes: transaction_id, client_id, date, and description. You want to run the following query:
SELECT client_id, SUM(amount)
FROM transactions
WHERE date >= 'yesterday'::timestamp AND date < 'today'::timestamp AND
description = 'Refund'
GROUP BY client_id
PostgreSQL may choose to use the index transactions_description_idx instead of transactions_date_idx, which may lead to the query taking several minutes instead of less than one second. If this is the case, you can force using the index on date by fudging the condition like this:
SELECT client_id, SUM(amount)
FROM transactions
WHERE date >= 'yesterday'::timestamp AND date < 'today'::timestamp AND
description||'' = 'Refund'
GROUP BY client_id
RUN
- command triggers while we build the docker image.
CMD
- command triggers while we launch the created docker image.
You can use .css()
to get the value of "visibility":
if( ! ( $("#singlechatpanel-1").css('visibility') === "hidden")){
}
In hibernate.cfg.xml , please put following code
<mapping class="class/bo name"/>
I believe you can do this:
gem "foo", path: "/path/to/foo"
Your class JSON_result
does not match your JSON string. Note how the object JSON_result
is going to represent is wrapped in another property named "Venue"
.
So either create a class for that, e.g.:
Public Class Container
Public Venue As JSON_result
End Class
Public Class JSON_result
Public ID As Integer
Public Name As String
Public NameWithTown As String
Public NameWithDestination As String
Public ListingType As String
End Class
Dim obj = JsonConvert.DeserializeObject(Of Container)(...your_json...)
or change your JSON string to
{
"ID": 3145,
"Name": "Big Venue, Clapton",
"NameWithTown": "Big Venue, Clapton, London",
"NameWithDestination": "Big Venue, Clapton, London",
"ListingType": "A",
"Address": {
"Address1": "Clapton Raod",
"Address2": "",
"Town": "Clapton",
"County": "Greater London",
"Postcode": "PO1 1ST",
"Country": "United Kingdom",
"Region": "Europe"
},
"ResponseStatus": {
"ErrorCode": "200",
"Message": "OK"
}
}
or use e.g. a ContractResolver
to parse the JSON string.
public static void main (String[] args)
{
Scanner s = new Scanner(System.in);
System.out.println("Please enter size of an array");
int n=s.nextInt();
double arr[] = new double[n];
System.out.println("Please enter elements of array:");
for (int i=0; i<n; i++)
{
arr[i] = s.nextDouble();
}
}
Git comes with a couple of GUI clients that helps you visualize this. Open GitGUI and go to menu Repository > Visualize All Branch History
Yes you just need to install the other version of python, and define the location of your other version of python in your command like :
virtualenv /home/payroll/Documents/env -p /usr/bin/python3
As per the official documentation of the jquery sortable UI: http://api.jqueryui.com/sortable/#method-toArray
In update event. use:
var sortedIDs = $( ".selector" ).sortable( "toArray" );
and if you alert or console this var (sortedIDs). You'll get your sequence. Please choose as the "Right Answer" if it is a right one.
If you want a simple method in your code that returns the milliseconds with datetime:
from datetime import datetime
from datetime import timedelta
start_time = datetime.now()
# returns the elapsed milliseconds since the start of the program
def millis():
dt = datetime.now() - start_time
ms = (dt.days * 24 * 60 * 60 + dt.seconds) * 1000 + dt.microseconds / 1000.0
return ms
Dim obj : Set obj = CreateObject("Scripting.FileSystemObject")
Dim outFile : Set outFile = obj.CreateTextFile("in.txt")
Dim inFile: Set inFile = obj.OpenTextFile("out.txt")
' Read file
Dim strRetVal : strRetVal = inFile.ReadAll
inFile.Close
' Write file
outFile.write (strRetVal)
outFile.Close
Try this:
myfile %>% mutate(V5 = (V1 == 1 & V2 != 4) + 2 * (V2 == 4 & V3 != 1))
giving:
V1 V2 V3 V4 V5
1 1 2 3 5 1
2 2 4 4 1 2
3 1 4 1 1 0
4 4 5 1 3 0
5 5 5 5 4 0
or this:
myfile %>% mutate(V5 = ifelse(V1 == 1 & V2 != 4, 1, ifelse(V2 == 4 & V3 != 1, 2, 0)))
giving:
V1 V2 V3 V4 V5
1 1 2 3 5 1
2 2 4 4 1 2
3 1 4 1 1 0
4 4 5 1 3 0
5 5 5 5 4 0
Suggest you get a better name for your data frame. myfile makes it seem as if it holds a file name.
Above used this input:
myfile <-
structure(list(V1 = c(1L, 2L, 1L, 4L, 5L), V2 = c(2L, 4L, 4L,
5L, 5L), V3 = c(3L, 4L, 1L, 1L, 5L), V4 = c(5L, 1L, 1L, 3L, 4L
)), .Names = c("V1", "V2", "V3", "V4"), class = "data.frame", row.names = c("1",
"2", "3", "4", "5"))
Update 1 Since originally posted dplyr has changed %.%
to %>%
so have modified answer accordingly.
Update 2 dplyr now has case_when
which provides another solution:
myfile %>%
mutate(V5 = case_when(V1 == 1 & V2 != 4 ~ 1,
V2 == 4 & V3 != 1 ~ 2,
TRUE ~ 0))
You are converting cert into BKS Keystore, why aren't you using .cert
directly, from https://developer.android.com/training/articles/security-ssl.html:
CertificateFactory cf = CertificateFactory.getInstance("X.509");
InputStream instream = context.getResources().openRawResource(R.raw.gtux_cert);
Certificate ca;
try {
ca = cf.generateCertificate(instream);
} finally {
caInput.close();
}
KeyStore kStore = KeyStore.getInstance(KeyStore.getDefaultType());
kStore.load(null, null);
kStore.setCertificateEntry("ca", ca);
TrustManagerFactory tmf = TrustManagerFactory.getInstance(TrustManagerFactory.getDefaultAlgorithm(););
tmf.init(kStore);
SSLContext context = SSLContext.getInstance("TLS");
context.init(null, tmf.getTrustManagers(), null);
okHttpClient.setSslSocketFactory(context.getSocketFactory());
If it is for use within your website, it's better practice to use relative URL, like this if you need to move the website to another domain name or just debug locally, you can.
Take a look at what's stackoverflow is doing (ctrl+U in firefox):
<a href="/users/recent/90691"> // Link to an internal element
In some cases they use absolute urls :
<link rel="stylesheet" href="http://sstatic.net/so/all.css?v=5934">
... but this is only it's a best practice to improve speed. In your case, it doesn't look like you're doing anything like that so I wouldn't worry about it.
This is a little bit fancy... but it works:
Step 1: Create a Powershell Profile:
FILE: install_profile.ps1
# THIS SCRIPT BLOWS AWAY YOUR DEFAULT POWERSHELL PROFILE SCRIPT
# AND INSTALLS A POINTER TO A GLOBAL POWERSHELL PROFILE
$ErrorActionPreference = "Stop"
function print ([string]$msg)
{
Write-Host -ForegroundColor Green $msg
}
print ""
# User's Powershell Profile
$psdir = "$env:USERPROFILE\Documents\WindowsPowerShell"
$psfile = $psdir + "\Microsoft.PowerShell_profile.ps1"
print "Creating Directory: $psdir"
md $psdir -ErrorAction SilentlyContinue | out-null
# this is your auto-generated powershell profile to be installed
$content = @(
"",
". ~/Documents/tools/profile.ps1",
""
)
print "Creating File: $psfile"
[System.IO.File]::WriteAllLines($psfile, $content)
print ""
# Make sure Powershell profile is readable
Set-ExecutionPolicy -Scope CurrentUser Unrestricted
Step 2: then in tools ~/Documents/tools/profile.ps1:
function Do-ActualThing {
# do actual thing
}
Set-Alias MyAlias Do-ActualThing
Step 3:
$ Set-ExecutionPolicy -Scope CurrentUser Unrestricted $ . ./install_profile.ps1
Yes there is a difference!
The immediate effect of using innerHTML
versus dangerouslySetInnerHTML
is identical -- the DOM node will update with the injected HTML.
However, behind the scenes when you use dangerouslySetInnerHTML
it lets React know that the HTML inside of that component is not something it cares about.
Because React uses a virtual DOM, when it goes to compare the diff against the actual DOM, it can straight up bypass checking the children of that node because it knows the HTML is coming from another source. So there's performance gains.
More importantly, if you simply use innerHTML
, React has no way to know the DOM node has been modified. The next time the render
function is called, React will overwrite the content that was manually injected with what it thinks the correct state of that DOM node should be.
Your solution to use componentDidUpdate
to always ensure the content is in sync I believe would work but there might be a flash during each render.
It’s less confusing to always use an escaped hyphen, so that it doesn't have to be positionally dependent. That’s a \-
inside the bracketed character class.
But there’s something else to consider. Some of those enumerated characters should possibly be written differently. In some circumstances, they definitely should.
This comparison of regex flavors says that C? can use some of the simpler Unicode properties. If you’re dealing with Unicode, you should probably use the general category \p{L}
for all possible letters, and maybe \p{Nd}
for decimal numbers. Also, if you want to accomodate all that dash punctuation, not just HYPHEN-MINUS, you should use the \p{Pd}
property. You might also want to write that sequence of whitespace characters simply as \s
, assuming that’s not too general for you.
All together, that works out to apattern of [\p{L}\p{Nd}\p{Pd}!$*]
to match any one character from that set.
I’d likely use that anyway, even if I didn’t plan on dealing with the full Unicode set, because it’s a good habit to get into, and because these things often grow beyond their original parameters. Now when you lift it to use in other code, it will still work correctly. If you hard-code all the characters, it won’t.
I think you wanted to do this:
while( $row = mysql_fetch_assoc( $result)){
$new_array[] = $row; // Inside while loop
}
Or maybe store id as key too
$new_array[ $row['id']] = $row;
Using the second ways you would be able to address rows directly by their id, such as: $new_array[ 5]
.
Ensures that the object is displayed (or should be) only to readers and similar devices. It give more sense in context with other element with attribute aria-hidden="true".
<div class="alert alert-danger" role="alert">
<span class="glyphicon glyphicon-exclamation-sign" aria-hidden="true"></span>
<span class="sr-only">Error:</span>
Enter a valid email address
</div>
Glyphicon will be displayed on all other devices, word Error: on text readers.
You can launch any command line program using the Process class, and set the StandardOutput property of the Process instance with a stream reader you create (either based on a string or a memory location). After the process completes, you can then do whatever diff you need to on that stream.
Yes that is valid syntax but it may well not do what you want.
Execution will continue after your RAISERROR
except if you add a RETURN
. So you will need to add a block with BEGIN ... END
to hold the two statements.
Also I'm not sure why you plumped for severity 15. That usually indicates a syntax error.
Finally I'd simplify the conditions using IN
CREATE PROCEDURE [dbo].[AddApplicationUser] (@TenantId BIGINT,
@UserType TINYINT,
@UserName NVARCHAR(100),
@Password NVARCHAR(100))
AS
BEGIN
IF ( @TenantId IS NULL
AND @UserType IN ( 0, 1 ) )
BEGIN
RAISERROR('The value for @TenantID should not be null',15,1);
RETURN;
END
END
In PHP 7 we can use:
ini_set('magic_quotes_runtime', 0);
instead of set_magic_quotes_runtime(0);
Excel VBA version below. I needed to implement this in VBA (not my preference, don't judge me!), and used the answers on this page for the approach. I'm uploading in case others also need a VBA version.
Option Explicit
Public Sub SumTarget()
Dim numbers(0 To 6) As Long
Dim target As Long
target = 15
numbers(0) = 3: numbers(1) = 9: numbers(2) = 8: numbers(3) = 4: numbers(4) = 5
numbers(5) = 7: numbers(6) = 10
Call SumUpTarget(numbers, target)
End Sub
Public Sub SumUpTarget(numbers() As Long, target As Long)
Dim part() As Long
Call SumUpRecursive(numbers, target, part)
End Sub
Private Sub SumUpRecursive(numbers() As Long, target As Long, part() As Long)
Dim s As Long, i As Long, j As Long, num As Long
Dim remaining() As Long, partRec() As Long
s = SumArray(part)
If s = target Then Debug.Print "SUM ( " & ArrayToString(part) & " ) = " & target
If s >= target Then Exit Sub
If (Not Not numbers) <> 0 Then
For i = 0 To UBound(numbers)
Erase remaining()
num = numbers(i)
For j = i + 1 To UBound(numbers)
AddToArray remaining, numbers(j)
Next j
Erase partRec()
CopyArray partRec, part
AddToArray partRec, num
SumUpRecursive remaining, target, partRec
Next i
End If
End Sub
Private Function ArrayToString(x() As Long) As String
Dim n As Long, result As String
result = "{" & x(n)
For n = LBound(x) + 1 To UBound(x)
result = result & "," & x(n)
Next n
result = result & "}"
ArrayToString = result
End Function
Private Function SumArray(x() As Long) As Long
Dim n As Long
SumArray = 0
If (Not Not x) <> 0 Then
For n = LBound(x) To UBound(x)
SumArray = SumArray + x(n)
Next n
End If
End Function
Private Sub AddToArray(arr() As Long, x As Long)
If (Not Not arr) <> 0 Then
ReDim Preserve arr(0 To UBound(arr) + 1)
Else
ReDim Preserve arr(0 To 0)
End If
arr(UBound(arr)) = x
End Sub
Private Sub CopyArray(destination() As Long, source() As Long)
Dim n As Long
If (Not Not source) <> 0 Then
For n = 0 To UBound(source)
AddToArray destination, source(n)
Next n
End If
End Sub
Output (written to the Immediate window) should be:
SUM ( {3,8,4} ) = 15
SUM ( {3,5,7} ) = 15
SUM ( {8,7} ) = 15
SUM ( {5,10} ) = 15
The biggest different is the basic concept.
From the Set and List interface. Set is mathematics concept. Set method extends collection.however not add new method. size() means cardinality(more is BitSet.cardinality, Linear counter,Log Log,HyperLogLog). addAll() means union. retainAll() means intersection. removeAll() means difference.
However List lack of these concepts. List add a lot of method to support sequence concept which Collection interface not supply. core concept is INDEX. like add(index,element),get(index),search(indexOf()),remove(index) element. List also provide "Collection View" subList. Set do not have view. do not have positional access. List also provide a lot of algorithms in Collections class. sort(List),binarySearch(List),reverse(List),shuffle(List),fill(List). the method params is List interface. duplicate elements are just the result of concepts. not the essential difference.
So the essential difference is concept. Set is mathematics set concept.List is sequence concept.
You can do a one liner:
str = ...
int = Integer(str) rescue nil
if int
int.times {|i| p i}
end
or even
int = Integer(str) rescue false
Depending on what you are trying to do you can also directly use a begin end block with rescue clause:
begin
str = ...
i = Integer(str)
i.times do |j|
puts j
end
rescue ArgumentError
puts "Not an int, doing something else"
end
for empty all input tags such as input,select,textatea etc. run this code
$('#message').val('').change();
In python notebooks I often want to filter out 'dangling' numpy.ndarray
's, in particular the ones that are stored in _1
, _2
, etc that were never really meant to stay alive.
I use this code to get a listing of all of them and their size.
Not sure if locals()
or globals()
is better here.
import sys
import numpy
from humanize import naturalsize
for size, name in sorted(
(value.nbytes, name)
for name, value in locals().items()
if isinstance(value, numpy.ndarray)):
print("{:>30}: {:>8}".format(name, naturalsize(size)))
Actually, on 32-bit computers a word is 32-bit, but the DWORD type is a leftover from the good old days of 16-bit.
In order to make it easier to port programs to the newer system, Microsoft has decided all the old types will not change size.
You can find the official list here: http://msdn.microsoft.com/en-us/library/aa383751(VS.85).aspx
All the platform-dependent types that changed with the transition from 32-bit to 64-bit end with _PTR (DWORD_PTR will be 32-bit on 32-bit Windows and 64-bit on 64-bit Windows).
My error was solved after adding this dependency.
<!-- https://mvnrepository.com/artifact/org.hibernate/hibernate-validator -->
<dependency>
<groupId>org.hibernate.validator</groupId>
<artifactId>hibernate-validator</artifactId>
<version>6.0.16.Final</version>
</dependency>
If all you need to do is wait for the html on the page to become stable before trying to interact with elements, you can poll the DOM periodically and compare the results, if the DOMs are the same within the given poll time, you're golden. Something like this where you pass in the maximum wait time and the time between page polls before comparing. Simple and effective.
public void waitForJavascript(int maxWaitMillis, int pollDelimiter) {
double startTime = System.currentTimeMillis();
while (System.currentTimeMillis() < startTime + maxWaitMillis) {
String prevState = webDriver.getPageSource();
Thread.sleep(pollDelimiter); // <-- would need to wrap in a try catch
if (prevState.equals(webDriver.getPageSource())) {
return;
}
}
}
I use @Test
annotiation of org.junit.Test
package, but I had the same problem. After adding testImplementation("org.assertj:assertj-core:3.10.0")
on build.gradle
, it worked.
For me, I update node and npm to the latest version and it works.
You can also use the arrow library. This is a simple example:
from datetime import datetime
import arrow
start = datetime(2014, 1, 17)
end = datetime(2014, 6, 20)
for d in arrow.Arrow.range('month', start, end):
print d.month, d.format('MMMM')
This will print:
1 January
2 February
3 March
4 April
5 May
6 June
Hope this helps!
You can $apply
your changes only if $apply
is not already in progress. You can update your code as
if(!$scope.$$phase) $scope.$apply();
To delimit by a tab you can use the sep
argument of to_csv
:
df.to_csv(file_name, sep='\t')
To use a specific encoding (e.g. 'utf-8') use the encoding
argument:
df.to_csv(file_name, sep='\t', encoding='utf-8')
That's a good problem. In order to solve that problem you will also have to disable ASLR otherwise the address of g() will be unpredictable.
Disable ASLR:
sudo bash -c 'echo 0 > /proc/sys/kernel/randomize_va_space'
Disable canaries:
gcc overflow.c -o overflow -fno-stack-protector
After canaries and ASLR are disabled it should be a straight forward attack like the ones described in Smashing the Stack for Fun and Profit
Here is a list of security features used in ubuntu: https://wiki.ubuntu.com/Security/Features You don't have to worry about NX bits, the address of g() will always be in a executable region of memory because it is within the TEXT memory segment. NX bits only come into play if you are trying to execute shellcode on the stack or heap, which is not required for this assignment.
Now go and clobber that EIP!
"Vanilla JS” is an expression that got popular after the publishing of a satire website in 2012 (http://vanilla-js.com/). There’s a section covering its story/meaning in this post.
So why the joke? It kind of came as a modern response to the old school knee-jerk reflex of relying on jQuery and additional JS libraries. With the ECMAScript spec and modern browsers capabilities, the need to bypass plain JS with external libraries to maintain consistency across browsers just isn’t there anymore. Here’s a site that shows you how true this is with concrete examples: http://youmightnotneedjquery.com/
And with Prototype:
$('yourDivId').setStyle({top: '100px', left:'80px'});
It checks whether the page has been called through POST (as opposed to GET, HEAD, etc). When you type a URL in the menu bar, the page is called through GET. However, when you submit a form with method="post" the action page is called with POST.
Fast, simple, but maybe not always right:
>>> [x for x in mylist if x.isdigit()]
['1', '2', '3', '4']
More traditional if you need to get numbers:
new_list = []
for value in mylist:
try:
new_list.append(int(value))
except ValueError:
continue
Note: The result has integers. Convert them back to strings if needed, replacing the lines above with:
try:
new_list.append(str(int(value)))
I think thats impossible, sorry.
Thats why whenever running a delete or update you should always use BEGIN TRANSACTION
, then COMMIT
if successful or ROLLBACK
if not.
I made this work in this way:
<button class="btn" ng-click='toggleClass($event)'>button one</button>
<button class="btn" ng-click='toggleClass($event)'>button two</button>
in your controller:
$scope.toggleClass = function (event) {
$(event.target).toggleClass('active');
}
SELECT d1.Short_Code
FROM domain1 d1
LEFT JOIN domain2 d2
ON d1.Short_Code = d2.Short_Code
WHERE d2.Short_Code IS NULL
{ getApplicationContext.finish(); }
Try this method..
This script will read lines from large file and write to new small files. Will duplicate the header of the first line (Header) to all child files
Dim strLine
lCounter = 1
fCounter = 1
cPosition = 1
MaxLine = 1000
splitAt = MaxLine
Dim fHeader
sFile = "inputFile.txt"
dFile = LEFT(sFile, (LEN(sFile)-4))& "_0" & fCounter & ".txt"
Set objFileToRead = CreateObject("Scripting.FileSystemObject").OpenTextFile(sFile,1)
Set objFileToWrite = CreateObject("Scripting.FileSystemObject").OpenTextFile(dFile,2,true)
do while not objFileToRead.AtEndOfStream
strLine = objFileToRead.ReadLine()
objFileToWrite.WriteLine(strLine)
If cPosition = 1 Then
fHeader = strLine
End If
If cPosition = splitAt Then
fCounter = fCounter + 1
splitAt = splitAt + MaxLine
objFileToWrite.Close
Set objFileToWrite = Nothing
If fCounter < 10 Then
dFile=LEFT(dFile, (LEN(dFile)-5))& fCounter & ".txt"
Set objFileToWrite = CreateObject("Scripting.FileSystemObject").OpenTextFile(dFile,2,true)
objFileToWrite.WriteLine(fHeader)
ElseIf fCounter <100 Or fCounter = 100 Then
dFile=LEFT(dFile, (LEN(dFile)-6))& fCounter & ".txt"
Set objFileToWrite = CreateObject("Scripting.FileSystemObject").OpenTextFile(dFile,2,true)
objFileToWrite.WriteLine(fHeader)
Else
dFile=LEFT(dFile, (LEN(dFile)-7)) & fCounter & ".txt"
Set objFileToWrite = CreateObject("Scripting.FileSystemObject").OpenTextFile(dFile,2,true)
objFileToWrite.WriteLine(fHeader)
End If
End If
lCounter=lCounter + 1
cPosition=cPosition + 1
Loop
objFileToWrite.Close
Set objFileToWrite = Nothing
objFileToRead.Close
Set objFileToRead = Nothing
HTML
<div id="replaceMe">i need to be replaced</div>
<div id="iamReplacement">i am replacement</div>
JavaScript
jQuery('#replaceMe').replaceWith(jQuery('#iamReplacement'));
This is a quick example
plot(rnorm(30), xlab = expression(paste("4"^"th")))
Normaly you can GET and POST parameters in a servlet the same way:
request.getParameter("cmd");
But only if the POST data is encoded as key-value pairs of content type: "application/x-www-form-urlencoded" like when you use a standard HTML form.
If you use a different encoding schema for your post data, as in your case when you post a json data stream, you need to use a custom decoder that can process the raw datastream from:
BufferedReader reader = request.getReader();
Json post processing example (uses org.json package )
public void doPost(HttpServletRequest request, HttpServletResponse response)
throws ServletException, IOException {
StringBuffer jb = new StringBuffer();
String line = null;
try {
BufferedReader reader = request.getReader();
while ((line = reader.readLine()) != null)
jb.append(line);
} catch (Exception e) { /*report an error*/ }
try {
JSONObject jsonObject = HTTP.toJSONObject(jb.toString());
} catch (JSONException e) {
// crash and burn
throw new IOException("Error parsing JSON request string");
}
// Work with the data using methods like...
// int someInt = jsonObject.getInt("intParamName");
// String someString = jsonObject.getString("stringParamName");
// JSONObject nestedObj = jsonObject.getJSONObject("nestedObjName");
// JSONArray arr = jsonObject.getJSONArray("arrayParamName");
// etc...
}
They are pretty similar, with Lodash is taking over...
They both are a utility library which takes the world of utility in JavaScript...
It seems Lodash is getting updated more regularly now, so more used in the latest projects...
Also Lodash seems is lighter by a couple of KBs...
Both have a good API and documentation, but I think the Lodash one is better...
Here is a screenshot for each of the documentation items for getting the first value of an array...
Underscore.js:
Lodash:
As things may get updated time to time, just check their website also...
To highlight a block of code in Notepad++, please do the following steps
Style token
and select any of the five choices available ( styles from Using 1st style
to using 5th style
). Each is of different colors.If you want yellow color choose using 3rd style
.If you want to create your own style you can use Style Configurator
under Settings
menu.
Use repr:
a = "Hello\tWorld\nHello World"
print(repr(a))
# 'Hello\tWorld\nHello World'
Note you do not get \s
for a space. I hope that was a typo...?
But if you really do want \s
for spaces, you could do this:
print(repr(a).replace(' ',r'\s'))
There is an ipython nbextension that constructs a table of contents for a notebook. It seems to only provide navigation, not section folding.
I am providing the modern answer. The Timestamp
class was always poorly designed, a real hack on top of the already poorly designed Date
class. Both those classes are now long outdated. Don’t use them.
When the question was asked, you would need a Timestamp
for sending a point in time to the SQL database. Since JDBC 4.2 that is no longer the case. Assuming your database needs a timestamp with time zone
(recommended for true timestamps), pass it an OffsetDateTime
.
Before we can do that we need to overcome a real trouble with your sample string, Mon May 27 11:46:15 IST 2013
: the time zone abbreviation. IST
may mean Irish Summer Time, Israel Standard Time or India Standard Time (I have even read that Java may parse it into Atlantic/Reykjavik time zone — Icelandic Standard Time?) To control the interpretation we pass our preferred time zone to the formatter that we are using for parsing.
DateTimeFormatter formatter = new DateTimeFormatterBuilder()
.appendPattern("EEE MMM dd HH:mm:ss ")
.appendZoneText(TextStyle.SHORT, Set.of(ZoneId.of("Asia/Kolkata")))
.appendPattern(" yyyy")
.toFormatter(Locale.ROOT);
String dateString = "Mon May 27 11:46:15 IST 2013";
OffsetDateTime dateTime = formatter.parse(dateString, Instant::from)
.atOffset(ZoneOffset.UTC);
System.out.println(dateTime);
This snippet prints:
2013-05-27T06:16:15Z
This is the UTC equivalent of your string (assuming IST was for India Standard Time). Pass the OffsetDateTime
to your database using one of the PreparedStatement.setObject
methods (not setTimestamp
).
How can I convert this into timestamp and calculate in seconds the difference between the same and current time?
Calculating the difference in seconds goes very naturally with java.time:
long differenceInSeconds = ChronoUnit.SECONDS
.between(dateTime, OffsetDateTime.now(ZoneOffset.UTC));
System.out.println(differenceInSeconds);
When running just now I got:
202213260
Link: Oracle tutorial: Date Time explaining how to use java.time.
By design, dictionaries are not sortable. If you need this capability in a dictionary, look at SortedDictionary instead.
The list is maintaining an object reference to the original value stored in the list. So when you execute this line:
Integer x = i.next();
Both x
and the list are storing a reference to the same object. However, when you execute:
x = Integer.valueOf(9);
nothing has changed in the list, but x
is now storing a reference to a different object. The list has not changed. You need to use some of the list manipulation methods, such as
list.set(index, Integer.valueof(9))
Note: this has nothing to do with the immutability of Integer
, as others are suggesting. This is just basic Java object reference behaviour.
Here's a complete example, to help explain the point. Note that this makes use of the ListIterator
class, which supports removing/setting items mid-iteration:
import java.util.*;
public class ListExample {
public static void main(String[] args) {
List<Foo> fooList = new ArrayList<Foo>();
for (int i = 0; i < 9; i++)
fooList.add(new Foo(i, i));
// Standard iterator sufficient for altering elements
Iterator<Foo> iterator = fooList.iterator();
if (iterator.hasNext()) {
Foo foo = iterator.next();
foo.x = 99;
foo.y = 42;
}
printList(fooList);
// List iterator needed for replacing elements
ListIterator<Foo> listIterator = fooList.listIterator();
if (listIterator.hasNext()) {
// Need to call next, before set.
listIterator.next();
// Replace item returned from next()
listIterator.set(new Foo(99,99));
}
printList(fooList);
}
private static void printList(List<?> list) {
Iterator<?> iterator = list.iterator();
while (iterator.hasNext()) {
System.out.print(iterator.next());
}
System.out.println();
}
private static class Foo {
int x;
int y;
Foo(int x, int y) {
this.x = x;
this.y = y;
}
@Override
public String toString() {
return String.format("[%d, %d]", x, y);
}
}
}
This will print:
[99, 42][1, 1][2, 2][3, 3][4, 4][5, 5][6, 6][7, 7][8, 8]
[99, 99][1, 1][2, 2][3, 3][4, 4][5, 5][6, 6][7, 7][8, 8]
From 6.11. Boolean operations:
In the context of Boolean operations, and also when expressions are used by control flow statements, the following values are interpreted as false: False, None, numeric zero of all types, and empty strings and containers (including strings, tuples, lists, dictionaries, sets and frozensets). All other values are interpreted as true.
The key phrasing here that I think you are misunderstanding is "interpreted as false" or "interpreted as true". This does not mean that any of those values are identical to True or False, or even equal to True or False.
The expression '/bla/bla/bla'
will be treated as true where a Boolean expression is expected (like in an if
statement), but the expressions '/bla/bla/bla' is True
and '/bla/bla/bla' == True
will evaluate to False for the reasons in Ignacio's answer.
Down-casting and up-casting was as follows:
Upcasting: When we want to cast a Sub class to Super class, we use Upcasting(or widening). It happens automatically, no need to do anything explicitly.
Downcasting : When we want to cast a Super class to Sub class, we use Downcasting(or narrowing), and Downcasting is not directly possible in Java, explicitly we have to do.
Dog d = new Dog();
Animal a = (Animal) d; //Explicitly you have done upcasting. Actually no need, we can directly type cast like Animal a = d; compiler now treat Dog as Animal but still it is Dog even after upcasting
d.callme();
a.callme(); // It calls Dog's method even though we use Animal reference.
((Dog) a).callme2(); // Downcasting: Compiler does know Animal it is, In order to use Dog methods, we have to do typecast explicitly.
// Internally if it is not a Dog object it throws ClassCastException
Generally you would need some form of post build tool to perform an assembly merge like you are describing. There is a free tool called Eazfuscator (eazfuscator.blogspot.com/) which is designed for bytecode mangling that also handles assembly merging. You can add this into a post build command line with Visual Studio to merge your assemblies, but your mileage will vary due to issues that will arise in any non trival assembly merging scenarios.
You could also check to see if the build make untility NANT has the ability to merge assemblies after building, but I am not familiar enough with NANT myself to say whether the functionality is built in or not.
There are also many many Visual Studio plugins that will perform assembly merging as part of building the application.
Alternatively if you don't need this to be done automatically, there are a number of tools like ILMerge that will merge .net assemblies into a single file.
The biggest issue I've had with merging assemblies is if they use any similar namespaces. Or worse, reference different versions of the same dll (my problems were generally with the NUnit dll files).
@Shaikovsky's answer is excellent (…and heavily edited since I posted this answer), but I wanted to clarify a couple of points.
[next(generator) for _ in range(n)]
This is the most simple approach, but throws StopIteration
if the generator is prematurely exhausted.
On the other hand, the following approaches return up to n
items which is preferable in many circumstances:
List:
[x for _, x in zip(range(n), records)]
Generator:
(x for _, x in zip(range(n), records))
Try writing it like this:
div { border: 1px solid #CCC; }
_x000D_
<div style="display: inline">a</div>_x000D_
<div style="display: inline">b</div>_x000D_
<div style="display: inline">c</div>
_x000D_
UPDATED
I've updated your demo: http://jsfiddle.net/terryyounghk/QS56z/18/
Also, I've changed two ^=
to *=
. See http://api.jquery.com/category/selectors/
And note the :checked
selector. See http://api.jquery.com/checked-selector/
function createcodes() {
//run through each row
$('.authors-list tr').each(function (i, row) {
// reference all the stuff you need first
var $row = $(row),
$family = $row.find('input[name*="family"]'),
$grade = $row.find('input[name*="grade"]'),
$checkedBoxes = $row.find('input:checked');
$checkedBoxes.each(function (i, checkbox) {
// assuming you layout the elements this way,
// we'll take advantage of .next()
var $checkbox = $(checkbox),
$line = $checkbox.next(),
$size = $line.next();
$line.val(
$family.val() + ' ' + $size.val() + ', ' + $grade.val()
);
});
});
}
SVG animations are probably a better solution to this problem. You won't need to worry about writing CSS and compared to GIFs, you'll get better resolution and alpha transparency. Some very good SVG loading animations that you can use are here: http://samherbert.net/svg-loaders/
You can also use those animations directly through a service I built: https://svgbox.net/iconset/loaders. It allows you to customize the fill and direct usage (hotlinking) is permitted.
To accomplish what you want to do with jQuery, you probably should have a loading info element hidden and use .show()
when you want to show the loader. For eg, this code shows the loader after one second:
setTimeout(function() {
$("#load").show();
}, 1000)
_x000D_
<script src="https://cdnjs.cloudflare.com/ajax/libs/jquery/3.3.0/jquery.min.js"></script>
<div id="load" style="display:none">
Please wait...
<img src="//s.svgbox.net/loaders.svg?fill=maroon&ic=tail-spin"
style="width:24px">
</div>
_x000D_
Problems only surface when I am I trying to give the first loaded content an active state
Does this mean that you want to add a class to the first button?
$('.o-links').click(function(e) { // ... }).first().addClass('O_Nav_Current');
instead of using IDs for the slider's items and resetting html contents you can use classes and indexes:
CSS:
.image-area { width: 100%; height: auto; display: none; } .image-area:first-of-type { display: block; }
JavaScript:
var $slides = $('.image-area'), $btns = $('a.o-links'); $btns.on('click', function (e) { var i = $btns.removeClass('O_Nav_Current').index(this); $(this).addClass('O_Nav_Current'); $slides.filter(':visible').fadeOut(1000, function () { $slides.eq(i).fadeIn(1000); }); e.preventDefault(); }).first().addClass('O_Nav_Current');
Had the same problem, it turned out it was the WindowsFirewall blocking connections. Try to disable WindowsFirewall for a while to see if helps and if it is the problem open ports as needed.
Here is the simplest solution to your query
$date=date_create("2013-03-15"); // or your date string
date_add($date,date_interval_create_from_date_string("40 days"));// add number of days
echo date_format($date,"Y-m-d"); //set date format of the result
If you actually want to filter blank lines from a file then you may try this:
(gc $source_file).Trim() | ? {$_.Length -gt 0}
Nc is a link to nmap-ncat.
It would be nice to use nmap-ncat in your puppet, because NC is a virtual name of nmap-ncat.
Puppet cannot understand the links/virtualnames
your puppet should be:
package {
'nmap-ncat':
ensure => installed;
}
For anyone trying to use jQuery.active with JSONP requests (like I was) you'll need enable it with this:
jQuery.ajaxPrefilter(function( options ) {
options.global = true;
});
Keep in mind that you'll need a timeout on your JSONP request to catch failures.
If the idea is to print integers stored as doubles as if they are integers, and otherwise print the doubles with the minimum necessary precision:
public static String fmt(double d)
{
if(d == (long) d)
return String.format("%d",(long)d);
else
return String.format("%s",d);
}
Produces:
232
0.18
1237875192
4.58
0
1.2345
And does not rely on string manipulation.
I had the same issue as OP but none of the current answers solved my issue so to add a slightly different answer that did work for me:
Running Python 3.6.5 on a Windows Machine, I used the format
r"\DriveName\then\file\path\txt.md"
so the combination of double backslashes from reading @Johnsyweb UNC link and adding the r in front as recommended solved my similar to OP's issue.
"But i want to know a better way to do this, if there is one ?"
Yes, since you seem to already have the original object, there's no reason to fetch it again from the Array.
function Update(keyValue, newKey, newValue)
{
keyValue.Key = newKey;
keyValue.Value = newValue;
}
You can use ax.figure.savefig()
, as suggested in a comment on the question:
import pandas as pd
df = pd.DataFrame([0, 1])
ax = df.plot.line()
ax.figure.savefig('demo-file.pdf')
This has no practical benefit over ax.get_figure().savefig()
as suggested in other answers, so you can pick the option you find the most aesthetically pleasing. In fact, get_figure()
simply returns self.figure
:
# Source from snippet linked above
def get_figure(self):
"""Return the `.Figure` instance the artist belongs to."""
return self.figure
Follow below steps to generate web.xml in Eclipse with existing Dynamic Web Project
Another option is to enclose the unwanted lines in an IF block that can never be true
if 1==0 (
...
)
Of course nothing within the if block will be executed, but it will be parsed. So you can't have any invalid syntax within. Also, the comment cannot contain )
unless it is escaped or quoted. For those reasons the accepted GOTO solution is more reliable. (The GOTO solution may also be faster)
Update 2017-09-19
Here is a cosmetic enhancement to pdub's GOTO solution. I define a simple environment variable "macro" that makes the GOTO comment syntax a bit better self documenting. Although it is generally recommended that :labels are unique within a batch script, it really is OK to embed multiple comments like this within the same batch script.
@echo off
setlocal
set "beginComment=goto :endComment"
%beginComment%
Multi-line comment 1
goes here
:endComment
echo This code executes
%beginComment%
Multi-line comment 2
goes here
:endComment
echo Done
Or you could use one of these variants of npocmaka's solution. The use of REM instead of BREAK makes the intent a bit clearer.
rem.||(
remarks
go here
)
rem^ ||(
The space after the caret
is critical
)
This is easy to fix, because you have changed the folder name to: exampleproject
So SSH to your vagrant:
ssh [email protected] -p 2222
Then change your nginx config:
sudo vi /etc/nginx/sites-enabled/homestead.app
Edit the correct URI to the root on line 3 to this with the new folder name:
root "/Users/MYUSERNAME/Code/exampleproject/public";
Restart Nginx
sudo service nginx reload
Reload the web browser, it should work now
Found this on github...
import warnings
warnings.simplefilter(action='ignore', category=FutureWarning)
import pandas
Using update directly is more efficient and could also prevent integrity problems.
From the official documentation https://docs.djangoproject.com/en/3.0/ref/models/querysets/#django.db.models.query.QuerySet.update
If you’re just updating a record and don’t need to do anything with the model object, the most efficient approach is to call update(), rather than loading the model object into memory. For example, instead of doing this:
e = Entry.objects.get(id=10) e.comments_on = False e.save()
…do this:
Entry.objects.filter(id=10).update(comments_on=False)
Using update() also prevents a race condition wherein something might change in your database in the short period of time between loading the object and calling save().
In Kotlin you can add Textview as follows.
val textView = TextView(activity).apply {
layoutParams = LinearLayout.LayoutParams(
LinearLayout.LayoutParams.MATCH_PARENT,
LinearLayout.LayoutParams.WRAP_CONTENT
).apply {
setMargins(0, 20, 0, 0)
setPadding(10, 10, 0, 10)
}
text = "SOME TEXT"
setBackgroundColor(ContextCompat.getColor(this@MainActivity, R.color.colorPrimary))
setTextColor(ContextCompat.getColor(this@MainActivity, R.color.colorPrimaryDark))
textSize = 16.0f
typeface = Typeface.defaultFromStyle(Typeface.BOLD)
}
linearLayoutContainer.addView(textView)
If by version you mean a tag or a release, then github provides download links for those. For example, if I want to install fetch version 0.3.2 (it is not available on npm), then I add to my package.json
under dependencies
:
"fetch": "https://github.com/github/fetch/archive/v0.3.2.tar.gz",
The only disadvantage when compared with the commit hash approach is that a hash is guaranteed not to represent changed code, whereas a tag could be replaced. Thankfully this rarely happens.
Update:
These days the approach I use is the compact notation for a GitHub served dependency:
"dependencies": {
"package": "github:username/package#commit"
}
Where commit can be anything commitish, like a tag. In the case of GitHub you can even drop the initial github:
since it's the default.
My problem was solved that way:
Your username is probably restricted, You must grant full access to the user.
Go to your Tomcat Directory with : cd/home/user/apache-tomcat6.0
sh bin/startup.sh.>> tail -f logs/catelina.out.>>
If you use numpy,
if np.zeros(3)==None: pass
will give you error when numpy does elementwise comparison
Adding the following two lines at the top of my .py script worked for me (first line was necessary):
#!/usr/bin/env python
# -*- coding: utf-8 -*-
A matrix is really just a vector with a dim
attribute (for the dimensions). So you can add dimensions to vec
using the dim()
function and vec
will then be a matrix:
vec <- 1:49
dim(vec) <- c(7, 7) ## (rows, cols)
vec
> vec <- 1:49
> dim(vec) <- c(7, 7) ## (rows, cols)
> vec
[,1] [,2] [,3] [,4] [,5] [,6] [,7]
[1,] 1 8 15 22 29 36 43
[2,] 2 9 16 23 30 37 44
[3,] 3 10 17 24 31 38 45
[4,] 4 11 18 25 32 39 46
[5,] 5 12 19 26 33 40 47
[6,] 6 13 20 27 34 41 48
[7,] 7 14 21 28 35 42 49
Setting spring.datasource.tomcat.testOnBorrow=true
in application.properties didn't work.
Programmatically setting like below worked without any issues.
import org.apache.tomcat.jdbc.pool.DataSource;
import org.apache.tomcat.jdbc.pool.PoolProperties;
@Bean
public DataSource dataSource() {
PoolProperties poolProperties = new PoolProperties();
poolProperties.setUrl(this.properties.getDatabase().getUrl());
poolProperties.setUsername(this.properties.getDatabase().getUsername());
poolProperties.setPassword(this.properties.getDatabase().getPassword());
//here it is
poolProperties.setTestOnBorrow(true);
poolProperties.setValidationQuery("SELECT 1");
return new DataSource(poolProperties);
}
Only two Lines of code required for this
Swift 3.0
let closeButtonImage = UIImage(named: "ic_close_white")
navigationItem.rightBarButtonItem = UIBarButtonItem(image: closeButtonImage, style: .plain, target: self, action: #selector(ResetPasswordViewController.barButtonDidTap(_:)))
func barButtonDidTap(_ sender: UIBarButtonItem)
{
}
Use this:
window.onload = setTimeout("window.print()", 1000);
<input id="fusk" type="file" name="upload" style="display: none;"
onChange=" document.getElementById('myForm').submit();"
>
These commands will do the work on command prompt without altering any files on local repository
git config --file=.gitmodules submodule.Submod.url https://github.com/username/ABC.git
git config --file=.gitmodules submodule.Submod.branch Development
git submodule sync
git submodule update --init --recursive --remote
Please look at the blog for screenshots: Changing GIT submodules URL/Branch to other URL/branch of same repository
The below solution is more straight-forward. All you have to do is define one simple function that can "CREATE" the object from the two given items. Then simply apply this function to TWO arrays having elements for which you want to create object and save in resultArray.
var arr1 = ['01','02','03'];
var arr2 = ['item-1','item-2','item-3'];
resultArray = [];
for (var j=0; j<arr1.length; j++) {
resultArray[j] = new makeArray(arr1[j], arr2[j]);
}
function makeArray(first,second) {
this.first = first;
this.second = second;
}
You're probably after Set wbOOR = ThisWorkbook
Just to clarify
ThisWorkbook
will always refer to the workbook the code resides in
ActiveWorkbook
will refer to the workbook that is active
Be careful how you use this when dealing with multiple workbooks. It really depends on what you want to achieve as to which is the best option.
This only works in situations where you have a numeric field, but you can put a minus sign in front of the field name like so:
reportingNameGroups = reportingNameGroups.OrderBy(x=> - x.GroupNodeId);
However this works a little bit different than OrderByDescending
when you have are running it on an int?
or double?
or decimal?
fields.
What will happen is on OrderByDescending
the nulls will be at the end, vs with this method the nulls will be at the beginning. Which is useful if you want to shuffle nulls around without splitting data into pieces and splicing it later.
I ran this on MacOS /Applications/Python\ 3.6/Install\ Certificates.command
this works fine, but file name does not display anymore.
$(document).ready(function(){ $("img.attach2").click(function(){ $("input.attach1").click(); return false; }); });
Identifiers are used for class names, method names, and variable names. An identifiermay be any descriptive sequence of uppercase and lowercase letters, numbers, or theunderscore and dollar-sign characters. They must not begin with a number, lest they beconfused with a numeric literal. Again, Java is case-sensitive, so VALUE is a differentidentifier than Value. Some examples of valid identifiers are:
AvgTemp ,count a4 ,$test ,this_is_ok
Invalid variable names include:
2count, high-temp, Not/ok
To convert the private key from PKCS#1 to PKCS#8 with openssl:
# openssl pkcs8 -topk8 -inform PEM -outform PEM -nocrypt -in pkcs1.key -out pkcs8.key
That will work as long as you have the PKCS#1 key in PEM (text format) as described in the question.
Background location service. It will be restarted even after killing the app.
MainActivity.java
public class MainActivity extends AppCompatActivity {
AlarmManager alarmManager;
Button stop;
PendingIntent pendingIntent;
@Override
protected void onCreate(Bundle savedInstanceState) {
super.onCreate(savedInstanceState);
setContentView(R.layout.activity_main);
if (alarmManager == null) {
alarmManager = (AlarmManager) getSystemService(Context.ALARM_SERVICE);
Intent intent = new Intent(this, AlarmReceive.class);
pendingIntent = PendingIntent.getBroadcast(this, 0, intent, 0);
alarmManager.setRepeating(AlarmManager.RTC_WAKEUP, System.currentTimeMillis(), 30000,
pendingIntent);
}
}
}
BookingTrackingService.java
public class BookingTrackingService extends Service implements LocationListener {
private static final String TAG = "BookingTrackingService";
private Context context;
boolean isGPSEnable = false;
boolean isNetworkEnable = false;
double latitude, longitude;
LocationManager locationManager;
Location location;
private Handler mHandler = new Handler();
private Timer mTimer = null;
long notify_interval = 30000;
public double track_lat = 0.0;
public double track_lng = 0.0;
public static String str_receiver = "servicetutorial.service.receiver";
Intent intent;
@Nullable
@Override
public IBinder onBind(Intent intent) {
return null;
}
@Override
public void onCreate() {
super.onCreate();
mTimer = new Timer();
mTimer.schedule(new TimerTaskToGetLocation(), 5, notify_interval);
intent = new Intent(str_receiver);
}
@Override
public int onStartCommand(Intent intent, int flags, int startId) {
this.context = this;
return START_NOT_STICKY;
}
@Override
public void onDestroy() {
super.onDestroy();
Log.e(TAG, "onDestroy <<");
if (mTimer != null) {
mTimer.cancel();
}
}
private void trackLocation() {
Log.e(TAG, "trackLocation");
String TAG_TRACK_LOCATION = "trackLocation";
Map<String, String> params = new HashMap<>();
params.put("latitude", "" + track_lat);
params.put("longitude", "" + track_lng);
Log.e(TAG, "param_track_location >> " + params.toString());
stopSelf();
mTimer.cancel();
}
@Override
public void onLocationChanged(Location location) {
}
@Override
public void onStatusChanged(String provider, int status, Bundle extras) {
}
@Override
public void onProviderEnabled(String provider) {
}
@Override
public void onProviderDisabled(String provider) {
}
/******************************/
private void fn_getlocation() {
locationManager = (LocationManager) getApplicationContext().getSystemService(LOCATION_SERVICE);
isGPSEnable = locationManager.isProviderEnabled(LocationManager.GPS_PROVIDER);
isNetworkEnable = locationManager.isProviderEnabled(LocationManager.NETWORK_PROVIDER);
if (!isGPSEnable && !isNetworkEnable) {
Log.e(TAG, "CAN'T GET LOCATION");
stopSelf();
} else {
if (isNetworkEnable) {
location = null;
locationManager.requestLocationUpdates(LocationManager.NETWORK_PROVIDER, 1000, 0, this);
if (locationManager != null) {
location = locationManager.getLastKnownLocation(LocationManager.NETWORK_PROVIDER);
if (location != null) {
Log.e(TAG, "isNetworkEnable latitude" + location.getLatitude() + "\nlongitude" + location.getLongitude() + "");
latitude = location.getLatitude();
longitude = location.getLongitude();
track_lat = latitude;
track_lng = longitude;
// fn_update(location);
}
}
}
if (isGPSEnable) {
location = null;
locationManager.requestLocationUpdates(LocationManager.GPS_PROVIDER, 1000, 0, this);
if (locationManager != null) {
location = locationManager.getLastKnownLocation(LocationManager.GPS_PROVIDER);
if (location != null) {
Log.e(TAG, "isGPSEnable latitude" + location.getLatitude() + "\nlongitude" + location.getLongitude() + "");
latitude = location.getLatitude();
longitude = location.getLongitude();
track_lat = latitude;
track_lng = longitude;
// fn_update(location);
}
}
}
Log.e(TAG, "START SERVICE");
trackLocation();
}
}
private class TimerTaskToGetLocation extends TimerTask {
@Override
public void run() {
mHandler.post(new Runnable() {
@Override
public void run() {
fn_getlocation();
}
});
}
}
// private void fn_update(Location location) {
//
// intent.putExtra("latutide", location.getLatitude() + "");
// intent.putExtra("longitude", location.getLongitude() + "");
// sendBroadcast(intent);
// }
}
AlarmReceive.java (BroadcastReceiver)
public class AlarmReceive extends BroadcastReceiver {
@Override
public void onReceive(Context context, Intent intent) {
Log.e("Service_call_" , "You are in AlarmReceive class.");
Intent background = new Intent(context, BookingTrackingService.class);
// Intent background = new Intent(context, GoogleService.class);
Log.e("AlarmReceive ","testing called broadcast called");
context.startService(background);
}
}
AndroidManifest.xml
<uses-permission android:name="android.permission.ACCESS_COARSE_LOCATION" />
<uses-permission android:name="android.permission.ACCESS_FINE_LOCATION" />
<service
android:name=".ServiceAndBroadcast.BookingTrackingService"
android:enabled="true" />
<receiver
android:name=".ServiceAndBroadcast.AlarmReceive"
android:exported="false">
<intent-filter>
<action android:name="android.intent.action.BOOT_COMPLETED" />
</intent-filter>
</receiver>
Apparently the index 'productid' is missing from your html form.
Inspect your html inputs first. eg <input type="text" name="productid" value="">
But this will handle the current error PHP is raising.
$rowID = isset($_POST['rowID']) ? $_POST['rowID'] : '';
$productid = isset($_POST['productid']) ? $_POST['productid'] : '';
$name = isset($_POST['name']) ? $_POST['name'] : '';
$price = isset($_POST['price']) ? $_POST['price'] : '';
$description = isset($_POST['description']) ? $_POST['description'] : '';
Forget switch
and break
, lets play with if
. And instead of asserting
if(pageid === "listing-page" || pageid === "home-page")
lets create several arrays with cases and check it with Array.prototype.includes()
var caseA = ["listing-page", "home-page"];
var caseB = ["details-page", "case04", "case05"];
if(caseA.includes(pageid)) {
alert("hello");
}
else if (caseB.includes(pageid)) {
alert("goodbye");
}
else {
alert("there is no else case");
}
Hope this can help you.
- What is the difference between connection and read timeout for sockets?
The connection timeout is the timeout in making the initial connection; i.e. completing the TCP connection handshake. The read timeout is the timeout on waiting to read data1. If the server (or network) fails to deliver any data <timeout> seconds after the client makes a socket read
call, a read timeout error will be raised.
- What does connection timeout set to "infinity" mean? In what situation can it remain in an infinitive loop? and what can trigger that the infinity-loop dies?
It means that the connection attempt can potentially block for ever. There is no infinite loop, but the attempt to connect can be unblocked by another thread closing the socket. (A Thread.interrupt()
call may also do the trick ... not sure.)
- What does read timeout set to "infinity" mean? In what situation can it remain in an infinite loop? What can trigger that the infinite loop to end?
It means that a call to read
on the socket stream may block for ever. Once again there is no infinite loop, but the read
can be unblocked by a Thread.interrupt()
call, closing the socket, and (of course) the other end sending data or closing the connection.
1 - It is not ... as one commenter thought ... the timeout on how long a socket can be open, or idle.
I have solved this problem, try to use root privileges, such as sudo gpg ... I think that gpg elevated without permissions does not refer to file permissions, but system
jvmtop can show the current jvm thread count beside other metrics.
open the CMD and use this command :
**
pip uninstall django
**
it will easy uninstalled .
For images and other sources you can use that:
$(el).one('load', function(){
// completed
}).each(function() {
if (this.complete)
$(this).load();
});
Don't forget to use var/let while declaring any variable.See below examples for JS compiler behaviour.
function func(){
return true;
}
isBool = func();
console.log(typeof (isBool)); // output - string
let isBool = func();
console.log(typeof (isBool)); // output - boolean
One way would be (deprecated as of Hg2.7, August 2013)hg rollback
Please use
hg commit --amend
instead ofrollback
to correct mistakes in the last commit.Roll back the last transaction in a repository.
When committing or merging, Mercurial adds the changeset entry last.
Mercurial keeps a transaction log of the name of each file touched and its length prior to the transaction. On abort, it truncates each file to its prior length. This simplicity is one benefit of making revlogs append-only. The transaction journal also allows an undo operation.
See TortoiseHg Recovery section:
This thread also details the difference between hg rollback
and hg strip
:
(written by Martin Geisler who also contributes on SO)
'
hg rollback
' will remove the last transaction. Transactions are a concept often found in databases. In Mercurial we start a transaction when certain operations are run, such as commit, push, pull...
When the operation finishes succesfully, the transaction is marked as complete. If an error occurs, the transaction is "rolled back" and the repository is left in the same state as before.
You can manually trigger a rollback with 'hg rollback'. This will undo the last transactional command. If a pull command brought 10 new changesets into the repository on different branches, then 'hg rollback
' will remove them all. Please note: there is no backup when you rollback a transaction!'
hg strip
' will remove a changeset and all its descendants. The changesets are saved as a bundle, which you can apply again if you need them back.
ForeverWintr suggests in the comments (in 2016, 5 years later)
You can 'un-commit' files by first hg forgetting them, e.g.:
hg forget filea; hg commit --amend
, but that seems unintuitive.
hg strip --keep
is probably a better solution for modern hg.
Make sure you are loading those modules (myApp.services and myApp.directives) as dependencies of your main app module, like this:
angular.module('myApp', ['myApp.directives', 'myApp.services']);
plunker: http://plnkr.co/edit/wxuFx6qOMfbuwPq1HqeM?p=preview
It is an old question but i want to add that if you want to resize image according to viewport size only with css; you can use viewport units "vh (viewport height) or vw (viewport width)".
.img {
width: 100vw;
height: 100vh;
}
in Global.asax add
public override void Init()
{
this.PostAuthenticateRequest += MvcApplication_PostAuthenticateRequest;
base.Init();
}
void MvcApplication_PostAuthenticateRequest(object sender, EventArgs e)
{
System.Web.HttpContext.Current.SetSessionStateBehavior(
SessionStateBehavior.Required);
}
give it a shot ;)
If you're using PHP then the wordwrap function works well for this: http://php.net/manual/en/function.wordwrap.php
The CSS solution word-wrap: break-word;
does not seem to be consistent across all browsers.
Other server-side languages have similar functions - or can be hand built.
Here's how the the PHP wordwrap function works:
$string = "ACTGATCGAGCTGAAGCGCAGTGCGATGCTTCGATGATGCTGACGATGCTACGATGCGAGCATCTACGATCAGTCGATGTAGCTAGTAGCATGTAGTGA";
$wrappedstring = wordwrap($string,50,"<br>",true);
This wraps the string at 50 characters with a <br> tag. The 'true' parameter forces the string to be cut.
There are various Java JSON serializers and deserializers linked from the JSON home page.
As of this writing, there are these 22:
...but of course the list can change.
Here a solution with less line of code and easily understandable (or at least I like to think so).
If you want to keep order (match only if the smaller list is found in the same order on the bigger list):
def is_ordered_subset(l1, l2):
# First check to see if all element of l1 are in l2 (without checking order)
if not set(l1).issubset(l2):
return False
length = len(l1)
# Make sublist of same size than l1
list_of_sublist = [l2[i:i+length] for i, x in enumerate(l2)]
#Check if one of this sublist is l1
return l1 in list_of_sublist
This works in my case:
@RequestMapping(value = "/savedata",
params = {"textArea", "localKey", "localFile"})
@ResponseBody
public void saveData(@RequestParam(value = "textArea") String textArea,
@RequestParam(value = "localKey") String localKey,
@RequestParam(value = "localFile") String localFile) {
}
Laravel does not need mcrypt
extension anymore. mcrypt
is obsolete, the last update to libmcrypt was in 2007. Laravel 4.2 is obsolete too and has no more support. The best (=secure) solution is to update to Laravel >5.1 (there is no LTS before Laravel 5.2).
Mcrypt was removed from Laravel in June 2015: https://github.com/laravel/framework/pull/9041
Ok, so this might not fix your issue but it definitely worked for me.
So you've created your Mysql user I take it? Go to user privileges on PhpMyAdmin and click edit next to the user your using for Symfony. Scroll down to near the bottom and where it says which host you want to use make sure you've selected LocalHost not % Any.
Then in your config file swap 127.0.0.1 for localhost. Hopefully that will work for you. Just worked for me as I was having the same issue.
This works for me
td::after {
content: '';
display: block;
width: 30px;
}
This solution helped me to skip the number of lines specified by the linetostart
variable.
You get the index (int) and the line (string) if you want to keep track of those too.
In your case, you substitute linetostart with 18, or assign 18 to linetostart variable.
f = open("file.txt", 'r')
for i, line in enumerate(f, linetostart):
#Your code
Simplest solution is the following:
=(NEW/OLD-1)*SIGN(OLD)
The SIGN()
function will result in -1
if the value is negative and 1
if the value is positive. So multiplying by that will conditionally invert the result if the previous value is negative.