The problem is that you compiled the code with java 13 (class file 57), and the java runtime is set to java 8 (class file 52).

Assuming you have the JRE 13 installed in your local system, you could change your runtime from 52 to 57. That you can do with the plugin Choose Runtime. To install it go to File/Settings/Plugins

Once installed go to Help/Find Action, type "runtime" and select the jre 13 from the dropdown menu.

I had this same issue, which led me here. In particular, for local development, I wanted to be able to do mysql -u root -p without sudo. I don't want to create a new user. I want to use root from a local PHP web app.

The error message is misleading, as there was nothing wrong with the default 'root'@'%' user privileges.

Instead, as several people mentioned in the other answers, the solution was simply to set bind-address=0.0.0.0 instead of bind-address=127.0.0.1 in my /etc/mysql/mysql.conf.d/mysqld.cnf config. No changes were otherwise required.

Full Solution

All the above solutions are fine. And here I'm gonna combine all the solutions so that it should work for all the situations.

1. Fixed DEFINER

For Linux and Mac

sed -i old 's/\DEFINER\=`[^`]*`@`[^`]*`//g' file.sql

For Windows
download atom or notepad++, open your dump sql file with atom or notepad++, press Ctrl+F
search the word DEFINER, and remove the line DEFINER=admin@% (or may be little different for you) from everywhere and save the file.
As for example
before removing that line: CREATE DEFINER=admin@% PROCEDURE MyProcedure
After removing that line: CREATE PROCEDURE MyProcedure

1. Remove the 3 lines Remove all these 3 lines from the dump file. You can use sed command or open the file in Atom editor and search for each line and then remove the line.
   Example: Open Dump2020.sql in Atom, Press ctrl+F, search SET @@SESSION.SQL_LOG_BIN= 0, remove that line.

SET @@SESSION.SQL_LOG_BIN= 0;
SET @@GLOBAL.GTID_PURGED=/*!80000 '+'*/ '';
SET @@SESSION.SQL_LOG_BIN = @MYSQLDUMP_TEMP_LOG_BIN;

2. There an issue with your generated file You might face some issue if your generated dump.sql file is not proper. But here, I'm not gonna explain how to generate a dump file. But you can ask me (_)

In my case, I needed to Edit Inbound Rules on my AWS RDS instance to accept All Traffic. The default TCP/IP constraint prevented me from creating a database from my local machine otherwise.

I observed the same issue, and added the command and args block in yaml file. I am copying sample of my yaml file for reference

 apiVersion: v1
    kind: Pod
    metadata:
      labels:
        run: ubuntu
      name: ubuntu
      namespace: default
    spec:
      containers:
      - image: gcr.io/ow/hellokubernetes/ubuntu
        imagePullPolicy: Never
        name: ubuntu
        resources:
          requests:
            cpu: 100m
        command: ["/bin/sh"]
        args: ["-c", "while true; do echo hello; sleep 10;done"]
      dnsPolicy: ClusterFirst
      enableServiceLinks: true

You may have to run cmd as administrator to perform these tasks. You can do it by right clicking on cmd icon and selecting run as administrator. It's worked for me.

You need to use the change directory command 'cd' to change directory

cd C:\Users\MyName\Desktop

you can use cd \d to change the drive as well.

link for additional resources http://ss64.com/nt/cd.html

Actually you have a code compiled targeting a higher JDK (JDK 1.8 in your case) but at runtime you are supplying a lower JRE(JRE 7 or below).

you can fix this problem by adding target parameter while compilation
e.g. if your runtime target is 1.7, you should use 1.7 or below

javac -target 1.7 *.java

if you are using eclipse, you can sent this parameter at Window -> Preferences -> Java -> Compiler -> set "Compiler compliance level" = choose your runtime jre version or lower.

I found some issue about that kind of error

1. Database username or password not match in the mysql or other other database. Please set application.properties like this

  

# ===============================
# = DATA SOURCE
# ===============================
# Set here configurations for the database connection
# Connection url for the database please let me know "[email protected]"
spring.datasource.url = jdbc:mysql://localhost:3306/bookstoreapiabc
# Username and secret
spring.datasource.username = root
spring.datasource.password =
# Keep the connection alive if idle for a long time (needed in production)
spring.datasource.testWhileIdle = true
spring.datasource.validationQuery = SELECT 1
# ===============================
# = JPA / HIBERNATE
# ===============================
# Use spring.jpa.properties.* for Hibernate native properties (the prefix is
# stripped before adding them to the entity manager).
# Show or not log for each sql query
spring.jpa.show-sql = true
# Hibernate ddl auto (create, create-drop, update): with "update" the database
# schema will be automatically updated accordingly to java entities found in
# the project
spring.jpa.hibernate.ddl-auto = update
# Allows Hibernate to generate SQL optimized for a particular DBMS
spring.jpa.properties.hibernate.dialect = org.hibernate.dialect.MySQL5Dialect

Issue no 2.

Your local server has two database server and those database server conflict. this conflict like this mysql server & xampp or lampp or wamp server. Please one of the database like mysql server because xampp or lampp server automatically install mysql server on this machine

Sometimes it's knowing what to ask. I didn't know as I am a developer who has taken on some DevOps work.

Apparently 'passwordless' or NOPASSWD login is a thing which you need to put in the /etc/sudoers file.

The answer to my question is at Ansible: best practice for maintaining list of sudoers.

The Ansible playbook code fragment looks like this from my problem:

- name: Make sure we have a 'wheel' group
  group:
    name: wheel
    state: present

- name: Allow 'wheel' group to have passwordless sudo
  lineinfile:
    dest: /etc/sudoers
    state: present
    regexp: '^%wheel'
    line: '%wheel ALL=(ALL) NOPASSWD: ALL'
    validate: 'visudo -cf %s'

- name: Add sudoers users to wheel group
  user:
    name=deployer
    groups=wheel
    append=yes
    state=present
    createhome=yes

- name: Set up authorized keys for the deployer user
  authorized_key: user=deployer key="{{item}}"
  with_file:
    - /home/railsdev/.ssh/id_rsa.pub

And the best part is that the solution is idempotent. It doesn't add the line

%wheel ALL=(ALL) NOPASSWD: ALL

to /etc/sudoers when the playbook is run a subsequent time. And yes...I was able to ssh into the server as "deployer" and run sudo commands without having to give a password.

I had this error when I tried to create a replicationcontroller. The issue was, I wrongly spelt the nginx image name in template definition.

Note: This error occurs when kubernetes is unable to pull the specified image from the repository.

With mysql Ver 14.14 Distrib 5.7.22 the update statement is now:

update user set authentication_string=password('1111') where user='root';

2 points in addition to all other good answers:

1:

what are the Grant Tables?

from dev.mysql.com

The MySQL system database includes several grant tables that contain information about user accounts and the privileges held by them.

clari?cation: in MySQL, there are some inbuilt databases , one of them is "mysql" , all the tables on "mysql" database have been called as grant tables

2:

note that if you perform:

UPDATE a_grant_table SET password=PASSWORD('1234') WHERE test_col = 'test_val';

and refresh phpMyAdmin , you'll realize that your password has been changed on that table but even now if you perform:

mysql -u someuser -p

your access will be denied by your new password until you perform :

FLUSH PRIVILEGES;

I'd had this issue for too long (SO etc hadn't helped) and only just solved it (using sdk 25).

-The local.properties file proguard.dir var was not applying with ant; I'd specified 5.3.2, but a command line call and signed export build (eclipse) was using 4.7, from the sdk dir(only 5+ supports java 8)

My solution was to replace the proguard jars (android-sdk/tools/proguard/libs directory) in the sdk with a current (5+) version of proguard.

Use jackson-bom which will have all the three jackson versions.i.e.jackson-annotations, jackson-core and jackson-databind. This will resolve the dependencies related to those versions

mybe your hive metastore are inconsistent! I'm in this scene.

first. I run

 $ schematool -dbType mysql -initSchema  

then I found this

Error: Duplicate key name 'PCS_STATS_IDX' (state=42000,code=1061) org.apache.hadoop.hive.metastore.HiveMetaException: Schema initialization FAILED! Metastore state would be inconsistent !!

then I run

 $ schematool -dbType mysql -info

found this error

Hive distribution version: 2.3.0 Metastore schema version: 1.2.0 org.apache.hadoop.hive.metastore.HiveMetaException: Metastore schema version is not compatible. Hive Version: 2.3.0, Database Schema Version: 1.2.0

• drop mysql database, the database named hive_db
• run schematool -dbType mysql -initSchema for initialize metadata

Do not log in as a root user, try another one with sudo permissions.

You have to initialize the data directory by running the following command

mysqld --initialize [with random root password]

mysqld --initialize-insecure [with blank root password]

You can run a command in a running container using docker exec [OPTIONS] CONTAINER COMMAND [ARG...]:

docker exec mycontainer /path/to/test.sh

And to run from a bash session:

docker exec -it mycontainer /bin/bash

From there you can run your script.

That version number (51.0) indicates that you are trying to run classes compiled for Java 7. You will need to recompile them for Java 6.

Note, however, that some features may no longer be compatible with Java 6, which is very old, and no longer (publicly) supported by Oracle.

In case you are uploading an sql file on cpanel, then try and replace root with your cpanel username in your sql file.

in the case above you could write

CREATE DEFINER = control_panel_username@localhost FUNCTION fnc_calcWalkedDistance

then upload the file. Hope it helps

If you use MAMP, you might have to set the socket: unix_socket: /Applications/MAMP/tmp/mysql/mysql.sock

The configuration here is working for me:

configurations {
    customProvidedRuntime
}

dependencies {
    compile(
        // Spring Boot dependencies
    )

    customProvidedRuntime('org.springframework.boot:spring-boot-starter-tomcat')
}

war {
    classpath = files(configurations.runtime.minus(configurations.customProvidedRuntime))
}

springBoot {
    providedConfiguration = "customProvidedRuntime"
}

If you are using springboot then jackson is added by default,

So the version of jackson you are adding manualy is probably conflicting with the one spring boot adds,

Try to delete the jackson dependencies from your pom,

If you need to override the version spring boots add, then you need to exclude it first and then add your own

Do this in your .profile -

export JAVA_HOME=`/usr/libexec/java_home`

(backticks make sure to execute the command and place its value in JAVA_HOME)

I came here because I had the same problem.
What was the problem for me was that the procedure was defined in the package body, but not in the package header.
I was executing my function with a lose BEGIN END statement.

In my experaince

15/02/22 18:23:04 WARN util.NativeCodeLoader: Unable to load native-hadoop
library for your platform... using builtin-java classes where applicable

You may have 64 bit version OS, and hadoop installation 32bit. refer this

java.net.ConnectException: Call From marta-komputer/127.0.1.1 to
localhost:9000 failed on connection exception: java.net.ConnectException: 
connection refused; For more details see:   
http://wiki.apache.org/hadoop/ConnectionRefused

this problem refers to your ssh public key authorization. please provide details about your ssh set up.

Please refer this link to check the complete steps.

also provide info if

cat $HOME/.ssh/authorized_keys

returns any result or not.

Try the command

sudo mysql_secure_installation

press enter and assign a new password for root in mysql/mariadb.

If you get an error like

ERROR 2002 (HY000): Can't connect to local MySQL server through socket '/var/run/mysqld/mysqld.sock'

enable the service with

service mysql start

now if you re-enter with

mysql -u root -p

if you follow the problem enter with sudo su and mysql -u root -p now apply permissions to root

GRANT ALL PRIVILEGES ON *.* TO 'root'@'localhost' IDENTIFIED BY '<password>';

this fixed my problem in MariaDB.

Good luck

Solving this problem is easy:

1. Open a command prompt with administrator privileges
   • Find "cmd", right-click on it, then select "Administrator".
2. In the prompt, type net stop W3SVC and Enter.

You can now click in WAMPP and restart all services. Open your browser and navigate to "localhost".

If you need to start W3SVC again,

1. Open a command prompt with administrator privileges
2. In the prompt, type net start W3SVC and Enter.

I fixed it using following configuration.

 Listen 85
 <VirtualHost *:85>
           DocumentRoot "C:/xampp/htdocs/LaraBlog/public"
           <Directory "C:/xampp/htdocs/CommunicationApp/public">
           DirectoryIndex index.php
           AllowOverride All
           Order allow,deny
           Allow from all
           </Directory>
 </VirtualHost>

For all users on a specific database, do the following:

# psql
\c your_database
select grantee, table_catalog, privilege_type, table_schema, table_name from information_schema.table_privileges order by grantee, table_schema, table_name;

Got stuck as I was trying to a go get ... I think it was related to git. Here is how was able to fix it ...

1. I entered the following in terminal:

   sudo xcodebuild -license
   

2. This will open the agreement. Go all the way to end and type "agree".

That takes care of go get issues.

It was quite interesting how unrelated things were.

You have to grant the Superuser right to the shell app (com.anroid.shell). In my case, I use Magisk to root my phone Nexsus 6P (Oreo 8.1). So I can grant Superuser right in the Magisk Manager app, whih is in the left upper option menu.

Writing an updated answer since most of the already present answers are obsolete as of now.

Versions earlier than Docker 19.03 used to require nvidia-docker2 and the --runtime=nvidia flag.

Since Docker 19.03, you need to install nvidia-container-toolkit package and then use the --gpus all flag.

So, here are the basics,

Package Installation

Install the nvidia-container-toolkit package as per official documentation at Github.

For Redhat based OSes, execute the following set of commands:

$ distribution=$(. /etc/os-release;echo $ID$VERSION_ID)
$ curl -s -L https://nvidia.github.io/nvidia-docker/$distribution/nvidia-docker.repo | sudo tee /etc/yum.repos.d/nvidia-docker.repo

$ sudo yum install -y nvidia-container-toolkit
$ sudo systemctl restart docker

For Debian based OSes, execute the following set of commands:

# Add the package repositories
$ distribution=$(. /etc/os-release;echo $ID$VERSION_ID)
$ curl -s -L https://nvidia.github.io/nvidia-docker/gpgkey | sudo apt-key add -
$ curl -s -L https://nvidia.github.io/nvidia-docker/$distribution/nvidia-docker.list | sudo tee /etc/apt/sources.list.d/nvidia-docker.list

$ sudo apt-get update && sudo apt-get install -y nvidia-container-toolkit
$ sudo systemctl restart docker

Running the docker with GPU support

docker run --name my_all_gpu_container --gpus all -t nvidia/cuda

Please note, the flag --gpus all is used to assign all available gpus to the docker container.

To assign specific gpu to the docker container (in case of multiple GPUs available in your machine)

docker run --name my_first_gpu_container --gpus device=0 nvidia/cuda

Or

docker run --name my_first_gpu_container --gpus '"device=0"' nvidia/cuda

I've had similar errors when trying to deploy a Gradle artefact to a Nexus Sonatype repository. You will get a 401 Unauthorized error if you supply the wrong credentials (password etc). You also get an error (and off the top of my head is also a 401) if you try to publish something to a releases repository and that version already exists in the repository. So you might find that by publishing from the command line it works, but then when you do it from a script it fails (because it didn't exist in the repository the first time around). Either publish using a different version number, or delete the old artefact on the server and republish.

The SNAPSHOTS repository (as opposed to the releases repository) allows you to overwrite a similarly numbered version, but your version number should have "-SNAPSHOT" at the end of it.

this will make the powershell window to wait until you press any key:

pause

Update One

Thanks to Stein. it is the Enter key not any key.

I got the same error when xampp was installed on windows 10.

www.example.com:443:0 server certificate does NOT include an ID which matches the server name

So I opened httpd-ssl.conf file in xampp folder and changed the following line

ServerName www.example.com:443

To

ServerName localhost

And the problem was fixed.

I too faced the same issue.

Cannot determine embedded database driver class for database type NONE.

In my case deleting the jar file from repository corresponding to the database fixes the issue. There was corrupted jar present in the repository which was causing the issue.

Bind-address XXX.XX.XX.XXX in /etc/my.cnf

comment line:

skip-networking

or

skip-external-locking

after edit hit service mysqld restart

login into mysql and hit this query:

GRANT ALL PRIVILEGES ON dbname.* TO 'username'@'%' IDENTIFIED BY 'password';

FLUSH PRIVILEGES;
quit;

add firewall rule:

iptables -I INPUT -i eth0 -p tcp --destination-port 3306 -j ACCEPT

So that you don't mess up other permissions already on the file, use the flag +, such as via

sudo chmod -R o+rw /var/www

You're calling writer.close(); after you've done writing to it. Once a stream is closed, it can not be written to again. Usually, the way I go about implementing this is by moving the close out of the write to method.

public void writeToFile(){
    String file_text= pedStatusText + "     " + gatesStatus + "     " + DrawBridgeStatusText;
    try {
        writer.write(file_text);
        writer.flush();
    } catch (IOException e) {
        // TODO Auto-generated catch block
        e.printStackTrace();
    }
}

And add a method cleanUp to close the stream.

public void cleanUp() {
     writer.close();
}

This means that you have the responsibility to make sure that you're calling cleanUp when you're done writing to the file. Failure to do this will result in memory leaks and resource locking.

EDIT: You can create a new stream each time you want to write to the file, by moving writer into the writeToFile() method..

 public void writeToFile() {
    FileWriter writer = new FileWriter("status.txt", true);
    // ... Write to the file.

    writer.close();
 }

Install the vagrant-vbguest plugin by running this command:

vagrant plugin install vagrant-vbguest

I did the following to add a role 'eSumit' on PostgreSQL 9.4.15 database and provide all permission to this role :

CREATE ROLE eSumit;

GRANT ALL PRIVILEGES ON ALL TABLES IN SCHEMA public TO eSumit;

GRANT ALL PRIVILEGES ON DATABASE "postgres" to eSumit;

ALTER USER eSumit WITH SUPERUSER;

Also checked the pg_table enteries via :

select * from pg_roles;

Database queries snapshot :

My issue was, i am unable to create a view with my "scott" user in oracle 11g edition. So here is my solution for this

Error in my case

SQL>create view v1 as select * from books where id=10;

insufficient privileges.

Solution

1)open your cmd and change your directory to where you install your oracle database. in my case i was downloaded in E drive so my location is E:\app\B_Amar\product\11.2.0\dbhome_1\BIN> after reaching in the position you have to type sqlplus sys as sysdba

E:\app\B_Amar\product\11.2.0\dbhome_1\BIN>sqlplus sys as sysdba

2) Enter password: here you have to type that password that you give at the time of installation of oracle software.

3) Here in this step if you want create a new user then you can create otherwise give all the privileges to existing user.

for creating new user

SQL> create user abc identified by xyz;

here abc is user and xyz is password.

giving all the privileges to abc user

SQL> grant all privileges to abc;

 grant succeeded. 

if you are seen this message then all the privileges are giving to the abc user.

4) Now exit from cmd, go to your SQL PLUS and connect to the user i.e enter your username & password.Now you can happily create view.

In My case

in cmd E:\app\B_Amar\product\11.2.0\dbhome_1\BIN>sqlplus sys as sysdba

SQL> grant all privileges to SCOTT;

grant succeeded.

Now I can create views.

Try with array_intersect method

$id = $access_data['Privilege']['id']; 

if(count(array_intersect($id,$user_access_arr)) == 0){

$this->Session->setFlash(__('Access Denied! You are not eligible to access this.'), 'flash_custom_success');
return $this->redirect(array('controller'=>'Dashboard','action'=>'index'));
}

Also, it is very likely, that problem with proxy settings.

Any who didn't overcome Tomact starting problrem, - try in NetBeans choose No Proxy in the Tools -> Options -> General tab.

It helped me.

Suppose you are usin Jersey 2.25.1, this worked for me - I am using Apache Tomcat web container:

    <dependency>
        <groupId>org.glassfish.jersey.core</groupId>
        <artifactId>jersey-server</artifactId>
        <version>2.25.1</version>
    </dependency>
    <dependency>
        <groupId>org.glassfish.jersey.containers</groupId>
        <artifactId>jersey-container-servlet</artifactId>
        <version>2.25.1</version>
    </dependency>

NB: Replace version with the version you are using

The reason i could not delete some of the users via 'drop' statement was that there is a bug in Mysql http://bugs.mysql.com/bug.php?id=62255 with hostname containing upper case letters. The solution was running following query:

DELETE FROM mysql.user where host='Some_Host_With_UpperCase_Letters';

I am still trying to figure the other issue where the root user with all permissions are unable to grant privileges to new user for particular database

You cannot insert data because you have a quota of 0 on the tablespace. To fix this, run

ALTER USER <user> quota unlimited on <tablespace name>;

or

ALTER USER <user> quota 100M on <tablespace name>;

as a DBA user (depending on how much space you need / want to grant).

If your user account has spaces in it and you have tried all the above but none worked,

I recommended you create a new windows user account and give it an administrative privilege, not standard.

Log out of your old account and log into this new account and try installing again. It worked well.

You can specify become_method to override the default method set in ansible.cfg (if any), and which can be set to one of sudo, su, pbrun, pfexec, doas, dzdo, ksu.

- name: I am confused
  command: 'whoami'
  become: true
  become_method: su
  become_user: some_user
  register: myidentity

- name: my secret identity
  debug:
    msg: '{{ myidentity.stdout }}'

Should display

TASK [my-task : my secret identity] ************************************************************
ok: [my_ansible_server] => {
    "msg": "some_user"
}

Near the top of the code with the Public Workshop(), I am assumeing this bit,

suitButton = new JCheckBox("Suit");
suitButton.setMnemonic(KeyEvent.VK_Y);


suitButton = new JCheckBox("Denim Jeans");
suitButton.setMnemonic(KeyEvent.VK_U);

should maybe be,

suitButton = new JCheckBox("Suit");
suitButton.setMnemonic(KeyEvent.VK_Y);


denimjeansButton = new JCheckBox("Denim Jeans");
denimjeansButton.setMnemonic(KeyEvent.VK_U);

You may get ORA-01031: insufficient privileges instead of ORA-00942: table or view does not exist when you have at least one privilege on the table, but not the necessary privilege.

Create schemas

SQL> create user schemaA identified by schemaA;

User created.

SQL> create user schemaB identified by schemaB;

User created.

SQL> create user test_user identified by test_user;

User created.

SQL> grant connect to test_user;

Grant succeeded.

Create objects and privileges

It is unusual, but possible, to grant a schema a privilege like DELETE without granting SELECT.

SQL> create table schemaA.table1(a number);

Table created.

SQL> create table schemaB.table2(a number);

Table created.

SQL> grant delete on schemaB.table2 to test_user;

Grant succeeded.

Connect as TEST_USER and try to query the tables

This shows that having some privilege on the table changes the error message.

SQL> select * from schemaA.table1;
select * from schemaA.table1
                      *
ERROR at line 1:
ORA-00942: table or view does not exist


SQL> select * from schemaB.table2;
select * from schemaB.table2
                      *
ERROR at line 1:
ORA-01031: insufficient privileges


SQL>

Check in Deployment Assembly,

I have the same error, when i generate the war file with the "maven clean install" way and deploy manualy, it works fine, but when i use the runtime enviroment (eclipse) the problems come.

The solution for me (for eclipse IDE) go to: "proyect properties" --> "Deployment Assembly" --> "Add" --> "the jar you need", in my case java "build path entries". Maybe can help a litle!

I followed these steps (for Mac).

In /etc/ssh/sshd_config change

#ChallengeResponseAuthentication yes
#PasswordAuthentication yes

to

ChallengeResponseAuthentication no
PasswordAuthentication no

Now generate the RSA key:

ssh-keygen -t rsa -P '' -f ~/.ssh/id_rsa

(For me an RSA key worked. A DSA key did not work.)

A private key will be generated in ~/.ssh/id_rsa along with ~/.ssh/id_rsa.pub (public key).

Now move to the .ssh folder: cd ~/.ssh

Enter rm -rf authorized_keys (sometimes multiple keys lead to an error).

Enter vi authorized_keys

Enter :wq to save this empty file

Enter cat ~/.ssh/id_rsa.pub >> ~/.ssh/authorized_keys

Restart the SSH:

sudo launchctl stop com.openssh.sshd
sudo launchctl start com.openssh.sshd

Another option is to use the Apache Maven Shade Plugin: This plugin provides the capability to package the artifact in an uber-jar, including its dependencies and to shade - i.e. rename - the packages of some of the dependencies.

add this to your build plugins section

<plugin>
     <groupId>org.apache.maven.plugins</groupId>
     <artifactId>maven-shade-plugin</artifactId>
</plugin>

This is because of a higher JDK during compile time and lower JDK during runtime. So you just need to update your JDK version, possible to JDK 7

You may also check Unsupported major.minor version 51.0

It looks like you're trying to make a user 'golden'@'%' but a different user by the name of 'golden'@'localhost' is getting in the way/has precedence.

Do this command to see the users:

SELECT user,host FROM mysql.user;

You should see two entries:

1) user= golden, host=%

2) user= golden, host=localhost

Do these Command:

DROP User 'golden'@'localhost';
DROP User 'golden'@'%';

Restart MySQL Workbench.

Then do your original commands again:

CREATE USER 'golden'@'%' IDENTIFIED BY 'password';
GRANT ALL PRIVILEGES ON * . * TO 'golden'@'%';

Then when you go to try to sign in to MySQL, type it in like this:

Hit 'Test Connection' and enter your password 'password'.

While out of the box, MongoDb has no authentication, you can create the equivalent of a root/superuser by using the "any" roles to a specific user to the admin database.

Something like this:

use admin
db.addUser( { user: "<username>",
          pwd: "<password>",
          roles: [ "userAdminAnyDatabase",
                   "dbAdminAnyDatabase",
                   "readWriteAnyDatabase"

] } )

Update for 2.6+

While there is a new root user in 2.6, you may find that it doesn't meet your needs, as it still has a few limitations:

Provides access to the operations and all the resources of the readWriteAnyDatabase, dbAdminAnyDatabase, userAdminAnyDatabase and clusterAdmin roles combined.

root does not include any access to collections that begin with the system. prefix.

Update for 3.0+

Use db.createUser as db.addUser was removed.

Update for 3.0.7+

root no longer has the limitations stated above.

The root has the validate privilege action on system. collections. Previously, root does not include any access to collections that begin with the system. prefix other than system.indexes and system.namespaces.

I also had the same issue. I fixed this by installing the .NET framework version 4.5.

I had to delete Tomcat's work directory as it had cached previously generated files. To do this:

1. Stop Tomcat
2. Delete the 'work' directory
3. Start Tomcat

This will cause the work directory to be newly generated.

Thank you all for your reply. I have got my script working with the module/ script written by Preston Landers way back in 2010. After two days of browsing the internet I could find the script as it was was deeply hidden in pywin32 mailing list. With this script it is easier to check if the user is admin and if not then ask for UAC/ admin right. It does provide output in separate windows to find out what the code is doing. Example on how to use the code also included in the script. For the benefit of all who all are looking for UAC on windows have a look at this code. I hope it helps someone looking for same solution. It can be used something like this from your main script:-

import admin
if not admin.isUserAdmin():
        admin.runAsAdmin()

The actual code is:-

#!/usr/bin/env python
# -*- coding: utf-8; mode: python; py-indent-offset: 4; indent-tabs-mode: nil -*-
# vim: fileencoding=utf-8 tabstop=4 expandtab shiftwidth=4

# (C) COPYRIGHT © Preston Landers 2010
# Released under the same license as Python 2.6.5


import sys, os, traceback, types

def isUserAdmin():

    if os.name == 'nt':
        import ctypes
        # WARNING: requires Windows XP SP2 or higher!
        try:
            return ctypes.windll.shell32.IsUserAnAdmin()
        except:
            traceback.print_exc()
            print "Admin check failed, assuming not an admin."
            return False
    elif os.name == 'posix':
        # Check for root on Posix
        return os.getuid() == 0
    else:
        raise RuntimeError, "Unsupported operating system for this module: %s" % (os.name,)

def runAsAdmin(cmdLine=None, wait=True):

    if os.name != 'nt':
        raise RuntimeError, "This function is only implemented on Windows."

    import win32api, win32con, win32event, win32process
    from win32com.shell.shell import ShellExecuteEx
    from win32com.shell import shellcon

    python_exe = sys.executable

    if cmdLine is None:
        cmdLine = [python_exe] + sys.argv
    elif type(cmdLine) not in (types.TupleType,types.ListType):
        raise ValueError, "cmdLine is not a sequence."
    cmd = '"%s"' % (cmdLine[0],)
    # XXX TODO: isn't there a function or something we can call to massage command line params?
    params = " ".join(['"%s"' % (x,) for x in cmdLine[1:]])
    cmdDir = ''
    showCmd = win32con.SW_SHOWNORMAL
    #showCmd = win32con.SW_HIDE
    lpVerb = 'runas'  # causes UAC elevation prompt.

    # print "Running", cmd, params

    # ShellExecute() doesn't seem to allow us to fetch the PID or handle
    # of the process, so we can't get anything useful from it. Therefore
    # the more complex ShellExecuteEx() must be used.

    # procHandle = win32api.ShellExecute(0, lpVerb, cmd, params, cmdDir, showCmd)

    procInfo = ShellExecuteEx(nShow=showCmd,
                              fMask=shellcon.SEE_MASK_NOCLOSEPROCESS,
                              lpVerb=lpVerb,
                              lpFile=cmd,
                              lpParameters=params)

    if wait:
        procHandle = procInfo['hProcess']    
        obj = win32event.WaitForSingleObject(procHandle, win32event.INFINITE)
        rc = win32process.GetExitCodeProcess(procHandle)
        #print "Process handle %s returned code %s" % (procHandle, rc)
    else:
        rc = None

    return rc

def test():
    rc = 0
    if not isUserAdmin():
        print "You're not an admin.", os.getpid(), "params: ", sys.argv
        #rc = runAsAdmin(["c:\\Windows\\notepad.exe"])
        rc = runAsAdmin()
    else:
        print "You are an admin!", os.getpid(), "params: ", sys.argv
        rc = 0
    x = raw_input('Press Enter to exit.')
    return rc


if __name__ == "__main__":
    sys.exit(test())

You can grant system privileges with or without the admin option. The default being without admin option.

GRANT CREATE SESSION TO username

or with admin option:

GRANT CREATE SESSION TO username WITH ADMIN OPTION

The Grantee with the ADMIN OPTION can grant and revoke privileges to other users

You have to reset the password! steps for mac osx(tested and working) and ubuntu

Stop MySQL

$ sudo /usr/local/mysql/support-files/mysql.server stop

Start it in safe mode:

$ sudo mysqld_safe --skip-grant-tables

(above line is the whole command)

This will be an ongoing command until the process is finished so open another shell/terminal window, log in without a password:

$ mysql -u root

mysql> UPDATE mysql.user SET Password=PASSWORD('password') WHERE User='root';

Start MySQL

sudo /usr/local/mysql/support-files/mysql.server start

your new password is 'password'.

i also faced this problem,

i found password field was blank in config file of phpmyadmin. i put that password which i filled in database settings. now it is working fine

This is a pretty old thread but the problem is still the same -

I tried multiple things, none of them worked -

1. Added a Start In Path (without quotes)
2. Removed the complete path of the batch file in the Program/Script field etc
3. Added C:\Windows\system32\cmd.exe to the Program and added /c myscript.bat to the arguments field.

This is what worked for me -

Program/Script Field - cmd

Add Arguments - /c myscript.bat

Start In : Path to myscript.bat

For those who are able to access cpanel, there is a simpler way getting around it.

1. log in cpanel => "Remote MySQL" under DATABASES section:

2. Add the IPs / hostname which you are accessing from

3. done!!!

The link has the driver for sqlserver, download and add it your eclipse buildpath.

If you are using IIS Express and VS 2017:

Go to the Web Application Properties > Web Tab > Servers Section > And change the Bitness to x64.

Nginx needs to run by command 'sudo /etc/init.d/nginx start'

I found that the problem was to do with Powershell not being able to run scripts, if that's the case for you, here is the solution.

Try the following, none of the above solved it for me

Select "Run as administrator"

Then click on the big left box next to Apache

And Choose to uninstall Apache

I have no idea why this worked but it solved my problem directly!

First off, when I went into cmd and typed "netsh wlan show drivers", I had a NO for hosted network support too. Doesn't matter, you can still do it. Just not in cmd.

I think this problem happens because they changed the way hosted networks work in windows 10. Don't use command line.

Just go on your pc to settings>Network>Mobile Hotspot and you should see all the necessary settings there. Turn it on, set up your network.

If it's still not working, go to Control panel>Network and Internet>Network and Sharing Center>Change Adapter Options> and then click on the properties of the network adapter that you want to share. Go to the sharing tab, and share that internet connection, selecting the name of the adapter you want to use to share it with.

Here are few pointers/suggestions for investigation

1. I see that every time you vote, you call vote method which creates a fresh HTTP connection.
2. This might be a problem. I would suggest to use a single HttpClient instance to post to the server. This way it wont create too many connections from the client side.
3. At the end of everything, HttpClient needs to be shut and hence call httpclient.getConnectionManager().shutdown(); to release the resources used by the connections.

I literally deleted every file from c:\xampp\mysql\data\ except my.ini and it works

Do not use passwords. Use peer authentication instead:

postgres://myuser@%2Fvar%2Frun%2Fpostgresql/mydb

For me i was using MYSQLWorkbench and the port was 3306 MAMP using 8889

It happens a lot with my genymotion devices. Make sure you have a good amount of memory available on your drive where Genymotion is installed.

go to C:xampp\apache\conf\extra\httpd-ssl.conf
Find the line where it says Listen 443, change it to Listen 4330 and restart your computer

[![enter image description here][2]][2]

The USAGE-privilege in mysql simply means that there are no privileges for the user 'phpadmin'@'localhost' defined on global level *.*. Additionally the same user has ALL-privilege on database phpmyadmin phpadmin.*.

So if you want to remove all the privileges and start totally from scratch do the following:

• Revoke all privileges on database level:

  REVOKE ALL PRIVILEGES ON phpmyadmin.* FROM 'phpmyadmin'@'localhost';

• Drop the user 'phpmyadmin'@'localhost'

  DROP USER 'phpmyadmin'@'localhost';

Above procedure will entirely remove the user from your instance, this means you can recreate him from scratch.

To give you a bit background on what described above: as soon as you create a user the mysql.user table will be populated. If you look on a record in it, you will see the user and all privileges set to 'N'. If you do a show grants for 'phpmyadmin'@'localhost'; you will see, the allready familliar, output above. Simply translated to "no privileges on global level for the user". Now your grant ALL to this user on database level, this will be stored in the table mysql.db. If you do a SELECT * FROM mysql.db WHERE db = 'nameofdb'; you will see a 'Y' on every priv.

Above described shows the scenario you have on your db at the present. So having a user that only has USAGE privilege means, that this user can connect, but besides of SHOW GLOBAL VARIABLES; SHOW GLOBAL STATUS; he has no other privileges.

In my situation I had moved the htdocs to a new location updated in httpd.conf, which worked fine. I then received the same error after updating the httpd-vhost.conf file.

I found that the error was caused by a typo in the vhost configuration file. Previously I changed all "DocumentRoot" ’s to the new htdocs location, but had forgot to update the new location for "ErrorLog". After correcting the missing path, Apache was running smooth again.

For a production system, you can use this configuration :

--ACCESS DB
REVOKE CONNECT ON DATABASE nova FROM PUBLIC;
GRANT  CONNECT ON DATABASE nova  TO user;

--ACCESS SCHEMA
REVOKE ALL     ON SCHEMA public FROM PUBLIC;
GRANT  USAGE   ON SCHEMA public  TO user;

--ACCESS TABLES
REVOKE ALL ON ALL TABLES IN SCHEMA public FROM PUBLIC ;
GRANT SELECT                         ON ALL TABLES IN SCHEMA public TO read_only ;
GRANT SELECT, INSERT, UPDATE, DELETE ON ALL TABLES IN SCHEMA public TO read_write ;
GRANT ALL                            ON ALL TABLES IN SCHEMA public TO admin ;

Please see http://mvnrepository.com/artifact/javax.mail/mail/, you can download jar or use the maven dependency, depending on your project type. That should pretty much cover it and you won't get a NoClassDefFoundError exception.

% mysql --user=root mysql
CREATE USER 'monty'@'localhost' IDENTIFIED BY 'some_pass';
GRANT ALL PRIVILEGES ON *.* TO 'monty'@'localhost' WITH GRANT OPTION;
CREATE USER 'monty'@'%' IDENTIFIED BY 'some_pass';
GRANT ALL PRIVILEGES ON *.* TO 'monty'@'%' WITH GRANT OPTION;
CREATE USER 'admin'@'localhost';
GRANT RELOAD,PROCESS ON *.* TO 'admin'@'localhost';
CREATE USER 'dummy'@'localhost';
FLUSH PRIVILEGES;

Search here for centos jre install all users:

The easiest way to set an environment variable in CentOS is to use export as in

$> export JAVA_HOME=/usr/java/jdk.1.5.0_12

$> export PATH=$PATH:$JAVA_HOME

However, variables set in such a manner are transient i.e. they will disappear the moment you exit the shell. Obviously this is not helpful when setting environment variables that need to persist even when the system reboots. In such cases, you need to set the variables within the system wide profile. In CentOS (I’m using v5.2), the folder /etc/profile.d/ is the recommended place to add customizations to the system profile. For example, when installing the Sun JDK, you might need to set the JAVA_HOME and JRE_HOME environment variables. In this case: Create a new file called java.sh

vim /etc/profile.d/java.sh

Within this file, initialize the necessary environment variables

export JRE_HOME=/usr/java/jdk1.5.0_12/jre
export PATH=$PATH:$JRE_HOME/bin

export JAVA_HOME=/usr/java/jdk1.5.0_12
export JAVA_PATH=$JAVA_HOME

export PATH=$PATH:$JAVA_HOME/bin

Now when you restart your machine, the environment variables within java.sh will be automatically initialized (checkout /etc/profile if you are curious how the files in /etc/profile.d/ are loaded).

PS: If you want to load the environment variables within java.sh without having to restart the machine, you can use the source command as in:

$> source java.sh

Issue could be with different table(might not exists or grant privilege is not for that table) mapped due to foreign key or synonym.

For me the issue was with a column in that table which had mapping with another schema-table, and it was missing.ex, public-synonym.

Copyed the *.jar into my WEB-INF/lib folder -> Worked for me. When including over buildpath there was everytime this errormsg.

I had the same exact problem and my issue was that I had 2 IP addresses from 2 different networks configured in the etc/hosts as below.

10.xxx.x.xxx    localhost
192.xxx.x.xxx   localhost

This should be because there was a conflict as to which IP to be used for the other devices to reach the rmiregistry over the network.

Once I removed the extra-record that is not required, I was able to solve the issue.

So my etc/hosts file had only the following record.

10.xxx.x.xxx    localhost

GRANT ALL PRIVILEGES ON ALL TABLES IN SCHEMA public to jerry;
GRANT ALL PRIVILEGES ON ALL SEQUENCES IN SCHEMA public to jerry;
GRANT ALL PRIVILEGES ON ALL FUNCTIONS IN SCHEMA public to jerry;

Here is how I resolved this issue

Go to the remote repository on Github and copy the project's repository url.

On git bash type: git remote add origin the remote repository url goes here

Ok so i figured it out. Go to yourWorkspace/.metadata/.plugins and delete everything in there. Eclipse will start and repopulate the folder.

For me, this code worked:

/Applications/Postgres.app/Contents/Versions/9.4/bin/createuser -s postgres

it came from here: http://talk.growstuff.org/t/fatal-role-postgres-does-not-exist/216/4

Well, Even I tried to log in with the admin/password which was failed. So I created my own user like this.

1. Go to Jenkins home folder (C:\User.jenkins or you can find this in Jenkins server startup logs)
2. Go to Config file config.xml
3. set disableSignup to false false if at all you want to disable login security 4.set ser security to false. true

I had naively added junit-4.12.jar from poi.apache.org to my Build Path in Eclipse. I deleted it (Project, Properties, Java Build Path, Libraries, junit-4.12.jar, Remove) then in my test class allowed Eclipse to "Fix Project Setup" after pressing Ctrl-1. No more problems! :-)

First you need to keep copy of following somewhere in your hard disk.

C:\xampp\mysql\backup

C:\xampp\mysql\data

After that

Copy every thing inside "C:\xampp\mysql\backup" and paste and replace it in
"C:\xampp\mysql\data"

Now your mysql will work in phpmyadmin but your tables will show "Table not found in engine"

For this you will have to go to the copy of "backup and data folders" which have created in your hard disk and there in the data folder copy "ibdata1" file and past and replace in the "C:\xampp\mysql\data".

Now your tables data will be available.

Run

git remote -v

and check whether your origin's URL has your co-worker's username hardcoded in there. If so, substitute it with your own:

git remote set-url origin <url-with-your-username>

In addition to VAV's answer, The first one was most useful in my environment

select * from USER_ROLE_PRIVS where USERNAME='SAMPLE';
select * from USER_TAB_PRIVS where Grantee = 'SAMPLE';
select * from USER_SYS_PRIVS where USERNAME = 'SAMPLE';

IUSR is part of IIS_IUSER group.so i guess you can remove the permissions for IUSR without worrying. Further Reading

However, a problem arose over time as more and more Windows system services started to run as NETWORKSERVICE. This is because services running as NETWORKSERVICE can tamper with other services that run under the same identity. Because IIS worker processes run third-party code by default (Classic ASP, ASP.NET, PHP code), it was time to isolate IIS worker processes from other Windows system services and run IIS worker processes under unique identities. The Windows operating system provides a feature called "Virtual Accounts" that allows IIS to create unique identities for each of its Application Pools. DefaultAppPool is the by default pool that is assigned to all Application Pool you create.

To make it more secure you can change the IIS DefaultAppPool Identity to ApplicationPoolIdentity.

Regarding permission, Create and Delete summarizes all the rights that can be given. So whatever you have assigned to the IIS_USERS group is that they will require. Nothing more, nothing less.

hope this helps.

You can use these queries:

select * from all_tab_privs;
select * from dba_sys_privs;
select * from dba_role_privs;

Each of these tables have a grantee column, you can filter on that in the where criteria:

where grantee = 'A'

To query privileges on objects (e.g. tables) in other schema I propose first of all all_tab_privs, it also has a table_schema column.

If you are logged in with the same user whose privileges you want to query, you can use user_tab_privs, user_sys_privs, user_role_privs. They can be queried by a normal non-dba user.

Had the same issue today. I added the user to:

Administrative Tools -> Local Security Policy -> Local Policies -> User Rights Assignment -> Log on as a batch job

But was still getting the error. I found this post, and it turns out there's also this setting that I had to remove the user from (not sure how it got in there):

Administrative Tools -> Local Security Policy -> Local Policies -> User Rights Assignment -> Deny log on as a batch job

So just be aware that you may need to check both policies for the user.

Try stopping Apache and MySql and starting them again in the following order.

1. Apache
2. MySql
3. Etc...

Wait for both services to stop properly before restarting. Turning them on and off too quickly gives the same problem.

Inspired by lansharks answer.

java.io.NotSerializableException can occur when you serialize an inner class instance because:

serializing such an inner class instance will result in serialization of its associated outer class instance as well

Serialization of inner classes (i.e., nested classes that are not static member classes), including local and anonymous classes, is strongly discouraged

Ref: The Serializable Interface

When you use just "localhost" the MySQL client library tries to use a Unix domain socket for the connection instead of a TCP/IP connection. The error is telling you that the socket, called MySQL, cannot be used to make the connection, probably because it does not exist (error number 2).

From the MySQL Documentation:

On Unix, MySQL programs treat the host name localhost specially, in a way that is likely different from what you expect compared to other network-based programs. For connections to localhost, MySQL programs attempt to connect to the local server by using a Unix socket file. This occurs even if a --port or -P option is given to specify a port number. To ensure that the client makes a TCP/IP connection to the local server, use --host or -h to specify a host name value of 127.0.0.1, or the IP address or name of the local server. You can also specify the connection protocol explicitly, even for localhost, by using the --protocol=TCP option.

There are a few ways to solve this problem.

1. You can just use TCP/IP instead of the Unix socket. You would do this by using 127.0.0.1 instead of localhost when you connect. The Unix socket might by faster and safer to use, though.
2. You can change the socket in php.ini: open the MySQL configuration file my.cnf to find where MySQL creates the socket, and set PHP's mysqli.default_socket to that path. On my system it's /var/run/mysqld/mysqld.sock.

3. Configure the socket directly in the PHP script when opening the connection. For example:

   $db = new MySQLi('localhost', 'kamil', '***', '', 0, 
                                 '/var/run/mysqld/mysqld.sock')
   

For me, I was setting up a database with pgAdmin and it seems setting the owner during database creation was not enough. I had to navigate down to the 'public' schema and set the owner there as well (was originally 'postgres').

I had the same problem, but I understand the VMware service is the problem. VMware host service and Apache service conflict together.

To Solve it » Run your task manager » in services tab find VMwareHostd » then right click and stop it » every thing have been solved.

Maybe this is useful to anyone in the future, I have implemented a custom Authorize Attribute like this:

[AttributeUsage(AttributeTargets.Class | AttributeTargets.Method, AllowMultiple = true, Inherited = true)]
public class ClaimAuthorizeAttribute : AuthorizeAttribute, IAuthorizationFilter
{
    private readonly string _claim;

    public ClaimAuthorizeAttribute(string Claim)
    {
        _claim = Claim;
    }

    public void OnAuthorization(AuthorizationFilterContext context)
    {
        var user = context.HttpContext.User;
        if(user.Identity.IsAuthenticated && user.HasClaim(ClaimTypes.Name, _claim))
        {
            return;
        }

        context.Result = new ForbidResult();
    }
}

• Use -S option in the sudo command which tells to read the password from 'stdin' instead of the terminal device.

• Tell Popen to read stdin from PIPE.

• Send the Password to the stdin PIPE of the process by using it as an argument to communicate method. Do not forget to add a new line character, '\n', at the end of the password.

sp = Popen(cmd , shell=True, stdin=PIPE)
out, err = sp.communicate(_user_pass+'\n')   

Using java 1.7, on UNIX -

java -cp myjar.jar:lib/*:. mypackage.MyClass

On Windows you need to use ';' instead of ':' -

java -cp myjar.jar;lib/*;. mypackage.MyClass

In my case I was already logged in as a local administrator and I needed to run CMD as a domain admin so what worked for me was running the below from a powershell window:

runas /noprofile /user:DOMAIN\USER "cmd"

I had this problem - the symptoms were the same, but the issue I had was that I had set the "My Documents" folder to be on a network share, and the share was not accessible.

The root problem was that the IIS config files located at %USERPROFILE%\Documents are not accessible. Once I changed the "My Documents" folder location (I modified the reg value), it started working again.

I know that this may not be a common scenario that you might run into, but I've posted it here because it gives the same symptoms.

Another option is to delete all the classes and rebuild. Having build file is an ideal solution to control whole process like compilation, packaging and deployment. You can also specify source/target versions

If you wish to list all tables, you must use:

\dt *.*

to indicate that you want all tables in all schemas. This will include tables in pg_catalog, the system tables, and those in information_schema. There's no built-in way to say "all tables in all user-defined schemas"; you can, however, set your search_path to a list of all schemas of interest before running \dt.

You may want to do this programmatically, in which case psql backslash-commands won't do the job. This is where the INFORMATION_SCHEMA comes to the rescue. To list tables:

SELECT table_name FROM information_schema.tables WHERE table_schema = 'public';

BTW, if you ever want to see what psql is doing in response to a backslash command, run psql with the -E flag. eg:

$ psql -E regress    
regress=# \list
********* QUERY **********
SELECT d.datname as "Name",
       pg_catalog.pg_get_userbyid(d.datdba) as "Owner",
       pg_catalog.pg_encoding_to_char(d.encoding) as "Encoding",
       d.datcollate as "Collate",
       d.datctype as "Ctype",
       pg_catalog.array_to_string(d.datacl, E'\n') AS "Access privileges"
FROM pg_catalog.pg_database d
ORDER BY 1;
**************************

so you can see that psql is searching pg_catalog.pg_database when it gets a list of databases. Similarly, for tables within a given database:

SELECT n.nspname as "Schema",
  c.relname as "Name",
  CASE c.relkind WHEN 'r' THEN 'table' WHEN 'v' THEN 'view' WHEN 'i' THEN 'index' WHEN 'S' THEN 'sequence' WHEN 's' THEN 'special' WHEN 'f' THEN 'foreign table' END as "Type",
  pg_catalog.pg_get_userbyid(c.relowner) as "Owner"
FROM pg_catalog.pg_class c
     LEFT JOIN pg_catalog.pg_namespace n ON n.oid = c.relnamespace
WHERE c.relkind IN ('r','')
      AND n.nspname <> 'pg_catalog'
      AND n.nspname <> 'information_schema'
      AND n.nspname !~ '^pg_toast'
  AND pg_catalog.pg_table_is_visible(c.oid)
ORDER BY 1,2;

It's preferable to use the SQL-standard, portable INFORMATION_SCHEMA instead of the Pg system catalogs where possible, but sometimes you need Pg-specific information. In those cases it's fine to query the system catalogs directly, and psql -E can be a helpful guide for how to do so.

blog_development doesn't exist

You can see this in sql by the 0 rows affected message

create it in mysql with

mysql> create database blog_development

However as you are using rails you should get used to using

$ rake db:create

to do the same task. It will use your database.yml file settings, which should include something like:

development:
  adapter: mysql2
  database: blog_development
  pool: 5

Also become familiar with:

$ rake db:migrate  # Run the database migration
$ rake db:seed     # Run thew seeds file create statements
$ rake db:drop     # Drop the database

You can see the privileges here.

Then you can edit the user

Prepare MANIFEST.MF file with the following content

Manifest-Version: 1.0
Main-Class: org.testng.TestNG

Pack all test and dependency classes in the same jar, say tests.jar

jar cmf MANIFEST.MF tests.jar -C folder-with-classes/ .

Notice trailing ".", replace folder-with-classes/ with proper folder name or path.

Create testng.xml with content like below

<?xml version="1.0" encoding="UTF-8"?>
<!DOCTYPE suite SYSTEM "http://testng.org/testng-1.0.dtd" >
<suite name="Tests" verbose="5">
  <test name="Test1">
    <classes>
      <class name="com.example.yourcompany.qa.Test1"/>
    </classes>
  </test>  
</suite>

Replace com.example.yourcompany.qa.Test1 with path to your Test class.

Run your tests

java -jar tests.jar testng.xml

Gain access to a MariaDB 10 database server

After stopping the database server, the next step is to gain access to the server through a backdoor by starting the database server and skipping networking and permission tables. This can be done by running the commands below.

sudo mysqld_safe --skip-grant-tables --skip-networking &

Reset MariaDB root Password

Now that the database server is started in safe mode, run the commands below to logon as root without password prompt. To do that, run the commands below

sudo mysql -u root

Then run the commands below to use the mysql database.

use mysql;

Finally, run the commands below to reset the root password.

update user set password=PASSWORD("new_password_here") where User='root';

Replace new_password _here with the new password you want to create for the root account, then press Enter.

After that, run the commands below to update the permissions and save your changes to disk.

flush privileges;

Exit (CTRL + D) and you’re done.

Next start MariaDB normally and test the new password you just created.

sudo systemctl stop mariadb.service
sudo systemctl start mariadb.service

Logon to the database by running the commands below.

sudo mysql -u root -p

source: https://websiteforstudents.com/reset-mariadb-root-password-ubuntu-17-04-17-10/

The executable packer maven plugin can be used for exactly that purpose: creating standalone java applications containing all dependencies as JAR files in a specific folder.

Just add the following to your pom.xml inside the <build><plugins> section (be sure to replace the value of mainClass accordingly):

<plugin>
    <groupId>de.ntcomputer</groupId>
    <artifactId>executable-packer-maven-plugin</artifactId>
    <version>1.0.1</version>
    <configuration>
        <mainClass>com.example.MyMainClass</mainClass>
    </configuration>
    <executions>
        <execution>
            <goals>
                <goal>pack-executable-jar</goal>
            </goals>
        </execution>
    </executions>
</plugin>

The built JAR file is located at target/<YourProjectAndVersion>-pkg.jar after you run mvn package. All of its compile-time and runtime dependencies will be included in the lib/ folder inside the JAR file.

Disclaimer: I am the author of the plugin.

Check that your remote host (i.e. the web hosting server you're trying to connect FROM) allows OUTGOING traffic on port 3306.

I saw the (100) error in this situation. I could connect from my PC/Mac, but not from my website. The MySQL instance was accessible via the internet, but my hosting company wasn't allowing my website to connect to the database on port 3306.

Once I asked my hosting company to open my web hosting account up to outgoing traffic on port 3306, my website could connect to my remote database.

after you connect server and you want to connect on your host, you should do the steps below:

1. write mysql to open mysql
2. write GRANT ALL ON . to root@'write_your_ip_addres' IDENTIFIED BY 'write_password_to_connect';
3. press control and X to quit from mysql
4. write nano /etc/mysql/my.cnf
5. write # before bind-address = 127.0.0.1 in my.cnf folder
6. #bind-address = 127.0.0.1
7. save my.cnf folder with control + X
8. write service mysql restart
9. you could connect via navicat on your host

Above answers were helpful, but for unknown reasons they did not seem to work. So if you have already installed MySql workbench on your system, instead of downloading the jar files and struggling with the correct version just go to

C:\Program Files (x86)\MySQL\Connector J 8.0

and copy mysql-connector-java-8.0.12 (does not matter what version it is) the jar file in that location and paste it to C:\Program Files\pentaho\design-tools\data-integration\lib

Go to command prompt and enter the command,

net user <username>

Will show your local group memberships.

If you're on a domain, use localgroup instead:

net localgroup Administrators or net localgroup [Admin group name]

Check the list of local groups with localgroup on its own.

net localgroup

I am using Windows 8 and the above solutions did not work out for me. I downgraded Postgres from 9.4 to 9.3. Man,it worked :)

Login using the system maintenance user and password created when you installed phpMyAdmin.
It can be found in the debian.cnf file at /etc/mysql then you will have total access.

cd /etc/mysql
sudo nano debian.cnf
Just look - don't change anything!
[mysql_upgrade]
host     = localhost
user     = debian-sys-maint       <----use this user
password = s0meRaND0mChar$s       <----use this password
socket   = /var/run/mysqld/mysqld.sock

Worked for me.

These steps worked for me.

• Delete the content of local Maven repository.
• run mvn clean install in the command line. (cd to the pom directory).
• Build Project in Eclipse.

I found a simple solution, Simply add your jars inside WEB-INF-->lib folder..

The pg_hba.conf (C:\Program Files\PostgreSQL\9.3\data) file has changed since these answers were given. What worked for me, in Windows, is to open the file and change the METHOD from md5 to trust:

# TYPE  DATABASE        USER            ADDRESS                 METHOD

# IPv4 local connections:
host    all             all             127.0.0.1/32            trust
# IPv6 local connections:
host    all             all             ::1/128                 trust

Then, using pgAdmin III, I logged in using no password and changed user postgres' password by going to File -> Change Password

In my environment, I just added the two files to class path. And is work fine.

slf4j-jdk14-1.7.25.jar
slf4j-api-1.7.25.jar

I was able to work around it by running mvn install:install-file with -Dpackaging=class. Then adding entry to POM as described here:

My answer is similar to this one on ServerFault.com.

To Be Conservative

If you want to be more conservative than granting "all privileges", you might want to try something more like these.

GRANT SELECT, INSERT, UPDATE, DELETE ON ALL TABLES IN SCHEMA public TO some_user_;
GRANT EXECUTE ON ALL FUNCTIONS IN SCHEMA public TO some_user_;

The use of public there refers to the name of the default schema created for every new database/catalog. Replace with your own name if you created a schema.

Access to the Schema

To access a schema at all, for any action, the user must be granted "usage" rights. Before a user can select, insert, update, or delete, a user must first be granted "usage" to a schema.

You will not notice this requirement when first using Postgres. By default every database has a first schema named public. And every user by default has been automatically been granted "usage" rights to that particular schema. When adding additional schema, then you must explicitly grant usage rights.

GRANT USAGE ON SCHEMA some_schema_ TO some_user_ ;

Excerpt from the Postgres doc:

For schemas, allows access to objects contained in the specified schema (assuming that the objects' own privilege requirements are also met). Essentially this allows the grantee to "look up" objects within the schema. Without this permission, it is still possible to see the object names, e.g. by querying the system tables. Also, after revoking this permission, existing backends might have statements that have previously performed this lookup, so this is not a completely secure way to prevent object access.

For more discussion see the Question, What GRANT USAGE ON SCHEMA exactly do?. Pay special attention to the Answer by Postgres expert Craig Ringer.

Existing Objects Versus Future

These commands only affect existing objects. Tables and such you create in the future get default privileges until you re-execute those lines above. See the other answer by Erwin Brandstetter to change the defaults thereby affecting future objects.

MySQL account names consist of a user name and a host name, The name 'localhost' in host name indicates the local host also You can use the wildcard characters “%” and “_” in host name or IP address values. These have the same meaning as for pattern-matching operations performed with the LIKE operator. For example, a host value of '%' matches any host name, whereas a value of '%.mysql.com' matches any host in the mysql.com domain. '192.168.1.%' matches any host in the 192.168.1 class C network.

Above was just introduction:

actually both users 'bill'@'localhost' and 'bill'@'%' are different MySQL accounts, hence both should use their own authentication details like password.

For more information refer http://dev.mysql.com/doc/refman//5.5/en/account-names.html

None of these answers worked for me.

I had to remove all deployed java web app:

• Windows/Show View/Other...
• Go the the Server folder and select "Servers"
• Right-click on the J2EE Preview at localhost
• Click to Add and Remove... Click Remove all

Then run the project on the server

The Error is gone!

You will have to stop the server before deploying another project because it will not be found by the server. Otherwise you will get a 404 error

Also you need to disable below line in configuration file: bind-address = 127.0.0.1

On properties,

Check whether radio button is selected for

Run only when user is logged on 

If you selected for the above option then that is the reason why it is failed.

so change the option to

Run whether user is logged on or not

OR

In other case, user might have changed his/her login credentials

Solved. I just logout and login with xorg!

You need only to write:

GRANT DBA TO NewDBA;

Because this already makes the user a DB Administrator

Here's a script that claims to be able to fix this.

Get admin rights to your local SQL Server Express with this simple script

Download link to the script

Description

This command script allows you to easily add yourself to the sysadmin role of a local SQL Server instance. You must be a member of the Windows local Administrators group, or have access to the credentials of a user who is. The script supports SQL Server 2005 and later.

The script is most useful if you are a developer trying to use SQL Server 2008 Express that was installed by someone else. In this situation you usually won't have admin rights to the SQL Server 2008 Express instance, since by default only the person installing SQL Server 2008 is granted administrative privileges.

The user who installed SQL Server 2008 Express can use SQL Server Management Studio to grant the necessary privileges to you. But what if SQL Server Management Studio was not installed? Or worse if the installing user is not available anymore?

This script fixes the problem in just a few clicks!

Note: You will need to provide the BAT file with an 'Instance Name' (Probably going to be 'MSSQLSERVER' - but it might not be): you can get the value by first running the following in the "Microsoft SQL Server Management Console":

 SELECT @@servicename

Then copy the result to use when the BAT file prompts for 'SQL instance name'.

  @echo off 
    rem 
    rem **************************************************************************** 
    rem 
    rem    Copyright (c) Microsoft Corporation. All rights reserved. 
    rem    This code is licensed under the Microsoft Public License. 
    rem    THIS CODE IS PROVIDED *AS IS* WITHOUT WARRANTY OF 
    rem    ANY KIND, EITHER EXPRESS OR IMPLIED, INCLUDING ANY 
    rem    IMPLIED WARRANTIES OF FITNESS FOR A PARTICULAR 
    rem    PURPOSE, MERCHANTABILITY, OR NON-INFRINGEMENT. 
    rem 
    rem **************************************************************************** 
    rem 
    rem CMD script to add a user to the SQL Server sysadmin role 
    rem 
    rem Input:  %1 specifies the instance name to be modified. Defaults to SQLEXPRESS. 
    rem         %2 specifies the principal identity to be added (in the form "<domain>\<user>"). 
    rem            If omitted, the script will request elevation and add the current user (pre-elevation) to the sysadmin role. 
    rem            If provided explicitly, the script is assumed to be running elevated already. 
    rem 
    rem Method: 1) restart the SQL service with the '-m' option, which allows a single connection from a box admin 
    rem            (the box admin is temporarily added to the sysadmin role with this start option) 
    rem         2) connect to the SQL instance and add the user to the sysadmin role 
    rem         3) restart the SQL service for normal connections 
    rem 
    rem Output: Messages indicating success/failure. 
    rem         Note that if elevation is done by this script, a new command process window is created: the output of this 
    rem         window is not directly accessible to the caller. 
    rem 
    rem 
    setlocal 
    set sqlresult=N/A 
    if .%1 == . (set /P sqlinstance=Enter SQL instance name, or default to SQLEXPRESS: ) else (set sqlinstance=%1) 
    if .%sqlinstance% == . (set sqlinstance=SQLEXPRESS) 
    if /I %sqlinstance% == MSSQLSERVER (set sqlservice=MSSQLSERVER) else (set sqlservice=MSSQL$%sqlinstance%) 
    if .%2 == . (set sqllogin="%USERDOMAIN%\%USERNAME%") else (set sqllogin=%2) 
    rem remove enclosing quotes 
    for %%i in (%sqllogin%) do set sqllogin=%%~i 
    @echo Adding '%sqllogin%' to the 'sysadmin' role on SQL Server instance '%sqlinstance%'. 
    @echo Verify the '%sqlservice%' service exists ... 
    set srvstate=0 
    for /F "usebackq tokens=1,3" %%i in (`sc query %sqlservice%`) do if .%%i == .STATE set srvstate=%%j 
    if .%srvstate% == .0 goto existerror 
    rem 
    rem elevate if <domain/user> was defaulted 
    rem 
    if NOT .%2 == . goto continue 
    echo new ActiveXObject("Shell.Application").ShellExecute("cmd.exe", "/D /Q /C pushd \""+WScript.Arguments(0)+"\" & \""+WScript.Arguments(1)+"\" %sqlinstance% \""+WScript.Arguments(2)+"\"", "", "runas"); >"%TEMP%\addsysadmin{7FC2CAE2-2E9E-47a0-ADE5-C43582022EA8}.js" 
    call "%TEMP%\addsysadmin{7FC2CAE2-2E9E-47a0-ADE5-C43582022EA8}.js" "%cd%" %0 "%sqllogin%" 
    del "%TEMP%\addsysadmin{7FC2CAE2-2E9E-47a0-ADE5-C43582022EA8}.js" 
    goto :EOF 
    :continue 
    rem 
    rem determine if the SQL service is running 
    rem 
    set srvstarted=0 
    set srvstate=0 
    for /F "usebackq tokens=1,3" %%i in (`sc query %sqlservice%`) do if .%%i == .STATE set srvstate=%%j 
    if .%srvstate% == .0 goto queryerror 
    rem 
    rem if required, stop the SQL service 
    rem 
    if .%srvstate% == .1 goto startm 
    set srvstarted=1 
    @echo Stop the '%sqlservice%' service ... 
    net stop %sqlservice% 
    if errorlevel 1 goto stoperror 
    :startm 
    rem 
    rem start the SQL service with the '-m' option (single admin connection) and wait until its STATE is '4' (STARTED) 
    rem also use trace flags as follows: 
    rem     3659 - log all errors to errorlog 
    rem     4010 - enable shared memory only (lpc:) 
    rem     4022 - do not start autoprocs 
    rem 
    @echo Start the '%sqlservice%' service in maintenance mode ... 
    sc start %sqlservice% -m -T3659 -T4010 -T4022 >nul 
    if errorlevel 1 goto startmerror 
    :checkstate1 
    set srvstate=0 
    for /F "usebackq tokens=1,3" %%i in (`sc query %sqlservice%`) do if .%%i == .STATE set srvstate=%%j 
    if .%srvstate% == .0 goto queryerror 
    if .%srvstate% == .1 goto startmerror 
    if NOT .%srvstate% == .4 goto checkstate1 
    rem 
    rem add the specified user to the sysadmin role 
    rem access tempdb to avoid a misleading shutdown error 
    rem 
    @echo Add '%sqllogin%' to the 'sysadmin' role ... 
    for /F "usebackq tokens=1,3" %%i in (`sqlcmd -S np:\\.\pipe\SQLLocal\%sqlinstance% -E -Q "create table #foo (bar int); declare @rc int; execute @rc = sp_addsrvrolemember '$(sqllogin)', 'sysadmin'; print 'RETURN_CODE : '+CAST(@rc as char)"`) do if .%%i == .RETURN_CODE set sqlresult=%%j 
    rem 
    rem stop the SQL service 
    rem 
    @echo Stop the '%sqlservice%' service ... 
    net stop %sqlservice% 
    if errorlevel 1 goto stoperror 
    if .%srvstarted% == .0 goto exit 
    rem 
    rem start the SQL service for normal connections 
    rem 
    net start %sqlservice% 
    if errorlevel 1 goto starterror 
    goto exit 
    rem 
    rem handle unexpected errors 
    rem 
    :existerror 
    sc query %sqlservice% 
    @echo '%sqlservice%' service is invalid 
    goto exit 
    :queryerror 
    @echo 'sc query %sqlservice%' failed 
    goto exit 
    :stoperror 
    @echo 'net stop %sqlservice%' failed 
    goto exit 
    :startmerror 
    @echo 'sc start %sqlservice% -m' failed 
    goto exit 
    :starterror 
    @echo 'net start %sqlservice%' failed 
    goto exit 
    :exit 
    if .%sqlresult% == .0 (@echo '%sqllogin%' was successfully added to the 'sysadmin' role.) else (@echo '%sqllogin%' was NOT added to the 'sysadmin' role: SQL return code is %sqlresult%.) 
    endlocal 
    pause

More simpler single query oracle version.

WITH data 
     AS (SELECT granted_role 
         FROM   dba_role_privs 
         CONNECT BY PRIOR granted_role = grantee 
         START WITH grantee = '&USER') 
SELECT 'SYSTEM'     typ, 
       grantee      grantee, 
       privilege    priv, 
       admin_option ad, 
       '--'         tabnm, 
       '--'         colnm, 
       '--'         owner 
FROM   dba_sys_privs 
WHERE  grantee = '&USER' 
        OR grantee IN (SELECT granted_role 
                       FROM   data) 
UNION 
SELECT 'TABLE'    typ, 
       grantee    grantee, 
       privilege  priv, 
       grantable  ad, 
       table_name tabnm, 
       '--'       colnm, 
       owner      owner 
FROM   dba_tab_privs 
WHERE  grantee = '&USER' 
        OR grantee IN (SELECT granted_role 
                       FROM   data) 
ORDER  BY 1; 

What could be the possible cause of this exception?

You may not have appropriate Jar in your class path.

How it could be removed?

By putting HTTPClient jar in your class path. If it's a webapp, copy Jar into WEB-INF/lib if it's standalone, make sure you have this jar in class path or explicitly set using -cp option

as the doc says,

Thrown if the Java Virtual Machine or a ClassLoader instance tries to load in the definition of a class (as part of a normal method call or as part of creating a new instance using the new expression) and no definition of the class could be found.

The searched-for class definition existed when the currently executing class was compiled, but the definition can no longer be found.

Edit:
If you are using a dependency management like Maven/Gradle (see the answer below) or SBT please use it to bring the httpclient jar for you.

Giving us the whole error message would be much more useful. If it's for make install then you're probably trying to install something to a system directory and you're not root. If you have root access then you can run

sudo make install

or log in as root and do the whole process as root.

On CentOS EL 6 and perhaps on earlier versions there is one way to get into this same mess.

Install CentOS EL6 with a minimal installation. For example I used kickstart to install the following:

%packages
@core
acpid
bison
cmake
dhcp-common
flex
gcc
gcc-c++
git
libaio-devel
make
man
ncurses-devel
perl
ntp
ntpdate
pciutils
tar
tcpdump
wget
%end

You will find that one of the dependencies of the above list is mysql-libs. I found that my system has a default my.cnf in /etc and this contains:

[mysqld]
dataddir=/var/lib/mysql
socket=/var/lib/mysql/mysql.sock
user=mysql
# Disabling symbolic-links is recommended to prevent assorted security risks
symbolic-links=0

[mysqld_safe]
log-error=/var/log/mysqld.log
pid-file=/var/run/mysqld/mysqld.pid

When you build from the Generic Linux (Architecture Independent), Compressed TAR Archive your default data directory is /usr/local/mysql/data which conflicts with the /etc/my.cnf already present which defines datadir=/var/lib/mysql. Also the pid-file defined in the same file does not have permissions for the mysql user/group to write to it in /var/run/mysqld.

A quick remedy is to mv /etc/my.cnf /etc/my.cnf.old which should get your generic source procedure working.

Of course the experience is different of you use the source RPMs.

When you log on Windows creates an access token. This identifies you, the groups you are a member of and your privileges. And note that whether a user is an administrator or not is determined by whether the user is a member of the Administrators group.

Without UAC, when you run a program it gets a copy of the access token, and this controls what the program can access.

With UAC, when you run a program it gets a restricted access token. This is the original access token with "Administrators" removed from the list of groups (and some other changes). Even though your user is a member of the Administrators group, the program can't use Administrator privileges.

When you select "Run as Administrator" and your user is an administrator the program is launched with the original unrestricted access token. If your user is not an administrator you are prompted for an administrator account, and the program is run under that account.

I solved deleting *.snap from the workspace dir (and all subdirectories):

metadata\.plugins\*.snap

Please do check Hibernate Property Name and Id Name also.

Most Developers log-in to server(I assume you r having user-name and password for mysql database) then from Bash they switch to mysql> prompt then use the command below(which doesn’t work

mysql -h localhost -u root -p

What needs to be done is use the above command in the bash prompt--> on doing so it will ask for password if given it will take directly to mysql prompt and

then database, table can be created one by one

I faced similar deadlock so sharing the experience

There are two ways to achieve that:

• Use -rpath linker option:

gcc XXX.c -o xxx.out -L$HOME/.usr/lib -lXX -Wl,-rpath=/home/user/.usr/lib

• Use LD_LIBRARY_PATH environment variable - put this line in your ~/.bashrc file:

  export LD_LIBRARY_PATH=/home/user/.usr/lib

This will work even for a pre-generated binaries, so you can for example download some packages from the debian.org, unpack the binaries and shared libraries into your home directory, and launch them without recompiling.

For a quick test, you can also do (in bash at least):

LD_LIBRARY_PATH=/home/user/.usr/lib ./xxx.out

which has the advantage of not changing your library path for everything else.

You use the available API of JTable and do not try to mess with the colors.

Some selection methods are available directly on the JTable (like the setRowSelectionInterval). If you want to have access to all selection-related logic, the selection model is the place to start looking

1) You can set root password by invoking MySQL console. It is located in

C:\wamp\bin\mysql\mysql5.1.53\bin by default.

Get to the directory and type MySQL. then set the password as follows..

    > SET PASSWORD FOR root@localhost = PASSWORD('new-password');

2) You can configure wamp's phpmyadmin application for root user by editing

C:\wamp\apps\phpmyadmin3.3.9\config.inc.php 

Note :- if you are using xampp then , file will be located at

C:\xampp\phpMyadmin\config.inc.php

It looks like this:

        $cfg['Servers'][$i]['verbose'] = 'localhost';
        $cfg['Servers'][$i]['host'] = 'localhost';
        $cfg['Servers'][$i]['port'] = '';
        $cfg['Servers'][$i]['socket'] = '';
        $cfg['Servers'][$i]['connect_type'] = 'tcp';
        $cfg['Servers'][$i]['extension'] = 'mysqli';
        $cfg['Servers'][$i]['auth_type'] = 'config';
        $cfg['Servers'][$i]['user'] = 'root';
        $cfg['Servers'][$i]['password'] = 'YOURPASSWORD';
        $cfg['Servers'][$i]['AllowNoPassword'] = false;

The error "Access denied for user 'root@localhost' (using password:NO)" will be resolved when you set $cfg['Servers'][$i]['AllowNoPassword'] to false

If you priviously changed the password for 'root@localhost', then you have to do 2 things to solve the error "Access denided for user 'root@localhost'":

1. if ['password'] have a empty quotes like ' ' then put your password between quotes.
2. change the (using password:NO) to (using password:YES)

This will resolve the error.

Note: phpmyadmin is a separate tool which comes with wamp. It just provide a interface to MySQL. if you change my sql root's password, then you should change the phpmyadmin configurations. Usually phpmyadmin is configured to root user.

I had the same problem and it took a lot of reading SO posts and Google's documentation. I finally found this from the Cloud SQL FAQ:

Google Cloud SQL does not support SUPER privileges, which means that GRANT ALL PRIVILEGES statements will not work. As an alternative, you can use GRANT ALL ON `%`.*

Did you sort this? I just found this code here:

http://www.pythian.com/news/29665/httpconsultingblogs-emc-comjamiethomsonarchive20070209sql-server-2005_3a00_-view-all-permissions-_2800_2_2900_-aspx/

I think I'll need to do a bit of tweaking, but essentially this has sorted it for me!

I hope it does for you too!

J

Enable Remote Access (Grant) Home / Tutorials / Mysql / Enable Remote Access (Grant) If you try to connect to your mysql server from remote machine, and run into error like below, this article is for you.

ERROR 1130 (HY000): Host ‘1.2.3.4’ is not allowed to connect to this MySQL server

Change mysql config

Start with editing mysql config file

vim /etc/mysql/my.cnf

Comment out following lines.

#bind-address           = 127.0.0.1
#skip-networking

If you do not find skip-networking line, add it and comment out it.

Restart mysql server.

~ /etc/init.d/mysql restart

Change GRANT privilege

You may be surprised to see even after above change you are not getting remote access or getting access but not able to all databases.

By default, mysql username and password you are using is allowed to access mysql-server locally. So need to update privilege.

Run a command like below to access from all machines. (Replace USERNAME and PASSWORD by your credentials.)

mysql> GRANT ALL PRIVILEGES ON *.* TO 'USERNAME'@'%' IDENTIFIED BY 'PASSWORD' WITH GRANT OPTION;

Run a command like below to give access from specific IP. (Replace USERNAME and PASSWORD by your credentials.)

mysql> GRANT ALL PRIVILEGES ON *.* TO 'USERNAME'@'1.2.3.4' IDENTIFIED BY 'PASSWORD' WITH GRANT OPTION;

You can replace 1.2.3.4 with your IP. You can run above command many times to GRANT access from multiple IPs.

You can also specify a separate USERNAME & PASSWORD for remote access.

You can check final outcome by:

SELECT * from information_schema.user_privileges where grantee like "'USERNAME'%";

Finally, you may also need to run:

mysql> FLUSH PRIVILEGES;

Test Connection

From terminal/command-line:

mysql -h HOST -u USERNAME -pPASSWORD

If you get a mysql shell, don’t forget to run show databases; to check if you have right privileges from remote machines.

Bonus-Tip: Revoke Access

If you accidentally grant access to a user, then better have revoking option handy.

Following will revoke all options for USERNAME from all machines:

mysql> REVOKE ALL PRIVILEGES, GRANT OPTION FROM 'USERNAME'@'%';
Following will revoke all options for USERNAME from particular IP:

mysql> REVOKE ALL PRIVILEGES, GRANT OPTION FROM 'USERNAME'@'1.2.3.4';
Its better to check information_schema.user_privileges table after running REVOKE command.

If you see USAGE privilege after running REVOKE command, its fine. It is as good as no privilege at all. I am not sure if it can be revoked.

I read many (most?) of the responses, then developed a bat file that works for me in Win 8.1. Thought I'd share it.

setlocal
set runState=user
whoami /groups | findstr /b /c:"Mandatory Label\High Mandatory Level" > nul && set runState=admin
whoami /groups | findstr /b /c:"Mandatory Label\System Mandatory Level" > nul && set runState=system
echo Running in state: "%runState%"
if not "%runState%"=="user" goto notUser
  echo Do user stuff...
  goto end
:notUser
if not "%runState%"=="admin" goto notAdmin
  echo Do admin stuff...
  goto end
:notAdmin
if not "%runState%"=="system" goto notSystem
  echo Do admin stuff...
  goto end
:notSystem
echo Do common stuff...
:end

Hope someone finds this useful :)

For development purposes, one of the simplest ways is to install Postgres.app from the official site. It can be started/stopped from Applications folder or using the following commands in terminal:

# Start
open -a Postgres

# Stop
killall Postgres
killall postgres

This happened to me because I was using a Tomcat 5.5 catalina.sh file with a Tomcat 7 installation. Using the catalina.sh that came with the Tomcat 7 install fixed the problem.

First thing to do is run this:

SHOW GRANTS;

You will quickly see you were assigned the anonymous user to authenticate into mysql.

Instead of logging into mysql with

mysql

login like this:

mysql -uroot

By default, root@localhost has all rights and no password.

If you cannot login as root without a password, do the following:

Step 01) Add the two options in the mysqld section of my.ini:

[mysqld]
skip-grant-tables
skip-networking

Step 02) Restart mysql

net stop mysql
<wait 10 seconds>
net start mysql

Step 03) Connect to mysql

mysql

Step 04) Create a password from root@localhost

UPDATE mysql.user SET password=password('whateverpasswordyoulike')
WHERE user='root' AND host='localhost';
exit

Step 05) Restart mysql

net stop mysql
<wait 10 seconds>
net start mysql

Step 06) Login as root with password

mysql -u root -p

You should be good from there.

CAVEAT: Please remove anonymous users !!!

This works on firefox 3.6.x and IE:

    function copyToClipboardCrossbrowser(s) {           
        s = document.getElementById(s).value;               

        if( window.clipboardData && clipboardData.setData )
        {
            clipboardData.setData("Text", s);
        }           
        else
        {
            // You have to sign the code to enable this or allow the action in about:config by changing
            //user_pref("signed.applets.codebase_principal_support", true);
            netscape.security.PrivilegeManager.enablePrivilege('UniversalXPConnect');

            var clip = Components.classes["@mozilla.org/widget/clipboard;1"].createInstance(Components.interfaces.nsIClipboard);
            if (!clip) return;

            // create a transferable

            var trans = Components.classes["@mozilla.org/widget/transferable;1"].createInstance(Components.interfaces.nsITransferable);
            if (!trans) return;

            // specify the data we wish to handle. Plaintext in this case.
            trans.addDataFlavor('text/unicode');

            // To get the data from the transferable we need two new objects
            var str = new Object();
            var len = new Object();

            var str = Components.classes["@mozilla.org/supports-string;1"].createInstance(Components.interfaces.nsISupportsString);

            str.data= s;        

            trans.setTransferData("text/unicode",str, str.data.length * 2);

            var clipid=Components.interfaces.nsIClipboard;              
            if (!clip) return false;
            clip.setData(trans,null,clipid.kGlobalClipboard);      
        }
    }

For anyone having trouble after upgrading to 14.04 https://askubuntu.com/questions/452042/why-is-my-apache-not-working-after-upgrading-to-ubuntu-14-04 as root changed before upgrade = /var/www after upgrade = /var/www/html

What's the first part of your Subversion repository URL?

• If your URL looks like: http://subversion/repos/, then you're probably going over Port 80.
• If your URL looks like: https://subversion/repos/, then you're probably going over Port 443.
• If your URL looks like: svn://subversion/, then you're probably going over Port 3690.
• If your URL looks like: svn+ssh://subversion/repos/, then you're probably going over Port 22.
• If your URL contains a port number like: http://subversion/repos:8080, then you're using that port.

I can't guarantee the first four since it's possible to reconfigure everything to use different ports, of if you go through a proxy of some sort.

If you're using a VPN, you may have to configure your VPN client to reroute these to their correct ports. A lot of places don't configure their correctly VPNs to do this type of proxying. It's either because they have some sort of anal-retentive IT person who's being overly security conscious, or because they simply don't know any better. Even worse, they'll give you a client where this stuff can't be reconfigured.

The only way around that is to log into a local machine over the VPN, and then do everything from that system.

I had this problem, after installing jdk7 next to Java 6. The binaries were correctly updated using update-alternatives --config java to jdk7, but the $JAVA_HOME environment variable still pointed to the old directory of Java 6.

I also had that problem and i did what hairul said:

1. Go to localhost/security/
2. Click the orange link localhost/security/xamppsecurity.php
3. Change the password for superuser: 'root'"

then i restarted mysql on the xampp control panel and didn t work.

It only worked when i restarted my computer!!!!

If you need to 'see' the list of temporary tables, you could simply log the names used. (and as others have noted, it is possible to directly query this information)

If you need to 'see' the content of temporary tables, you will need to create real tables with a (unique) temporary name.

You can trace the SQL being executed using SQL Profiler:

• Using SQL Server Profiler

• How to Identify Slow Running Queries with SQL Profiler

[These articles target SQL Server versions later than 2000, but much of the advice is the same.]

If you have a lengthy process that is important to your business, it's a good idea to log various steps (step name/number, start and end time) in the process. That way you have a baseline to compare against when things don't perform well, and you can pinpoint which step(s) are causing the problem more quickly.

As jcoder and Matt mentioned, PowerShell made it easy, and it could even be embedded in the batch script without creating a new script.

I modified Matt's script:

:: Check privileges 
net file 1>NUL 2>NUL
if not '%errorlevel%' == '0' (
    powershell Start-Process -FilePath "%0" -ArgumentList "%cd%" -verb runas >NUL 2>&1
    exit /b
)

:: Change directory with passed argument. Processes started with
:: "runas" start with forced C:\Windows\System32 workdir
cd /d %1

:: Actual work

you need to add jar file in your build path..

commons-dbcp-1.1-RC2.jar

or any version of that..!!!!

ADDED : also make sure you have commons-pool-1.1.jar too in your build path.

ADDED: sorry saw complete list of jar late... may be version clashes might be there.. better check out..!!! just an assumption.

first Download the ssl certificate then you can go to your java bin path execute the below command in the console.

C:\java\JDK1.8.0_66-X64\bin>keytool -printcert -file C:\Users\lova\openapi.cer -keystore openapistore

Two steps:

1. set up user with wildcard:
   create user 'root'@'%' identified by 'some_characters'; GRANT ALL PRIVILEGES ON *.* TO 'root'@'%' IDENTIFIED BY PASSWORD 'some_characters' WITH GRANT OPTION

2. vim /etc/my.cnf
   add the following:
   bind-address=0.0.0.0

restart server, you should not have any problem connecting to it.

If you are using IntelliJ IDEA, and deploy application on Tomcat Server, it says: Under File menu -> select project Structure -> click artifact -> select your jars and right click -> put in WEB\lib -> restart server

The simplest way to create a manifest is:

Project Properties -> Security -> Click "enable ClickOnce security settings" 
(it will generate default manifest in your project Properties) -> then Click 
it again in order to uncheck that Checkbox -> open your app.maifest and edit 
it as you wish.

Assume file is already created in the predefined directory with name "table.txt"

• 1) change the ownership for file :

  sudo chown username:username table.txt
  

• 2) change the mode of the file

  sudo chmod 777 table.txt
  

Now, try it should work!

Press the start button. In the search box type "cmd", then press Ctrl+Shift+Enter

Instead of

Player[PlayerCount] thePlayers;

you want

Player[] thePlayers = new Player[PlayerCount];

and

for(int i = 0; i < PlayerCount ; i++)
{
    thePlayers[i] = new Player(i);
}
return thePlayers;

should return the array initialized with Player instances.

EDIT:

Do check out this table on wikipedia on naming conventions for java that is widely used.

Cover the offending elements with an invisible block, using a pseudo element: :before or :after

a:before {
//IE No click hack by covering the element.
  display:block;
  position:absolute;
  height:100%;
  width:100%;
  content:' ';
}

Thus you're click lands on the parent element. No good, if the parent is clickable, but works well otherwise.

To run Java class file from the command line, the syntax is:

java -classpath /path/to/jars <packageName>.<MainClassName>

where packageName (usually starts with either com or org) is the folder name where your class file is present.

For example if your main class name is App and Java package name of your app is com.foo.app, then your class file needs to be in com/foo/app folder (separate folder for each dot), so you run your app as:

$ java com.foo.app.App

^{Note: $ is indicating shell prompt, ignore it when typing}

If your class doesn't have any package name defined, simply run as: java App.

If you've any other jar dependencies, make sure you specified your classpath parameter either with -cp/-classpath or using CLASSPATH variable which points to the folder with your jar/war/ear/zip/class files. So on Linux you can prefix the command with: CLASSPATH=/path/to/jars, on Windows you need to add the folder into system variable. If not set, the user class path consists of the current directory (.).

Practical example

Given we've created sample project using Maven as:

$ mvn archetype:generate -DgroupId=com.foo.app -DartifactId=my-app -DarchetypeArtifactId=maven-archetype-quickstart -DinteractiveMode=false 

and we've compiled our project by mvn compile in our my-app/ dir, it'll generate our class file is in target/classes/com/foo/app/App.class.

To run it, we can either specify class path via -cp or going to it directly, check examples below:

$ find . -name "*.class"
./target/classes/com/foo/app/App.class
$ CLASSPATH=target/classes/ java com.foo.app.App
Hello World!
$ java -cp target/classes com.foo.app.App
Hello World!
$ java -classpath .:/path/to/other-jars:target/classes com.foo.app.App
Hello World!
$ cd target/classes && java com.foo.app.App
Hello World!

To double check your class and package name, you can use Java class file disassembler tool, e.g.:

$ javap target/classes/com/foo/app/App.class
Compiled from "App.java"
public class com.foo.app.App {
  public com.foo.app.App();
  public static void main(java.lang.String[]);
}

^{Note: javap won't work if the compiled file has been obfuscated.}

I had this problem and it was kind of tricky to realise what was wrong. The project had a dependency project with some error, which stopped the build from execute. When I remove this dependency problem, the project was built as expected.

Ps.: I am working on a project that has many compilation errors, because we are porting an application that was converted from Delphi to Java, so I didn't care to the compilation error at the beginning, that's why it took me some time to find out the problem.

Just in case someone is looking for user Display Name as opposed to User Name, like me.

Here's the treat :

System.DirectoryServices.AccountManagement.UserPrincipal.Current.DisplayName.

Add Reference to System.DirectoryServices.AccountManagement in your project.

For JBoss, in standalone.xml, put after .

<extensions>
</extensions>

<system-properties>
    <property name="my.project.dir" value="/home/francesco" />
</system-properties>

For eclipse:

http://www.avajava.com/tutorials/lessons/how-do-i-set-system-properties.html?page=2

Hello I used this code to have the super user in mysql

GRANT EXECUTE, PROCESS, SELECT, SHOW DATABASES, SHOW VIEW, ALTER, ALTER ROUTINE,
    CREATE, CREATE ROUTINE, CREATE TEMPORARY TABLES, CREATE VIEW, DELETE, DROP,
    EVENT, INDEX, INSERT, REFERENCES, TRIGGER, UPDATE, CREATE USER, FILE,
    LOCK TABLES, RELOAD, REPLICATION CLIENT, REPLICATION SLAVE, SHUTDOWN,
    SUPER
        ON *.* TO mysql@'%'
    WITH GRANT OPTION;

and then

FLUSH PRIVILEGES;

Had the same issue trying to debug a DNN (Dot Net Nuke) module. Turned out you need to have compilation debug="true":

<compilation debug="true" strict="false" targetFramework="4.0"> 

in your web.config. By default it is false in DNN. Original source here: http://www.dnnsoftware.com/forums/forumid/111/postid/189880/scope/posts

I was following this video: https://www.youtube.com/watch?v=WHPPQGOyy_Y but failed to run the test. After that, I deleted all the downloaded files and add the Junit using the step in the picture.

This is normally a file access permissions issue but I see your already addressing that in point b, but it's worth going over just in case. Another option is to use LOAD DATA LOCAL INFILE which gets past a lot of these issues of file access permissions. To use this method though you need to copy the file locally (in the mysql folder is best) first. •If LOCAL is specified, the file is read by the client program on the client host and sent to the server.

Insufficient Directory Permissions

The error in this example has resulted because the file you are trying to import is not in a directory which is readable by the user the MySql server is running as. Note that all the parent directories of the directory the is in need to be readable by the MySql user for this to work. Saving the file to /tmp will usually work as this is usually readable (and writable) by all users. The error code number is 13. Source

EDIT:

Remember you will need permissions on not just the folder the holds the file but also the upper directories.

Example from this post on the MySql Forums.

If your file was contained within the following strucutre: /tmp/imports/site1/data.file

you would need (I think, 755 worked) r+x for 'other' on these directories:

/tmp

/tmp/imports

As well as the main two:

/tmp/imports/site1

/tmp/imports/site1/data.file

You need the file and directory to be world-readable. Apologies if you've already tried this method but it may be worth retracing your steps, never hurts to double check.

...an old one... anyway I had the same issue with MariaDB

In my case most pathes contain special characters like: # Wrapping pathes in my.ini in double quotes made the trick - e.g.

datadir="C:/#windata64/db/MariaDB/data"

How about:

import java.io.File;

import javax.xml.parsers.DocumentBuilder;
import javax.xml.parsers.DocumentBuilderFactory;

import org.w3c.dom.Document;
import org.w3c.dom.NodeList;

public class Demo {

    public static void main(String[] args) throws Exception {
        DocumentBuilderFactory dbf = DocumentBuilderFactory.newInstance();
        DocumentBuilder db = dbf.newDocumentBuilder();
        Document document = db.parse(new File("input.xml"));
        NodeList nodeList = document.getElementsByTagName("Item");
        for(int x=0,size= nodeList.getLength(); x<size; x++) {
            System.out.println(nodeList.item(x).getAttributes().getNamedItem("name").getNodeValue());
        }
    }
}

You need to do this:

    exec procName 
    @parameter_1_Name = 'parameter_1_Value', 
    @parameter_2_name = 'parameter_2_value',
    @parameter_z_name = 'parameter_z_value'

If you really want them to have ALL rights:

use YourDatabase
go
exec sp_addrolemember 'db_owner', 'UserName'
go

If you want to change your 'sa' password with SQL Server Management Studio, here are the steps:

1. Login using Windows Authentication and ".\SQLExpress" as Server Name

2. Change server authentication mode - Right click on root, choose Properties, from Security tab select "SQL Server and Windows Authentication mode", click OK

3. Set sa password - Navigate to Security > Logins > sa, right click on it, choose Properties, from General tab set the Password (don't close the window)

4. Grant permission - Go to Status tab, make sure the Grant and Enabled radiobuttons are chosen, click OK

5. Restart SQLEXPRESS service from your local services (Window+R > services.msc)

From your ant buildfile, I assume that what you want is to create a single JAR archive that will contain not only your application classes, but also the contents of other JARs required by your application.

However your build-jar file is just putting required JARs inside your own JAR; this will not work as explained here (see note).

Try to modify this:

<jar destfile="${jar.file}" 
    basedir="${build.dir}" 
    manifest="${manifest.file}">
    <fileset dir="${classes.dir}" includes="**/*.class" />
    <fileset dir="${lib.dir}" includes="**/*.jar" />
</jar>

to this:

<jar destfile="${jar.file}" 
    basedir="${build.dir}" 
    manifest="${manifest.file}">
    <fileset dir="${classes.dir}" includes="**/*.class" />
    <zipgroupfileset dir="${lib.dir}" includes="**/*.jar" />
</jar>

More flexible and powerful solutions are the JarJar or One-Jar projects. Have a look into those if the above does not satisfy your requirements.

I had similar problem and the issue was in wrong value in htaccess as shamittomar mentioned.

Change php_value post_max_size 10MB to php_value post_max_size 10M

The UnsupportedClassVersionError means that you are probably using (installed) an older version of Java as used to create the JAR.
Go to java.sun.com page, download and install a newer JRE (Java Runtime Environment).
if you want/need to develop with Java, you will need the JDK which includes the JRE.

This can a time consuming problem. For those who want to get on with their work because they do not want to waste much time, I would like to suggest that you download the zip file and unpack the zip file and use it. The zip file is available for all major OS.

https://www.eclipse.org/downloads/packages/

Here instead of hitting the Download button, which will download the Eclipse installer, scroll to the middle area where a list of the various Eclipse IDEs with their respective features are shown. Select the Eclipse IDE of your like and click on the link on the right-hand-side to download the zip or corresponding file for your OS version.

If you still want to use your other Eclipse installations because, for example, you have plugins installed, then download the Eclipse installer and on the right-hand top corner press the icon with 3 minus. After that press Update, then after restart, install the version of Eclipse IDE, which you want (the one that you want to reactivate) in a different folder. The installation will take some time. After the installation is finished you should be able to start your old Eclipse IDE.

Given the latest RFC's on the matter (7231 and 7235) the use-case seems quite clear (italics added):

• 401 is for unauthenticated ("lacks valid authentication"); i.e. 'I don't know who you are, or I don't trust you are who you say you are.'

401 Unauthorized

The 401 (Unauthorized) status code indicates that the request has not been applied because it lacks valid authentication credentials for the target resource. The server generating a 401 response MUST send a WWW-Authenticate header field (Section 4.1) containing at least one challenge applicable to the target resource.

If the request included authentication credentials, then the 401 response indicates that authorization has been refused for those credentials. The user agent MAY repeat the request with a new or replaced Authorization header field (Section 4.2). If the 401 response contains the same challenge as the prior response, and the user agent has already attempted authentication at least once, then the user agent SHOULD present the enclosed representation to the user, since it usually contains relevant diagnostic information.

• 403 is for unauthorized ("refuses to authorize"); i.e. 'I know who you are, but you don't have permission to access this resource.'

403 Forbidden

The 403 (Forbidden) status code indicates that the server understood the request but refuses to authorize it. A server that wishes to make public why the request has been forbidden can describe that reason in the response payload (if any).

If authentication credentials were provided in the request, the server considers them insufficient to grant access. The client SHOULD NOT automatically repeat the request with the same credentials. The client MAY repeat the request with new or different credentials. However, a request might be forbidden for reasons unrelated to the credentials.

An origin server that wishes to "hide" the current existence of a forbidden target resource MAY instead respond with a status code of 404 (Not Found).

We face this error when permanent generation heap is full and some of us we use command prompt to build our maven project in windows. since we need to increase heap size, we could set our environment variable @ControlPanel/System and Security/System and there you click on Change setting and select Advanced and set Environment variable as below

• Variable-name : MAVEN_OPTS
• Variable-value : -XX:MaxPermSize=128m

I faced the same problem and now found a way to solve it. First you have to delete the database of the user that you wish to drop. Then the user can be easily deleted.

I created an user named "msf" and struggled a while to delete the user and recreate it. I followed the below steps and Got succeeded.

1) Drop the database

dropdb msf

2) drop the user

dropuser msf

Now I got the user successfully dropped.

Tell it where to look for you class: it's in ".", which is the current directory:

java -classpath . HelloWorld

No need to set JAVA_HOME or CLASSPATH in this case

The main problem is port number used by another application.So you can change the port number to unused one as shown below.

In windows you can view the used port numbers used by different apps in windows task manager.

python manage.py runserver 127.0.0.1:portnumber
Ex: python manage.py runserver 127.0.0.1:8080

Salvaging (and extending) the list from an old version of the Wikipedia page:

Documentation

• Primer
• Cheat Sheet
• Quick Reference

Implementations

Although the reference implementation of reStructuredText is written in Python, there are reStructuredText parsers in other languages too.

Python - Docutils

The main distribution of reStructuredText is the Python Docutils package. It contains several conversion tools:

• rst2html - from reStructuredText to HTML
• rst2xml - from reStructuredText to XML
• rst2latex - from reStructuredText to LaTeX
• rst2odt - from reStructuredText to ODF Text (word processor) document.
• rst2s5 - from reStructuredText to S5, a Simple Standards-based Slide Show System
• rst2man - from reStructuredText to Man page

Haskell - Pandoc

Pandoc is a Haskell library for converting from one markup format to another, and a command-line tool that uses this library. It can read Markdown and (subsets of) reStructuredText, HTML, and LaTeX, and it can write Markdown, reStructuredText, HTML, LaTeX, ConTeXt, PDF, RTF, DocBook XML, OpenDocument XML, ODT, GNU Texinfo, MediaWiki markup, groff man pages, and S5 HTML slide shows.

There is an Pandoc online tool (POT) to try this library. Unfortunately, compared to the reStructuredText online renderer (ROR),

• POT truncates input rather more shortly. The POT user must render input in chunks that could be rendered whole by the ROR.
• POT output lacks the helpful error messages displayed by the ROR (and generated by docutils)

Java - JRst

JRst is a Java reStructuredText parser. It can currently output HTML, XHTML, DocBook xdoc and PDF, BUT seems to have serious problems: neither PDF or (X)HTML generation works using the current full download, result pages in (X)HTML are empty and PDF generation fails on IO problems with XSL files (not bundled??). Note that the original JRst has been removed from the website; a fork is found on GitHub.

Scala - Laika

Laika is a new library for transforming markup languages to other output formats. Currently it supports input from Markdown and reStructuredText and produce HTML output. The library is written in Scala but should be also usable from Java.

Perl

• Text::Restructured - Perl implementation of reStructuredText parser
• Dotiac::DTL::Addon::markup - Filters to work with common markup languages - support reStructuredText
• Pod::POM::View::Restructured - View for Pod::POM that outputs reStructuredText

PHP

• Gregwar/RST - A mature PHP5.3 parser with tests
• php-restructuredtext - A simple, incomplete (but functional) implementation

C#/.NET

• reStructuredText for ANTLR - A C# based parser with tests (in progress). It also provides the language server behind reStructuredText extension for Visual Studio Code.

Nim/C

The Nim compiler features the commands rst2htmland rst2tex which transform reStructuredText files to HTML and TeX files. The standard library provides the following modules (used by the compiler) to handle reStructuredText files programmatically:

• rst - implements a reStructuredText parser
• rstast - implements an AST for the reStructuredText parser
• rstgen - implements a generator of HTML/Latex from reStructuredText

Other 3rd party converters

Most (but not all) of these tools are based on Docutils (see above) and provide conversion to or from formats that might not be supported by the main distribution.

From reStructuredText

• restview - This pip-installable python package requires docutils, which does the actual rendering. restview's major ease-of-use feature is that, when you save changes to your document(s), it automagically re-renders and re-displays them. restview
  1. starts a small web server
  2. calls docutils to render your document(s) to HTML
  3. calls your device's browser to display the output HTML.
• rst2pdf - from reStructuredText to PDF
• rst2odp - from reStructuredText to ODF Presentation
• rst2beamer - from reStructuredText to LaTeX beamer Presentation class
• Wikir - from reStructuredText to a Google (and possibly other) Wiki formats
• rst2qhc - Convert a collection of reStructuredText files into a Qt (toolkit) Help file and (optional) a Qt Help Project file

To reStructuredText

• xml2rst is an XSLT script to convert Docutils internal XML representation (back) to reStructuredText
• Pandoc (see above) can also convert from Markdown, HTML and LaTeX to reStructuredText
• db2rst is a simple and limited DocBook to reStructuredText translator
• pod2rst - convert .pod files to reStructuredText files

Extensions

Some projects use reStructuredText as a baseline to build on, or provide extra functionality extending the utility of the reStructuredText tools.

Sphinx

The Sphinx documentation generator translates a set of reStructuredText source files into various output formats, automatically producing cross-references, indices etc.

rest2web

rest2web is a simple tool that lets you build your website from a single template (or as many as you want), and keep the contents in reStructuredText.

Pygments

Pygments is a generic syntax highlighter for general use in all kinds of software such as forum systems, Wikis or other applications that need to prettify source code. See Using Pygments in reStructuredText documents.

Free Editors

While any plain text editor is suitable to write reStructuredText documents, some editors have better support than others.

Emacs

The Emacs support via rst-mode comes as part of the Docutils package under /docutils/tools/editors/emacs/rst.el

Vim

The vim-common package for that comes with most GNU/Linux distributions has reStructuredText syntax highlight and indentation support of reStructuredText out of the box:

• reStructuredText syntax highlighting mode for vim
• VST (Vim reStructured Text) is a plugin for Vim7 with folding for reStructuredText
• Riv.vim - fresh vim plugin for authoring rst and Sphinx doc
• Previm: Vim plugin for live previewing of reStructuredText and other mark up documents

Jed

There is a rst mode for the Jed programmers editor.

gedit

gedit, the official text editor of the GNOME desktop environment. There is a gedit reStructuredText plugin.

Geany

Geany, a small and lightweight Integrated Development Environment include support for reStructuredText from version 0.12 (October 10, 2007).

Leo

Leo, an outlining editor for programmers, supports reStructuredText via rst-plugin or via "@auto-rst" nodes (it's not well-documented, but @auto-rst nodes allow editing rst files directly, parsing the structure into the Leo outline).

It also provides a way to preview the resulting HTML, in a "viewrendered" pane.

FTE

The FTE Folding Text Editor - a free (licensed under the GNU GPL) text editor for developers. FTE has a mode for reStructuredText support. It provides color highlighting of basic RSTX elements and special menu that provide easy way to insert most popular RSTX elements to a document.

PyK

PyK is a successor of PyEdit and reStInPeace, written in Python with the help of the Qt4 toolkit.

Eclipse

The Eclipse IDE with the ReST Editor plug-in provides support for editing reStructuredText files.

NoTex

NoTex is a browser based (general purpose) text editor, with integrated project management and syntax highlighting. Plus it enables to write books, reports, articles etc. using rST and convert them to LaTex, PDF or HTML. The PDF files are of high publication quality and are produced via Sphinx with the Texlive LaTex suite.

Notepad++

Notepad++ is a general purpose text editor for Windows. It has syntax highlighting for many languages built-in and support for reStructuredText via a user defined language for reStructuredText.

Visual Studio Code

Visual Studio Code is a general purpose text editor for Windows/macOS/Linux. It has syntax highlighting for many languages built-in and supports reStructuredText via an extension from LeXtudio.

Dedicated reStructuredText Editors

• ReSTedit by Dinu Gherman and Bill Bumgarner
• Rest in Peace
• Enthought Tool Suite editor
• ReText a cross platform program that works like Marked.
• RSTPad a standalone cross-platform editor with live preview

Proprietary editors

Sublime Text

Sublime Text is a completely customizable and extensible source code editor available for Windows, OS X, and Linux. Registration is required for long-term use, but all functions are available in the unregistered version, with occasional reminders to purchase a license. Versions 2 and 3 (currently in beta) support reStructuredText syntax highlighting by default, and several plugins are available through the package manager Package Control to provide snippets and code completion, additional syntax highlighting, conversion to/from RST and other formats, and HTML preview in the browser.

BBEdit / TextWrangler

BBEdit (and its free variant TextWrangler) for Mac can syntax-highlight reStructuredText using this codeless language module.

TextMate

TextMate, a proprietary general-purpose GUI text editor for Mac OS X, has a bundle for reStructuredText.

Intype

Intype is a proprietary text editor for Windows, that support reStructuredText out of the box.

E Text Editor

E is a proprietary Text Editor licensed under the "Open Company License". It supports TextMate's bundles, so it should support reStructuredText the same way TextMate does.

PyCharm

PyCharm (and other IntelliJ platform IDEs?) has ReST/Sphinx support (syntax highlighting, autocomplete and preview).)

Wiki

here are some Wiki programs that support the reStructuredText markup as the native markup syntax, or as an add-on:

MediaWiki

MediaWiki reStructuredText extension allows for reStructuredText markup in MediaWiki surrounded by <rst> and </rst>.

MoinMoin

MoinMoin is an advanced, easy to use and extensible WikiEngine with a large community of users. Said in a few words, it is about collaboration on easily editable web pages.

There is a reStructuredText Parser for MoinMoin.

Trac

Trac is an enhanced wiki and issue tracking system for software development projects. There is a reStructuredText Support in Trac.

This Wiki

This Wiki is a Webware for Python Wiki written by Ian Bicking. This wiki uses ReStructuredText for its markup.

rstiki

rstiki is a minimalist single-file personal wiki using reStructuredText syntax (via docutils) inspired by pwyky. It does not support authorship indication, versioning, hierarchy, chrome/framing/templating or styling. It leverages docutils/reStructuredText as the wiki syntax. As such, it's under 200 lines of code, and in a single file. You put it in a directory and it runs.

ikiwiki

Ikiwiki is a wiki compiler. It converts wiki pages into HTML pages suitable for publishing on a website. Ikiwiki stores pages and history in a revision control system such as Subversion or Git. There are many other features, including support for blogging, as well as a large array of plugins. It's reStructuredText plugin, however is somewhat limited and is not recommended as its' main markup language at this time.

Web Services

Sandbox

An Online reStructuredText editor can be used to play with the markup and see the results immediately.

Blogging frameworks

WordPress

WordPreSt reStructuredText plugin for WordPress. (PHP)

Zine

reStructuredText parser plugin for Zine (will become obsolete in version 0.2 when Zine is scheduled to get a native reStructuredText support). Zine is discontinued. (Python)

pelican

Pelican is a static blog generator that supports writing articles in ReST. (Python)

hyde

Hyde is a static website generator that supports ReST. (Python)

Acrylamid

Acrylamid is a static blog generator that supports writing articles in ReST. (Python)

Nikola

Nikola is a Static Site and Blog Generator that supports ReST. (Python)

ipsum genera

Ipsum genera is a static blog generator written in Nim.

Yozuch

Yozuch is a static blog generator written in Python.

More

• Voidspace: ReStructuredText Tools blog post.
• reStructuredText wiki post to the text.docutils.user mailing list.
• IBM's Developer Works XML Matters: reStructuredText article.
• MZlinux » Marc Links and Tips » Networking » World Wide Web » Wikis » Structured text formatters

If anyone else gets here because they're trying to set up a Jenkins slave, then you need to set the url of the host to the one it's actually using.

On the host, go to Manage Jenkins > Configure System and edit "Jenkins URL"

FOR NEOVIM

Due to problems with interactive calls (https://github.com/neovim/neovim/issues/1716), I am using this for neovim, based on Dr Beco's answer:

cnoremap w!! execute 'silent! write !SUDO_ASKPASS=`which ssh-askpass` sudo tee % >/dev/null' <bar> edit!

This will open a dialog using ssh-askpass asking for the sudo password.

This works when I try it. I double-checked with two sample programs:

using System;
using System.Diagnostics;

namespace ConsoleApplication1 {
  class Program {
    static void Main(string[] args) {
      Process.Start("ConsoleApplication2.exe");
    }
  }
}

using System;
using System.IO;

namespace ConsoleApplication2 {
  class Program {
    static void Main(string[] args) {
      try {
        File.WriteAllText(@"c:\program files\test.txt", "hello world");
      }
      catch (Exception ex) {
        Console.WriteLine(ex.ToString());
        Console.ReadLine();
      }
    }
  }
}

First verified that I get the UAC bomb:

System.UnauthorizedAccessException: Access to the path 'c:\program files\test.txt' is denied.
// etc..

Then added a manifest to ConsoleApplication1 with the phrase:

    <requestedExecutionLevel level="requireAdministrator" uiAccess="false" />

No bomb. And a file I can't easily delete :) This is consistent with several previous tests on various machines running Vista and Win7. The started program inherits the security token from the starter program. If the starter has acquired admin privileges, the started program has them as well.

ALL_TAB_COLUMNS should be queryable from PL/SQL. DESC is a SQL*Plus command.

SQL> desc all_tab_columns;
 Name                                      Null?    Type
 ----------------------------------------- -------- ----------------------------
 OWNER                                     NOT NULL VARCHAR2(30)
 TABLE_NAME                                NOT NULL VARCHAR2(30)
 COLUMN_NAME                               NOT NULL VARCHAR2(30)
 DATA_TYPE                                          VARCHAR2(106)
 DATA_TYPE_MOD                                      VARCHAR2(3)
 DATA_TYPE_OWNER                                    VARCHAR2(30)
 DATA_LENGTH                               NOT NULL NUMBER
 DATA_PRECISION                                     NUMBER
 DATA_SCALE                                         NUMBER
 NULLABLE                                           VARCHAR2(1)
 COLUMN_ID                                          NUMBER
 DEFAULT_LENGTH                                     NUMBER
 DATA_DEFAULT                                       LONG
 NUM_DISTINCT                                       NUMBER
 LOW_VALUE                                          RAW(32)
 HIGH_VALUE                                         RAW(32)
 DENSITY                                            NUMBER
 NUM_NULLS                                          NUMBER
 NUM_BUCKETS                                        NUMBER
 LAST_ANALYZED                                      DATE
 SAMPLE_SIZE                                        NUMBER
 CHARACTER_SET_NAME                                 VARCHAR2(44)
 CHAR_COL_DECL_LENGTH                               NUMBER
 GLOBAL_STATS                                       VARCHAR2(3)
 USER_STATS                                         VARCHAR2(3)
 AVG_COL_LEN                                        NUMBER
 CHAR_LENGTH                                        NUMBER
 CHAR_USED                                          VARCHAR2(1)
 V80_FMT_IMAGE                                      VARCHAR2(3)
 DATA_UPGRADED                                      VARCHAR2(3)
 HISTOGRAM                                          VARCHAR2(15)

Look into BufferedReader. If that isn't general/high-level enough, I recommend reading the I/O tutorial.

I thought my problem and its solution could help.So i was getting this same error in my eclipse project.In my project i have couple of jar files and the NOCLASSDEFERROR was thrown for a file in the jar file.

My library files were part of a folder name "lib" in my project heirarchy.I changed my folders name to "libs" and voila it worked.

(I looked into the .classpath file and i had key-value pairs,and the entry for my jar file had key named "lib" and hence i thought probably changing from lib could help.)

In addition mysql passwords when not using the IDENTIFIED BY clause, may be blank values, if non-blank, they may be encrypted. But yes USAGE is used to modify an account by granting simple resource limiters such as MAX_QUERIES_PER_HOUR, again this can be specified by also using the WITH clause, in conjuction with GRANT USAGE(no privileges added) or GRANT ALL, you can also specify GRANT USAGE at the global level, database level, table level,etc....

Convert binary file to base64 & vice versa. Prove in python 3.5.2

import base64

read_file = open('/tmp/newgalax.png', 'rb')
data = read_file.read()

b64 = base64.b64encode(data)

print (b64)

# Save file
decode_b64 = base64.b64decode(b64)
out_file = open('/tmp/out_newgalax.png', 'wb')
out_file.write(decode_b64)

# Test in python 3.5.2

As far as I know Celery does not give API for examining tasks that are waiting in the queue. This is broker-specific. If you use Redis as a broker for an example, then examining tasks that are waiting in the celery (default) queue is as simple as:

1. connect to the broker database
2. list items in the celery list (LRANGE command for an example)

Keep in mind that these are tasks WAITING to be picked by available workers. Your cluster may have some tasks running - those will not be in this list as they have already been picked.

As another example of its use:

If you have an RSS Feed (xml document) and want to include some basic HTML encoding in the display of the description, you can use CData to encode it:

<item>
  <title>Title of Feed Item</title>
  <link>/mylink/article1</link>
  <description>
    <![CDATA[
      <p>
      <a href="/mylink/article1"><img style="float: left; margin-right: 5px;" height="80" src="/mylink/image" alt=""/></a>
      Author Names
      <br/><em>Date</em>
      <br/>Paragraph of text describing the article to be displayed</p>
    ]]>
  </description>
</item>

The RSS Reader pulls in the description and renders the HTML within the CDATA.

Note - not all HTML tags work - I think it depends on the RSS reader you are using.

And as a explanation for why this example uses CData (and not the appropriate pubData and dc:creator tags): this is for website display using a RSS widget for which we have no real formatting control.

This enables us to specify the height and position of the included image, format the author names and date correctly, and so forth, without the need for a new widget. It also means I can script this and not have to add them by hand.

Hope this helps

/* Hide scrollbar for Chrome, Safari and Opera */
::-webkit-scrollbar {
  display: none;
}

/* Hide scrollbar for IE, Edge and Firefox */
html {
  -ms-overflow-style: none;  /* IE and Edge */
  scrollbar-width: none;  /* Firefox */
}

this works for me

<input ID="TIPO_INST-0" Name="TIPO_INST" Type="Radio" value="UNAM" onchange="convenio_unam();">UNAM

<script type="text/javascript">
            function convenio_unam(){
                if(this.document.getElementById('TIPO_INST-0').checked){
                    $("#convenio_unam").hide();
                }else{
                    $("#convenio_unam").show(); 
                }                               
            }
</script>

In case you were wondering where to add @Service annotation, then make sure you have added @Service annotation to the class that implements the interface. That would solve this problem.

I've recently found a lib called ion that brings a little extra to the table.

ion has built-in support for image download integrated with ImageView, JSON (with the help of GSON), files and a very handy UI threading support.

I'm using it on a new project and so far the results have been good. Its use is much simpler than Volley or Retrofit.

Sorry to resurrect an old question, but I thought I might contribute a couple of very basic examples and for-dummies explanations. None of the other answers posted thusfar illustrate syntax like the MDN guide's first example, which is about as basic as one can get.

Getter:

var settings = {
    firstname: 'John',
    lastname: 'Smith',
    get fullname() { return this.firstname + ' ' + this.lastname; }
};

console.log(settings.fullname);

... will log John Smith, of course. A getter behaves like a variable object property, but offers the flexibility of a function to calculate its returned value on the fly. It's basically a fancy way to create a function that doesn't require () when calling.

Setter:

var address = {
    set raw(what) {
        var loc = what.split(/\s*;\s*/),
        area = loc[1].split(/,?\s+(\w{2})\s+(?=\d{5})/);

        this.street = loc[0];
        this.city = area[0];
        this.state = area[1];
        this.zip = area[2];
    }
};

address.raw = '123 Lexington Ave; New York NY  10001';
console.log(address.city);

... will log New York to the console. Like getters, setters are called with the same syntax as setting an object property's value, but are yet another fancy way to call a function without ().

See this jsfiddle for a more thorough, perhaps more practical example. Passing values into the object's setter triggers the creation or population of other object items. Specifically, in the jsfiddle example, passing an array of numbers prompts the setter to calculate mean, median, mode, and range; then sets object properties for each result.

I've got a solution that's pretty simple to implement.

Make a temporary class just to wrap the list object and later call the value from the class.

Here's a practical example:

1. Let's say you want to insert list object into the dataframe.

df = pd.DataFrame([
    {'a': 1},
    {'a': 2},
    {'a': 3},
])

df.loc[:, 'b'] = [
    [1,2,4,2,], 
    [1,2,], 
    [4,5,6]
] # This works. Because the list has the same length as the rows of the dataframe

df.loc[:, 'c'] = [1,2,4,5,3] # This does not work. 

>>> ValueError: Must have equal len keys and value when setting with an iterable

## To force pandas to have list as value in each cell, wrap the list with a temporary class.

class Fake(object):
    def __init__(self, li_obj):
        self.obj = li_obj

df.loc[:, 'c'] = Fake([1,2,5,3,5,7,]) # This works. 

df.c = df.c.apply(lambda x: x.obj) # Now extract the value from the class. This works. 

Creating a fake class to do this might look like a hassle but it can have some practical applications. For an example you can use this with apply when the return value is list.

Pandas would normally refuse to insert list into a cell but if you use this method, you can force the insert.

Swift 3.0 code

self.timer = Timer.scheduledTimer(timeInterval: timeInterval, target: self, selector:#selector(fetchAutocompletePlaces(timer:)), userInfo:[textView.text], repeats: true)

func fetchAutocompletePlaces(timer : Timer) {

  let keyword = timer.userInfo
}

You can send value in 'userinfo' and use that as parameter in the function.

Update this function :

if (version_compare(PHP_VERSION, '5.3.0', '<')) {
  set_magic_quotes_runtime(0);
}
else {
  ini_set('magic_quotes_runtime', 0);
}
$magic_quotes = get_magic_quotes_runtime();
$file_buffer = fread($fd, filesize($path));
$file_buffer = $this->EncodeString($file_buffer, $encoding);
fclose($fd);
if ($magic_quotes) {
  if (version_compare(PHP_VERSION, '5.3.0', '<')) {
    set_magic_quotes_runtime($magic_quotes);
  }
  else {
    ini_set('magic_quotes_runtime', $magic_quotes);
  }
}

return $file_buffer;

Objective-C code for copy Table from a Database to another Database

-(void) createCopyDatabase{

          NSArray *paths = NSSearchPathForDirectoriesInDomains(NSDocumentDirectory , NSUserDomainMask, YES);
          NSString *documentsDir = [paths objectAtIndex:0];

          NSString *maindbPath = [documentsDir stringByAppendingPathComponent:@"User.sqlite"];;

          NSString *newdbPath = [documentsDir stringByAppendingPathComponent:@"User_copy.sqlite"];
          NSFileManager *fileManager = [NSFileManager defaultManager];
          char *error;

         if ([fileManager fileExistsAtPath:newdbPath]) {
             [fileManager removeItemAtPath:newdbPath error:nil];
         }
         sqlite3 *database;
         //open database
        if (sqlite3_open([newdbPath UTF8String], &database)!=SQLITE_OK) {
            NSLog(@"Error to open database");
        }

        NSString *attachQuery = [NSString stringWithFormat:@"ATTACH DATABASE \"%@\" AS aDB",maindbPath];

       sqlite3_exec(database, [attachQuery UTF8String], NULL, NULL, &error);
       if (error) {
           NSLog(@"Error to Attach = %s",error);
       }

       //Query for copy Table
       NSString *sqlString = @"CREATE TABLE Info AS SELECT * FROM aDB.Info";
       sqlite3_exec(database, [sqlString UTF8String], NULL, NULL, &error);
        if (error) {
            NSLog(@"Error to copy database = %s",error);
        }

        //Query for copy Table with Where Clause

        sqlString = @"CREATE TABLE comments AS SELECT * FROM aDB.comments Where user_name = 'XYZ'";
        sqlite3_exec(database, [sqlString UTF8String], NULL, NULL, &error);
        if (error) {
            NSLog(@"Error to copy database = %s",error);
        }
 }

Try the QuickTime Player! Heres my JavaScript that generates the embedded object on a web page and plays the stream:

//SET THE RTSP STREAM ADDRESS HERE
var address = "rtsp://192.168.0.101/mpeg4/1/media.3gp";

var output = '<object width="640" height="480" id="qt" classid="clsid:02BF25D5-8C17-4B23-BC80-D3488ABDDC6B" codebase="http://www.apple.com/qtactivex/qtplugin.cab">';
    output += '<param name="src" value="'+address+'">';
    output += '<param name="autoplay" value="true">';
    output += '<param name="controller" value="false">';
    output += '<embed id="plejer" name="plejer" src="/poster.mov" bgcolor="000000" width="640" height="480" scale="ASPECT" qtsrc="'+address+'"  kioskmode="true" showlogo=false" autoplay="true" controller="false" pluginspage="http://www.apple.com/quicktime/download/">';
    output += '</embed></object>';

    //SET THE DIV'S ID HERE
    document.getElementById("the_div_that_will_hold_the_player_object").innerHTML = output;

Let us say you have a data frame you created and named "Data_output", you can simply export it to same directory by using the following syntax.

write.csv(Data_output, "output.csv", row.names = F, quote = F)

credit to Peter and Ilja, UMCG, the Netherlands

I got same issue after migration from another mac. And it blocked to connect github by my key.

I reset permission as below and it works well now.

chmod 700 ~/.ssh     # (drwx------)
cd ~/.ssh            
chmod 644 *.pub      # (-rw-r--r--)
chmod 600 id_rsa     # (-rw-------)

From the .NET blog Announcing .NET 2015 Preview: A New Era for .NET:

.NET Core has two major components. It includes a small runtime that is built from the same codebase as the .NET Framework CLR. The .NET Core runtime includes the same GC and JIT (RyuJIT), but doesn’t include features like Application Domains or Code Access Security. The runtime is delivered via NuGet, as part of the [ASP.NET Core] package.

.NET Core also includes the base class libraries. These libraries are largely the same code as the .NET Framework class libraries, but have been factored (removal of dependencies) to enable us to ship a smaller set of libraries. These libraries are shipped as System.* NuGet packages on NuGet.org.

And:

[ASP.NET Core] is the first workload that has adopted .NET Core. [ASP.NET Core] runs on both the .NET Framework and .NET Core. A key value of [ASP.NET Core] is that it can run on multiple versions of [.NET Core] on the same machine. Website A and website B can run on two different versions of .NET Core on the same machine, or they can use the same version.

In short: first, there was the Microsoft .NET Framework, which consists of a runtime that executes application and library code, and a nearly fully documented standard class library.

The runtime is the Common Language Runtime, which implements the Common Language Infrastructure, works with The JIT compiler to run the CIL (formerly MSIL) bytecode.

Microsoft's specification and implementation of .NET were, given its history and purpose, very Windows- and IIS-centered and "fat". There are variations with fewer libraries, namespaces and types, but few of them were useful for web or desktop development or are troublesome to port from a legal standpoint.

So in order to provide a non-Microsoft version of .NET, which could run on non-Windows machines, an alternative had to be developed. Not only the runtime has to be ported for that, but also the entire Framework Class Library to become well-adopted. On top of that, to be fully independent from Microsoft, a compiler for the most commonly used languages will be required.

Mono is one of few, if not the only alternative implementation of the runtime, which runs on various OSes besides Windows, almost all namespaces from the Framework Class Library as of .NET 4.5 and a VB and C# compiler.

Enter .NET Core: an open-source implementation of the runtime, and a minimal base class library. All additional functionality is delivered through NuGet packages, deploying the specific runtime, framework libraries and third-party packages with the application itself.

ASP.NET Core is a new version of MVC and WebAPI, bundled together with a thin HTTP server abstraction, that runs on the .NET Core runtime - but also on the .NET Framework.

I am nothing adding new here but another alternate way.

 var newCodes = function() {
     var dCodes = fg.codecsCodes.rs;
     var dCodes2 = fg.codecsCodes2.rs;
     let [...val] = [dCodes,dCodes2];
     return [...val];
 };

Here is an example I used to connect node.js to my Postgres database.

The interface in node.js that I used can be found here https://github.com/brianc/node-postgres

var pg = require('pg');
var conString = "postgres://YourUserName:YourPassword@localhost:5432/YourDatabase";

var client = new pg.Client(conString);
client.connect();

//queries are queued and executed one after another once the connection becomes available
var x = 1000;

while (x > 0) {
    client.query("INSERT INTO junk(name, a_number) values('Ted',12)");
    client.query("INSERT INTO junk(name, a_number) values($1, $2)", ['John', x]);
    x = x - 1;
}

var query = client.query("SELECT * FROM junk");
//fired after last row is emitted

query.on('row', function(row) {
    console.log(row);
});

query.on('end', function() {
    client.end();
});



//queries can be executed either via text/parameter values passed as individual arguments
//or by passing an options object containing text, (optional) parameter values, and (optional) query name
client.query({
    name: 'insert beatle',
    text: "INSERT INTO beatles(name, height, birthday) values($1, $2, $3)",
    values: ['George', 70, new Date(1946, 02, 14)]
});

//subsequent queries with the same name will be executed without re-parsing the query plan by postgres
client.query({
    name: 'insert beatle',
    values: ['Paul', 63, new Date(1945, 04, 03)]
});
var query = client.query("SELECT * FROM beatles WHERE name = $1", ['john']);

//can stream row results back 1 at a time
query.on('row', function(row) {
    console.log(row);
    console.log("Beatle name: %s", row.name); //Beatle name: John
    console.log("Beatle birth year: %d", row.birthday.getYear()); //dates are returned as javascript dates
    console.log("Beatle height: %d' %d\"", Math.floor(row.height / 12), row.height % 12); //integers are returned as javascript ints
});

//fired after last row is emitted
query.on('end', function() {
    client.end();
});

UPDATE:- THE query.on function is now deprecated and hence the above code will not work as intended. As a solution for this look at:- query.on is not a function

Or a comparison on the class name e.g.

except ClientError as e:
    if 'EntityAlreadyExistsException' == e.__class__.__name__:
        # handle specific error

Because they are dynamically created you can never import the class and catch it using real Python.

According to RFC 4329 the correct MIME type for JavaScript should be application/javascript. Howerver, older IE versions choke on this since they expect text/javascript.

background-image takes an url as a value. Use either

background-image: url ('/image/btn.png');

or

background: url ('/image/btn.png') no-repeat;

which is a shorthand for

background-image: url ('/image/btn.png');
background-repeat: no-repeat;

Also, you might want to look at the button HTML element for fancy submit buttons.

In case of float values with characters 'e' '+' it errors out if we try to convert in decimal. ('2.81104e+006'). It still pass ISNUMERIC test.

SELECT ISNUMERIC('2.81104e+006') 

returns 1.

SELECT convert(decimal(15,2), '2.81104e+006') 

returns

error: Error converting data type varchar to numeric.

And

SELECT try_convert(decimal(15,2), '2.81104e+006') 

returns NULL.

SELECT convert(float, '2.81104e+006') 

returns the correct value 2811040.

A simple trick is to define the $_SESSION array as a global variable. For that, edit the core.php file in the extension folder by adding this function :

public function getGlobals() {
    return array(
        'session'   => $_SESSION,
    ) ;
}

Then, you'll be able to acces any session variable as :

{{ session.username }}

if you want to access to

$_SESSION['username']

I've got the same problem, and what worked for me is in THIS OTHER ANSWER.

I didn't replicated it here because it is NOT A CORRECT THING TO DO.

Basically is a re-install being sure to delete everything very well and using 32 bit versions.

One other approach that we have taken successfully is to generate the WS client proxy code using wsimport (from Ant, as an Ant task) and specify the wsdlLocation attribute.

<wsimport debug="true" keep="true" verbose="false" target="2.1" sourcedestdir="${generated.client}" wsdl="${src}${wsdl.file}" wsdlLocation="${wsdl.file}">
</wsimport>

Since we run this for a project w/ multiple WSDLs, the script resolves the $(wsdl.file} value dynamically which is set up to be /META-INF/wsdl/YourWebServiceName.wsdl relative to the JavaSource location (or /src, depending on how you have your project set up). During the build proess, the WSDL and XSDs files are copied to this location and packaged in the JAR file. (similar to the solution described by Bhasakar above)

MyApp.jar
|__META-INF
   |__wsdl
      |__YourWebServiceName.wsdl
      |__YourWebServiceName_schema1.xsd
      |__YourWebServiceName_schmea2.xsd

Note: make sure the WSDL files are using relative refrerences to any imported XSDs and not http URLs:

  <types>
    <xsd:schema>
      <xsd:import namespace="http://valueobject.common.services.xyz.com/" schemaLocation="YourWebService_schema1.xsd"/>
    </xsd:schema>
    <xsd:schema>
      <xsd:import namespace="http://exceptions.util.xyz.com/" schemaLocation="YourWebService_schema2.xsd"/>
    </xsd:schema>
  </types>

In the generated code, we find this:

/**
 * This class was generated by the JAX-WS RI.
 * JAX-WS RI 2.2-b05-
 * Generated source version: 2.1
 * 
 */
@WebServiceClient(name = "YourService", targetNamespace = "http://test.webservice.services.xyz.com/", wsdlLocation = "/META-INF/wsdl/YourService.wsdl")
public class YourService_Service
    extends Service
{

    private final static URL YOURWEBSERVICE_WSDL_LOCATION;
    private final static WebServiceException YOURWEBSERVICE_EXCEPTION;
    private final static QName YOURWEBSERVICE_QNAME = new QName("http://test.webservice.services.xyz.com/", "YourService");

    static {
        YOURWEBSERVICE_WSDL_LOCATION = com.xyz.services.webservice.test.YourService_Service.class.getResource("/META-INF/wsdl/YourService.wsdl");
        WebServiceException e = null;
        if (YOURWEBSERVICE_WSDL_LOCATION == null) {
            e = new WebServiceException("Cannot find '/META-INF/wsdl/YourService.wsdl' wsdl. Place the resource correctly in the classpath.");
        }
        YOURWEBSERVICE_EXCEPTION = e;
    }

    public YourService_Service() {
        super(__getWsdlLocation(), YOURWEBSERVICE_QNAME);
    }

    public YourService_Service(URL wsdlLocation, QName serviceName) {
        super(wsdlLocation, serviceName);
    }

    /**
     * 
     * @return
     *     returns YourService
     */
    @WebEndpoint(name = "YourServicePort")
    public YourService getYourServicePort() {
        return super.getPort(new QName("http://test.webservice.services.xyz.com/", "YourServicePort"), YourService.class);
    }

    /**
     * 
     * @param features
     *     A list of {@link javax.xml.ws.WebServiceFeature} to configure on the proxy.  Supported features not in the <code>features</code> parameter will have their default values.
     * @return
     *     returns YourService
     */
    @WebEndpoint(name = "YourServicePort")
    public YourService getYourServicePort(WebServiceFeature... features) {
        return super.getPort(new QName("http://test.webservice.services.xyz.com/", "YourServicePort"), YourService.class, features);
    }

    private static URL __getWsdlLocation() {
        if (YOURWEBSERVICE_EXCEPTION!= null) {
            throw YOURWEBSERVICE_EXCEPTION;
        }
        return YOURWEBSERVICE_WSDL_LOCATION;
    }

}

Perhaps this might help too. It's just a different approach that does not use the "catalog" approach.

By printing the hashcode of the String/StringBuffer object after any append operation also prove, String object is getting recreated internally every time with new values rather than using the same String object.

public class MutableImmutable {

/**
 * @param args
 */
public static void main(String[] args) {
    System.out.println("String is immutable");
    String s = "test";
    System.out.println(s+"::"+s.hashCode());
    for (int i = 0; i < 10; i++) {
        s += "tre";
        System.out.println(s+"::"+s.hashCode());
    }

    System.out.println("String Buffer is mutable");

    StringBuffer strBuf = new StringBuffer("test");
    System.out.println(strBuf+"::"+strBuf.hashCode());
    for (int i = 0; i < 10; i++) {
        strBuf.append("tre");
        System.out.println(strBuf+"::"+strBuf.hashCode());
    }

 }

}

Output: It prints object value along with its hashcode

    String is immutable
    test::3556498
    testtre::-1422435371
    testtretre::-1624680014
    testtretretre::-855723339
    testtretretretre::2071992018
    testtretretretretre::-555654763
    testtretretretretretre::-706970638
    testtretretretretretretre::1157458037
    testtretretretretretretretre::1835043090
    testtretretretretretretretretre::1425065813
    testtretretretretretretretretretre::-1615970766
    String Buffer is mutable
    test::28117098
    testtre::28117098
    testtretre::28117098
    testtretretre::28117098
    testtretretretre::28117098
    testtretretretretre::28117098
    testtretretretretretre::28117098
    testtretretretretretretre::28117098
    testtretretretretretretretre::28117098
    testtretretretretretretretretre::28117098
    testtretretretretretretretretretre::28117098

Generally any change in the .htaccess should have visible effects. If no effect, check your configuration apache files, something like:

<Directory ..>
    ...
    AllowOverride None
    ...
</Directory>

Should be changed to

AllowOverride All

And you'll be able to change directives in .htaccess files.

Try:

output=$(ps -ef | awk '/siebsvc –s siebsrvr/ && !/awk/ { a++ } END { print a }'); echo $output

Wrapping your command in $( ) tells the shell to run that command, instead of attempting to set the command itself to the variable named "output". (Note that you could also use backticks `command`.)

I can highly recommend http://tldp.org/LDP/abs/html/commandsub.html to learn more about command substitution.

Also, as 1_CR correctly points out in a comment, the extra space between the equals sign and the assignment is causing it to fail. Here is a simple example on my machine of the behavior you are experiencing:

jed@MBP:~$ foo=$(ps -ef |head -1);echo $foo
UID PID PPID C STIME TTY TIME CMD

jed@MBP:~$ foo= $(ps -ef |head -1);echo $foo
-bash: UID: command not found
UID PID PPID C STIME TTY TIME CMD

In addition to Temi Lajumoke's answer, it's worth noting that after creating the required roles and assigning them to specific users in ASP.NET Core 2.1 MVC Web Application, after launching the application, you may encounter a method error, such as registering or managing an account:

InvalidOperationException: Unable to resolve service for type 'Microsoft.AspNetCore.Identity.UI.Services.IEmailSender' while attempting to activate 'WebApplication.Areas.Identity.Pages.Account.Manage.IndexModel'.

A similar error can be quickly corrected in the ConfigureServices method by adding the AddDefaultUI() method:

services.AddIdentity<IdentityUser, IdentityRole>()
//services.AddDefaultIdentity<IdentityUser>()
    .AddEntityFrameworkStores<ApplicationDbContext>()
    .AddDefaultUI()
    .AddDefaultTokenProviders();

Check

 https://blogs.msdn.microsoft.com/webdev/2018/03/02/aspnetcore-2-1-identity-ui/

and related topic on github:

 https://github.com/aspnet/Docs/issues/6784 for more information.

And for assigning role to specific user could be used IdentityUser class instead of ApplicationUser.

Set the margin for body at 0 and that will fix it.

body {
   margin: 0;
}

Always get a positive random number.

 var nexnumber = Guid.NewGuid().GetHashCode();
        if (nexnumber < 0)
        {
            nexnumber *= -1;
        }

JAXB is part of JDK standard edition version 1.6+. So it is FREE and no extra libraries to download and manage. A simple example can be found here

XStream seems to be dead. Last update was on Dec 6 2008. Simple seems as easy and simpler as JAXB but I could not find any licensing information to evaluate it for enterprise use.

Consider the alternative:

<properties>
    <javac.src.version>1.8</javac.src.version>
    <javac.target.version>1.8</javac.target.version>
</properties>

It should be the same thing of maven.compiler.source/maven.compiler.target but the above solution works for me, otherwise the second one gets the parent specification (I have a matrioska of .pom)

If you are here because of the Liquibase error saying:

Caused By: Precondition Error
...
Can't detect type of array [Ljava.lang.Short

and you are using

not {
  indexExists()
}

precondition multiple times, then you are facing an old bug: https://liquibase.jira.com/browse/CORE-1342

We can try to execute an above check using bare sqlCheck(Postgres):

SELECT COUNT(i.relname)
FROM
    pg_class t,
    pg_class i,
    pg_index ix
WHERE
    t.oid = ix.indrelid
    and i.oid = ix.indexrelid
    and t.relkind = 'r'
    and t.relname = 'tableName'
    and i.relname = 'indexName';

where tableName - is an index table name and indexName - is an index name

Google Chrome has a two ways to check for unused CSS.

1. Audit Tab: > Right Click + Inspect Element on the page, find the "Audit" tab, and run the audit, making sure "Web Page Performance" is checked.

Lists all unused CSS tags - see image below.

Update: - - - - - - - - - - - - - - OR - - - - - - - - - - - - - -

2. Coverage Tab: > Right Click + Inspect Element on the page, find the three dots on the far right (circled in image) and open Console Drawer (or hit Esc), finally click the three dots left side in the drawer (circled in image) to open Coverage tool.

Chrome launched a tool to see unused CSS and JS - Chrome 59 Update Allows you to start and stop a recording (red square in image) to allow better coverage of a user experience on the page.

Shows all used and unused CSS/JS in the files - see image below.

if you just want to add timeout as an additional option for the entire existing script, you can make it test for the timeout-option, and then make it call it self recursively without that option.

example.sh:

#!/bin/bash
if [ "$1" == "-t" ]; then
  timeout 1m $0 $2
else
  #the original script
  echo $1
  sleep 2m
  echo YAWN...
fi

running this script without timeout:

$./example.sh -other_option # -other_option
                            # YAWN...

running it with a one minute timeout:

$./example.sh -t -other_option # -other_option

Design patterns aren't trivially reusable solutions.

Design patterns are reusable, by definition. They're patterns you detect in other good solutions.

A pattern is not trivially reusable. You can implement your down design following the pattern however.

Relational design patters include things like:

1. One-to-Many relationships (master-detail, parent-child) relationships using a foreign key.

2. Many-to-Many relationships with a bridge table.

3. Optional one-to-one relationships managed with NULLs in the FK column.

4. Star-Schema: Dimension and Fact, OLAP design.

5. Fully normalized OLTP design.

6. Multiple indexed search columns in a dimension.

7. "Lookup table" that contains PK, description and code value(s) used by one or more applications. Why have code? I don't know, but when they have to be used, this is a way to manage the codes.

8. Uni-table. [Some call this an anti-pattern; it's a pattern, sometimes it's bad, sometimes it's good.] This is a table with lots of pre-joined stuff that violates second and third normal form.

9. Array table. This is a table that violates first normal form by having an array or sequence of values in the columns.

10. Mixed-use database. This is a database normalized for transaction processing but with lots of extra indexes for reporting and analysis. It's an anti-pattern -- don't do this. People do it anyway, so it's still a pattern.

Most folks who design databases can easily rattle off a half-dozen "It's another one of those"; these are design patterns that they use on a regular basis.

And this doesn't include administrative and operational patterns of use and management.

you can try this way

• git: repo: 'https://foosball.example.org/path/to/repo.git' dest: /srv/checkout version: release-0.2 delegate_to: localhost
• name: perform some command next yum: name=ntp state=latest

JSONObject obj=(JSONObject)JSONValue.parse(content); 
JSONArray arr=(JSONArray)obj.get("units"); 
System.out.println(arr.get(1));  //this will print {"id":42,...sities ..}

@cyberz is right but explain it reverse

Read the info.plist file of your app and get the value for key CFBundleShortVersionString. Reading info.plist will give you an NSDictionary object

findByInventoryIdIn(List<Long> inventoryIdList) should do the trick.

The HTTP request parameter format would be like so:

Yes ?id=1,2,3
No  ?id=1&id=2&id=3

The complete list of JPA repository keywords can be found in the current documentation listing. It shows that IsIn is equivalent – if you prefer the verb for readability – and that JPA also supports NotIn and IsNotIn.

here is a function that fix your problem

    public static void fixID(Connection conn, String table) {

    try {
        Statement myStmt = conn.createStatement();
        ResultSet myRs;
        int i = 1, id = 1, n = 0;
        boolean b;
        String sql;

        myRs = myStmt.executeQuery("select max(id) from " + table);
        if (myRs.next()) {
            n = myRs.getInt(1);
        }
        while (i <= n) {
            b = false;
            myRs = null;
            while (!b) {
                myRs = myStmt.executeQuery("select id from " + table + " where id=" + id);
                if (!myRs.next()) {
                    id++;
                } else {
                    b = true;
                }
            }

            sql = "UPDATE " + table + " set id =" + i + " WHERE id=" + id;
            myStmt.execute(sql);
            i++;
            id++;
        }

    } catch (SQLException e) {
        e.printStackTrace();
    }
}

Well, I think something is missing here. User wants to get data from the last year and not from the last 365 days. There is a huge diference. In my opinion, data from the last year is every data from 2007 (if I am in 2008 now). So the right answer would be:

SELECT ... FROM ... WHERE YEAR(DATE) = YEAR(GETDATE()) - 1

Then if you want to restrict this query, you can add some other filter, but always searching in the last year.

SELECT ... FROM ... WHERE YEAR(DATE) = YEAR(GETDATE()) - 1 AND DATE > '05/05/2007'

After having so many nightmares, I found a solution.

utf8_decode(chr(10))

I tried \n, <br/> and chr(10) but nothing worked. Then I realized that it was utf-8 and just tried the above one. It works fine with MultiCell but not with Cell.

What causes a "broken pipe", and more importantly, is it possible to recover from that state?

It is caused by something causing the connection to close. (It is not your application that closed the connection: that would have resulted in a different exception.)

It is not possible to recover the connection. You need to open a new one.

If it cannot be recovered, it seems this would be a good sign that an irreversible problem has occurred and that I should simply close this socket connection. Is that a reasonable assumption?

Yes it is. Once you've received that exception, the socket won't ever work again. Closing it is is the only sensible thing to do.

Is there ever a time when this IOException would occur while the socket connection is still being properly connected in the first place (rather than a working connection that failed at some point)?

No. (Or at least, not without subverting proper behavior of the OS'es network stack, the JVM and/or your application.)

Is it wise to always call SocketChannel.isConnected() before attempting a SocketChannel.write() ...

In general, it is a bad idea to call r.isXYZ() before some call that uses the (external) resource r. There is a small chance that the state of the resource will change between the two calls. It is a better idea to do the action, catch the IOException (or whatever) resulting from the failed action and take whatever remedial action is required.

In this particular case, calling isConnected() is pointless. The method is defined to return true if the socket was connected at some point in the past. It does not tell you if the connection is still live. The only way to determine if the connection is still alive is to attempt to use it; e.g. do a read or write.

$("#selector <b>></b> option:selected").val()

Or

$("#selector <b>></b> option:selected").text()

Above codes worked well for me

You can use reptyr:

sudo apt install reptyr
reptyr pid

To include native libraries you need:

1. create "jar" file with special structure containing ".so" files;
2. include that file in dependencies list.

To create jar file, use the following snippet:

task nativeLibsToJar(type: Zip, description: 'create a jar archive of the native libs') {
    destinationDir file("$buildDir/native-libs")
    baseName 'native-libs'
    extension 'jar'
    from fileTree(dir: 'libs', include: '**/*.so')
    into 'lib/'
}

tasks.withType(Compile) {
    compileTask -> compileTask.dependsOn(nativeLibsToJar)
}

To include resulting file, paste the following line into "dependencies" section in "build.gradle" file:

compile fileTree(dir: "$buildDir/native-libs", include: 'native-libs.jar')

Dynamic programming is a technique for solving problems with overlapping sub problems. A dynamic programming algorithm solves every sub problem just once and then Saves its answer in a table (array). Avoiding the work of re-computing the answer every time the sub problem is encountered. The underlying idea of dynamic programming is: Avoid calculating the same stuff twice, usually by keeping a table of known results of sub problems.

The seven steps in the development of a dynamic programming algorithm are as follows:

1. Establish a recursive property that gives the solution to an instance of the problem.
2. Develop a recursive algorithm as per recursive property
3. See if same instance of the problem is being solved again an again in recursive calls
4. Develop a memoized recursive algorithm
5. See the pattern in storing the data in the memory
6. Convert the memoized recursive algorithm into iterative algorithm
7. Optimize the iterative algorithm by using the storage as required (storage optimization)

The Python 2 syntax works in Python 3 as well:

>>> class MyClass:
...     def __init__(self):
...         self.title = 'Title'
... 
>>> a = MyClass()
>>> print('The title is %(title)s' % a.__dict__)
The title is Title
>>> 
>>> path = '/path/to/a/file'
>>> print('You put your file here: %(path)s' % locals())
You put your file here: /path/to/a/file

Neither basic nor extended Posix/GNU regex recognizes the non-greedy quantifier; you need a later regex. Fortunately, Perl regex for this context is pretty easy to get:

perl -pe 's|(http://.*?/).*|\1|'

The shortest expression is

curl 'http://…' | jq length

tl;dr

ZonedDateTime.parse( 
                        "Jun 13 2003 23:11:52.454 UTC" , 
                        DateTimeFormatter.ofPattern ( "MMM d uuuu HH:mm:ss.SSS z" ) 
                    )
              .toInstant()
              .toEpochMilli()

1055545912454

java.time

This Answer expands on the Answer by Lockni.

DateTimeFormatter

First define a formatting pattern to match your input string by creating a DateTimeFormatter object.

String input = "Jun 13 2003 23:11:52.454 UTC";
DateTimeFormatter f = DateTimeFormatter.ofPattern ( "MMM d uuuu HH:mm:ss.SSS z" );

ZonedDateTime

Parse the string as a ZonedDateTime. You can think of that class as: ( Instant + ZoneId ).

ZonedDateTime zdt = ZonedDateTime.parse ( "Jun 13 2003 23:11:52.454 UTC" , f );

zdt.toString(): 2003-06-13T23:11:52.454Z[UTC]

Count-from-epoch

I do not recommend tracking date-time values as a count-from-epoch. Doing so makes debugging tricky as humans cannot discern a meaningful date-time from a number so invalid/unexpected values may slip by. Also such counts are ambiguous, in granularity (whole seconds, milli, micro, nano, etc.) and in epoch (at least two dozen in by various computer systems).

But if you insist you can get a count of milliseconds from the epoch of first moment of 1970 in UTC (1970-01-01T00:00:00) through the Instant class. Be aware this means data-loss as you are truncating any nanoseconds to milliseconds.

Instant instant = zdt.toInstant ();

instant.toString(): 2003-06-13T23:11:52.454Z

long millisSinceEpoch = instant.toEpochMilli() ; 

1055545912454

About java.time

The java.time framework is built into Java 8 and later. These classes supplant the troublesome old legacy date-time classes such as java.util.Date, Calendar, & SimpleDateFormat.

To learn more, see the Oracle Tutorial. And search Stack Overflow for many examples and explanations. Specification is JSR 310.

The Joda-Time project, now in maintenance mode, advises migration to the java.time classes.

You may exchange java.time objects directly with your database. Use a JDBC driver compliant with JDBC 4.2 or later. No need for strings, no need for java.sql.* classes.

Where to obtain the java.time classes?

• Java SE 8, Java SE 9, Java SE 10, Java SE 11, and later - Part of the standard Java API with a bundled implementation.
  • Java 9 adds some minor features and fixes.
• Java SE 6 and Java SE 7
  • Most of the java.time functionality is back-ported to Java 6 & 7 in ThreeTen-Backport.
• Android
  • Later versions of Android bundle implementations of the java.time classes.
  • For earlier Android (<26), the ThreeTenABP project adapts ThreeTen-Backport (mentioned above). See How to use ThreeTenABP….

The ThreeTen-Extra project extends java.time with additional classes. This project is a proving ground for possible future additions to java.time. You may find some useful classes here such as Interval, YearWeek, YearQuarter, and more.

I was able to resolve this by adding the following to my component:

componentDidMount() {
  ReactDOM.findDOMNode(this).addEventListener('click', (event) => {
    event.stopPropagation();
  }, false);
}

There should be only one localhost defined, check sites-enabled or nginx.conf.

A key pair (the private and public keys) will have the same fingerprint; so in the case you can't remember which private key belong to which public key, find the match by comparing their fingerprints.

The most voted answer by Marvin Vinto provides the fingerprint of a public SSH key file. The fingerprint of the corresponding private SSH key can also be queried, but it requires a longer series of step, as shown below.

1. Load the SSH agent, if you haven't done so. The easiest way is to invoke

   $ ssh-agent bash
   

   or

   $ ssh-agent tcsh
   

   (or another shell you use).

2. Load the private key you want to test:

   $ ssh-add /path/to/your-ssh-private-key
   

   You will be asked to enter the passphrase if the key is password-protected.

3. Now, as others have said, type

   $ ssh-add -l
   1024 fd:bc:8a:81:58:8f:2c:78:86:a2:cf:02:40:7d:9d:3c you@yourhost (DSA)
   

   fd:bc:... is the fingerprint you are after. If there are multiple keys, multiple lines will be printed, and the last line contains the fingerprint of the last loaded key.

4. If you want to stop the agent (i.e., if you invoked step 1 above), then simply type `exit' on the shell, and you'll be back on the shell prior to the loading of ssh agent.

I do not add new information, but hopefully this answer is clear to users of all levels.

intersect_all <- function(a,b,...){
  all_data <- c(a,b,...)
  require(plyr)
  count_data<- length(list(a,b,...))
  freq_dist <- count(all_data)
  intersect_data <- freq_dist[which(freq_dist$freq==count_data),"x"]
  intersect_data
}


intersect_all(a,b,c)

UPDATE EDIT A simpler code

intersect_all <- function(a,b,...){
  Reduce(intersect, list(a,b,...))
}

intersect_all(a,b,c)

is it possible to export without looping through all records

For a range in Excel with a large number of rows you may see some performance improvement if you create an Access.Application object in Excel and then use it to import the Excel data into Access. The code below is in a VBA module in the same Excel document that contains the following test data

Option Explicit

Sub AccImport()
    Dim acc As New Access.Application
    acc.OpenCurrentDatabase "C:\Users\Public\Database1.accdb"
    acc.DoCmd.TransferSpreadsheet _
            TransferType:=acImport, _
            SpreadSheetType:=acSpreadsheetTypeExcel12Xml, _
            TableName:="tblExcelImport", _
            Filename:=Application.ActiveWorkbook.FullName, _
            HasFieldNames:=True, _
            Range:="Folio_Data_original$A1:B10"
    acc.CloseCurrentDatabase
    acc.Quit
    Set acc = Nothing
End Sub

BATCH LOAD - OK, so after having my previous reply deleted for just using links I have updated with the code I managed to get working. Appreciate anyone to simplify / correct / refine / put in function etc as I'm still learning this stuff, but I got batch member list add working :)

$apikey = "whatever-us99";                            
$list_id = "12ab34dc56";

$email1 = "[email protected]";
$fname1 = "Jack";
$lname1 = "Black";

$email2 = "[email protected]";
$fname2 = "Jill";
$lname2 = "Hill";

$auth = base64_encode( 'user:'.$apikey );

$data1 = array(
    "apikey"        => $apikey,
    "email_address" => $email1,
    "status"        => "subscribed",
    "merge_fields"  => array(                
            'FNAME' => $fname1,
            'LNAME' => $lname1,
    )
);

$data2 = array(
    "apikey"        => $apikey,
    "email_address" => $email2,
    "status"        => "subscribed",                
    "merge_fields"  => array(                
            'FNAME' => $fname2,
            'LNAME' => $lname2,
    )
);

$json_data1 = json_encode($data1);
$json_data2 = json_encode($data2);

$array = array(
    "operations" => array(
        array(
            "method" => "POST",
            "path" => "/lists/$list_id/members/",
            "body" => $json_data1
        ),
        array(
            "method" => "POST",
            "path" => "/lists/$list_id/members/",
            "body" => $json_data2
        )
    )
);

$json_post = json_encode($array);

$ch = curl_init();

$curlopt_url = "https://us99.api.mailchimp.com/3.0/batches";
curl_setopt($ch, CURLOPT_URL, $curlopt_url);

curl_setopt($ch, CURLOPT_HTTPHEADER, array('Content-Type: application/json',
'Authorization: Basic '.$auth));
curl_setopt($ch, CURLOPT_USERAGENT, 'PHP-MCAPI/3.0');
curl_setopt($ch, CURLOPT_RETURNTRANSFER, true);
curl_setopt($ch, CURLOPT_TIMEOUT, 10);
curl_setopt($ch, CURLOPT_POST, true);
curl_setopt($ch, CURLOPT_SSL_VERIFYPEER, false);
curl_setopt($ch, CURLOPT_POSTFIELDS, $json_post);

print_r($json_post . "\n");
$result = curl_exec($ch);

var_dump($result . "\n");
print_r ($result . "\n");

You can also do

if ($ie) {
    # Do Something if $ie is not null
}

Function Declaration

function foo() { ... }

Because of function hoisting, the function declared this way can be called both after and before the definition.

Function Expression

1. Named Function Expression

   var foo = function bar() { ... }
   

2. Anonymous Function Expression

   var foo = function() { ... }
   

foo() can be called only after creation.

Immediately-Invoked Function Expression (IIFE)

(function() { ... }());

Conclusion

Crockford recommends to use function expression because it makes it clear that foo is a variable containing a function value. Well, personally, I prefer to use Declaration unless there is a reason for Expression.

if you want to change only the colour of the flag on hover use this:

http://jsfiddle.net/uvamhedx/

.fa-flag:hover {_x000D_
    color: red;_x000D_
}

<link href="https://maxcdn.bootstrapcdn.com/font-awesome/4.7.0/css/font-awesome.min.css" rel="stylesheet"/>_x000D_
_x000D_
<i class="fa fa-flag fa-3x"></i>

A short solution:

use Dotenv;

with(new Dotenv(app()->environmentPath(), app()->environmentFile()))->overload();
with(new LoadConfiguration())->bootstrap(app());

In my case I needed to re-establish database connection after altering .env programmatically, but it didn't work , If you get into this trouble try this

app('db')->purge($connection->getName()); 

after reloading .env , that's because Laravel App could have accessed the default connection before and the \Illuminate\Database\DatabaseManager needs to re-read config parameters.

There is two way :

1) Using Glide library This is best way to load image from url because when you try to display same url in second time it will display from catch so improve app performance

Glide.with(context).load("YourUrl").into(imageView);

dependency : implementation 'com.github.bumptech.glide:glide:4.10.0'

2) Using Stream. Here you want to create bitmap from url image

URL url = new URL("YourUrl");
Bitmap bitmap = BitmapFactory.decodeStream(url.openConnection().getInputStream());
imageView.setImageBitmap(bitmap);

onProgressChanged() should be called on every progress changed, not just on first and last touch (that why you have onStartTrackingTouch() and onStopTrackingTouch() methods).

Make sure that your SeekBar have more than 1 value, that is to say your MAX>=3.

In your onCreate:

 yourSeekBar=(SeekBar) findViewById(R.id.yourSeekBar);
 yourSeekBar.setOnSeekBarChangeListener(new yourListener());

Your listener:

private class yourListener implements SeekBar.OnSeekBarChangeListener {

        public void onProgressChanged(SeekBar seekBar, int progress,
                boolean fromUser) {
                            // Log the progress
            Log.d("DEBUG", "Progress is: "+progress);
                            //set textView's text
            yourTextView.setText(""+progress);
        }

        public void onStartTrackingTouch(SeekBar seekBar) {}

        public void onStopTrackingTouch(SeekBar seekBar) {}

    }

Please share some code and the Log results for furter help.

I recently wrote a directive that supports native multiple file uploads. The solution I've created relies on a service to fill the gap you've identified with the $http service. I've also included a directive, which provides an easy API for your angular module to use to post the files and data.

Example usage:

<lvl-file-upload
    auto-upload='false'
    choose-file-button-text='Choose files'
    upload-file-button-text='Upload files'
    upload-url='http://localhost:3000/files'
    max-files='10'
    max-file-size-mb='5'
    get-additional-data='getData(files)'
    on-done='done(files, data)'
    on-progress='progress(percentDone)'
    on-error='error(files, type, msg)'/>

You can find the code on github, and the documentation on my blog

It would be up to you to process the files in your web framework, but the solution I've created provides the angular interface to getting the data to your server. The angular code you need to write is to respond to the upload events

angular
    .module('app', ['lvl.directives.fileupload'])
    .controller('ctl', ['$scope', function($scope) {
        $scope.done = function(files,data} { /*do something when the upload completes*/ };
        $scope.progress = function(percentDone) { /*do something when progress is reported*/ };
        $scope.error = function(file, type, msg) { /*do something if an error occurs*/ };
        $scope.getAdditionalData = function() { /* return additional data to be posted to the server*/ };

    });

adding to CMS's answer, this is a more generic approach of toggle_visibility I've just used myself:

function toggle_visibility(className,display) {
   var elements = getElementsByClassName(document, className),
       n = elements.length;
   for (var i = 0; i < n; i++) {
     var e = elements[i];

     if(display.length > 0) {
       e.style.display = display;
     } else {
       if(e.style.display == 'block') {
         e.style.display = 'none';
       } else {
         e.style.display = 'block';
       }
     }
  }
}

<html>
    <body>
        <input id="mycheck" type="checkbox">
    </body>

    <script language="javascript">
        var=check;
        document.getElementById("mycheck");
        check.checked="false";
    </script>
</html>

I had a slightly different situation, when both JDK and JRE 1.8.0_112 were present on my system.

I imported the new CA certificates into [JDK_FOLDER]\jre\lib\security\cacerts using the already known command:

keytool -import -trustcacerts -keystore cacerts -alias <new_ca_alias> -file <path_to_ca_cert_file>

Still, I kept getting the same PKIX path building failed error.

I added debug information to the java CLI, by using java -Djavax.net.debug=all ... > debug.log. In the debug.log file, the line that begins with trustStore is: actually pointed to the cacerts store found in [JRE_FOLDER]\lib\security\cacerts.

In my case the solution was to copy the cacerts file used by JDK (which had the new CAs added) over the one used by the JRE and that fixed the issue.

Try:

int[][] multD = new int[5][10];

Note that in your code only the first line of the 2D array is initialized to 0. Line 2 to 5 don't even exist. If you try to print them you'll get null for everyone of them.

I had this exact problem and this worked:

plt.savefig(output_dir + '/xyz.png', bbox_inches='tight')

Here is the documentation:

[https://matplotlib.org/3.1.1/api/_as_gen/matplotlib.pyplot.savefig.html][1]

With Spring boot , the spring.config.location does work,just provide comma separated properties files.

see the below code

@PropertySource(ignoreResourceNotFound=true,value="classpath:jdbc-${spring.profiles.active}.properties")
public class DBConfig{

     @Value("${jdbc.host}")
        private String jdbcHostName;
     }
}

one can put the default version of jdbc.properties inside application. The external versions can be set lie this.

java -jar target/myapp.jar --spring.config.location=classpath:file:///C:/Apps/springtest/jdbc.properties,classpath:file:///C:/Apps/springtest/jdbc-dev.properties

Based on profile value set using spring.profiles.active property, the value of jdbc.host will be picked up. So when (on windows)

set spring.profiles.active=dev

jdbc.host will take value from jdbc-dev.properties.

for

set spring.profiles.active=default

jdbc.host will take value from jdbc.properties.

Now require-dev is enabled by default, for local development you can do composer install and composer update without the --dev option.

When you want to deploy to production, you'll need to make sure composer.lock doesn't have any packages that came from require-dev.

You can do this with

composer update --no-dev

Once you've tested locally with --no-dev you can deploy everything to production and install based on the composer.lock. You need the --no-dev option again here, otherwise composer will say "The lock file does not contain require-dev information".

composer install --no-dev

Note: Be careful with anything that has the potential to introduce differences between dev and production! I generally try to avoid require-dev wherever possible, as including dev tools isn't a big overhead.

That watermark in the bottom right only appears on mouseover. There's no parameter to remove that, however if you stack a transparent div on top of the video and make it a higher z-index and the same size of the video, your mouseover will not trigger the watermark because your mouse will be hitting the div.

Of course the tradeoff for this is that you lose the ability to actually click on the video to pause it. But if you want to leave the ability to pause it, you could display the controls and have the top layer div cover up until the bottom 30 pixels or so, letting you click the controls.

You set an element's id by setting its corresponding property:

myPara.id = ID;

Go to: Settings > Preferences > Backup > and Uncheck Remember current session for next launch

In older versions (6.5-), this option is located on Settings > Preferences > MISC.

Instead of using IN clause, can you try using JOIN with the other table, which is fetching the id. that way we don't need to worry about limit. just a thought from my side.

Here's a very simple use case and has nothing to do with thread safety.

To share an object between lambda invocations, the AtomicReference is an option:

public void doSomethingUsingLambdas() {

    AtomicReference<YourObject> yourObjectRef = new AtomicReference<>();

    soSomethingThatTakesALambda(() -> {
        yourObjectRef.set(youObject);
    });

    soSomethingElseThatTakesALambda(() -> {
        YourObject yourObject = yourObjectRef.get();
    });
}

I'm not saying this is good design or anything (it's just a trivial example), but if you have have the case where you need to share an object between lambda invocations, the AtomicReference is an option.

In fact you can use any object that holds a reference, even a Collection that has only one item. However, the AtomicReference is a perfect fit.

Another option using linq is

[TestMethod]
public void Test()
{
  var input = "it's worth a lot of money, if you can find a buyer.";
  var expected = "its worth a lot of money if you can find a buyer";
  var removeList = new string[] { ".", ",", "'" };
  var result = input;

  removeList.ToList().ForEach(o => result = result.Replace(o, string.Empty));

  Assert.AreEqual(expected, result);
}

for this, I have noticed that it far better to show and hide the tags instead of adding and removing them for the DOM. It performs better that way.

Meanwhile I have found the (for me) perfect solution: nexe, which creates a single executable from a Node.js application including all of its modules.

It's the next best thing to an ideal solution.

In case of Include Program will not terminate and display warning on browser,On the other hand Require program will terminate and display fatal error in case of file not found.

Am I missing something?

Doesn't this hypothetical code

while(rowIndex >= dataColLinker.size()) {
    dataColLinker.add(value);
} else {
    dataColLinker.set(rowIndex, value);
}

mean the same thing as this?

while(rowIndex >= dataColLinker.size()) {
    dataColLinker.add(value);
}
dataColLinker.set(rowIndex, value);

or this?

if (rowIndex >= dataColLinker.size()) {
    do {
        dataColLinker.add(value);
    } while(rowIndex >= dataColLinker.size());
} else {
    dataColLinker.set(rowIndex, value);
}

(The latter makes more sense ... I guess). Either way, it is obvious that you can rewrite the loop so that the "else test" is not repeated inside the loop ... as I have just done.

FWIW, this is most likely a case of premature optimization. That is, you are probably wasting your time optimizing code that doesn't need to be optimized:

• For all you know, the JIT compiler's optimizer may have already moved the code around so that the "else" part is no longer in the loop.

• Even if it hasn't, the chances are that the particular thing you are trying to optimize is not a significant bottleneck ... even if it might be executed 600,000 times.

My advice is to forget this problem for now. Get the program working. When it is working, decide if it runs fast enough. If it doesn't then profile it, and use the profiler output to decide where it is worth spending your time optimizing.

Hhere is what what I did to fix it:

Prerequisite

• Make sure JDK is installed (Not JRE).
• Make sure Oracle is installed

After

1. Open the file ..\sqldeveloper\sqldeveloper\bin\sqldevloper.conf and add the following line to set jdk path:

   SetJavaHome C:\Program Files\Oracle\11g\product\11.1.0\client_1\jdk

   If it dont allow you to save the file, copy whole sqldeveloper folder to a different location where you have write access to modify this file.

2. Run sqldeveloper.exe (from the new place if you moved the folder out from oracle folders) as administrator and enter the jdk path that comes with your oracle installation: e.g. C:\Program Files\Oracle\11g\product\11.1.0\client_1\jdk\bin

Since nobody has mentioned it, I'd like to add that Facebook chat is written in Erlang.

For MySQL Workbench 6.1: in the home window click on the server instance(connection)/ or create a new one. In the thus opened 'connection' tab click on 'server' -> 'data import'. The rest of the steps remain as in Vishy's answer.

I figured out that this behaves like a mousedown event:

button:active:hover {}

Using TextEncoder and TextDecoder

var uint8array = new TextEncoder("utf-8").encode("Plain Text");
var string = new TextDecoder().decode(uint8array);
console.log(uint8array ,string )

A colleague of mine recommends trapping the CurrentCellDirtyStateChanged event. See http://msdn.microsoft.com/en-us/library/system.windows.forms.datagridview.currentcelldirtystatechanged.aspx.

I think the code is something like:

int rgb = red;
rgb = (rgb << 8) + green;
rgb = (rgb << 8) + blue;

Also, I believe you can get the individual values using:

int red = (rgb >> 16) & 0xFF;
int green = (rgb >> 8) & 0xFF;
int blue = rgb & 0xFF;

You can try using FormulaLocal property instead of Formula. Then the semicolon should work.

If using JDK 9 +, use Objects.requireNonNullElse(T obj, T defaultObj)

EDIT: I tried using a CTE on my previous answer which was incorrect, as pointed out by @bummi. This option should work instead:

Here's one option using a CROSS APPLY, to kind of work around this problem:

SELECT st.Value, Constants.CONSTANT_ONE, Constants.CONSTANT_TWO
FROM SomeTable st
CROSS APPLY (
    SELECT 'Value1' AS CONSTANT_ONE,
           'Value2' AS CONSTANT_TWO
) Constants

mongo => mongo-db console
mongodb => mongo-db server

If you're on Mac and looking for a easier way to start/stop your mongo-db server, then MongoDB Preference Pane is something that you should look into. With it, you start/stop your mongo-db instance via UI. Hope it helps!

"Windows could not start the Apache Tomcat 6 on Local Computer. For more information, review the System Event Log. If this is a non-Microsoft service, contact the service vendor, and refer to service-specific error code 0"

When an error of this sort come. please go to start -> configure tomcat -> startup -> Mode -> java similarly start -> configure tomcat -> shutdown -> Mode -> java

First, the network name is likely "Ethernet", not "Local Area Connection". To find out the name you can do this:

netsh interface show interface

Which will show the name under the "Interface Name" column (shown here in bold):

Admin State    State          Type             Interface Name
-------------------------------------------------------------------------
Enabled        Connected      Dedicated        Ethernet

Now you can change the primary dns (index=1), assuming that your interface is static (not using dhcp):

netsh interface ipv4 add dnsserver "Ethernet" address=192.168.x.x index=1

2018 Update - The command will work with either dnsserver (singular) or dnsservers (plural). The following example uses the latter and is valid as well:

netsh interface ipv4 add dnsservers "Ethernet" address=192.168.x.x index=1

I was getting the same error, found out it was due to some of the dependencies missing in my pom.xml like that of Spring JPA, Hibernate, Mysql or maybe Jackson. So make sure that dependencies are not missing in your pom.xml and check their version compatibility.

<!-- Jpa and hibernate -->
<dependency>
    <groupId>org.springframework</groupId>
    <artifactId>spring-orm</artifactId>
    <version>4.2.2.RELEASE</version>
</dependency>
<dependency>
    <groupId>org.hibernate</groupId>
    <artifactId>hibernate-entitymanager</artifactId>
    <version>5.0.3.Final</version>
</dependency>
<dependency>
    <groupId>mysql</groupId>
    <artifactId>mysql-connector-java</artifactId>
    <version>5.1.6</version>
</dependency>

For Redmi and Mi devices turn off MIUI Optimization

Settings > Additional Settings > Developer Options > MIUI Optimization

try this

if (ContextCompat.checkSelfPermission(this, Manifest.permission.ACCESS_FINE_LOCATION)
                == PackageManager.PERMISSION_GRANTED) {
    mMap.setMyLocationEnabled(true);
} else {
    // Show rationale and request permission.
}

I found slightly different problem running R on through mac terminal, but connecting remotely to an Ubuntu server, which prevented me from successfully installing a library.

The solution I have was finding out what "LANG" variable is used in Ubuntu terminal

Ubuntu > echo $LANG
en_US.TUF-8

I got "en_US.TUF-8" reply from Ubuntu.

In R session, however, I got "UTF-8" as the default value and it complained that LC_TYPEC Setting LC_CTYPE failed, using "C"

R> Sys.getenv("LANG")
"UTF-8"

So, I tried to change this variable in R. It worked.

R> Sys.setenv(LANG="en_US.UTF-8")

The real question to ask is, is there any reason to use any layout other than a constraint layout? I believe the answer might be no.

To those insisting they are aimed at novice programmers or the like, they should provide some reason for them to be inferior to any other layout.

Constraints layouts are better in every way (They do cost like 150k in APK size.). They are faster, they are easier, they are more flexible, they react better to changes, they fix the problems when items go away, they conform better to radically different screen types and they don't use a bunch of nested loop with that long drawn out tree structure for everything. You can put anything anywhere, with respect to anything, anywhere.

They were a bit screwy back in mid 2016, where the visual layout editor just wasn't good enough, but they are to the point that if you are having a layout at all, you might want to seriously consider using a constraint layout, even when it does the same thing as a RelativeLayout, or even a simple LinearLayout. FrameLayouts clearly still have their purpose. But, I can't see building anything else at this point. If they started with this they wouldn't have added anything else.

Redirecting stderr to stdout seems to also do the trick without any other commands/scriptblock wrappers although I can't find an explanation why it works that way..

# test.ps1

$ErrorActionPreference = "Stop"

aws s3 ls s3://xxx
echo "==> pass"

aws s3 ls s3://xxx 2>&1
echo "shouldn't be here"

This will output the following as expected (the command aws s3 ... returns $LASTEXITCODE = 255)

PS> .\test.ps1

An error occurred (AccessDenied) when calling the ListObjectsV2 operation: Access Denied
==> pass

Also, what helped me understand this particular scenario that you described is the Promise API documentation, specifically where it explains how the promised returned by the then method will be resolved differently depending on what the handler fn returns:

if the handler function:

• returns a value, the promise returned by then gets resolved with the returned value as its value;
• throws an error, the promise returned by then gets rejected with the thrown error as its value;
• returns an already resolved promise, the promise returned by then gets resolved with that promise's value as its value;
• returns an already rejected promise, the promise returned by then gets rejected with that promise's value as its value.
• returns another pending promise object, the resolution/rejection of the promise returned by then will be subsequent to the resolution/rejection of the promise returned by the handler. Also, the value of the promise returned by then will be the same as the value of the promise returned by the handler.

Try this:

    list.setOnItemSelectedListener(new OnItemSelectedListener() {

    @Override
    public void onItemSelected(AdapterView<?> arg0, View arg1,
            int arg2, long arg3)
    }

    @Override
    public void onNothingSelected(AdapterView<?> arg0) {

    }
});

It's pretty easy.

At the first there is a deprecated arguments.callee — a reference to called function. At the second if you have a reference to your function you can easily get their textual representation. At the third if you calling your function as constructor you can also have a link via yourObject.constructor. NB: The first solution deprecated so if you can't to not use it you must also think about your app architecture. If you don't need exact variable names just use inside a function internal variable arguments without any magic.

https://developer.mozilla.org/en-US/docs/JavaScript/Reference/Functions_and_function_scope/arguments/callee

All of them going to call toString and replace with re so we can create a helper:

// getting names of declared parameters
var getFunctionParams = function (func) {
    return String(func).replace(/[^\(]+\(([^\)]*)\).*/m, '$1');
}

Some examples:

// Solution 1. deprecated! don't use it!
var myPrivateFunction = function SomeFuncName (foo, bar, buz) {
    console.log(getFunctionParams(arguments.callee));
};
myPrivateFunction (1, 2);

// Solution 2.
var myFunction = function someFunc (foo, bar, buz) {
    // some code
};
var params = getFunctionParams(myFunction);
console.log(params);

// Solution 3.
var cls = function SuperKewlClass (foo, bar, buz) {
    // some code
};
var inst = new cls();
var params = getFunctionParams(inst.constructor);
console.log(params);

Enjoy with JS!

UPD: Jack Allan was provided a little bit better solution actually. GJ Jack!

For Mono(Droid) solutions:

decimal decimalValue = decimal.Parse(input.Text.Replace(",", ".") , CultureInfo.InvariantCulture);

what you are trying to do is more a segmentedbutton than an imagebutton list.

here http://blog.bookworm.at/2010/10/segmented-controls-in-android.html is an example on how to do so. The basic idea is to customize RadioButton instead of ImageButton, since the RadioButton will have the checked state you need

The best way to make the header full screen is set height to be 100vh

#header{
height: 100vh;
}

You can specify a default value for the optional argument with something that would never passed to the function and check it with the is operator:

class _NO_DEFAULT:
    def __repr__(self):return "<no default>"
_NO_DEFAULT = _NO_DEFAULT()

def func(optional= _NO_DEFAULT):
    if optional is _NO_DEFAULT:
        print("the optional argument was not passed")
    else:
        print("the optional argument was:",optional)

then as long as you do not do func(_NO_DEFAULT) you can be accurately detect whether the argument was passed or not, and unlike the accepted answer you don't have to worry about side effects of ** notation:

# these two work the same as using **
func()
func(optional=1)

# the optional argument can be positional or keyword unlike using **
func(1) 

#this correctly raises an error where as it would need to be explicitly checked when using **
func(invalid_arg=7)

In Python3.6, the StringIO and cStringIO modules are gone, you should use io.StringIO instead.So you should do this like the first answer:

import sys
from io import StringIO

old_stdout = sys.stdout
old_stderr = sys.stderr
my_stdout = sys.stdout = StringIO()
my_stderr = sys.stderr = StringIO()

# blah blah lots of code ...

sys.stdout = self.old_stdout
sys.stderr = self.old_stderr

// if you want to see the value of redirect output, be sure the std output is turn back
print(my_stdout.getvalue())
print(my_stderr.getvalue())

my_stdout.close()
my_stderr.close()

Using Postman for Chrome, selecting CODE you get this... And works

<?php_x000D_
_x000D_
$curl = curl_init();_x000D_
_x000D_
curl_setopt_array($curl, array(_x000D_
  CURLOPT_URL => "https://blablabla.com/comorl",_x000D_
  CURLOPT_RETURNTRANSFER => true,_x000D_
  CURLOPT_ENCODING => "",_x000D_
  CURLOPT_MAXREDIRS => 10,_x000D_
  CURLOPT_TIMEOUT => 30,_x000D_
  CURLOPT_HTTP_VERSION => CURL_HTTP_VERSION_1_1,_x000D_
  CURLOPT_CUSTOMREQUEST => "PUT",_x000D_
  CURLOPT_POSTFIELDS => "{\n  \"customer\" : \"con\",\n  \"customerID\" : \"5108\",\n  \"customerEmail\" : \"[email protected]\",\n  \"Phone\" : \"34600000000\",\n  \"Active\" : false,\n  \"AudioWelcome\" : \"https://audio.com/welcome-defecto-es.mp3\"\n\n}",_x000D_
  CURLOPT_HTTPHEADER => array(_x000D_
    "cache-control: no-cache",_x000D_
    "content-type: application/json",_x000D_
    "x-api-key: whateveriyouneedinyourheader"_x000D_
  ),_x000D_
));_x000D_
_x000D_
$response = curl_exec($curl);_x000D_
$err = curl_error($curl);_x000D_
_x000D_
curl_close($curl);_x000D_
_x000D_
if ($err) {_x000D_
  echo "cURL Error #:" . $err;_x000D_
} else {_x000D_
  echo $response;_x000D_
}_x000D_
_x000D_
?>

creates a list of entries for each value, where the values are sorted
requires Java 8 or above

Map<Double,List<Entry<String,Double>>> sorted =
map.entrySet().stream().collect( Collectors.groupingBy( Entry::getValue, TreeMap::new,
    Collectors.mapping( Function.identity(), Collectors.toList() ) ) );

using the map {[A=99.5], [B=67.4], [C=67.4], [D=67.3]}
gets {67.3=[D=67.3], 67.4=[B=67.4, C=67.4], 99.5=[A=99.5]}

…and how to access each entry one after the other:

sorted.entrySet().forEach( e -> e.getValue().forEach( l -> System.out.println( l ) ) );

D=67.3 B=67.4 C=67.4 A=99.5

Use this function from stringi package

stri_trans_totitle(c("zip code", "state", "final count"))
## [1] "Zip Code"      "State"       "Final Count" 

stri_trans_totitle("i like pizza very much")
## [1] "I Like Pizza Very Much"

Its quite simple. Try this instead:

let myReferenceDiv = document.getElementById('mydiv');
let prev = myReferenceDiv.previousElementSibling;
let next = myReferenceDiv.nextElementSibling;

I accomplish this with a VisualBrush and some triggers in a Style suggested by :sellmeadog.

<TextBox>
        <TextBox.Style>
            <Style TargetType="TextBox" xmlns:sys="clr-namespace:System;assembly=mscorlib">
                <Style.Resources>
                    <VisualBrush x:Key="CueBannerBrush" AlignmentX="Left" AlignmentY="Center" Stretch="None">
                        <VisualBrush.Visual>
                            <Label Content="Search" Foreground="LightGray" />
                        </VisualBrush.Visual>
                    </VisualBrush>
                </Style.Resources>
                <Style.Triggers>
                    <Trigger Property="Text" Value="{x:Static sys:String.Empty}">
                        <Setter Property="Background" Value="{StaticResource CueBannerBrush}" />
                    </Trigger>
                    <Trigger Property="Text" Value="{x:Null}">
                        <Setter Property="Background" Value="{StaticResource CueBannerBrush}" />
                    </Trigger>
                    <Trigger Property="IsKeyboardFocused" Value="True">
                        <Setter Property="Background" Value="White" />
                    </Trigger>
                </Style.Triggers>
            </Style>
        </TextBox.Style>
    </TextBox>

@sellmeadog :Application running, bt Design not loading...the following Error comes: Ambiguous type reference. A type named 'StaticExtension' occurs in at least two namespaces, 'MS.Internal.Metadata.ExposedTypes.Xaml' and 'System.Windows.Markup'. Consider adjusting the assembly XmlnsDefinition attributes. 'm using .net 3.5

The difference between "" and () is:

With "" you are not calling anything.
With () you are calling a sub.

Example with sub:

Sub = MsgBox("Msg",vbYesNo,vbCritical,"Title")
Select Case Sub
     Case = vbYes
          MsgBox"You said yes"
     Case = vbNo
          MsgBox"You said no"
 End Select

vs Normal:

 MsgBox"This is normal"

this should work

 .navbar-nav {
    position: absolute;
    left: 50%;
    transform: translatex(-50%);
}

The HTTP server doesn't send the response header back to the client until you either specify an error or else you start sending data. If you start sending data back to the client, then the server has to send the response head (which contains the status code) first. Once the header has been sent, you can no longer put a status code in the header, obviously.

Here's the usual problem. You start up the page, and send some initial tags (i.e. <head>). The server then sends those tags to the client, after first sending the HTTP response header with an assumed SUCCESS status. Now you start working on the meat of the page and discover a problem. You can not send an error at this point because the response header, which would contain the error status, has already been sent.

The solution is this: Before you generate any content at all, check if there are going to be any errors. Only then, when you have assured that there will be no problems, can you then start sending content, like the tag.

In your case, it seems like you have a login page that processes a POST request from a form. You probably throw out some initial HTML, then check if the username and password are valid. Instead, you should authenticate the user/password first, before you generate any HTML at all.

https://github.com/pypa/pip/raw/master/contrib/get-pip.py is probably the right way now.

I suggest you try JMapper Framework.

It is a Java bean to Java bean mapper, allows you to perform the passage of data dynamically with annotations and / or XML.

With JMapper you can:

• Create and enrich target objects
• Apply a specific logic to the mapping
• Automatically manage the XML file
• Implement the 1 to N and N to 1 relationships
• Implement explicit conversions
• Apply inherited configurations

After many painful experiences with Struts, Tapestry 3/4, JSF, JBoss Seam, GWT I will stick with Wicket for now. Wicket Bench for Eclipse is handy but not 100% complete, still useful though. MyEclipse plugin for deploying to Tomcat is ace. No Maven just deploy once, changes are automatically copied to Tomcat. Magic.

My suggestion: Wicket 1.4, MyEclipse, Subclipse, Wicket Bench, Tomcat 6. It will take an hour or so to setup but most of that will be downloading tomcat and the Eclipse plugins.

Hint: Don't use the Wicket Bench libs, manually install Wicket 1.4 libs into project.

This site took me about 2 hours to write http://ratearear.co.uk - don't go there from work!! And this one is about 3 days work http://tnwdb.com

Good luck. Tim

The problem is that there is no class called com.service.SempediaSearchManager on your webapp's classpath. The most likely root causes are:

• the fully qualified classname is incorrect in /WEB-INF/Sempedia-service.xml; i.e. the class name is something else,

• the class is not in your webapp's /WEB-INF/classes directory tree or a JAR file in the /WEB-INF/lib directory.

EDIT : The only other thing that I can think of is that the ClassDefNotFoundException may actually be a result of an earlier class loading / static initialization problem. Check your log files for the first stack trace, and look the nested exceptions, i.e. the "caused by" chain. [If a class load fails one time and you or Spring call Class.forName() again for some reason, then Java won't actually try to load a second time. Instead you will get a ClassDefNotFoundException stack trace that does not explain the real cause of the original failure.]

If you are still stumped, you should take Eclipse out of the picture. Create the WAR file in the form that you are eventually going to deploy it, then from the command line:

1. manually shutdown Tomcat

2. clean out your Tomcat webapp directory,

3. copy the WAR file into the webapp directory,

4. start Tomcat.

If that doesn't solve the problem directly, look at the deployed webapp directory on Tomcat to verify that the "missing" class is in the right place.

Instance variable is the variable declared inside a class, but outside a method: something like:

class IronMan {

    /** These are all instance variables **/
    public String realName;
    public String[] superPowers;
    public int age;

    /** Getters and setters here **/
}

Now this IronMan Class can be instantiated in another class to use these variables. Something like:

class Avengers {

    public static void main(String[] a) {
        IronMan ironman = new IronMan();
        ironman.realName = "Tony Stark";
        // or
        ironman.setAge(30);
    }

}

This is how we use the instance variables. Shameless plug: This example was pulled from this free e-book here here.

To quote section 2.3 of RFC 3986:

Characters that are allowed in a URI, but do not have a reserved purpose, are called unreserved. These include uppercase and lowercase letters, decimal digits, hyphen, period, underscore, and tilde.

  ALPHA  DIGIT  "-" / "." / "_" / "~"

Note that RFC 3986 lists fewer reserved punctuation marks than the older RFC 2396.

For me it worked a simple sudo pip -I install <package>.

As man pip states, -I ignores installed packages, forcing reinstall instead.

You could do something like this:

i={'foo':'bar', 'baz':'huh?'}
keys=i.keys()  #in python 3, you'll need `list(i.keys())`
values=i.values()
print keys[values.index("bar")]  #'foo'

However, any time you change your dictionary, you'll need to update your keys,values because dictionaries are not ordered in versions of Python prior to 3.7. In these versions, any time you insert a new key/value pair, the order you thought you had goes away and is replaced by a new (more or less random) order. Therefore, asking for the index in a dictionary doesn't make sense.

As of Python 3.6, for the CPython implementation of Python, dictionaries remember the order of items inserted. As of Python 3.7+ dictionaries are ordered by order of insertion.

Also note that what you're asking is probably not what you actually want. There is no guarantee that the inverse mapping in a dictionary is unique. In other words, you could have the following dictionary:

d={'i':1, 'j':1}

In that case, it is impossible to know whether you want i or j and in fact no answer here will be able to tell you which ('i' or 'j') will be picked (again, because dictionaries are unordered). What do you want to happen in that situation? You could get a list of acceptable keys ... but I'm guessing your fundamental understanding of dictionaries isn't quite right.

I am using Chrome version 75.

add the muted property to video tag

<video id="myvid" muted>

then play it using javascript and set muted to false

var myvideo = document.getElementById("myvid");
myvideo.play();
myvideo.muted = false;

edit: need user interaction (at least click anywhere in the page to work)

About performance:

public static void main(String[] args) throws Exception {      
  long start = System.currentTimeMillis();
  for(int i = 0; i < 1000000; i++){
    String s = "Hi " + i + "; Hi to you " + i*2;
  }
  long end = System.currentTimeMillis();
  System.out.println("Concatenation = " + ((end - start)) + " millisecond") ;

  start = System.currentTimeMillis();
  for(int i = 0; i < 1000000; i++){
    String s = String.format("Hi %s; Hi to you %s",i, + i*2);
  }
  end = System.currentTimeMillis();
  System.out.println("Format = " + ((end - start)) + " millisecond");
}

The timing results are as follows:

• Concatenation = 265 millisecond
• Format = 4141 millisecond

Therefore, concatenation is much faster than String.format.

Another example to output date and time using zero as a fill character on instances of single digit values: 2017-06-04 18:13:02

#include "stdafx.h"
#include <iostream>
#include <iomanip>
#include <ctime>
using namespace std;

int main()
{
    time_t t = time(0);   // Get time now
    struct tm * now = localtime(&t);
    cout.fill('0');
    cout << (now->tm_year + 1900) << '-'
        << setw(2) << (now->tm_mon + 1) << '-'
        << setw(2) << now->tm_mday << ' '
        << setw(2) << now->tm_hour << ':'
        << setw(2) << now->tm_min << ':'
        << setw(2) << now->tm_sec
        << endl;
    return 0;
}

List<String> arrayList = new ArrayList<String>();
for (String s : arrayList) {
    if(s.equals(value)){
        //do something
    }
}

or

for (int i = 0; i < arrayList.size(); i++) {
    if(arrayList.get(i).equals(value)){
        //do something
    }
}

But be carefull ArrayList can hold null values. So comparation should be

value.equals(arrayList.get(i))

when you are sure that value is not null or you should check if given element is null.

You just need to use the shape: CircleBorder()

MaterialButton(
  onPressed: () {},
  color: Colors.blue,
  textColor: Colors.white,
  child: Icon(
    Icons.camera_alt,
    size: 24,
  ),
  padding: EdgeInsets.all(16),
  shape: CircleBorder(),
)

I noticed that I get this error when I'm working on a new computer if I try to build from the command line first. However, if I build from Android Studio, it retrieves the SDK and creates the directory automatically. Then when I build from the command line it works.

find:

^>([^\n\r]+)[\n\r]([A-Z\n\r]+)

\1 = some_varying_text

\2 = lines of all CAPS

Edit (proof that this works):

text = """> some_Varying_TEXT

DSJFKDAFJKDAFJDSAKFJADSFLKDLAFKDSAF
GATACAACATAGGATACA
GGGGGAAAAAAAATTTTTTTTT
CCCCAAAA

> some_Varying_TEXT2

DJASDFHKJFHKSDHF
HHASGDFTERYTERE
GAGAGAGAGAG
PPPPPAAAAAAAAAAAAAAAP
"""

import re

regex = re.compile(r'^>([^\n\r]+)[\n\r]([A-Z\n\r]+)', re.MULTILINE)
matches = [m.groups() for m in regex.finditer(text)]

for m in matches:
    print 'Name: %s\nSequence:%s' % (m[0], m[1])

/**
 * Checks display and visibility of elements and it's parents
 * @param  DomElement  el
 * @param  boolean isDeep Watch parents? Default is true
 * @return {Boolean}
 *
 * @author Oleksandr Knyga <[email protected]>
 */
function isVisible(el, isDeep) {
    var elIsVisible = true;

    if("undefined" === typeof isDeep) {
        isDeep = true;
    }

    elIsVisible = elIsVisible && el.offsetWidth > 0 && el.offsetHeight > 0;

    if(isDeep && elIsVisible) {

        while('BODY' != el.tagName && elIsVisible) {
            elIsVisible = elIsVisible && 'hidden' != window.getComputedStyle(el).visibility;
            el = el.parentElement;
        }
    }

    return elIsVisible;
}

INSERT INTO wp_bp_activity
            (
            user_id,
             component,
             `type`,
             `action`,
             content,
             primary_link,
             item_id,
             secondary_item_id,
             date_recorded,
             hide_sitewide,
             mptt_left,
             mptt_right
             )
             VALUES(
             1,'activity','activity_update','<a title="admin" href="http://brandnewmusicreleases.com/social-network/members/admin/">admin</a> posted an update','<a title="242925_1" href="http://brandnewmusicreleases.com/social-network/wp-content/uploads/242925_1.jpg" class="buddyboss-pics-picture-link">242925_1</a>','http://brandnewmusicreleases.com/social-network/members/admin/',' ',' ','2012-06-22 12:39:07',0,0,0
             )

For $ Your Ruby version is 2.3.0, but your Gemfile specified 2.4.1. Changed 2.4.1 in Gemfile to 2.3.0

Try adding WorksheetFunction:

If Not IsError(Application.WorksheetFunction.Match(ValueToSearchFor, RangeToSearchIn, 0)) Then
' String is in range

Add new column to Table

ALTER TABLE [table]
ADD Column1 Datatype

E.g

ALTER TABLE [test]
ADD ID Int

If User wants to make it auto incremented then

ALTER TABLE [test]
ADD ID Int IDENTITY(1,1) NOT NULL

Returning null could be more efficient, as no new object is created. However, it would also often require a null check (or exception handling.)

Semantically, null and an empty list do not mean the same thing. The differences are subtle and one choice may be better than the other in specific instances.

Regardless of your choice, document it to avoid confusion.

Depending on what you are doing, system() or popen() may be perfect. Use system() if the Python script has no output, or if you want the Python script's output to go directly to the browser. Use popen() if you want to write data to the Python script's standard input, or read data from the Python script's standard output in php. popen() will only let you read or write, but not both. If you want both, check out proc_open(), but with two way communication between programs you need to be careful to avoid deadlocks, where each program is waiting for the other to do something.

If you want to pass user supplied data to the Python script, then the big thing to be careful about is command injection. If you aren't careful, your user could send you data like "; evilcommand ;" and make your program execute arbitrary commands against your will.

escapeshellarg() and escapeshellcmd() can help with this, but personally I like to remove everything that isn't a known good character, using something like

preg_replace('/[^a-zA-Z0-9]/', '', $str)

Simply create a fallback to '' if the this.state.name is null.

<input name="name" type="text" value={this.state.name || ''} onChange={this.onFieldChange('name').bind(this)}/>

This also works with the useState variables.

The following transact SQL script works for all languages (international). The solution is not to check for alphanumeric but to check for not containing special characters.

DECLARE @teststring nvarchar(max)
SET @teststring = 'Test''Me'
SELECT 'IS ALPHANUMERIC: ' + @teststring
WHERE @teststring NOT LIKE '%[-!#%&+,./:;<=>@`{|}~"()*\\\_\^\?\[\]\'']%' {ESCAPE '\'}

require section This section contains the packages/dependencies which are better candidates to be installed/required in the production environment.

require-dev section: This section contains the packages/dependencies which can be used by the developer to test her code (or to experiment on her local machine and she doesn't want these packages to be installed on the production environment).

I got this error when I was trying to access Bundle data from One Intent by using getInt("ID").

I solved it by using getString("ID").

From Activity1 i had

Intent intent=new Intent(this,ActivityB.class);
intent.putExtra("data",data)// 
startActivity(intent);

On Activity B,

Bundle bundle=getIntent().getExtras();
if(extras!=null){
// int x=extras.getInt("Data"); This Line gave me error int 
x=Integer.parseInt(extras.getString("Data")); // This solved the problem.
}

Sometimes gradlew clean or Invalidate Cache and Restart does not help, because these methods do not clean Android Studio specific files by themselves.

In this case, close AS and remove .idea directory and .iml file in a root project where settings.gradle file exists. This will make AS rebuild from the fresh ground.

This other solution for covert datetime to unixtimestampmillis C#.

private static readonly DateTime UnixEpoch = new DateTime(1970, 1, 1, 0, 0, 0, DateTimeKind.Utc);

public static long GetCurrentUnixTimestampMillis()
{
    DateTime localDateTime, univDateTime;
    localDateTime = DateTime.Now;          
    univDateTime = localDateTime.ToUniversalTime();
    return (long)(univDateTime - UnixEpoch).TotalMilliseconds;
} 

In my case there was a /etc/sysconfig/tomcat5.conf file overwriting all settings in /etc/tomcat5/tomcat5.conf

Yes you can. You can even test it:

var i = 0;_x000D_
var timer = setInterval(function() {_x000D_
  console.log(++i);_x000D_
  if (i === 5) clearInterval(timer);_x000D_
  console.log('post-interval'); //this will still run after clearing_x000D_
}, 200);

In this example, this timer clears when i reaches 5.

The other answers require the response body to be downloaded. But there's a way to make a POST request that will only fetch the header:

curl -s -I -X POST http://www.google.com

An -I by itself performs a HEAD request which can be overridden by -X POST to perform a POST (or any other) request and still only get the header data.

This solution belongs to the previous version of MySQL. By logging in to MySQL using socket authentication, you can do it.

sudo mysql -u root

Then the following command could be run.

ALTER USER 'root'@'localhost' IDENTIFIED WITH mysql_native_password BY 'password';

Details are available here .

Timer

As mentioned on the javadocs you are better off using a ScheduledThreadPoolExecutor.

ScheduledThreadPoolExecutor

Use this class when your use case requires multiple worker threads and the sleep interval is small. How small ? Well, I'd say about 15 minutes. The AlarmManager starts schedule intervals at this time and it seems to suggest that for smaller sleep intervals this class can be used. I do not have data to back the last statement. It is a hunch.

Service

Your service can be closed any time by the VM. Do not use services for recurring tasks. A recurring task can start a service, which is another matter entirely.

BroadcastReciever with AlarmManager

For longer sleep intervals (>15 minutes), this is the way to go. AlarmManager already has constants ( AlarmManager.INTERVAL_DAY ) suggesting that it can trigger tasks several days after it has initially been scheduled. It can also wake up the CPU to run your code.

You should use one of those solutions based on your timing and worker thread needs.

The output of this query is very clean (original here)

clear screen
accept uname prompt 'Enter User Name : '
accept outfile prompt  ' Output filename : '

spool &&outfile..gen

SET LONG 20000 LONGCHUNKSIZE 20000 PAGESIZE 0 LINESIZE 1000 FEEDBACK OFF VERIFY OFF TRIMSPOOL ON

BEGIN
   DBMS_METADATA.set_transform_param (DBMS_METADATA.session_transform, 'SQLTERMINATOR', true);
   DBMS_METADATA.set_transform_param (DBMS_METADATA.session_transform, 'PRETTY', true);
END;
/

SELECT dbms_metadata.get_ddl('USER','&&uname') FROM dual;
SELECT DBMS_METADATA.GET_GRANTED_DDL('SYSTEM_GRANT','&&uname') from dual;
SELECT DBMS_METADATA.GET_GRANTED_DDL('ROLE_GRANT','&&uname') from dual;
SELECT DBMS_METADATA.GET_GRANTED_DDL('OBJECT_GRANT','&&uname') from dual;

spool off

its awful oracle installer:

[INS-13001]

I got it as I used MY_PC as NETBIOS name instead of MYPC (Underscore is bad for it..)

Can be an historical reason.. but message is obscure.

don't forget all the pleasure that occur with the shell limitation around " and '

so (in ksh)

Var=">New version of \"content' here <"
printf "%s" "${Var}" | sed "s/[&\/\\\\*\\"']/\\&/g' | read -r EscVar

echo "Here is your \"text\" to change" | sed "s/text/${EscVar}/g"

A solution that works:

Wrap the part of the document that needs this modified behavior with the code provided below. In my case the portion to wrap is a \part{} and some text following it.

\makeatletter\@openrightfalse
\part{Whatever}

Some text

\chapter{Foo}
\@openrighttrue\makeatother 

The wrapped portion should also include the chapter at the beginning of which this behavior needs to stop. Otherwise LaTeX may generate an empty page before this chapter.

Source: folks at the #latex IRC channel on irc.freenode.net

I think this is a simple solution:

<div style="_x000D_
    display: inline-block;_x000D_
    position: fixed;_x000D_
    top: 0;_x000D_
    bottom: 0;_x000D_
    left: 0;_x000D_
    right: 0;_x000D_
    width: 200px;_x000D_
    height: 100px;_x000D_
    margin: auto;_x000D_
    background-color: #f3f3f3;">Full Center ON Page_x000D_
</div>

Do same as you did in file1.c In file2.c:

#include <stdio.h> 

extern int i;  /*This declare that i is an int variable which is defined in some other file*/

int main(void)
{
/* your code*/

If you use int i; in file2.c under main() then i will be treated as local auto variable not the same as defined in file1.c

Use ng-value instead of value.

ng-value="true"

Version with ng-checked is worse because of the code duplication.

We know that the UDP is a connection-less protocol, so it is

1. suitable for process that require simple request-response communication.
2. suitable for process which has internal flow ,error control
3. suitable for broad casting and multicasting

Specific examples:

• used in SNMP
• used for some route updating protocols such as RIP

I have created a general multi replace string Oracle function by a table of varchar2 as parameter. The varchar will be replaced for the position rownum value of table.

For example:

Text: Hello {0}, this is a {2} for {1}
Parameters: TABLE('world','all','message')

Returns:

Hello world, this is a message for all.

You must create a type:

CREATE OR REPLACE TYPE "TBL_VARCHAR2" IS TABLE OF VARCHAR2(250);

The funcion is:

CREATE OR REPLACE FUNCTION FN_REPLACETEXT(
    pText IN VARCHAR2, 
    pPar IN TBL_VARCHAR2
) RETURN VARCHAR2
IS
    vText VARCHAR2(32767);
    vPos INT;
    vValue VARCHAR2(250);

    CURSOR cuParameter(POS INT) IS
    SELECT VAL
        FROM
            (
            SELECT VAL, ROWNUM AS RN 
            FROM (
                  SELECT COLUMN_VALUE VAL
                  FROM TABLE(pPar)
                  )
            )
        WHERE RN=POS+1;
BEGIN
    vText := pText;
    FOR i IN 1..REGEXP_COUNT(pText, '[{][0-9]+[}]') LOOP
        vPos := TO_NUMBER(SUBSTR(REGEXP_SUBSTR(pText, '[{][0-9]+[}]',1,i),2, LENGTH(REGEXP_SUBSTR(pText, '[{][0-9]+[}]',1,i)) - 2));

        OPEN cuParameter(vPos);
        FETCH cuParameter INTO vValue;
        IF cuParameter%FOUND THEN
            vText := REPLACE(vText, REGEXP_SUBSTR(pText, '[{][0-9]+[}]',1,i), vValue);
        END IF;
        CLOSE cuParameter;
    END LOOP;

    RETURN vText;

EXCEPTION
      WHEN OTHERS
      THEN
         RETURN pText;
END FN_REPLACETEXT;
/

Usage:

TEXT_RETURNED := FN_REPLACETEXT('Hello {0}, this is a {2} for {1}', TBL_VARCHAR2('world','all','message'));

What I did is first check what are the running processes by

SELECT * FROM pg_stat_activity WHERE state = 'active';

Find the process you want to kill, then type:

SELECT pg_cancel_backend(<pid of the process>)

This basically "starts" a request to terminate gracefully, which may be satisfied after some time, though the query comes back immediately.

If the process cannot be killed, try:

SELECT pg_terminate_backend(<pid of the process>)

In my case I wanted to tear down the underlying connection in which case I had to call socket.disconnect(true) as you can see is needed from the source here

A complete example in data binding Fragments

FragmentMyProgramsBinding is binding class generated for res/layout/fragment_my_programs

public class MyPrograms extends Fragment {
    FragmentMyProgramsBinding fragmentMyProgramsBinding;

    public MyPrograms() {
        // Required empty public constructor
    }


    @Override
    public View onCreateView(LayoutInflater inflater, ViewGroup container,
                             Bundle savedInstanceState) {
        // Inflate the layout for this fragment
    FragmentMyProgramsBinding    fragmentMyProgramsBinding = DataBindingUtil.inflate(inflater, R
                .layout.fragment_my_programs, container, false);
        return fragmentMyProgramsBinding.getRoot();
    }

    @Override
    public void onViewCreated(@NonNull View view, @Nullable Bundle savedInstanceState) {
        super.onViewCreated(view, savedInstanceState);

    }
}

If your <option> elements don't have value attributes, then you can just use .val:

$selectElement.val("text_you're_looking_for")

However, if your <option> elements have value attributes, or might do in future, then this won't work, because whenever possible .val will select an option by its value attribute instead of by its text content. There's no built-in jQuery method that will select an option by its text content if the options have value attributes, so we'll have to add one ourselves with a simple plugin:

/*
  Source: https://stackoverflow.com/a/16887276/1709587

  Usage instructions:

  Call

      jQuery('#mySelectElement').selectOptionWithText('target_text');

  to select the <option> element from within #mySelectElement whose text content
  is 'target_text' (or do nothing if no such <option> element exists).
*/
jQuery.fn.selectOptionWithText = function selectOptionWithText(targetText) {
    return this.each(function () {
        var $selectElement, $options, $targetOption;

        $selectElement = jQuery(this);
        $options = $selectElement.find('option');
        $targetOption = $options.filter(
            function () {return jQuery(this).text() == targetText}
        );

        // We use `.prop` if it's available (which it should be for any jQuery
        // versions above and including 1.6), and fall back on `.attr` (which
        // was used for changing DOM properties in pre-1.6) otherwise.
        if ($targetOption.prop) {
            $targetOption.prop('selected', true);
        } 
        else {
            $targetOption.attr('selected', 'true');
        }
    });
}

Just include this plugin somewhere after you add jQuery onto the page, and then do

jQuery('#someSelectElement').selectOptionWithText('Some Target Text');

to select options.

The plugin method uses filter to pick out only the option matching the targetText, and selects it using either .attr or .prop, depending upon jQuery version (see .prop() vs .attr() for explanation).

Here's a JSFiddle you can use to play with all three answers given to this question, which demonstrates that this one is the only one to reliably work: http://jsfiddle.net/3cLm5/1/

it is late i know but, this can be helpfull someone else.

so here is my simpliest solution (with Turkish chars);

function (s,e)
{
    var key = e.htmlEvent.key;

    var upperCases = 'ABCÇDEFGGHIIJKLMNOÖPRSSTUÜVYZXWQ';
    var lowerCases = 'abcçdefgghiijklmnoöprsstuüvyzxwq';
    var digits = '0123456789';

    if (upperCases.includes(key))
    {
        document.getElementById('spanLetterCase').innerText = '[A]';
    }

    else if (lowerCases.includes(key))
    {
        document.getElementById('spanLetterCase').innerText = '[a]';
    }

    else if (digits.includes(key))
    {
        document.getElementById('spanLetterCase').innerText = '[1]';
    }

    else
    {
        document.getElementById('spanLetterCase').innerText = '';
    }
}

I made this procedure for us to use at work.

cd ~
curl -s https://pypi.python.org/packages/source/p/pip/pip-1.3.1.tar.gz | tar xvz
cd pip-1.3.1
python setup.py install --user
cd ~
rm -rf pip-1.3.1

$HOME/.local/bin/pip install --user --upgrade pip distribute virtualenvwrapper

# Might want these three in your .bashrc
export PATH=$PATH:$HOME/.local/bin
export VIRTUALENVWRAPPER_VIRTUALENV_ARGS="--distribute"
source $HOME/.local/bin/virtualenvwrapper.sh

mkvirtualenv mypy
workon mypy
pip install --upgrade distribute
pip install pudb # Or whatever other nice package you might want.

Key points for the security minded:

1. curl does ssl validation. wget doesn't.
2. Starting from pip 1.3.1, pip also does ssl validation.
3. Fewer users can upload the pypi tarball than a github tarball.

You can just put ?foo=1234 at the end of your CSS / JavaScript import, changing 1234 to be whatever you like. Have a look at the Stack Overflow HTML source for an example.

The idea there being that the ? parameters are discarded / ignored on the request anyway and you can change that number when you roll out a new version.

Note: There is some argument with regard to exactly how this affects caching. I believe the general gist of it is that GET requests, with or without parameters should be cachable, so the above solution should work.

However, it is down to both the web server to decide if it wants to adhere to that part of the spec and the browser the user uses, as it can just go right ahead and ask for a fresh version anyway.

You can check out this method for sending image and form data altogether

<div class="form-group ml-5 mt-4" ng-app="myApp" ng-controller="myCtrl">
                    <label for="image_name">Image Name:</label>
                    <input type="text"   placeholder="Image name" ng-model="fileName" class="form-control" required>
                    <br>

                    <br>
                    <input id="file_src" type="file"   accept="image/jpeg" file-input="files"   >
                    <br>
                        {{file_name}}
            <img class="rounded mt-2 mb-2 " id="prvw_img" width="150" height="100" >
                    <hr>
                      <button class="btn btn-info" ng-click="uploadFile()">Upload</button>
                        <br>

                       <div ng-show = "IsVisible" class="alert alert-info w-100 shadow mt-2" role="alert">
              <strong> {{response_msg}} </strong>
            </div>
                            <div class="alert alert-danger " id="filealert"> <strong> File Size should be less than 4 MB </strong></div>
                    </div>

Angular JS Code

    var app = angular.module("myApp", []);
 app.directive("fileInput", function($parse){
      return{
           link: function($scope, element, attrs){
                element.on("change", function(event){
                     var files = event.target.files;


                     $parse(attrs.fileInput).assign($scope, element[0].files);
                     $scope.$apply();
                });
           }
      }
 });
 app.controller("myCtrl", function($scope, $http){
      $scope.IsVisible = false;
      $scope.uploadFile = function(){
           var form_data = new FormData();
           angular.forEach($scope.files, function(file){
                form_data.append('file', file); //form file
                                form_data.append('file_Name',$scope.fileName); //form text data
           });
           $http.post('upload.php', form_data,
           {
                //'file_Name':$scope.file_name;
                transformRequest: angular.identity,
                headers: {'Content-Type': undefined,'Process-Data': false}
           }).success(function(response){
             $scope.IsVisible = $scope.IsVisible = true;
                      $scope.response_msg=response;
               // alert(response);
               // $scope.select();
           });
      }

 });

VBA functions treat the function name itself as a sort of variable. So instead of using a "return" statement, you would just say:

test = 1

Notice, though, that this does not break out of the function. Any code after this statement will also be executed. Thus, you can have many assignment statements that assign different values to test, and whatever the value is when you reach the end of the function will be the value returned.

Style ={{width : "100%"}}

try this:

StyleSheet generated: {
  "width": "80%",
  "textAlign": "center",
  "marginTop": 21.8625,
  "fontWeight": "bold",
  "fontSize": 16,
  "color": "rgb(24, 24, 24)",
  "fontFamily": "Trajan Pro",
  "textShadowColor": "rgba(255, 255, 255, 0.2)",
  "textShadowOffset": {
    "width": 0,
    "height": 0.5
  }
}

In a jupyter notebook cell: pip freeze | grep pandas

Private Sub Form1_Load(ByVal sender As System.Object, ByVal e As System.EventArgs) Handles MyBase.Load
        Dim dt As New DataTable
        Dim dc As DataColumn
        dc = New DataColumn("Question", System.Type.GetType("System.String"))
        dt.Columns.Add(dc)

        dc = New DataColumn("Ans1", System.Type.GetType("System.String"))
        dt.Columns.Add(dc)
        dc = New DataColumn("Ans2", System.Type.GetType("System.String"))
        dt.Columns.Add(dc)
        dc = New DataColumn("Ans3", System.Type.GetType("System.String"))
        dt.Columns.Add(dc)
        dc = New DataColumn("Ans4", System.Type.GetType("System.String"))
        dt.Columns.Add(dc)
        dc = New DataColumn("AnsType", System.Type.GetType("System.String"))
        dt.Columns.Add(dc)


        Dim Dr As DataRow
        Dr = dt.NewRow
        Dr("Question") = "What is Your Name"
        Dr("Ans1") = "Ravi"
        Dr("Ans2") = "Mohan"
        Dr("Ans3") = "Sohan"
        Dr("Ans4") = "Gopal"
        Dr("AnsType") = "Multi"
        dt.Rows.Add(Dr)

        Dr = dt.NewRow
        Dr("Question") = "What is your father Name"
        Dr("Ans1") = "Ravi22"
        Dr("Ans2") = "Mohan2"
        Dr("Ans3") = "Sohan2"
        Dr("Ans4") = "Gopal2"
        Dr("AnsType") = "Multi"
        dt.Rows.Add(Dr)
        Panel1.GrowStyle = TableLayoutPanelGrowStyle.AddRows
        Panel1.CellBorderStyle = TableLayoutPanelCellBorderStyle.Single
        Panel1.BackColor = Color.Azure
        Panel1.RowStyles.Insert(0, New RowStyle(SizeType.Absolute, 50))
        Dim i As Integer = 0

        For Each dri As DataRow In dt.Rows



            Dim lab As New Label()
            lab.Text = dri("Question")
            lab.AutoSize = True

            Panel1.Controls.Add(lab, 0, i)


            Dim Ans1 As CheckBox
            Ans1 = New CheckBox()
            Ans1.Text = dri("Ans1")
            Panel1.Controls.Add(Ans1, 1, i)

            Dim Ans2 As RadioButton
            Ans2 = New RadioButton()
            Ans2.Text = dri("Ans2")
            Panel1.Controls.Add(Ans2, 2, i)
            i = i + 1

            'Panel1.Controls.Add(Pan)
        Next

If the language you use accepts {}, you can use [0-9]{4,6}.

If not, you'll have to use [0-9][0-9][0-9][0-9][0-9]?[0-9]?.

In the repository root, the .git/config file holds all information about remote repositories and branches. In your example, you should look for something like:

[remote "origin"]
    fetch = +refs/heads/*:refs/remotes/origin/*
    url = server:gitRepo.git

Also, the Git command git remote -v shows the remote repository name and URL. The "origin" remote repository usually corresponds to the original repository, from which the local copy was cloned.

This is not possible with native HTML input elements. You can use webshim polyfill, which gives you this option by using this markup.

<input type="date" data-date-inline-picker="true" />

Here is a small demo

Suppose we have a API Controller ProductsController : ApiController

There is a Get function which returns some value and expects some input header (for eg. UserName & Password)

[HttpGet]
public IHttpActionResult GetProduct(int id)
{
    System.Net.Http.Headers.HttpRequestHeaders headers = this.Request.Headers;
    string token = string.Empty;
    string pwd = string.Empty;
    if (headers.Contains("username"))
    {
        token = headers.GetValues("username").First();
    }
    if (headers.Contains("password"))
    {
        pwd = headers.GetValues("password").First();
    }
    //code to authenticate and return some thing
    if (!Authenticated(token, pwd)
        return Unauthorized();
    var product = products.FirstOrDefault((p) => p.Id == id);
    if (product == null)
    {
        return NotFound();
    }
    return Ok(product);
}

Now we can send the request from page using JQuery:

$.ajax({
    url: 'api/products/10',
    type: 'GET',
    headers: { 'username': 'test','password':'123' },
    success: function (data) {
        alert(data);
    },
    failure: function (result) {
        alert('Error: ' + result);
    }
});

Hope this helps someone ...

Interestingly, a ComboBox with DropDownStyle=Simple has pretty much exactly the behaviour you are looking for, I think.

(If you reduce the height of the control to not show the list - and then by a couple of pixels more - there's no effective difference between the ComboBox and the TextBox.)

Assuming employee numbers are in the first column and their names are in the second:

=VLOOKUP(A1, Sheet2!A:B, 2,false)

This should work(with or without 'javascript:' part):

<img onclick="javascript:exportToForm('1.6','55','10','50','1')" src="China-Flag-256.png" />
<script>
function exportToForm(a, b, c, d, e) {
     alert(a, b);
 }
</script>

The PrimeFaces ajax events sometimes are very poorly documented, so in most cases you must go to the source code and check yourself.

p:selectOneMenu supports change event:

<p:selectOneMenu ..>
    <p:ajax event="change" update="msgtext"
        listener="#{post.subjectSelectionChanged}" />
    <!--...-->
</p:selectOneMenu>

which triggers listener with AjaxBehaviorEvent as argument in signature:

public void subjectSelectionChanged(final AjaxBehaviorEvent event)  {...}

You can use CSS background:url(ur_img.png) for insert image inside input box but for create click event you need to merge your arrow image and input box .

I do believe the easiest way is to first go to instant and then to string like:

String d = new Date().toInstant().toString();

Which will result in:

2017-09-08T12:56:45.331Z

You only have to get the view of activity that carry this fragment and this could only happen when your fragment is already created

override the onViewCreated() method inside your fragment and enjoy its magic :) ..

@Override
public void onViewCreated(View view, @Nullable Bundle savedInstanceState) {
    super.onViewCreated(view, savedInstanceState);
    Button button = (Button) view.findViewById(R.id.YOURBUTTONID);
    button.setOnClickListener(new View.OnClickListener() {
        @Override
        public void onClick(View view) {
         //place your action here
         }
    });

Hope this could help you ;

Failure [INSTALL_FAILED_OLDER_SDK]

basically means that the installation has failed due to the target location (AVD/Device) having an older SDK version than the targetSdkVersion specified in your app.

FROM

apply plugin: 'com.android.application'

android {

compileSdkVersion 'L' //Avoid String change to 20 without quotes
buildToolsVersion "20.0.0"

defaultConfig {
    applicationId "com.vahe_muradyan.notes"
    minSdkVersion 8
    targetSdkVersion 'L' //Set your correct Target which is 17 for Android 4.2.2
    versionCode 1
    versionName "1.0"
}
buildTypes {
    release {
        runProguard false
        proguardFiles getDefaultProguardFile('proguard-android.txt'),
'proguard-rules.pro'
    }
}
}

dependencies {
compile fileTree(dir: 'libs', include: ['*.jar'])

compile 'com.android.support:appcompat-v7:19.+' // Avoid Generalization 
// can lead to dependencies issues remove +

}

TO

apply plugin: 'com.android.application'

android {
compileSdkVersion 20 
buildToolsVersion "20.0.0"

defaultConfig {
    applicationId "com.vahe_muradyan.notes"
    minSdkVersion 8
    targetSdkVersion 17
    versionCode 1
    versionName "1.0"
}
buildTypes {
    release {
        runProguard false
        proguardFiles getDefaultProguardFile('proguard-android.txt'), 
'proguard-rules.pro'
    }
}
}

dependencies {
compile fileTree(dir: 'libs', include: ['*.jar'])

compile 'com.android.support:appcompat-v7:19.0.0'
}

This is common error from eclipse to now Android Studio 0.8-.8.6

Things to avoid in Android Studio (As for now)

• Avoid Strings instead set API level/Number
• Avoid generalizing dependencies + be specific

WAR (web archive) files contain servlet class files, JSPs (Java servlet pages), HTML and graphical files, and other supporting files.

EAR (enterprise archive) files contain the WAR files along with the JAR files containing code.

There may be other things in those files but their basically meant for what they sound like they mean: WAR for web-type stuff, EAR for enterprise-type stuff (WARs, code, connectors et al).

Try to add Space widget after adding view like this:

layout.addView(view)
val space = Space(context)
space.minimumHeight = spaceInterval
layout.addView(space)

A multiprocessing.Process can p.terminate()

In the cases where I want to kill a thread, but do not want to use flags/locks/signals/semaphores/events/whatever, I promote the threads to full blown processes. For code that makes use of just a few threads the overhead is not that bad.

E.g. this comes in handy to easily terminate helper "threads" which execute blocking I/O

The conversion is trivial: In related code replace all threading.Thread with multiprocessing.Process and all queue.Queue with multiprocessing.Queue and add the required calls of p.terminate() to your parent process which wants to kill its child p

See the Python documentation for multiprocessing.

Example:

import multiprocessing
proc = multiprocessing.Process(target=your_proc_function, args=())
proc.start()
# Terminate the process
proc.terminate()  # sends a SIGTERM

Let's consider I want specific implementation depending on some dynamic state. @Bean is perfect for that case.

@Bean
@Scope("prototype")
public SomeService someService() {
    switch (state) {
    case 1:
        return new Impl1();
    case 2:
        return new Impl2();
    case 3:
        return new Impl3();
    default:
        return new Impl();
    }
}

However there is no way to do that with @Component.

And here is the one liner:

$("<li><div class='bar'>bla</div></li>").find("li").attr("id","1234").end().appendTo("body")

But I'm wondering why you would like to add the "id" attribute at a later stage rather than injecting it directly in the template.

Try indexing (so you want a generic solution not only for this, so index order can be just what you want):

l=[0,2,1] # index order
frame=frame[[frame.columns[i] for i in l]]

Now:

print(frame)

Is:

   one thing second thing  other thing
0          1           0.1           a
1          2           0.2           e
2          3           1.0           i
3          4           2.0           o

try something like this

 URL u = new URL("http://www.puzzlers.org/pub/wordlists/pocket.txt");
 InputStream in = u.openStream();

Then use it as any plain old input stream

TO collect all item of an array and return a json object

collectData: function (arrayElements) {

        var main = [];

        for (var i = 0; i < arrayElements.length; i++) {
            var data = {};
            this.e = arrayElements[i];            
            data.text = arrayElements[i].text;
            data.val = arrayElements[i].value;
            main[i] = data;
        }
        return main;
    },

TO parse the same data we go through like this

dummyParse: function (json) {       
        var o = JSON.parse(json); //conerted the string into JSON object        
        $.each(o, function () {
            inner = this;
            $.each(inner, function (index) {
                alert(this.text)
            });
        });

}

Try using this code:

var datetime = 1383066000000; // anything
var date = new Date(datetime);
var options = {
        year: 'numeric', month: 'numeric', day: 'numeric',
    };

var result = date.toLocaleDateString('en', options); // 10/29/2013

See more: https://developer.mozilla.org/en-US/docs/Web/JavaScript/Reference/Global_Objects/Date/toLocaleDateString

you can use this one instead.

System.Environment.CurrentDirectory

Set LDFLAGS and CFLAGS when you run make:

$ LDFLAGS="-L/home/me/local/lib" CFLAGS="-I/home/me/local/include" make

If you don't want to do that a gazillion times, export these in your .bashrc (or your shell equivalent). Also set LD_LIBRARY_PATH to include /home/me/local/lib:

export LD_LIBRARY_PATH=$LD_LIBRARY_PATH:/home/me/local/lib

It's better to use backtracking

#include <stdio.h>
#include <string.h>

void swap(char *a, char *b) {
    char temp;
    temp = *a;
    *a = *b;
    *b = temp;
}

void print(char *a, int i, int n) {
    int j;
    if(i == n) {
        printf("%s\n", a);
    } else {
        for(j = i; j <= n; j++) {
            swap(a + i, a + j);
            print(a, i + 1, n);
            swap(a + i, a + j);
        }
    }
}

int main(void) {
    char a[100];
    gets(a);
    print(a, 0, strlen(a) - 1);
    return 0;
}

I was having this problem, I had configured my site for global require https in FilterConfig.cs.

public static void RegisterGlobalFilters(GlobalFilterCollection filters)
    {
        filters.Add(new HandleErrorAttribute());
        filters.Add(new RequireHttpsAttribute());
    }

I had forgotten to change the project url to https: from this tutorial http://azure.microsoft.com/en-us/documentation/articles/web-sites-dotnet-deploy-aspnet-mvc-app-membership-oauth-sql-database/ under ENABLE SSL part 4. This caused the errors you were getting.