You can simply use datetime diff and format for calculating difference.
<?php
$datetime1 = new DateTime('2009-10-11 12:12:00');
$datetime2 = new DateTime('2009-10-13 10:12:00');
$interval = $datetime1->diff($datetime2);
echo $interval->format('%Y-%m-%d %H:%i:%s');
?>
For more information OF DATETIME format, refer: here
You can change the interval format in the way,you want.
Here is the working example
P.S. These features( diff() and format()) work with >=PHP 5.3.0 only
You can try this...
$(document).ready(function() {
$("button").click(function(){
var checkBoxValues = [];
$.each($("input[name='check_name']:checked"), function(){
checkBoxValues.push($(this).val());
});
console.log(checkBoxValues);
});
});
From matplotlib 3.1 onwards you can use .legend_elements()
. An example is shown in Automated legend creation. The advantage is that a single scatter call can be used.
In this case:
import numpy as np
import pandas as pd
import matplotlib.pyplot as plt
df = pd.DataFrame(np.random.normal(10,1,30).reshape(10,3),
index = pd.date_range('2010-01-01', freq = 'M', periods = 10),
columns = ('one', 'two', 'three'))
df['key1'] = (4,4,4,6,6,6,8,8,8,8)
fig, ax = plt.subplots()
sc = ax.scatter(df['one'], df['two'], marker = 'o', c = df['key1'], alpha = 0.8)
ax.legend(*sc.legend_elements())
plt.show()
In case the keys were not directly given as numbers, it would look as
import numpy as np
import pandas as pd
import matplotlib.pyplot as plt
df = pd.DataFrame(np.random.normal(10,1,30).reshape(10,3),
index = pd.date_range('2010-01-01', freq = 'M', periods = 10),
columns = ('one', 'two', 'three'))
df['key1'] = list("AAABBBCCCC")
labels, index = np.unique(df["key1"], return_inverse=True)
fig, ax = plt.subplots()
sc = ax.scatter(df['one'], df['two'], marker = 'o', c = index, alpha = 0.8)
ax.legend(sc.legend_elements()[0], labels)
plt.show()
You can use this:
SELECT REPLACE(LTRIM(REPLACE('000010A', '0', ' ')),' ', '0')
So all in one line:
var checkedItemsAsString = $('[id*="checkbox"]:checked').map(function() { return $(this).val().toString(); } ).get().join(",");
..a note about the selector [id*="checkbox"]
, it will grab any item with the string "checkbox" in it. A bit clumsy here, but really good if you are trying to pull the selected values out of something like a .NET CheckBoxList. In that case "checkbox" would be the name that you gave the CheckBoxList control.
x=> x.Lists.Include(l => l.Title).Where(l=>l.Title != String.Empty).Where(l => l.Internal NAme != String.Empty)
or
x=> x.Lists.Include(l => l.Title).Where(l=>l.Title != String.Empty && l.Internal NAme != String.Empty)
You can use the fuser
command, like:
fuser file_name
You will receive a list of processes using the file.
You can use different flags with it, in order to receive a more detailed output.
You can find more info in the fuser's Wikipedia article, or in the man
pages.
PDOStatement has a public property $queryString. It should be what you want.
I've just notice that PDOStatement has an undocumented method debugDumpParams() which you may also want to look at.
After Checking Java Build Path, Then add lines of code in manifest file.
<meta-data
android:name="com.google.android.gms.version"
android:value="@integer/google_play_services_version" />
ImageIcon image = new ImageIcon("image/pic1.jpg");
JLabel label = new JLabel("", image, JLabel.CENTER);
JPanel panel = new JPanel(new BorderLayout());
panel.add( label, BorderLayout.CENTER );
I use the IntelliJ one, because I'm mostly concerned with IntelliJ flagging things that might produce a NPE. I agree that it's frustrating not having a standard annotation in the JDK. There's talk of adding it, it might make it into Java 7. In which case there will be one more to choose from!
Instead of using a split, I think it would be easier to simply execute a match and process all the found matches.
This expression will:
Regex: (?:^|,)(?=[^"]|(")?)"?((?(1)[^"]*|[^,"]*))"?(?=,|$)
Sample Text
123,2.99,AMO024,Title,"Description, more info",,123987564
ASP example using the non-java expression
Set regEx = New RegExp
regEx.Global = True
regEx.IgnoreCase = True
regEx.MultiLine = True
sourcestring = "your source string"
regEx.Pattern = "(?:^|,)(?=[^""]|("")?)""?((?(1)[^""]*|[^,""]*))""?(?=,|$)"
Set Matches = regEx.Execute(sourcestring)
For z = 0 to Matches.Count-1
results = results & "Matches(" & z & ") = " & chr(34) & Server.HTMLEncode(Matches(z)) & chr(34) & chr(13)
For zz = 0 to Matches(z).SubMatches.Count-1
results = results & "Matches(" & z & ").SubMatches(" & zz & ") = " & chr(34) & Server.HTMLEncode(Matches(z).SubMatches(zz)) & chr(34) & chr(13)
next
results=Left(results,Len(results)-1) & chr(13)
next
Response.Write "<pre>" & results
Matches using the non-java expression
Group 0 gets the entire substring which includes the comma
Group 1 gets the quote if it's used
Group 2 gets the value not including the comma
[0][0] = 123
[0][1] =
[0][2] = 123
[1][0] = ,2.99
[1][1] =
[1][2] = 2.99
[2][0] = ,AMO024
[2][1] =
[2][2] = AMO024
[3][0] = ,Title
[3][1] =
[3][2] = Title
[4][0] = ,"Description, more info"
[4][1] = "
[4][2] = Description, more info
[5][0] = ,
[5][1] =
[5][2] =
[6][0] = ,123987564
[6][1] =
[6][2] = 123987564
NOTE: Because people searching with the same keyword will land on this page, I am adding this answer which is not the cause for this compiler error in the above mentioned case.
I was facing this error when I had an enum
declared in some file which had one of the elements having the same symbol as my class name.
e.g. if I declare an enum = {A, B, C}
in some file which is included in another file where I declare an object of class A
.
This was throwing the same compiler error message mentioning that Class A does not name a type
. There was no circular dependency in my case.
So, be careful while naming classes and declaring enums (which might be visible, imported and used externally in other files) in C++.
First you need to allocate an array of the combined length, then use arraycopy to fill it from both sources.
byte[] ciphertext = blah;
byte[] mac = blah;
byte[] out = new byte[ciphertext.length + mac.length];
System.arraycopy(ciphertext, 0, out, 0, ciphertext.length);
System.arraycopy(mac, 0, out, ciphertext.length, mac.length);
You cannot do new T()
due to type erasure. The default constructor can only be
public Navigation() { this("", "", null); }
You can create other constructors to provide default values for trigger and description. You need an concrete object of T
.
$ od -t x1 -A n -v <empty.zip | tr -dc '[:xdigit:]' && echo
504b0506000000000000000000000000000000000000
$
Use the od
tool to print single hexadecimal bytes (-t x1
) --- without address offsets (-A n
) and without eliding repeated "groups" (-v)
--- from empty.zip
, which has been redirected to standard input. Pipe that to tr
which deletes (-d
) the complement (-c
) of the hexadecimal character set ('[:xdigit:]'
). You can optionally print a trailing newline (echo
) as I've done here to separate the output from the next shell prompt.
None of the above worked for me because my devices are in a balance-rr bond. Querying either would say the same MAC address with ip l l
, ifconfig
, or /sys/class/net/${device}/address
, so one of them is correct, and one is unknown.
But this works if you haven't renamed the device (any tips on what I missed?):
udevadm info -q all --path "/sys/class/net/${device}"
And this works even if you rename it (eg. ip l set name x0 dev p4p1
):
cat /proc/net/bonding/bond0
or my ugly script that makes it more parsable (untested driver/os/whatever compatibility):
awk -F ': ' '
$0 == "" && interface != "" {
printf "%s %s %s\n", interface, mac, status;
interface="";
mac=""
};
$1 == "Slave Interface" {
interface=$2
};
$1 == "Permanent HW addr" {
mac=$2
};
$1 == "MII Status" {
status=$2
};
END {
printf "%s %s %s\n", interface, mac, status
}' /proc/net/bonding/bond0
The following script deletes branches. Use it and modify it at your own risk, etc. etc.
Based on the other answers in this question, I ended up writing a quick bash script for myself. I called it "gitbd" (git branch -D) but if you use it, you can rename it to whatever you want.
gitbd() {
if [ $# -le 1 ]
then
local branches_to_delete=`git for-each-ref --format '%(refname:short)' refs/heads/ | grep "$1"`
printf "Matching branches:\n\n$branches_to_delete\n\nDelete? [Y/n] "
read -n 1 -r # Immediately continue after getting 1 keypress
echo # Move to a new line
if [[ ! $REPLY == 'N' && ! $REPLY == 'n' ]]
then
echo $branches_to_delete | xargs git branch -D
fi
else
echo "This command takes one arg (match pattern) or no args (match all)"
fi
}
It will offer to delete any branches which match a pattern argument, if passed in, or all local branches when called with with no arguments. It will also give you a confirmation step, since, you know, we're deleting things, so that's nice.
It's kind of dumb - if there are no branches that match the pattern, it doesn't realize it.
An example output run:
$ gitbd test
Matching branches:
dummy+test1
dummy+test2
dummy+test3
Delete? [Y/n]
See also this previous answer which recommends the not
keyword
How to check if a list is empty in Python?
It generalizes to more than just lists:
>>> a = ""
>>> not a
True
>>> a = []
>>> not a
True
>>> a = 0
>>> not a
True
>>> a = 0.0
>>> not a
True
>>> a = numpy.array([])
>>> not a
True
Notably, it will not work for "0" as a string because the string does in fact contain something - a character containing "0". For that you have to convert it to an int:
>>> a = "0"
>>> not a
False
>>> a = '0'
>>> not int(a)
True
You can use sp_lock
(and sp_lock2
), but in SQL Server 2005 onwards this is being deprecated in favour of querying sys.dm_tran_locks
:
select
object_name(p.object_id) as TableName,
resource_type, resource_description
from
sys.dm_tran_locks l
join sys.partitions p on l.resource_associated_entity_id = p.hobt_id
this worked for me:
ProxyRequests Off
ProxyPreserveHost On
RewriteEngine On
<Proxy http://localhost:8123>
Order deny,allow
Allow from all
</Proxy>
ProxyPass /node http://localhost:8123
ProxyPassReverse /node http://localhost:8123
There are two differences between ==
and ===
in PHP arrays and objects that I think didn't mention here; two arrays with different key sorts, and objects.
If you have an array with a key sort and another array with a different key sort, they are strictly different (i.e. using ===
). That may cause if you key-sort an array, and try to compare the sorted array with the original one.
For instance, consider an empty array. First, we try to push some new indexes to the array without any special sort. A good example would be an array with strings as keys. Now deep into an example:
// Define an array
$arr = [];
// Adding unsorted keys
$arr["I"] = "we";
$arr["you"] = "you";
$arr["he"] = "they";
Now, we have a not-sorted-keys array (e.g., 'he' came after 'you'). Consider the same array, but we sorted its keys alphabetically:
// Declare array
$alphabetArr = [];
// Adding alphabetical-sorted keys
$alphabetArr["I"] = "we";
$alphabetArr["he"] = "they";
$alphabetArr["you"] = "you";
Tip: You can sort an array by key using ksort() function.
Now you have another array with a different key sort from the first one. So, we're going to compare them:
$arr == $alphabetArr; // true
$arr === $alphabetArr; // false
Note: It may be obvious, but comparing two different arrays using strict comparison always results false
. However, two arbitrary arrays may be equal using ===
or not.
You would say: "This difference is negligible". Then I say it's a difference and should be considered and may happen anytime. As mentioned above, sorting keys in an array is a good example of that.
Keep in mind, two different objects are never strict-equal. These examples would help:
$stdClass1 = new stdClass();
$stdClass2 = new stdClass();
$clonedStdClass1 = clone $stdClass1;
// Comparing
$stdClass1 == $stdClass2; // true
$stdClass1 === $stdClass2; // false
$stdClass1 == $clonedStdClass1; // true
$stdClass1 === $clonedStdClass1; // false
Note: Assigning an object to another variable does not create a copy - rather, it creates a reference to the same memory location as the object. See here.
Note: As of PHP7, anonymous classes was added. From the results, there is no difference between new class {}
and new stdClass()
in the tests above.
You can raise a notice in Postgres
as follows:
raise notice 'Value: %', deletedContactId;
Read here
You need rawQuery method.
Example:
private final String MY_QUERY = "SELECT * FROM table_a a INNER JOIN table_b b ON a.id=b.other_id WHERE b.property_id=?";
db.rawQuery(MY_QUERY, new String[]{String.valueOf(propertyId)});
Use ? bindings instead of putting values into raw sql query.
update Angular 5
ngOutletContext
was renamed to ngTemplateOutletContext
See also https://github.com/angular/angular/blob/master/CHANGELOG.md#500-beta5-2017-08-29
original
Templates (<template>
, or <ng-template>
since 4.x) are added as embedded views and get passed a context.
With let-col
the context property $implicit
is made available as col
within the template for bindings.
With let-foo="bar"
the context property bar
is made available as foo
.
For example if you add a template
<ng-template #myTemplate let-col let-foo="bar">
<div>{{col}}</div>
<div>{{foo}}</div>
</ng-template>
<!-- render above template with a custom context -->
<ng-template [ngTemplateOutlet]="myTemplate"
[ngTemplateOutletContext]="{
$implicit: 'some col value',
bar: 'some bar value'
}"
></ng-template>
See also this answer and ViewContainerRef#createEmbeddedView.
*ngFor
also works this way. The canonical syntax makes this more obvious
<ng-template ngFor let-item [ngForOf]="items" let-i="index" let-odd="odd">
<div>{{item}}</div>
</ng-template>
where NgFor
adds the template as embedded view to the DOM for each item
of items
and adds a few values (item
, index
, odd
) to the context.
var wrapper = $(document.body);
strings = [
"19 51 2.108997",
"20 47 2.1089"
];
$.each(strings, function(key, value) {
var tmp = value.split(" ");
$.each([
tmp[0] + " " + tmp[1],
tmp[2]
], function(key, value) {
$("<span>" + value + "</span>").appendTo(wrapper);
});
});
You should use the setString()
method to set the userID
. This both ensures that the statement is formatted properly, and prevents SQL injection
:
statement =con.prepareStatement("SELECT * from employee WHERE userID = ?");
statement.setString(1, userID);
There is a nice tutorial on how to use PreparedStatement
s properly in the Java Tutorials.
Here are conversion method for both ways. this = instance of your class
public string ToXML()
{
using(var stringwriter = new System.IO.StringWriter())
{
var serializer = new XmlSerializer(this.GetType());
serializer.Serialize(stringwriter, this);
return stringwriter.ToString();
}
}
public static YourClass LoadFromXMLString(string xmlText)
{
using(var stringReader = new System.IO.StringReader(xmlText))
{
var serializer = new XmlSerializer(typeof(YourClass ));
return serializer.Deserialize(stringReader) as YourClass ;
}
}
Config file:
worker_processes 4; # 2 * Number of CPUs
events {
worker_connections 19000; # It's the key to high performance - have a lot of connections available
}
worker_rlimit_nofile 20000; # Each connection needs a filehandle (or 2 if you are proxying)
# Total amount of users you can serve = worker_processes * worker_connections
more info: Optimizing nginx for high traffic loads
WebViewClient provides the following callback methods, with which you can interfere in how WebView
makes a transition to the next content.
void doUpdateVisitedHistory (WebView view, String url, boolean isReload)
void onFormResubmission (WebView view, Message dontResend, Message resend)
void onLoadResource (WebView view, String url)
void onPageCommitVisible (WebView view, String url)
void onPageFinished (WebView view, String url)
void onPageStarted (WebView view, String url, Bitmap favicon)
void onReceivedClientCertRequest (WebView view, ClientCertRequest request)
void onReceivedError (WebView view, int errorCode, String description, String failingUrl)
void onReceivedError (WebView view, WebResourceRequest request, WebResourceError error)
void onReceivedHttpAuthRequest (WebView view, HttpAuthHandler handler, String host, String realm)
void onReceivedHttpError (WebView view, WebResourceRequest request, WebResourceResponse errorResponse)
void onReceivedLoginRequest (WebView view, String realm, String account, String args)
void onReceivedSslError (WebView view, SslErrorHandler handler, SslError error)
boolean onRenderProcessGone (WebView view, RenderProcessGoneDetail detail)
void onSafeBrowsingHit (WebView view, WebResourceRequest request, int threatType, SafeBrowsingResponse callback)
void onScaleChanged (WebView view, float oldScale, float newScale)
void onTooManyRedirects (WebView view, Message cancelMsg, Message continueMsg)
void onUnhandledKeyEvent (WebView view, KeyEvent event)
WebResourceResponse shouldInterceptRequest (WebView view, WebResourceRequest request)
WebResourceResponse shouldInterceptRequest (WebView view, String url)
boolean shouldOverrideKeyEvent (WebView view, KeyEvent event)
boolean shouldOverrideUrlLoading (WebView view, WebResourceRequest request)
boolean shouldOverrideUrlLoading (WebView view, String url)
WebChromeClient provides the following callback methods, with which your Activity
or Fragment
can update the surroundings of WebView
.
Bitmap getDefaultVideoPoster ()
View getVideoLoadingProgressView ()
void getVisitedHistory (ValueCallback<String[]> callback)
void onCloseWindow (WebView window)
boolean onConsoleMessage (ConsoleMessage consoleMessage)
void onConsoleMessage (String message, int lineNumber, String sourceID)
boolean onCreateWindow (WebView view, boolean isDialog, boolean isUserGesture, Message resultMsg)
void onExceededDatabaseQuota (String url, String databaseIdentifier, long quota, long estimatedDatabaseSize, long totalQuota, WebStorage.QuotaUpdater quotaUpdater)
void onGeolocationPermissionsHidePrompt ()
void onGeolocationPermissionsShowPrompt (String origin, GeolocationPermissions.Callback callback)
void onHideCustomView ()
boolean onJsAlert (WebView view, String url, String message, JsResult result)
boolean onJsBeforeUnload (WebView view, String url, String message, JsResult result)
boolean onJsConfirm (WebView view, String url, String message, JsResult result)
boolean onJsPrompt (WebView view, String url, String message, String defaultValue, JsPromptResult result)
boolean onJsTimeout ()
void onPermissionRequest (PermissionRequest request)
void onPermissionRequestCanceled (PermissionRequest request)
void onProgressChanged (WebView view, int newProgress)
void onReachedMaxAppCacheSize (long requiredStorage, long quota, WebStorage.QuotaUpdater quotaUpdater)
void onReceivedIcon (WebView view, Bitmap icon)
void onReceivedTitle (WebView view, String title)
void onReceivedTouchIconUrl (WebView view, String url, boolean precomposed)
void onRequestFocus (WebView view)
void onShowCustomView (View view, int requestedOrientation, WebChromeClient.CustomViewCallback callback)
void onShowCustomView (View view, WebChromeClient.CustomViewCallback callback)
boolean onShowFileChooser (WebView webView, ValueCallback<Uri[]> filePathCallback, WebChromeClient.FileChooserParams fileChooserParams)
This is working for me (i use laravel 5.6).
$collection = MyModel::all()->groupBy('column');
If you want to convert the collection to plain php array, you can use toArray()
$array = MyModel::all()->groupBy('column')->toArray();
Do you want an incrementing integer column returned with your recordset? If so: -
--Check for existance
if exists (select * from dbo.sysobjects where [id] = object_id(N'dbo.t') AND objectproperty(id, N'IsUserTable') = 1)
drop table dbo.t
go
--create dummy table and insert data
create table dbo.t(x char(1) not null primary key, y char(1) not null)
go
set nocount on
insert dbo.t (x,y) values ('A','B')
insert dbo.t (x,y) values ('C','D')
insert dbo.t (x,y) values ('E','F')
--create temp table to add an identity column
create table dbo.#TempWithIdentity(i int not null identity(1,1) primary key,x char(1) not null unique,y char(1) not null)
--populate the temporary table
insert into dbo.#TempWithIdentity(x,y) select x,y from dbo.t
--return the data
select i,x,y from dbo.#TempWithIdentity
--clean up
drop table dbo.#TempWithIdentity
>>> a = [5, 7, 11, 4, 5]
>>> for n,k in enumerate(a[:-1]):
... print a[n],a[n+1]
...
5 7
7 11
11 4
4 5
On Windows 8.1, since .NET 4.5 is built-in, the fix is to run this from an administrative command-prompt:
dism.exe /Online /Enable-Feature /all /FeatureName:IIS-ASPNET45
you must implement IComparer interface.
In this sample I've my custom object JSONReturn, I implement my class like this :
Friend Class JSONReturnComparer
Implements IComparer(of JSONReturn)
Public Function Compare(x As JSONReturn, y As JSONReturn) As Integer Implements IComparer(Of JSONReturn).Compare
Return String.Compare(x.Name, y.Name)
End Function
End Class
I call my sort List method like this : alResult.Sort(new JSONReturnComparer())
Maybe it could help you
Remove this.requests
from
ngOnInit(){
this.requests=this._http.getRequest().subscribe(res=>this.requests=res);
}
to
ngOnInit(){
this._http.getRequest().subscribe(res=>this.requests=res);
}
this._http.getRequest()
returns a subscription, not the response value.
The response value is assigned by the callback passed to subscribe(...)
Another possible case: if you use the connection direct, don't forget to close if. I needed to execute arbitrary SQL query, and read the result. This was a quick fix, I did not want to define a data class, not set up "normal" SQL connection. So simply I reused EFC's database connection as var connection = Context.Database.GetDbConnection() as SqlConnection
. Make sure you call connection.Close()
before you do Context.SaveChanges()
.
You can also use SciTE to paste code if you don't want to install heavy IDEs and then download plugins for all the code you're making. Simply choose your language from the language menu, type your code, high-light code, select Edit->Copy as RTF, paste into Word with formatting (default paste).
SciTE supports the following languages but probably has support for others: Abaqus*, Ada, ANS.1 MIB definition files*, APDL, Assembler (NASM, MASM), Asymptote*, AutoIt*, Avenue*, Batch files (MS-DOS), Baan*, Bash*, BlitzBasic*, Bullant*, C/C++/C#, Clarion, cmake*, conf (Apache), CSound, CSS*, D, diff files*, E-Script*, Eiffel*, Erlang*, Flagship (Clipper / XBase), Flash (ActionScript), Fortran*, Forth*, GAP*, Gettext, Haskell, HTML*, HTML with embedded JavaScript, VBScript, PHP and ASP*, Gui4Cli*, IDL - both MSIDL and XPIDL*, INI, properties* and similar, InnoSetup*, Java*, JavaScript*, LISP*, LOT*, Lout*, Lua*, Make, Matlab*, Metapost*, MMIXAL, MSSQL, nnCron, NSIS*, Objective Caml*, Opal, Octave*, Pascal/Delphi*, Perl, most of it except for some ambiguous cases*, PL/M*, Progress*, PostScript*, POV-Ray*, PowerBasic*, PowerShell*, PureBasic*, Python*, R*, Rebol*, Ruby*, Scheme*, scriptol*, Specman E*, Spice, Smalltalk, SQL and PLSQL, TADS3*, TeX and LaTeX, Tcl/Tk*, VB and VBScript*, Verilog*, VHDL*, XML*, YAML*.
For connecting to a sql server database via Windows authentication basically needs which server you want to connect , what is your database name , Integrated Security info and provider name.
Basically this works:
<connectionStrings>
<add name="MyConnectionString"
connectionString="data source=ServerName;
Initial Catalog=DatabaseName;Integrated Security=True;"
providerName="System.Data.SqlClient" />
</connectionStrings>
Setting Integrated Security field true means basically you want to reach database via Windows authentication, if you set this field false Windows authentication will not work.
It is also working different according which provider you are using.
SqlClient both Integrated Security=true; or IntegratedSecurity=SSPI; is working.
OleDb it is Integrated Security=SSPI;
Integrated Security=true throws an exception when used with the OleDb provider.
These methods worked for me, it maybe useful for anyone: MapOptions interface
set min zoom: mMap.setMinZoomPreference(N);
set max zoom: mMap.setMaxZoomPreference(N);
where N can equal to:
20 : 1128.497220
19 : 2256.994440
18 : 4513.988880
17 : 9027.977761
16 : 18055.955520
15 : 36111.911040
14 : 72223.822090
13 : 144447.644200
12 : 288895.288400
11 : 577790.576700
10 : 1155581.153000
9 : 2311162.307000
8 : 4622324.614000
7 : 9244649.227000
6 : 18489298.450000
5 : 36978596.910000
4 : 73957193.820000
3 : 147914387.600000
2 : 295828775.300000
1 : 591657550.500000
box-shadow: inset 10px 0 0 0 red;
If you're facing this error but your issue is different and you're tired of searching for a long time then this might help you.
If you have changed your database and updated .env file and still facing same issue then you should check C:\xampp\htdocs{your-project-name}\bootstrap\cache\config.php file and replace or remove the old database name and other changed items.
Here's the proper way to do things:
<?PHP
$sql = 'some query...';
$result = mysql_query($q);
if (! $result){
throw new My_Db_Exception('Database error: ' . mysql_error());
}
while($row = mysql_fetch_assoc($result)){
//handle rows.
}
Note the check on (! $result) -- if your $result is a boolean, it's certainly false, and it means there was a database error, meaning your query was probably bad.
There are several problems with your code:
WordList
is not defined anywhere. You should define it before you use it.#include <string>
before you can use the string class and iostream before you use cout
or endl
.string
, cout
and endl
live in the std
namespace, so you can not access them without prefixing them with std::
unless you use the using
directive to bring them into scope first.Class Meta is the place in your code logic where your model.fields MEET With your form.widgets. So under Class Meta() you create the link between your model' fields and the different widgets you want to have in your form.
Okay I modifed @AndroidMechanics Code, because on devices were facebook is disabled the app crashes!
here is the modifed getFacebookUrl:
public String getFacebookPageURL(Context context) {
PackageManager packageManager = context.getPackageManager();
try {
int versionCode = packageManager.getPackageInfo("com.facebook.katana", 0).versionCode;
boolean activated = packageManager.getApplicationInfo("com.facebook.katana", 0).enabled;
if(activated){
if ((versionCode >= 3002850)) {
return "fb://facewebmodal/f?href=" + FACEBOOK_URL;
} else {
return "fb://page/" + FACEBOOK_PAGE_ID;
}
}else{
return FACEBOOK_URL;
}
} catch (PackageManager.NameNotFoundException e) {
return FACEBOOK_URL;
}
}
The only added thing is to look if the app is disabled or not if it is disabled the app will call the webbrowser!
The following statement causes a user's password to expire:
ALTER USER user PASSWORD EXPIRE;
If you cause a database user's password to expire with PASSWORD EXPIRE, then the user (or the DBA) must change the password before attempting to log in to the database following the expiration. Tools such as SQL*Plus allow the user to change the password on the first attempted login following the expiration.
ALTER USER scott IDENTIFIED BY password;
Will set/reset the users password.
See the alter user doc for more info
mysqldump --no-create-info ...
Also you may use:
--skip-triggers
: if you are using triggers--no-create-db
: if you are using --databases ...
option--compact
: if you want to get rid of extra commentsSet
android:focusable="true"
in your <EditText/>
Expanding upon Melu's answer you can do this to functionalize the code and handle negative amounts.
Sample Output:
$5.23
-$5.23
function formatCurrency(total) {
var neg = false;
if(total < 0) {
neg = true;
total = Math.abs(total);
}
return (neg ? "-$" : '$') + parseFloat(total, 10).toFixed(2).replace(/(\d)(?=(\d{3})+\.)/g, "$1,").toString();
}
Well , it might help someone. i just got the same error while my json file is like this
{"id":"1101010","city_id":"1101","name":"TEUPAH SELATAN"}
{"id":"1101020","city_id":"1101","name":"SIMEULUE TIMUR"}
and i found it malformed, so i changed it into somekind of
{
"datas":[
{"id":"1101010","city_id":"1101","name":"TEUPAH SELATAN"},
{"id":"1101020","city_id":"1101","name":"SIMEULUE TIMUR"}
]
}
What's wrong with
func (e *Easy)SetStringOption(option Option, param string)
func (e *Easy)SetLongOption(option Option, param long)
and so on?
May not sound very elegant, but I usually do something like this:
var items = repository.func.ToList();
items.Insert(0, new funcItem { ID = 0, TextValue = "[None]" });
ViewBag.MyData = new SelectList(items);
tl;dr: Generic Pattern Counter
// THIS IS WHAT YOU NEED
const count = (str) => {
const re = /YOUR_PATTERN_HERE/g
return ((str || '').match(re) || []).length
}
For those that arrived here looking for a generic way to count the number of occurrences of a regex pattern in a string, and don't want it to fail if there are zero occurrences, this code is what you need. Here's a demonstration:
/*_x000D_
* Example_x000D_
*/_x000D_
_x000D_
const count = (str) => {_x000D_
const re = /[a-z]{3}/g_x000D_
return ((str || '').match(re) || []).length_x000D_
}_x000D_
_x000D_
const str1 = 'abc, def, ghi'_x000D_
const str2 = 'ABC, DEF, GHI'_x000D_
_x000D_
console.log(`'${str1}' has ${count(str1)} occurrences of pattern '/[a-z]{3}/g'`)_x000D_
console.log(`'${str2}' has ${count(str2)} occurrences of pattern '/[a-z]{3}/g'`)
_x000D_
Original Answer
The problem with your initial code is that you are missing the global identifier:
>>> 'hi there how are you'.match(/\s/g).length;
4
Without the g
part of the regex it will only match the first occurrence and stop there.
Also note that your regex will count successive spaces twice:
>>> 'hi there'.match(/\s/g).length;
2
If that is not desirable, you could do this:
>>> 'hi there'.match(/\s+/g).length;
1
The most basic way you can do this in SelectedIndexChanged events of DropDownLists. Check this code..
<asp:DropDownList ID="DropDownList1" runat="server" onselectedindexchanged="DropDownList1_SelectedIndexChanged" Width="224px"
AutoPostBack="True" AppendDataBoundItems="true">
<asp:DropDownList ID="DropDownList2" runat="server"
onselectedindexchanged="DropDownList2_SelectedIndexChanged">
</asp:DropDownList>
protected void DropDownList1_SelectedIndexChanged(object sender, EventArgs e)
{
//Load DropDownList2
}
protected void DropDownList2_SelectedIndexChanged(object sender, EventArgs e)
{
//Load DropDownList3
}
because your jQuery code is wrong. Correctly would be:
var theParent = $(this).parent().get(0);
$(theParent).css('z-index', 3000);
Fastest way to do this would be:
int count = 0;
for(int i = 0; i < str.length(); i++) {
if(Character.isWhitespace(str.charAt(i))) count++;
}
This would catch all characters that are considered whitespace.
Regex solutions require compiling regex and excecuting it - with a lot of overhead. Getting character array requires allocation. Iterating over byte array would be faster, but only if you are sure that your characters are ASCII.
Note that most of XLConnect's functions are already vectorized. This means that you can read in all worksheets with one function call without having to do explicit vectorization:
require(XLConnect)
wb <- loadWorkbook(system.file("demoFiles/mtcars.xlsx", package = "XLConnect"))
lst = readWorksheet(wb, sheet = getSheets(wb))
With XLConnect 0.2-0 lst will already be a named list.
for block elements:
<textarea style="width:100px; word-wrap:break-word;">_x000D_
ACTGATCGAGCTGAAGCGCAGTGCGATGCTTCGATGATGCTGACGATGCTACGATGCGAGCATCTACGATCAGTC_x000D_
</textarea>
_x000D_
for inline elements:
<span style="width:100px; word-wrap:break-word; display:inline-block;"> _x000D_
ACTGATCGAGCTGAAGCGCAGTGCGATGCTTCGATGATGCTGACGATGCTACGATGCGAGCATCTACGATCAGTC_x000D_
</span>
_x000D_
&&
and ||
are what is called "short circuiting". That means that they will not evaluate the second operand if the first operand is enough to determine the value of the expression.
For example if the first operand to &&
is false then there is no point in evaluating the second operand, since it can't change the value of the expression (false && true
and false && false
are both false). The same goes for ||
when the first operand is true.
You can read more about this here: http://en.wikipedia.org/wiki/Short-circuit_evaluation From the table on that page you can see that &&
is equivalent to AndAlso
in VB.NET, which I assume you are referring to.
As an ArrayList
that line would be
import java.util.ArrayList;
...
ArrayList<Card> hand = new ArrayList<Card>();
To use the ArrayList
you have do
hand.get(i); //gets the element at position i
hand.add(obj); //adds the obj to the end of the list
hand.remove(i); //removes the element at position i
hand.add(i, obj); //adds the obj at the specified index
hand.set(i, obj); //overwrites the object at i with the new obj
Also read this http://docs.oracle.com/javase/6/docs/api/java/util/ArrayList.html
The Microsoft certification material addresses this same question. In the .NET world, the overhead for the StringBuilder object makes a simple concatenation of 2 String objects more efficient. I would assume a similar answer for Java strings.
Unlike an int
(whole number), a float
have a decimal point, and so can a double
.
But the difference between the two is that a double
is twice as detailed as a float
, meaning that it can have double the amount of numbers after the decimal point.
As your query string is a literal, and assuming your dates are properly stored as DATE
you should use date literals:
SELECT * FROM OrderArchive
WHERE OrderDate <= DATE '2015-12-31'
If you want to use TO_DATE
(because, for example, your query value is not a literal), I suggest you to explicitly set the NLS_DATE_LANGUAGE parameter as you are using US abbreviated month names. That way, it won't break on some localized Oracle Installation:
SELECT * FROM OrderArchive
WHERE OrderDate <= to_date('31 Dec 2014', 'DD MON YYYY',
'NLS_DATE_LANGUAGE = American');
As I did first preferably use SVG
images instead of all other types, If not possible compress all of your PNG
and JPG
resources using some image processing tools such as Adobe Photoshop
or Fotosizer
. one of the easiest ways is online image compressing tools like this which helped me to decrease all my image files to almost 50% of their initial size.
To expand upon Mr. Eels comment, you can do it like this:
File file = new File("C:\\A.txt");
FileWriter writer;
try {
writer = new FileWriter(file, true);
PrintWriter printer = new PrintWriter(writer);
printer.append("Sue");
printer.close();
} catch (IOException e) {
// TODO Auto-generated catch block
e.printStackTrace();
}
Don't say we ain't good to ya!
If you get this error on an .MDF
file in the APP_DATA
folder (or where ever you put it) for a Visual Studio project, the way I did it was to simply copy permissions from the existing DATA
folder here (I'm using SQL Express 2014 to support an older app):
C:\Program Files\Microsoft SQL Server\MSSQL12.SQLEXPRESS2014\MSSQL\DATA
(note: your actual install path my vary - especially if your instance name is different)
Double click on theDATA
folder first as administrator to make sure you have access, then open the properties on the folder and mimic the same for the APP_DATA
folder. In my case the missing user was MSSQL$SQLEXPRESS2014
(because I named the instance SQLEXPRESS2014
- yours may be different). That also happens to be the SQL Server service username.
I use moment for all my time manipulation/display needs (both client side, and node.js if you use it), if you just need a simple format the answers above will do, if you are looking for something a bit more complex, moment is the way to go IMO.
I solved it by writing
[self.navigationController presentViewController:viewController
animated:TRUE
completion:NULL];
The relationship of the object having this method and its collaborators is different.
compareTo()
is a method of the interface Comparable, so it is used to compare THIS instance to another one.
compare()
is a method of the interface Comparator, so it is used to compare two different instances of another class with each other.
If you will, implementing Comparable
means that instances of the class can be easily compared.
Implementing Comparator
means, that instances are suited to compare different objects (of other classes).
Swift 3 & IBInspectable solution:
Inspired by Ade's solution
First, create an UIView extension:
//
// UIView-Extension.swift
//
import Foundation
import UIKit
@IBDesignable
extension UIView {
// Shadow
@IBInspectable var shadow: Bool {
get {
return layer.shadowOpacity > 0.0
}
set {
if newValue == true {
self.addShadow()
}
}
}
fileprivate func addShadow(shadowColor: CGColor = UIColor.black.cgColor, shadowOffset: CGSize = CGSize(width: 3.0, height: 3.0), shadowOpacity: Float = 0.35, shadowRadius: CGFloat = 5.0) {
let layer = self.layer
layer.masksToBounds = false
layer.shadowColor = shadowColor
layer.shadowOffset = shadowOffset
layer.shadowRadius = shadowRadius
layer.shadowOpacity = shadowOpacity
layer.shadowPath = UIBezierPath(roundedRect: layer.bounds, cornerRadius: layer.cornerRadius).cgPath
let backgroundColor = self.backgroundColor?.cgColor
self.backgroundColor = nil
layer.backgroundColor = backgroundColor
}
// Corner radius
@IBInspectable var circle: Bool {
get {
return layer.cornerRadius == self.bounds.width*0.5
}
set {
if newValue == true {
self.cornerRadius = self.bounds.width*0.5
}
}
}
@IBInspectable var cornerRadius: CGFloat {
get {
return self.layer.cornerRadius
}
set {
self.layer.cornerRadius = newValue
}
}
// Borders
// Border width
@IBInspectable
public var borderWidth: CGFloat {
set {
layer.borderWidth = newValue
}
get {
return layer.borderWidth
}
}
// Border color
@IBInspectable
public var borderColor: UIColor? {
set {
layer.borderColor = newValue?.cgColor
}
get {
if let borderColor = layer.borderColor {
return UIColor(cgColor: borderColor)
}
return nil
}
}
}
Then, simply select your UIView in interface builder setting shadow ON and corner radius, like below:
The result!
Most devices have some form of emulated storage. if they support sd cards they are usually mounted to /sdcard
(or some variation of that name) which is usually symlinked to to a directory in /storage
like /storage/sdcard0
or /storage/0
sometimes the emulated storage is mounted to /sdcard
and the actual path is something like /storage/emulated/legacy. You should be able to use to get the downloads directory. You are best off using the api calls to get directories.
Environment.getExternalStoragePublicDirectory(Environment.DIRECTORY_DOWNLOADS);
Since the filesystems and sdcard support varies among devices.
see similar question for more info how to access downloads folder in android?
Usually the DownloadManager handles downloads and the files are then accessed by requesting the file's uri fromthe download manager using a file id to get where file was places which would usually be somewhere in the sdcard/ real or emulated since apps can only read data from certain places on the filesystem outside of their data directory like the sdcard
<!DOCTYPE html>
<html>
<head>
<title>Dynamical Add/Remove Text Box</title>
<script language="javascript">
localStorage.i = Number(1);
function myevent(action)
{
var i = Number(localStorage.i);
var div = document.createElement('div');
if(action.id == "add")
{
localStorage.i = Number(localStorage.i) + Number(1);
var id = i;
div.id = id;
div.innerHTML = 'TextBox_'+id+': <input type="text" name="tbox_'+id+'"/>' + ' <input type="button" id='+id+' onclick="myevent(this)" value="Delete" />';
document.getElementById('AddDel').appendChild(div);
}
else
{
var element = document.getElementById(action.id);
element.parentNode.removeChild(element);
}
}
</script>
</head>
<body>
<fieldset>
<legend>Dynamical Add / Remove Text Box</legend>
<form>
<div id="AddDel">
Default TextBox:
<input type="text" name="default_tb">
<input type="button" id="add" onclick="myevent(this)" value="Add" />
</div>
<input type="button" type="submit" value="Submit Data" />
</form>
</fieldset>
</body>
</html>
There is, indeed, prevision for such feature, look http://www.w3.org/TR/css3-values/#attr-notation
This fiddle should work like what you need, but will not for now.
Unfortunately, it's still a draft, and isn't fully implemented on major browsers.
It does work for content
on pseudo-elements, though.
Just create a button element with jQuery, and add the event handler when you create it :
var div = $('<div />', {'data-role' : 'fieldcontain'}),
btn = $('<input />', {
type : 'button',
value : 'Dynamic Button',
id : 'btn_a',
on : {
click: function() {
alert ( this.value );
}
}
});
div.append(btn).appendTo( $('#pg_menu_content').empty() );
If you mean the screen where you have that interpreter prompt >>>
you can do CTRL+L on Bash shell can help. Windows does not have equivalent. You can do
import os
os.system('cls') # on windows
or
os.system('clear') # on linux / os x
They differ in spelling only. There is no difference in what they refer to. To be technical you could say they differ in emphasis. Non blocking refers to control flow(it doesn't block.) Asynchronous refers to when the event\data is handled(not synchronously.)
If you are new to IntelliJ u May take some time to understand IntelliJ. If a Code has written in Java and using cucumber framework then we have two main files -
Goal : what are things we have defined in feature file it must be navigate towards Step Definition File. (Ctrl +click ) Note :feature file has to contain some colourful gherkins keywords too .if it’s not follow the below steps
Solution : go to file >>settings >> plugins - search “Cucumber for Java” Add the plugin restart IntelliJ it will work for sure .
You can right-click on the project, click on export, type 'jar', choose 'Runnable JAR File Export'. There you have the option 'Extract required libraries into generated JAR'.
I am researching module usage in python just now and thought I would answer the question Markus asks in the comments above ("How to import variables when they are embedded in modules?") from two perspectives:
Here is how I would rewrite the main program f1.py to demonstrate variable reuse for Markus:
import f2
myStorage = f2.useMyVars(0) # initialze class and properties
for i in range(0,10):
print "Hello, "
f2.print_world()
myStorage.setMyVar(i)
f2.inc_gMyVar()
print "Display class property myVar:", myStorage.getMyVar()
print "Display global variable gMyVar:", f2.get_gMyVar()
Here is how I would rewrite the reusable module f2.py:
# Module: f2.py
# Example 1: functions to store and retrieve global variables
gMyVar = 0
def print_world():
print "World!"
def get_gMyVar():
return gMyVar # no need for global statement
def inc_gMyVar():
global gMyVar
gMyVar += 1
# Example 2: class methods to store and retrieve properties
class useMyVars(object):
def __init__(self, myVar):
self.myVar = myVar
def getMyVar(self):
return self.myVar
def setMyVar(self, myVar):
self.myVar = myVar
def print_helloWorld(self):
print "Hello, World!"
When f1.py is executed here is what the output would look like:
%run "f1.py"
Hello,
World!
Hello,
World!
Hello,
World!
Hello,
World!
Hello,
World!
Hello,
World!
Hello,
World!
Hello,
World!
Hello,
World!
Hello,
World!
Display class property myVar: 9
Display global variable gMyVar: 10
I think the point to Markus would be:
Also take a look at awesome project aqtinstall
https://github.com/miurahr/aqtinstall/ (it can install any Qt version on Linux, Mac and Windows machines without any interaction!) and GitHub Action that uses this tool: https://github.com/jurplel/install-qt-action
You should add yourself to the Developer Tools group. The general syntax for adding a user to a group in OS X is as follows:
sudo dscl . append /Groups/<group> GroupMembership <username>
I believe the name for the DevTools group is _developer
.
I'd try just installing the tools and database services to start with. leave analysis, Rs etc and see if you get further. I do remeber having issues with failed installs so be sure to go into add/remove programs and remove all the pieces that the uninstaller is leaving behind
Download and install Eclipse, and you're good to go.
http://www.eclipse.org/downloads/
Apple provides its own version of Java, so make sure it's up-to-date.
http://developer.apple.com/java/download/
Eclipse is an integrated development environment. It has many features, but the ones that are relevant for you at this stage is:
As you gain more experience, you'll start to appreciate the rest of its rich set of features.
Just subtract the two datetime values and multiply by 24:
Select Cast((@DateTime2 - @DateTime1) as Float) * 24.0
a test script might be:
Declare @Dt1 dateTime Set @Dt1 = '12 Jan 2009 11:34:12'
Declare @Dt2 dateTime Set @Dt2 = getdate()
Select Cast((@Dt2 - @Dt1) as Float) * 24.0
This works because all datetimes are stored internally as a pair of integers, the first integer is the number of days since 1 Jan 1900, and the second integer (representing the time) is the number of (1) ticks since Midnight. (For SmallDatetimes the time portion integer is the number of minutes since midnight). Any arithmetic done on the values uses the time portion as a fraction of a day. 6am = 0.25, noon = 0.5, etc... See MSDN link here for more details.
So Cast((@Dt2 - @Dt1) as Float) gives you total days between two datetimes. Multiply by 24 to convert to hours. If you need total minutes, Multiple by Minutes per day (24 * 60 = 1440) instead of 24...
NOTE 1: This is not the same as a dotNet or javaScript tick - this tick is about 3.33 milliseconds.
EDIT: Thanks for the comments - I looked it up in the C99 standard, which says in section 6.5.3.4:
The value of the result is implementation-defined, and its type (an unsigned integer type) is
size_t
, defined in<stddef.h>
(and other headers)
So, the size of size_t
is not specified, only that it has to be an unsigned integer type. However, an interesting specification can be found in chapter 7.18.3 of the standard:
limit of
size_t
SIZE_MAX 65535
Which basically means that, irrespective of the size of size_t
, the allowed value range is from 0-65535, the rest is implementation dependent.
We have following steps:
First you need to install typescript
npm install -g typescript
Create one file helloworld.ts
function hello(person){
return "Hello, " + person;
}
let user = "Aamod Tiwari";
const result = hello(user);
console.log("Result", result)
Open command prompt and type the following command
tsc helloworld.ts
Again run the command
node helloworld.js
Result will display on console
DisplayMetrics lDisplayMetrics = getResources().getDisplayMetrics();
int widthPixels = lDisplayMetrics.widthPixels;
int heightPixels = lDisplayMetrics.heightPixels;
Just throwing this in in case it helps, I had this issue and the reason for me was because when I bundled my Angular stuff I referenced the main app file as "AngularWebApp" instead of "AngularWebApp.js", hope this helps.
You can create a pre-filled form URL from within the Form Editor, as described in the documentation for Drive Forms. You'll end up with a URL like this, for example:
https://docs.google.com/forms/d/--form-id--/viewform?entry.726721210=Mike+Jones&entry.787184751=1975-05-09&entry.1381372492&entry.960923899
In this example, question 1, "Name", has an ID of 726721210
, while question 2, "Birthday" is 787184751
. Questions 3 and 4 are blank.
You could generate the pre-filled URL by adapting the one provided through the UI to be a template, like this:
function buildUrls() {
var template = "https://docs.google.com/forms/d/--form-id--/viewform?entry.726721210=##Name##&entry.787184751=##Birthday##&entry.1381372492&entry.960923899";
var ss = SpreadsheetApp.getActive().getSheetByName("Sheet1"); // Email, Name, Birthday
var data = ss.getDataRange().getValues();
// Skip headers, then build URLs for each row in Sheet1.
for (var i = 1; i < data.length; i++ ) {
var url = template.replace('##Name##',escape(data[i][1]))
.replace('##Birthday##',data[i][2].yyyymmdd()); // see yyyymmdd below
Logger.log(url); // You could do something more useful here.
}
};
This is effective enough - you could email the pre-filled URL to each person, and they'd have some questions already filled in.
Instead of creating our template using brute force, we can piece it together programmatically. This will have the advantage that we can re-use the code without needing to remember to change the template.
Each question in a form is an item. For this example, let's assume the form has only 4 questions, as you've described them. Item [0]
is "Name", [1]
is "Birthday", and so on.
We can create a form response, which we won't submit - instead, we'll partially complete the form, only to get the pre-filled form URL. Since the Forms API understands the data types of each item, we can avoid manipulating the string format of dates and other types, which simplifies our code somewhat.
(EDIT: There's a more general version of this in How to prefill Google form checkboxes?)
/**
* Use Form API to generate pre-filled form URLs
*/
function betterBuildUrls() {
var ss = SpreadsheetApp.getActive();
var sheet = ss.getSheetByName("Sheet1");
var data = ss.getDataRange().getValues(); // Data for pre-fill
var formUrl = ss.getFormUrl(); // Use form attached to sheet
var form = FormApp.openByUrl(formUrl);
var items = form.getItems();
// Skip headers, then build URLs for each row in Sheet1.
for (var i = 1; i < data.length; i++ ) {
// Create a form response object, and prefill it
var formResponse = form.createResponse();
// Prefill Name
var formItem = items[0].asTextItem();
var response = formItem.createResponse(data[i][1]);
formResponse.withItemResponse(response);
// Prefill Birthday
formItem = items[1].asDateItem();
response = formItem.createResponse(data[i][2]);
formResponse.withItemResponse(response);
// Get prefilled form URL
var url = formResponse.toPrefilledUrl();
Logger.log(url); // You could do something more useful here.
}
};
Any date item in the pre-filled form URL is expected to be in this format: yyyy-mm-dd
. This helper function extends the Date object with a new method to handle the conversion.
When reading dates from a spreadsheet, you'll end up with a javascript Date object, as long as the format of the data is recognizable as a date. (Your example is not recognizable, so instead of May 9th 1975
you could use 5/9/1975
.)
// From http://blog.justin.kelly.org.au/simple-javascript-function-to-format-the-date-as-yyyy-mm-dd/
Date.prototype.yyyymmdd = function() {
var yyyy = this.getFullYear().toString();
var mm = (this.getMonth()+1).toString(); // getMonth() is zero-based
var dd = this.getDate().toString();
return yyyy + '-' + (mm[1]?mm:"0"+mm[0]) + '-' + (dd[1]?dd:"0"+dd[0]);
};
Dim
and Private
work the same, though the common convention is to use Private
at the module level, and Dim
at the Sub/Function level. Public
and Global
are nearly identical in their function, however Global
can only be used in standard modules, whereas Public
can be used in all contexts (modules, classes, controls, forms etc.) Global
comes from older versions of VB and was likely kept for backwards compatibility, but has been wholly superseded by Public
.
I had this problem with no detectable lock files. I found the solution here: http://schooner.uwaterloo.ca/twiki/bin/view/MAG/HgLockError
Here is a transcript from Tortoise Hg Workbench console
% hg debuglocks
lock: user None, process 7168, host HPv32 (114213199s)
wlock: free
[command returned code 1 Sat Jan 07 18:00:18 2017]
% hg debuglocks --force-lock
[command completed successfully Sat Jan 07 18:03:15 2017]
cmdserver: Process crashed
PaniniDev% hg debuglocks
% hg debuglocks
lock: free
wlock: free
[command completed successfully Sat Jan 07 18:03:30 2017]
After this the aborted pull ran sucessfully.
The lock had been set more than 2 years ago, by a process on a machine that is no longer on the LAN. Shame on the hg developers for a) not documenting locks adequately; b) not timestamping them for automatic removal when they get stale.
IPA Format:
xcodebuild -exportArchive -exportFormat IPA -archivePath MyMobileApp.xcarchive -exportPath MyMobileApp.ipa -exportProvisioningProfile 'MyMobileApp Distribution Profile'
Exports the archive MyMobileApp.xcarchive as an IPA file to the path MyMobileApp.ipa using the provisioning profile MyMobileApp Distribution Profile.
APP Format:
xcodebuild -exportArchive -exportFormat APP -archivePath MyMacApp.xcarchive -exportPath MyMacApp.pkg -exportSigningIdentity 'Developer ID Application: My Team'
Exports the archive MyMacApp.xcarchive as a PKG file to the path MyMacApp.pkg using the appli-cation application cation signing identity Developer ID Application: My Team. The installer signing identity Developer ID Installer: My Team is implicitly used to sign the exported package.
System.out.println(NumberFormat.getNumberInstance(Locale.US).format(35634646));
Output: 35,634,646
You have to make the number to string in order to take length
var num = 123;
alert((num + "").length);
or
alert(num.toString().length);
public String CamelCase(String str)
{
String CamelCase="";
String parts[] = str.split("_");
for(String part:parts)
{
String as=part.toLowerCase();
int a=as.length();
CamelCase = CamelCase + as.substring(0, 1).toUpperCase()+ as.substring(1,a);
}
return CamelCase;
}
This is the Simplest Program to convert into CamelCase. hope it Will Help You..
You will want to verify whatever your calling is valid. For example, in the case of a specific function, you will want to check and see if the function exists:
function doIt($callback) {
if(function_exists($callback)) {
$callback();
} else {
// some error handling
}
}
If you wish to replace/overwrite the content of a file in your current branch with the content of the file from a previous commit or a different branch, you can do so with these commands:
git checkout 08618129e66127921fbfcbc205a06153c92622fe path/to/file.txt
or
git checkout mybranchname path/to/file.txt
You will then have to commit those changes in order for them to be effective in the current branch.
Lots of good answers but strange that no one has mentioned using a lambda
function.
So if you have no arguments, things become pretty trivial:
def method1():
return 'hello world'
def method2(methodToRun):
result = methodToRun()
return result
method2(method1)
But say you have one (or more) arguments in method1
:
def method1(param):
return 'hello ' + str(param)
def method2(methodToRun):
result = methodToRun()
return result
Then you can simply invoke method2
as method2(lambda: method1('world'))
.
method2(lambda: method1('world'))
>>> hello world
method2(lambda: method1('reader'))
>>> hello reader
I find this much cleaner than the other answers mentioned here.
What is your reason for excluding all transitive dependencies?
If there is a particular artifact (such as commons-logging) which you need to exclude from every dependency, the Version 99 Does Not Exist approach might help.
Update 2012: Don't use this approach. Use maven-enforcer-plugin and exclusions. Version 99 produces bogus dependencies and the Version 99 repository is offline (there are similar mirrors but you can't rely on them to stay online forever either; it's best to use only Maven Central).
Try this code, considers it only if you need the back button.
@Override
protected void onCreate(Bundle savedInstanceState) {
super.onCreate(savedInstanceState);
//YOUR CODE
getSupportActionBar().setDisplayHomeAsUpEnabled(true);
//YOUR CODE
}
@Override
public boolean onOptionsItemSelected(MenuItem item) {
onBackPressed();
return true;
}
This function will return a converted java date from SQL date object.
public static java.util.Date convertFromSQLDateToJAVADate(
java.sql.Date sqlDate) {
java.util.Date javaDate = null;
if (sqlDate != null) {
javaDate = new Date(sqlDate.getTime());
}
return javaDate;
}
you can implement a helper doing something like that :
public static LocalDateTime convertUTCFRtoUTCZ(LocalDateTime dateTime) {
ZoneId fr = ZoneId.of("Europe/Paris");
ZoneId utcZ = ZoneId.of("Z");
ZonedDateTime frZonedTime = ZonedDateTime.of(dateTime, fr);
ZonedDateTime utcZonedTime = frZonedTime.withZoneSameInstant(utcZ);
return utcZonedTime.toLocalDateTime();
}
The comparator should be only for the key, not for the whole entry. It sorts the entries based on the keys.
You should change it to something as follows
SortedMap<String, Double> myMap =
new TreeMap<String, Double>(new Comparator<String>()
{
public int compare(String o1, String o2)
{
return o1.compareTo(o2);
}
});
Update
You can do something as follows (create a list of entries in the map and sort the list base on value, but note this not going to sort the map itself) -
List<Map.Entry<String, Double>> entryList = new ArrayList<Map.Entry<String, Double>>(myMap.entrySet());
Collections.sort(entryList, new Comparator<Map.Entry<String, Double>>() {
@Override
public int compare(Entry<String, Double> o1, Entry<String, Double> o2) {
return o1.getValue().compareTo(o2.getValue());
}
});
Try this function...
function calculate_age(birth_month,birth_day,birth_year)
{
today_date = new Date();
today_year = today_date.getFullYear();
today_month = today_date.getMonth();
today_day = today_date.getDate();
age = today_year - birth_year;
if ( today_month < (birth_month - 1))
{
age--;
}
if (((birth_month - 1) == today_month) && (today_day < birth_day))
{
age--;
}
return age;
}
OR
function getAge(dateString)
{
var today = new Date();
var birthDate = new Date(dateString);
var age = today.getFullYear() - birthDate.getFullYear();
var m = today.getMonth() - birthDate.getMonth();
if (m < 0 || (m === 0 && today.getDate() < birthDate.getDate()))
{
age--;
}
return age;
}
Yes, this is something that you should worry about. Check the length of your objects with nrow(). R can auto-replicate objects so that they're the same length if they differ, which means you might be performing operations on mismatched data.
In this case you have an obvious flaw in that your subtracting aggregated data from raw data. These will definitely be of different lengths. I suggest that you merge them as time series (using the dates), then locf(), then do your subtraction. Otherwise merge them by truncating the original dates to the same interval as the aggregated series. Just be very careful that you don't drop observations.
Lastly, as some general advice as you get started: look at the result of your computations to see if they make sense. You might even pull them into a spreadsheet and replicate the results.
plt.hist(hmag, 30, range=[6.5, 12.5], facecolor='gray', align='mid')
Space variants:
<string name="space_demo">| | | |</string>
| SPACE | THIN SPACE | HAIR SPACE |
You can use this simply:
I'm using this function to check if the input int number is between 20 and 30
static boolean isValidInput(int input) {
return (input >= 20 && input <= 30);
}
Install
pip install Pillow
Then, Just import in your file like,
from PIL import Image
I am using windows. It is working for me.
NOTE:
Pillow is a functional drop-in replacement for the Python Imaging Library. To run your existing PIL-compatible code with Pillow, it needs to be modified to import the Imaging module from the PIL namespace instead of the global namespace.
i.e. change:
import Image
to:
from PIL import Image
 
is the numeric reference for the entity reference
— they are the exact same thing. It's likely your editor is simply inserting the numberic reference instead of the named one.
See the Wikipedia page for the non-breaking space.
Try updating the line to:
ocr.Init(@"C:\", "eng", false); // the path here should be the parent folder of tessdata
//Just add
RewriteBase /
//after
RewriteEngine On
//and you are done....
//so it should be
RewriteEngine On
RewriteBase /
RewriteCond %{REQUEST_FILENAME} !-d
RewriteCond %{REQUEST_FILENAME} !-f
RewriteRule ^ index.php [QSA,L]
With the current version of angular 2 you can't use '/' on a path or give a name to your route. What you can do is create a route file like "app.routes.ts" and import your components, make sure of the path when importing.
import { Component } from '@angular/core';
import { DashboardComponent } from './dashboard/dashboard.component';
import { ConfigManagerComponent } from './configManager/configManager.component';
import { ApplicationMgmtComponent } from './applicationMgmt/applicationMgmt.component';
import { MergeComponent } from './merge/merge.component';`
Add:
import {RouterConfig, provideRouter } from '@angular/router';
Then your routes:
const routes:RouterConfig = [
{ path: 'Dashboard', component: DashboardComponent },
{ path: 'ConfigManager', component: ConfigManagerComponent },
{ path: 'Merge', component: MergeComponent },
{ path: 'ApplicationManagement', component: ApplicationMgmtComponent }
];
Then export:
export const APP_ROUTER_PROVIDERS = [
provideRouter(routes)]
In your main.ts import APP_ROUTER_PROVIDERS
and add bootstrap the router providers to the main.ts like this:
bootstrap(AppComponent,[APP_ROUTER_PROVIDERS]);
Finally, your link will look like this:
li class="nav hidden-xs"><a [routerLink]="['./Dashboard']" routerLinkActive="active">Dashboard</a>/li>
SQL Server databases use two files - an MDF file, known as the primary database file, which contains the schema and data, and a LDF file, which contains the logs. See wikipedia. A database may also use secondary database file, which normally uses a .ndf extension.
As John S. indicates, these file extensions are purely convention - you can use whatever you want, although I can't think of a good reason to do that.
More info on MSDN here and in Beginning SQL Server 2005 Administation (Google Books) here.
Actually you can fix it with following steps -
cls.__dict__
{'isFilled':True}
or {'isFilled':False}
depending upon what you have set.del cls.__dict__['isFilled']
In this case, we delete the entry which overrides the method as mentioned by BrenBarn.
You could use Date.parse()
You can read in MDN documentation
The Date.parse() method parses a string representation of a date, and returns the number of milliseconds since January 1, 1970, 00:00:00 UTC or NaN if the string is unrecognized or, in some cases, contains illegal date values (e.g. 2015-02-31).
And check if the result of Date.parse
isNaN
let isValidDate = Date.parse('01/29/1980');
if (isNaN(isValidDate)) {
// when is not valid date logic
return false;
}
// when is valid date logic
Please take a look when is recommended to use Date.parse
in MDN
I believe your code is analogous to the following, and you should not have expected the value to have changed for the same reason it wouldn't here:
public static void Main()
{
StringWrapper testVariable = new StringWrapper("before passing");
Console.WriteLine(testVariable);
TestI(testVariable);
Console.WriteLine(testVariable);
}
public static void TestI(StringWrapper testParameter)
{
testParameter = new StringWrapper("after passing");
// this will change the object that testParameter is pointing/referring
// to but it doesn't change testVariable unless you use a reference
// parameter as indicated in other answers
}
Right click on project >> Click on properties >> Java Build Path >> Source >> Add Folder
Usually this can be done by using a function pointer, that is a special variable that points to the memory location of a function. You can then use this to call the function with specific arguments. So there will probably be a function that sets the callback function. This will accept a function pointer and then store that address somewhere where it can be used. After that when the specified event is triggered, it will call that function.
If the number of list items is fixed you can use the adjacent selector, e.g. if you only have three <li>
elements, you can select the last <li>
with:
#nav li+li+li {
border-bottom: 1px solid #b5b5b5;
}
As you continue to decouple your classes and invert your dependencies, the classes continue to stay small and the "dependency graph" continues to grow in size. (This isn't bad.) Using basic features of an IoC container makes wiring up all these objects trivial, but doing it manually can get very burdensome. For example, what if I want to create a new instance of "Foo" but it needs a "Bar". And a "Bar" needs an "A", "B", and "C". And each of those need 3 other things, etc etc. (yes, I can't come up with good fake names :) ).
Using an IoC container to build your object graph for you reduces complexity a ton and pushes it out into one-time configuration. I simply say "create me a 'Foo'" and it figures out what's needed to build one.
Some people use the IoC containers for much more infrastructure, which is fine for advanced scenarios but in those cases I agree it can obfuscate and make code hard to read and debug for new devs.
<?php
/*******************************
* author : [email protected]
* version : 3.8
* create on : 2017-09-17
* updated on : 2020-01-12
* download example: https://github.com/hishamdalal/overloadable
*****************************/
#> 1. Include Overloadable class
class Overloadable
{
static function call($obj, $method, $params=null) {
$class = get_class($obj);
// Get real method name
$suffix_method_name = $method.self::getMethodSuffix($method, $params);
if (method_exists($obj, $suffix_method_name)) {
// Call method
return call_user_func_array(array($obj, $suffix_method_name), $params);
}else{
throw new Exception('Tried to call unknown method '.$class.'::'.$suffix_method_name);
}
}
static function getMethodSuffix($method, $params_ary=array()) {
$c = '__';
if(is_array($params_ary)){
foreach($params_ary as $i=>$param){
// Adding special characters to the end of method name
switch(gettype($param)){
case 'array': $c .= 'a'; break;
case 'boolean': $c .= 'b'; break;
case 'double': $c .= 'd'; break;
case 'integer': $c .= 'i'; break;
case 'NULL': $c .= 'n'; break;
case 'object':
// Support closure parameter
if($param instanceof Closure ){
$c .= 'c';
}else{
$c .= 'o';
}
break;
case 'resource': $c .= 'r'; break;
case 'string': $c .= 's'; break;
case 'unknown type':$c .= 'u'; break;
}
}
}
return $c;
}
// Get a reference variable by name
static function &refAccess($var_name) {
$r =& $GLOBALS["$var_name"];
return $r;
}
}
//----------------------------------------------------------
#> 2. create new class
//----------------------------------------------------------
class test
{
private $name = 'test-1';
#> 3. Add __call 'magic method' to your class
// Call Overloadable class
// you must copy this method in your class to activate overloading
function __call($method, $args) {
return Overloadable::call($this, $method, $args);
}
#> 4. Add your methods with __ and arg type as one letter ie:(__i, __s, __is) and so on.
#> methodname__i = methodname($integer)
#> methodname__s = methodname($string)
#> methodname__is = methodname($integer, $string)
// func(void)
function func__() {
pre('func(void)', __function__);
}
// func(integer)
function func__i($int) {
pre('func(integer '.$int.')', __function__);
}
// func(string)
function func__s($string) {
pre('func(string '.$string.')', __function__);
}
// func(string, object)
function func__so($string, $object) {
pre('func(string '.$string.', '.print_r($object, 1).')', __function__);
//pre($object, 'Object: ');
}
// func(closure)
function func__c(Closure $callback) {
pre("func(".
print_r(
array( $callback, $callback($this->name) ),
1
).");", __function__.'(Closure)'
);
}
// anotherFunction(array)
function anotherFunction__a($array) {
pre('anotherFunction('.print_r($array, 1).')', __function__);
$array[0]++; // change the reference value
$array['val']++; // change the reference value
}
// anotherFunction(string)
function anotherFunction__s($key) {
pre('anotherFunction(string '.$key.')', __function__);
// Get a reference
$a2 =& Overloadable::refAccess($key); // $a2 =& $GLOBALS['val'];
$a2 *= 3; // change the reference value
}
}
//----------------------------------------------------------
// Some data to work with:
$val = 10;
class obj {
private $x=10;
}
//----------------------------------------------------------
#> 5. create your object
// Start
$t = new test;
#> 6. Call your method
// Call first method with no args:
$t->func();
// Output: func(void)
$t->func($val);
// Output: func(integer 10)
$t->func("hello");
// Output: func(string hello)
$t->func("str", new obj());
/* Output:
func(string str, obj Object
(
[x:obj:private] => 10
)
)
*/
// call method with closure function
$t->func(function($n){
return strtoupper($n);
});
/* Output:
func(Array
(
[0] => Closure Object
(
[parameter] => Array
(
[$n] =>
)
)
[1] => TEST-1
)
);
*/
## Passing by Reference:
echo '<br><br>$val='.$val;
// Output: $val=10
$t->anotherFunction(array(&$val, 'val'=>&$val));
/* Output:
anotherFunction(Array
(
[0] => 10
[val] => 10
)
)
*/
echo 'Result: $val='.$val;
// Output: $val=12
$t->anotherFunction('val');
// Output: anotherFunction(string val)
echo 'Result: $val='.$val;
// Output: $val=36
// Helper function
//----------------------------------------------------------
function pre($mixed, $title=null){
$output = "<fieldset>";
$output .= $title ? "<legend><h2>$title</h2></legend>" : "";
$output .= '<pre>'. print_r($mixed, 1). '</pre>';
$output .= "</fieldset>";
echo $output;
}
//----------------------------------------------------------
this example may be useful:
<html>_x000D_
<head>_x000D_
<script src="https://ajax.googleapis.com/ajax/libs/jquery/1.8.1/jquery.min.js"></script>_x000D_
</head>_x000D_
<body>_x000D_
<input id="test" type="text" />_x000D_
<button onclick="testF()" >click</button>_x000D_
_x000D_
_x000D_
<script>_x000D_
function testF(){_x000D_
_x000D_
alert($('#test').attr('value'));_x000D_
alert( $('#test').prop('value'));_x000D_
alert($('#test').val());_x000D_
}_x000D_
</script>_x000D_
</body>_x000D_
</html>
_x000D_
in above example, everything works perfectly. but if you change the version of jquery to 1.9.1 or newer in script tag you will see "undefined" in the first alert. attr('value') doesn't work with jquery version 1.9.1 or newer.
You can do
$('video').trigger('play');
$('video').trigger('pause');
I would recommend using rgba(255,255,255,0)
because broken (newest) safari thinks that if you are using transparent
or rgba(0,0,0,0)
in linear-gradent you really mean gray
, For more info please head to - What happens in Safari with the transparent color?
If you are doing complex, async input validation it might be worth it to abstract ng-model
up one level as part of a custom class with its own validation methods.
https://plnkr.co/edit/gUnUjs0qHQwkq2vPZlpO?p=preview
html
<div>
<label for="a">input a</label>
<input
ng-class="{'is-valid': vm.store.a.isValid == true, 'is-invalid': vm.store.a.isValid == false}"
ng-keyup="vm.store.a.validate(['isEmpty'])"
ng-model="vm.store.a.model"
placeholder="{{vm.store.a.isValid === false ? vm.store.a.warning : ''}}"
id="a" />
<label for="b">input b</label>
<input
ng-class="{'is-valid': vm.store.b.isValid == true, 'is-invalid': vm.store.b.isValid == false}"
ng-keyup="vm.store.b.validate(['isEmpty'])"
ng-model="vm.store.b.model"
placeholder="{{vm.store.b.isValid === false ? vm.store.b.warning : ''}}"
id="b" />
</div>
code
(function() {
const _ = window._;
angular
.module('app', [])
.directive('componentLayout', layout)
.controller('Layout', ['Validator', Layout])
.factory('Validator', function() { return Validator; });
/** Layout controller */
function Layout(Validator) {
this.store = {
a: new Validator({title: 'input a'}),
b: new Validator({title: 'input b'})
};
}
/** layout directive */
function layout() {
return {
restrict: 'EA',
templateUrl: 'layout.html',
controller: 'Layout',
controllerAs: 'vm',
bindToController: true
};
}
/** Validator factory */
function Validator(config) {
this.model = null;
this.isValid = null;
this.title = config.title;
}
Validator.prototype.isEmpty = function(checkName) {
return new Promise((resolve, reject) => {
if (/^\s+$/.test(this.model) || this.model.length === 0) {
this.isValid = false;
this.warning = `${this.title} cannot be empty`;
reject(_.merge(this, {test: checkName}));
}
else {
this.isValid = true;
resolve(_.merge(this, {test: checkName}));
}
});
};
/**
* @memberof Validator
* @param {array} checks - array of strings, must match defined Validator class methods
*/
Validator.prototype.validate = function(checks) {
Promise
.all(checks.map(check => this[check](check)))
.then(res => { console.log('pass', res) })
.catch(e => { console.log('fail', e) })
};
})();
I found a simple way
TrustStrategy acceptingTrustStrategy = (X509Certificate[] chain, String authType) -> true;
SSLContext sslContext = org.apache.http.ssl.SSLContexts.custom().loadTrustMaterial(null, acceptingTrustStrategy).build();
SSLConnectionSocketFactory csf = new SSLConnectionSocketFactory(sslContext);
CloseableHttpClient httpClient = HttpClients.custom().setSSLSocketFactory(csf).build();
HttpComponentsClientHttpRequestFactory requestFactory = new HttpComponentsClientHttpRequestFactory();
requestFactory.setHttpClient(httpClient);
RestTemplate restTemplate = new RestTemplate(requestFactory);
Using CSS only:
Right/Left Flippiing: Working Fiddle
.Container
{
height: 200px;
overflow-x: auto;
}
.Content
{
height: 300px;
}
.Flipped
{
direction: rtl;
}
.Content
{
direction: ltr;
}
Top/Bottom Flipping: Working Fiddle
.Container
{
width: 200px;
overflow-y: auto;
}
.Content
{
width: 300px;
}
.Flipped, .Flipped .Content
{
transform:rotateX(180deg);
-ms-transform:rotateX(180deg); /* IE 9 */
-webkit-transform:rotateX(180deg); /* Safari and Chrome */
}
You are trying to install a package on the system-wide path without having the permission to do so.
In general, you can use sudo
to temporarily obtain superuser
permissions at your responsibility in order to install the package on the system-wide path:
sudo pip install -r requirements.txt
Find more about sudo
here.
Actually, this is a bad idea and there's no good use case for it, see @wim's comment.
If you don't want to make system-wide changes, you can install the package on your per-user path using the --user
flag.
All it takes is:
pip install --user runloop requirements.txt
Finally, for even finer grained control, you can also use a virtualenv, which might be the superior solution for a development environment, especially if you are working on multiple projects and want to keep track of each one's dependencies.
After activating your virtualenv with
$ my-virtualenv/bin/activate
the following command will install the package inside the virtualenv (and not on the system-wide path):
pip install -r requirements.txt
std::string s(v.begin(), v.end());
Where v is pretty much anything iterable. (Specifically begin() and end() must return InputIterators.)
SELECT CAST(CAST('000000000' AS INTEGER) AS VARCHAR)
This has a limit on the length of the string that can be converted to an INT
I'd say
chunks = [data[x:x+100] for x in range(0, len(data), 100)]
If you are using python 2.x instead of 3.x, you can be more memory-efficient by using xrange()
, changing the above code to:
chunks = [data[x:x+100] for x in xrange(0, len(data), 100)]
System.Diagnostics.Process.Start( "notepad.exe", "text.txt");
the above script may not run in ksh. you have to use the 'let' opparand to assing the value and then echo it.
val1=4
val2=3
let val3=$val1+$val2
echo $val3
Also you may omit the AS keyword.
SELECT row1 Price, row2 'Other Price' FROM exampleDB.table1;
in this option readability is a bit degraded but you have desired result.
I can see great answers, so there's no need to repeat here, so I'd like to offer some advice:
I would recommend using a Unix Timestamp integer instead of a human-readable date format to handle time internally, then use PHP's date()
function to convert the timestamp value into a human-readable date format for user display. Here's a crude example of how it should be done:
// Get unix timestamp in seconds
$current_time = date();
// Or if you need millisecond precision
// Get unix timestamp in milliseconds
$current_time = microtime(true);
Then use $current_time
as needed in your app (store, add or subtract, etc), then when you need to display the date value it to your users, you can use date()
to specify your desired date format:
// Display a human-readable date format
echo date('d-m-Y', $current_time);
This way you'll avoid much headache dealing with date formats, conversions and timezones, as your dates will be in a standardized format (Unix Timestamp) that is compact, timezone-independent (always in UTC) and widely supported in programming languages and databases.
Add this WRITE_EXTERNAL_STORAGE permission to your applications manifest.
<?xml version="1.0" encoding="utf-8"?>
<manifest xmlns:android="http://schemas.android.com/apk/res/android"
package="your.company.package"
android:versionCode="1"
android:versionName="0.1">
<application android:icon="@drawable/icon" android:label="@string/app_name">
<!-- ... -->
</application>
<uses-sdk android:minSdkVersion="7" />
<uses-permission android:name="android.permission.WRITE_EXTERNAL_STORAGE" />
</manifest>
You should always check for availability first. A snippet from the official android documentation on external storage.
boolean mExternalStorageAvailable = false;
boolean mExternalStorageWriteable = false;
String state = Environment.getExternalStorageState();
if (Environment.MEDIA_MOUNTED.equals(state)) {
// We can read and write the media
mExternalStorageAvailable = mExternalStorageWriteable = true;
} else if (Environment.MEDIA_MOUNTED_READ_ONLY.equals(state)) {
// We can only read the media
mExternalStorageAvailable = true;
mExternalStorageWriteable = false;
} else {
// Something else is wrong. It may be one of many other states, but all we need
// to know is we can neither read nor write
mExternalStorageAvailable = mExternalStorageWriteable = false;
}
At last but not least forget about the FileOutputStream
and use a FileWriter
instead. More information on that class form the FileWriter javadoc. You'll might want to add some more error handling here to inform the user.
// get external storage file reference
FileWriter writer = new FileWriter(getExternalStorageDirectory());
// Writes the content to the file
writer.write("This\n is\n an\n example\n");
writer.flush();
writer.close();
Below JS function you can use to filter the row based on some specified columns see searchColumn array. It is taken from w3 school and little bit customised to search and filter on the given list of column.
HTML Structure
<input style="float: right" type="text" id="myInput" onkeyup="myFunction()" placeholder="Search" title="Type in a name">
<table id ="myTable">
<thead class="head">
<tr>
<th>COL 1</th>
<th>CoL 2</th>
<th>COL 3</th>
<th>COL 4</th>
<th>COL 5</th>
<th>COL 6</th>
</tr>
</thead>
<tbody>
<tr>
<td></td>
<td></td>
<td></td>
<td></td>
<td></td>
<td></td>
</tr>
</tbody>
</tbody>
function myFunction() {
var input, filter, table, tr, td, i;
input = document.getElementById("myInput");
filter = input.value.toUpperCase();
table = document.getElementById("myTable");
tr = table.getElementsByTagName("tr");
var searchColumn=[0,1,3,4]
for (i = 0; i < tr.length; i++) {
if($(tr[i]).parent().attr('class')=='head')
{
continue;
}
var found = false;
for(var k=0;k<searchColumn.length;k++){
td = tr[i].getElementsByTagName("td")[searchColumn[k]];
if (td) {
if (td.innerHTML.toUpperCase().indexOf(filter) > -1 ) {
found=true;
}
}
}
if(found==true) {
tr[i].style.display = "";
}
else{
tr[i].style.display = "none";
}
}
}
It's not necessary to remove relative path. Just change the version parent of springframework boot. The following version 2.1.2 works successfully.
<?xml version="1.0" encoding="UTF-8"?>
<project xmlns="http://maven.apache.org/POM/4.0.0" xmlns:xsi="http://www.w3.org/2001/XMLSchema-instance"
xsi:schemaLocation="http://maven.apache.org/POM/4.0.0 http://maven.apache.org/xsd/maven-4.0.0.xsd">
<modelVersion>4.0.0</modelVersion>
<parent>
<groupId>org.springframework.boot</groupId>
<artifactId>spring-boot-starter-parent</artifactId>
<version>2.1.2.RELEASE</version>
<relativePath/> <!-- lookup parent from repository -->
</parent>
<groupId>com.appsdeveloperblog.app.ws</groupId>
<artifactId>mobile-app-ws</artifactId>
<version>0.0.1-SNAPSHOT</version>
<name>mobile-app-ws</name>
<description>Demo project for Spring Boot</description>
<properties>
<java.version>1.8</java.version>
</properties>
<dependencies>
<dependency>
<groupId>org.springframework.boot</groupId>
<artifactId>spring-boot-starter-web</artifactId>
</dependency>
<dependency>
<groupId>org.springframework.boot</groupId>
<artifactId>spring-boot-starter-test</artifactId>
<scope>test</scope>
</dependency>
<dependency>
<groupId>com.appsdeveloperblog.app.ws</groupId>
<artifactId>mobile-app-ws</artifactId>
<version>0.0.1-SNAPSHOT</version>
</dependency>
</dependencies>
<build>
<plugins>
<plugin>
<groupId>org.springframework.boot</groupId>
<artifactId>spring-boot-maven-plugin</artifactId>
</plugin>
</plugins>
</build>
</project>
string s = "" + 2;
and you can do nice things like:
string s = 2 + 2 + "you"
The result will be:
"4 you"
In your viewDidLoad
, register at notification center to listen to this opened from background action
NotificationCenter.default.addObserver(self, selector:#selector(doSomething), name: NSNotification.Name.UIApplicationWillEnterForeground, object: nil)
Then add this function and perform needed action
func doSomething(){
//...
}
Finally add this function to clean up the notification observer when your view controller is destroyed.
deinit {
NotificationCenter.default.removeObserver(self)
}
You can't simple cast a plain-old-JavaScript result from an Ajax request into a prototypical JavaScript/TypeScript class instance. There are a number of techniques for doing it, and generally involve copying data. Unless you create an instance of the class, it won't have any methods or properties. It will remain a simple JavaScript object.
While if you only were dealing with data, you could just do a cast to an interface (as it's purely a compile time structure), this would require that you use a TypeScript class which uses the data instance and performs operations with that data.
Some examples of copying the data:
In essence, you'd just :
var d = new MyRichObject();
d.copyInto(jsonResult);
You can add listener all video events nicluding ended, loadedmetadata, timeupdate
where ended
function gets called when video ends
$("#myVideo").on("ended", function() {_x000D_
//TO DO: Your code goes here..._x000D_
alert("Video Finished");_x000D_
});_x000D_
_x000D_
$("#myVideo").on("loadedmetadata", function() {_x000D_
alert("Video loaded");_x000D_
this.currentTime = 50;//50 seconds_x000D_
//TO DO: Your code goes here..._x000D_
});_x000D_
_x000D_
_x000D_
$("#myVideo").on("timeupdate", function() {_x000D_
var cTime=this.currentTime;_x000D_
if(cTime>0 && cTime % 2 == 0)//Alerts every 2 minutes once_x000D_
alert("Video played "+cTime+" minutes");_x000D_
//TO DO: Your code goes here..._x000D_
var perc=cTime * 100 / this.duration;_x000D_
if(perc % 10 == 0)//Alerts when every 10% watched_x000D_
alert("Video played "+ perc +"%");_x000D_
});
_x000D_
<!DOCTYPE html>_x000D_
<html>_x000D_
_x000D_
<head>_x000D_
<script src="https://ajax.googleapis.com/ajax/libs/jquery/2.1.1/jquery.min.js"></script>_x000D_
</head>_x000D_
_x000D_
<body>_x000D_
_x000D_
<video id="myVideo" controls="controls">_x000D_
<source src="your_video_file.mp4" type="video/mp4">_x000D_
<source src="your_video_file.mp4" type="video/ogg">_x000D_
Your browser does not support HTML5 video._x000D_
</video>_x000D_
_x000D_
</body>_x000D_
_x000D_
</html>
_x000D_
I met this issue this morning because I used the same executable in DIFFERENT OSes: after compiling my program with gcc -ggdb -Wall test.c -o test
in my Mac(10.15.2), I ran gdb
with the executable in Ubuntu(16.04) in my VirtualBox.
Fix: recompile with the same command under Ubuntu, then you should be good.
If you have arrived at this question because IntelliSense has stopped working properly and you are hoping to force it to show you what you need, then most likely none of these solutions are going to work.
Closing and restarting Visual Studio should fix the problem.
cat script.sh
var1=$1
var2=$2
if [ "$#" -eq 2 ]
then
if [ -d $var1 ]
then
echo directory ${var1} exist
else
echo Directory ${var1} Does not exists
fi
if [ -d $var2 ]
then
echo directory ${var2} exist
else
echo Directory ${var2} Does not exists
fi
else
echo "Arguments are not equals to 2"
exit 1
fi
execute it like below -
./script.sh directory1 directory2
Output will be like -
directory1 exit
directory2 Does not exists
Let's say you have:
<a></a>
<(.*)>
would match a></a
where as <(.*?)>
would match a
.
The latter stops after the first match of >
. It checks for one
or 0 matches of .*
followed by the next expression.
The first expression <(.*)>
doesn't stop when matching the first >
. It will continue until the last match of >
.
Add this line before main function:
void swapCase (char* name);
int main()
{
...
swapCase(name); // swapCase prototype should be known at this point
...
}
This is called forward declaration: compiler needs to know function prototype when function call is compiled.
No, it's not possible.
It's really, if not use native selects, if you create custom select widget from html elements, t.e. "li".
Use XStream(http://x-stream.github.io/). You can even control which properties you can ignore through annotations or explicitly specifying the property name to XStream class. Moreover you do not need to implement clonable interface.
I was facing some problem from SQL PLUS Command Promt.
So I resolve this issue from windows CMD ,I follow such steps--->
1: open CMD (Windows)
2: type show pdbs;
now u have to unmount the data base which is mounted
3: type alter pluggable database database_Name open;
4: type show pdbs;(for cross check)
It works for me
Google is depreciating C2DM, but in its place their introducing GCM (Google Cloud Messaging) I dont think theirs any quota and its free! It does require Android 2.2+ though! http://developer.android.com/guide/google/gcm/index.html
Most of the answers above describe very nicely how contents are being served. What I was looking as additional was listing of the directory so that other contents of the directory can be browsed. Here is my solution for further readers:
'use strict';
var finalhandler = require('finalhandler');
var http = require('http');
var serveIndex = require('serve-index');
var serveStatic = require('serve-static');
var appRootDir = require('app-root-dir').get();
var log = require(appRootDir + '/log/bunyan.js');
var PORT = process.env.port || 8097;
// Serve directory indexes for reports folder (with icons)
var index = serveIndex('reports/', {'icons': true});
// Serve up files under the folder
var serve = serveStatic('reports/');
// Create server
var server = http.createServer(function onRequest(req, res){
var done = finalhandler(req, res);
serve(req, res, function onNext(err) {
if (err)
return done(err);
index(req, res, done);
})
});
server.listen(PORT, log.info('Server listening on: ', PORT));
This creates a "See Also" heading containing the link, i.e.:
/**
* @see <a href="http://google.com">http://google.com</a>
*/
will render as:
See Also:
http://google.com
whereas this:
/**
* See <a href="http://google.com">http://google.com</a>
*/
will create an in-line link:
For having a trasition effect like a highlighter just to highlight the text and fade off the bg color, we used the following:
.field-error {_x000D_
color: #f44336;_x000D_
padding: 2px 5px;_x000D_
position: absolute;_x000D_
font-size: small;_x000D_
background-color: white;_x000D_
}_x000D_
_x000D_
.highlighter {_x000D_
animation: fadeoutBg 3s; /***Transition delay 3s fadeout is class***/_x000D_
-moz-animation: fadeoutBg 3s; /* Firefox */_x000D_
-webkit-animation: fadeoutBg 3s; /* Safari and Chrome */_x000D_
-o-animation: fadeoutBg 3s; /* Opera */_x000D_
}_x000D_
_x000D_
@keyframes fadeoutBg {_x000D_
from { background-color: lightgreen; } /** from color **/_x000D_
to { background-color: white; } /** to color **/_x000D_
}_x000D_
_x000D_
@-moz-keyframes fadeoutBg { /* Firefox */_x000D_
from { background-color: lightgreen; }_x000D_
to { background-color: white; }_x000D_
}_x000D_
_x000D_
@-webkit-keyframes fadeoutBg { /* Safari and Chrome */_x000D_
from { background-color: lightgreen; }_x000D_
to { background-color: white; }_x000D_
}_x000D_
_x000D_
@-o-keyframes fadeoutBg { /* Opera */_x000D_
from { background-color: lightgreen; }_x000D_
to { background-color: white; }_x000D_
}
_x000D_
<div class="field-error highlighter">File name already exists.</div>
_x000D_
Here is a one-liner solution that works for as low as minSdkVersion 14
which you should insert in you res/styles.xml
:
<item name="android:windowAnimationStyle">@null</item>
like so:
<resources>
<!-- Base application theme. -->
<style name="AppTheme" parent="Theme.AppCompat.Light.NoActionBar">
...
<item name="android:windowAnimationStyle">@null</item>
</style>
...
</resources>
Cheers!
function saveAs(uri, filename) {
var link = document.createElement('a');
if (typeof link.download === 'string') {
document.body.appendChild(link); // Firefox requires the link to be in the body
link.download = filename;
link.href = uri;
link.click();
document.body.removeChild(link); // remove the link when done
} else {
location.replace(uri);
}
}
Depends on what you want to do with it I guess. If you just want to write some normal text you can use .fillText()
.
Working for Xamarin.Android:
Class:
public class FontsOverride
{
public static void SetDefaultFont(Context context, string staticTypefaceFieldName, string fontAssetName)
{
Typeface regular = Typeface.CreateFromAsset(context.Assets, fontAssetName);
ReplaceFont(staticTypefaceFieldName, regular);
}
protected static void ReplaceFont(string staticTypefaceFieldName, Typeface newTypeface)
{
try
{
Field staticField = ((Java.Lang.Object)(newTypeface)).Class.GetDeclaredField(staticTypefaceFieldName);
staticField.Accessible = true;
staticField.Set(null, newTypeface);
}
catch (Exception e)
{
Console.WriteLine(e.Message);
}
}
}
Application Implementation:
namespace SomeAndroidApplication
{
[Application]
public class App : Application
{
public App()
{
}
public App(IntPtr handle, JniHandleOwnership transfer)
: base(handle, transfer)
{
}
public override void OnCreate()
{
base.OnCreate();
FontsOverride.SetDefaultFont(this, "MONOSPACE", "fonts/Roboto-Light.ttf");
}
}
}
Style:
<style name="Theme.Storehouse" parent="Theme.Sherlock">
<item name="android:typeface">monospace</item>
</style>
I just installed Visual Studio Code v1.25.1. on a Windows 7 Professional SP1 machine. I wanted to understand workspaces in detail, so I spent a few hours figuring out how they work in this version of Visual Studio Code. I thought the results of my research might be of interest to the community.
First, workspaces are referred to by Microsoft in the Visual Studio Code documentation as "multi-root workspaces." In plain English that means "a multi-folder (A.K.A "root") work environment." A Visual Studio Code workspace is simply a collection of folders - any collection you desire, in any order you wish. The typical collection of folders constitutes a software development project. However, a folder collection could be used for anything else for which software code is being developed.
The mechanics behind how Visual Studio Code handles workspaces is a bit complicated. I think the quickest way to convey what I learned is by giving you a set of instructions that you can use to see how workspaces work on your computer. I am assuming that you are starting with a fresh install of Visual Studio Code v1.25.1. If you are using a production version of Visual Studio Code I don't recommend that you follow my instructions because you may lose some or all of your existing Visual Studio Code configuration! If you already have a test version of Visual Studio Code v1.25.1 installed, **and you are willing to lose any configuration that already exists, the following must be done to revert your Visual Studio Code to a fresh installation state:
Delete the following folder (if it exists):
C:\Users\%username%\AppData\Roaming\Code\Workspaces (where "%username%" is the name of the currently logged-on user)
You will be adding folders to Visual Studio Code to create a new workspace. If any of the folders you intend to use to create this new workspace have previously been used with Visual Studio Code, please delete the ".vscode" subfolder (if it exists) within each of the folders that will be used to create the new workspace.
Launch Visual Studio Code. If the Welcome page is displayed, close it. Do the same for the Panel (a horizontal pane) if it is displayed. If you received a message that Git isn't installed click "Remind me later." If displayed, also close the "Untitled" code page that was launched as the default code page. If the Explorer pane is not displayed click "View" on the main menu then click "Explorer" to display the Explorer pane. Inside the Explorer pane you should see three (3) View headers - Open Editors, No Folder Opened, and Outline (located at the very bottom of the Explorer pane). Make sure that, at a minimum, the open editors and no folder opened view headers are displayed.
Visual Studio Code displays a button that reads "Open Folder." Click this button and select a folder of your choice. Visual Studio Code will refresh and the name of your selected folder will have replaced the "No Folder Opened" View name. Any folders and files that exist within your selected folder will be displayed beneath the View name.
Now open the Visual Studio Code Preferences Settings file. There are many ways to do this. I'll use the easiest to remember which is menu File → Preferences → Settings. The Settings file is displayed in two columns. The left column is a read-only listing of the default values for every Visual Studio Code feature. The right column is used to list the three (3) types of user settings. At this point in your test only two user settings will be listed - User Settings and Workspace Settings. The User Settings is displayed by default. This displays the contents of your User Settings .json file. To find out where this file is located, simply hover your mouse over the "User Settings" listing that appears under the OPEN EDITORS View in Explorer. This listing in the OPEN EDITORS View is automatically selected when the "User Settings" option in the right column is selected. The path should be:
C:\Users\%username%\AppData\Roaming\Code\User\settings.json
This settings.json file is where the User Settings for Visual Studio Code are stored.
Now click the Workspace Settings option in the right column of the Preferences listing. When you do this, a subfolder named ".vscode" is automatically created in the folder you added to Explore a few steps ago. Look at the listing of your folder in Explorer to confirm that the .vscode subfolder has been added. Inside the new .vscode subfolder is another settings.json file. This file contains the workspace settings for the folder you added to Explorer a few steps ago.
At this point you have a single folder whose User Settings are stored at:
C:\Users\%username%\AppData\Roaming\Code\User\settings.json
and whose Workspace Settings are stored at:
C:\TheLocationOfYourFolder\settings.json
This is the configuration when a single folder is added to a new installation of Visual Studio Code. Things get messy when we add a second (or greater) folder. That's because we are changing Visual Studio Code's User Settings and Workspace Settings to accommodate multiple folders. In a single-folder environment only two settings.json files are needed as listed above. But in a multi-folder environment a .vscode subfolder is created in each folder added to Explorer and a new file, "workspaces.json," is created to manage the multi-folder environment. The new "workspaces.json" file is created at:
c:\Users\%username%\AppData\Roaming\Code\Workspaces\%workspace_id%\workspaces.json
The "%workspaces_id%" is a folder with a unique all-number name.
In the Preferences right column there now appears three user setting options - User Settings, Workspace Settings, and Folder Settings. The function of User Settings remains the same as for a single-folder environment. However, the settings file behind the Workspace Settings has been changed from the settings.json file in the single folder's .vscode subfolder to the workspaces.json file located at the workspaces.json file path shown above. The settings.json file located in each folder's .vscode subfolder is now controlled by a third user setting, Folder Options. This is a drop-down selection list that allows for the management of each folder's settings.json file located in each folder's .vscode subfolder. Please note: the .vscode subfolder will not be created in newly-added explorer folders until the newly-added folder has been selected at least once in the folder options user setting.
Notice that the Explorer single folder name has bee changed to "UNTITLED (WORKSPACE)." This indicates the following:
The full functionality of Visual Studio Code workspaces is only realized when a workspace is saved as a file that can be reloaded as needed. This provides the capability to create unique multi-folder workspaces (e.g., projects) and save them as files for later use! To do this select menu File → Save Workspace As from the main menu and save the current workspace configuration as a unique workspace file. If you need to create a workspace "from scratch," first save your current workspace configuration (if needed) then right-click each Explorer folder name and click "Remove Folder from Workspace." When all folders have been removed from the workspace, add the folders you require for your new workspace. When you finish adding new folders, simply save the new workspace as a new workspace file.
An important note - Visual Studio Code doesn't "revert" to single-folder mode when only one folder remains in Explorer or when all folders have been removed from Explorer when creating a new workspace "from scratch." The multi-folder workspace configuration that utilizes three user preferences remains in effect. This means that unless you follow the instructions at the beginning of this post, Visual Studio Code can never be returned to a single-folder mode of operation - it will always remain in multi-folder workspace mode.
If you have to test more than one string in the same validation, you can do something like this:
import java.util.Optional;
import java.util.function.Predicate;
import java.util.stream.Stream;
public class StringHelper {
public static Boolean hasBlank(String ... strings) {
Predicate<String> isBlank = s -> s == null || s.trim().isEmpty();
return Optional
.ofNullable(strings)
.map(Stream::of)
.map(stream -> stream.anyMatch(isBlank))
.orElse(false);
}
}
So, you can use this like StringHelper.hasBlank("Hello", null, "", " ")
or StringHelper.hasBlank("Hello")
in a generic form.
This is what I am using,
Intent intent = new Intent(android.content.Intent.ACTION_VIEW,
Uri.parse("http://maps.google.com/maps?saddr="+latitude_cur+","+longitude_cur+"&daddr="+latitude+","+longitude));
intent.addFlags(Intent.FLAG_ACTIVITY_NEW_TASK);
intent.addCategory(Intent.CATEGORY_LAUNCHER );
intent.setClassName("com.google.android.apps.maps", "com.google.android.maps.MapsActivity");
startActivity(intent);
Canvas zoom and pan
<!DOCTYPE html>_x000D_
<html>_x000D_
<body>_x000D_
_x000D_
<canvas id="myCanvas" width="" height=""_x000D_
style="border:1px solid #d3d3d3;">_x000D_
Your browser does not support the canvas element._x000D_
</canvas>_x000D_
_x000D_
<script>_x000D_
console.log("canvas")_x000D_
var ox=0,oy=0,px=0,py=0,scx=1,scy=1;_x000D_
var canvas = document.getElementById("myCanvas");_x000D_
canvas.onmousedown=(e)=>{px=e.x;py=e.y;canvas.onmousemove=(e)=>{ox-=(e.x-px);oy-=(e.y-py);px=e.x;py=e.y;} } _x000D_
_x000D_
canvas.onmouseup=()=>{canvas.onmousemove=null;}_x000D_
canvas.onwheel =(e)=>{let bfzx,bfzy,afzx,afzy;[bfzx,bfzy]=StoW(e.x,e.y);scx-=10*scx/e.deltaY;scy-=10*scy/e.deltaY;_x000D_
[afzx,afzy]=StoW(e.x,e.y);_x000D_
ox+=(bfzx-afzx);_x000D_
oy+=(bfzy-afzy);_x000D_
}_x000D_
var ctx = canvas.getContext("2d");_x000D_
_x000D_
function draw(){_x000D_
window.requestAnimationFrame(draw);_x000D_
ctx.clearRect(0,0,canvas.width,canvas.height);_x000D_
for(let i=0;i<=100;i+=10){_x000D_
let sx=0,sy=i;_x000D_
let ex=100,ey=i;_x000D_
[sx,sy]=WtoS(sx,sy);_x000D_
[ex,ey]=WtoS(ex,ey);_x000D_
ctx.beginPath();_x000D_
ctx.moveTo(sx, sy);_x000D_
ctx.lineTo(ex, ey);_x000D_
ctx.stroke();_x000D_
}_x000D_
for(let i=0;i<=100;i+=10){_x000D_
let sx=i,sy=0;_x000D_
let ex=i,ey=100;_x000D_
[sx,sy]=WtoS(sx,sy);_x000D_
[ex,ey]=WtoS(ex,ey);_x000D_
ctx.beginPath();_x000D_
ctx.moveTo(sx, sy);_x000D_
ctx.lineTo(ex, ey);_x000D_
ctx.stroke();_x000D_
}_x000D_
}_x000D_
draw()_x000D_
function WtoS(wx,wy){_x000D_
let sx=(wx-ox)*scx;_x000D_
let sy=(wy-oy)*scy;_x000D_
return[sx,sy];_x000D_
}_x000D_
function StoW(sx,sy){_x000D_
let wx=sx/scx+ox;_x000D_
let wy=sy/scy+oy;_x000D_
return[wx,wy];_x000D_
}_x000D_
_x000D_
</script>_x000D_
_x000D_
</body>_x000D_
</html>
_x000D_
The bootstrap 3 documentation lists this under helper classes:
Muted
, Primary
, Success
, Info
, Warning
, Danger
.
The bootstrap 4 documentation lists this under utilities -> color, and has more options:
primary
, secondary
, success
, danger
, warning
, info
, light
, dark
, muted
, white
.
To access them one uses the class
text-[class-name]
So, if I want the primary text color for example I would do something like this:
<p class="text-primary">This text is the primary color.</p>
This is not a huge number of choices, but it's some.
here all the important shortcuts from another question answered on stack overflow
If you would like to perform it dynamically try this:
using System;
using System.Collections.Generic;
using System.Text;
using log4net;
using log4net.Config;
using NUnit.Framework;
namespace ExampleConsoleApplication
{
enum DebugLevel : int
{
Fatal_Msgs = 0 ,
Fatal_Error_Msgs = 1 ,
Fatal_Error_Warn_Msgs = 2 ,
Fatal_Error_Warn_Info_Msgs = 3 ,
Fatal_Error_Warn_Info_Debug_Msgs = 4
}
class TestClass
{
private static readonly ILog logger = LogManager.GetLogger(typeof(TestClass));
static void Main ( string[] args )
{
TestClass objTestClass = new TestClass ();
Console.WriteLine ( " START " );
int shouldLog = 4; //CHANGE THIS FROM 0 TO 4 integer to check the functionality of the example
//0 -- prints only FATAL messages
//1 -- prints FATAL and ERROR messages
//2 -- prints FATAL , ERROR and WARN messages
//3 -- prints FATAL , ERROR , WARN and INFO messages
//4 -- prints FATAL , ERROR , WARN , INFO and DEBUG messages
string srtLogLevel = String.Empty;
switch (shouldLog)
{
case (int)DebugLevel.Fatal_Msgs :
srtLogLevel = "FATAL";
break;
case (int)DebugLevel.Fatal_Error_Msgs:
srtLogLevel = "ERROR";
break;
case (int)DebugLevel.Fatal_Error_Warn_Msgs :
srtLogLevel = "WARN";
break;
case (int)DebugLevel.Fatal_Error_Warn_Info_Msgs :
srtLogLevel = "INFO";
break;
case (int)DebugLevel.Fatal_Error_Warn_Info_Debug_Msgs :
srtLogLevel = "DEBUG" ;
break ;
default:
srtLogLevel = "FATAL";
break;
}
objTestClass.SetLogingLevel ( srtLogLevel );
objTestClass.LogSomething ();
Console.WriteLine ( " END HIT A KEY TO EXIT " );
Console.ReadLine ();
} //eof method
/// <summary>
/// Activates debug level
/// </summary>
/// <sourceurl>http://geekswithblogs.net/rakker/archive/2007/08/22/114900.aspx</sourceurl>
private void SetLogingLevel ( string strLogLevel )
{
string strChecker = "WARN_INFO_DEBUG_ERROR_FATAL" ;
if (String.IsNullOrEmpty ( strLogLevel ) == true || strChecker.Contains ( strLogLevel ) == false)
throw new Exception ( " The strLogLevel should be set to WARN , INFO , DEBUG ," );
log4net.Repository.ILoggerRepository[] repositories = log4net.LogManager.GetAllRepositories ();
//Configure all loggers to be at the debug level.
foreach (log4net.Repository.ILoggerRepository repository in repositories)
{
repository.Threshold = repository.LevelMap[ strLogLevel ];
log4net.Repository.Hierarchy.Hierarchy hier = (log4net.Repository.Hierarchy.Hierarchy)repository;
log4net.Core.ILogger[] loggers = hier.GetCurrentLoggers ();
foreach (log4net.Core.ILogger logger in loggers)
{
( (log4net.Repository.Hierarchy.Logger)logger ).Level = hier.LevelMap[ strLogLevel ];
}
}
//Configure the root logger.
log4net.Repository.Hierarchy.Hierarchy h = (log4net.Repository.Hierarchy.Hierarchy)log4net.LogManager.GetRepository ();
log4net.Repository.Hierarchy.Logger rootLogger = h.Root;
rootLogger.Level = h.LevelMap[ strLogLevel ];
}
private void LogSomething ()
{
#region LoggerUsage
DOMConfigurator.Configure (); //tis configures the logger
logger.Debug ( "Here is a debug log." );
logger.Info ( "... and an Info log." );
logger.Warn ( "... and a warning." );
logger.Error ( "... and an error." );
logger.Fatal ( "... and a fatal error." );
#endregion LoggerUsage
}
} //eof class
} //eof namespace
The app config:
<?xml version="1.0" encoding="utf-8" ?>
<configuration>
<configSections>
<section name="log4net"
type="log4net.Config.Log4NetConfigurationSectionHandler, log4net" />
</configSections>
<log4net>
<appender name="LogFileAppender" type="log4net.Appender.FileAppender">
<param name="File" value="LogTest2.txt" />
<param name="AppendToFile" value="true" />
<layout type="log4net.Layout.PatternLayout">
<param name="Header" value="[Header] \r\n" />
<param name="Footer" value="[Footer] \r\n" />
<param name="ConversionPattern" value="%d [%t] %-5p %c %m%n" />
</layout>
</appender>
<appender name="ColoredConsoleAppender" type="log4net.Appender.ColoredConsoleAppender">
<mapping>
<level value="ERROR" />
<foreColor value="White" />
<backColor value="Red, HighIntensity" />
</mapping>
<layout type="log4net.Layout.PatternLayout">
<conversionPattern value="%date [%thread] %-5level %logger [%property{NDC}] - %message%newline" />
</layout>
</appender>
<appender name="AdoNetAppender" type="log4net.Appender.AdoNetAppender">
<connectionType value="System.Data.SqlClient.SqlConnection, System.Data, Version=1.2.10.0, Culture=neutral, PublicKeyToken=b77a5c561934e089" />
<connectionString value="data source=ysg;initial catalog=DBGA_DEV;integrated security=true;persist security info=True;" />
<commandText value="INSERT INTO [DBGA_DEV].[ga].[tb_Data_Log] ([Date],[Thread],[Level],[Logger],[Message]) VALUES (@log_date, @thread, @log_level, @logger, @message)" />
<parameter>
<parameterName value="@log_date" />
<dbType value="DateTime" />
<layout type="log4net.Layout.PatternLayout" value="%date{yyyy'-'MM'-'dd HH':'mm':'ss'.'fff}" />
</parameter>
<parameter>
<parameterName value="@thread" />
<dbType value="String" />
<size value="255" />
<layout type="log4net.Layout.PatternLayout" value="%thread" />
</parameter>
<parameter>
<parameterName value="@log_level" />
<dbType value="String" />
<size value="50" />
<layout type="log4net.Layout.PatternLayout" value="%level" />
</parameter>
<parameter>
<parameterName value="@logger" />
<dbType value="String" />
<size value="255" />
<layout type="log4net.Layout.PatternLayout" value="%logger" />
</parameter>
<parameter>
<parameterName value="@message" />
<dbType value="String" />
<size value="4000" />
<layout type="log4net.Layout.PatternLayout" value="%messag2e" />
</parameter>
</appender>
<root>
<level value="INFO" />
<appender-ref ref="LogFileAppender" />
<appender-ref ref="AdoNetAppender" />
<appender-ref ref="ColoredConsoleAppender" />
</root>
</log4net>
</configuration>
The references in the csproj file:
<Reference Include="log4net, Version=1.2.10.0, Culture=neutral, PublicKeyToken=1b44e1d426115821, processorArchitecture=MSIL">
<SpecificVersion>False</SpecificVersion>
<HintPath>..\..\..\Log4Net\log4net-1.2.10\bin\net\2.0\release\log4net.dll</HintPath>
</Reference>
<Reference Include="nunit.framework, Version=2.4.8.0, Culture=neutral, PublicKeyToken=96d09a1eb7f44a77, processorArchitecture=MSIL" />
You're doing only one mistake.
use replaceAll()
function over there.
e.g.
String str = "Hi";
String str1 = "hello";
str.replaceAll( str, str1 );
The Elvis (?.) Optional Chaining Operator is supported in TypeScript 3.7.
You can use it to check for null values: cats?.miows
returns null if cats is null or undefined.
You can also use it for optional method calling: cats.doMiow?.(5)
will call doMiow if it exists.
Property access is also possible: cats?.['miows']
.
Reference: https://devblogs.microsoft.com/typescript/announcing-typescript-3-7-beta/
This is a String, not a json structure(key, value), try:
return new ResponseEntity("{"vale" : "This is a String"}", HttpStatus.OK);
Apologize for resurrect this thread, but for Windows 8.x users can find my.cnf at this folder:
C:\ProgramData\MySQL\MySQL Server 5.6\my.ini
Then also can find data folder on same folder.
I assume that you use distinct like a method call on a list. You need to use the result of the query as datasource for your DropDownList, for example by materializing it via ToList
.
var distinctCategories = product
.Select(m => new {m.CategoryId, m.CategoryName})
.Distinct()
.ToList();
DropDownList1.DataSource = distinctCategories;
DropDownList1.DataTextField = "CategoryName";
DropDownList1.DataValueField = "CategoryId";
Another way if you need the real objects instead of the anonymous type with only few properties is to use GroupBy
with an anonymous type:
List<Product> distinctProductList = product
.GroupBy(m => new {m.CategoryId, m.CategoryName})
.Select(group => group.First()) // instead of First you can also apply your logic here what you want to take, for example an OrderBy
.ToList();
A third option is to use MoreLinq's DistinctBy
.
DEPARTMENT_CODE is not a column that exists in the table Team. Check the DDL of the table to find the proper column name.
Change the key of the component.
<Component key="1" />
<Component key="2" />
Component will be unmounted and a new instance of Component will be mounted since the key has changed.
edit: Documented on You Probably Don't Need Derived State:
When a key changes, React will create a new component instance rather than update the current one. Keys are usually used for dynamic lists but are also useful here.
I wanted to do the same thing. The best I could find was @MicTech's solution. However, as pointed out by @MotoWilliams this does not survive any updates made by Git to the .gitconfig file which replaces the link with a new file containing only the new settings.
I solved this by writing the following PowerShell script and running it in my profile startup script. Each time it is run it copies any settings that have been added to the user's .gitconfig to the global one and then replaces all the text in the .gitconfig file with and [include] header that imports the global file.
I keep the global .gitconfig file in a repo along with a lot of other global scripts and tools. All I have to do is remember to check in any changes that the script appends to my global file.
This seems to work pretty transparently for me. Hope it helps!
Sept 9th: Updated to detect when new entries added to the config file are duplicates and ignore them. This is useful for tools like SourceTree which will write new updates if they cannot find existing ones and do not follow includes.
function git-config-update
{
$localPath = "$env:USERPROFILE\.gitconfig".replace('\', "\\")
$globalPath = "C:\src\github\Global\Git\gitconfig".replace('\', "\\")
$redirectAutoText = "# Generated file. Do not edit!`n[include]`n path = $globalPath`n`n"
$localText = get-content $localPath
$diffs = (compare-object -ref $redirectAutoText.split("`n") -diff ($localText) |
measure-object).count
if ($diffs -eq 0)
{
write-output ".gitconfig unchanged."
return
}
$skipLines = 0
$diffs = (compare-object -ref ($redirectAutoText.split("`n") |
select -f 3) -diff ($localText | select -f 3) | measure-object).count
if ($diffs -eq 0)
{
$skipLines = 4
write-warning "New settings appended to $localPath...`n "
}
else
{
write-warning "New settings found in $localPath...`n "
}
$localLines = (get-content $localPath | select -Skip $skipLines) -join "`n"
$newSettings = $localLines.Split(@("["), [StringSplitOptions]::RemoveEmptyEntries) |
where { ![String]::IsNullOrWhiteSpace($_) } | %{ "[$_".TrimEnd() }
$globalLines = (get-content $globalPath) -join "`n"
$globalSettings = $globalLines.Split(@("["), [StringSplitOptions]::RemoveEmptyEntries)|
where { ![String]::IsNullOrWhiteSpace($_) } | %{ "[$_".TrimEnd() }
$appendSettings = ($newSettings | %{ $_.Trim() } |
where { !($globalSettings -contains $_.Trim()) })
if ([string]::IsNullOrWhitespace($appendSettings))
{
write-output "No new settings found."
}
else
{
echo $appendSettings
add-content $globalPath ("`n# Additional settings added from $env:COMPUTERNAME on " + (Get-Date -displayhint date) + "`n" + $appendSettings)
}
set-content $localPath $redirectAutoText -force
}
Twitter has a public API which returns JSON, for example -
A GET
request to:
https://api.twitter.com/1/statuses/user_timeline.json?include_entities=true&include_rts=true&screen_name=mralexgray&count=1
,
EDIT: Removed due to twitter restricting their API with OAUTH
requirements...
{"errors": [{"message": "The Twitter REST API v1 is no longer active. Please migrate to API v1.1. https://dev.twitter.com/docs/api/1.1/overview.", "code": 68}]}
Replacing it with a simple example of the Github API - that returns a tree, of in this case, my repositories...
I won't include the output, as it's long.. (returns 30 repos at a time) ... But here is proof of it's tree-ed-ness.
Another solution, besides the ondes already mentioned (using layout
or par(xpd=TRUE)
) is to overlay your plot with a transparent plot over the entire device and then add the legend to that.
The trick is to overlay a (empty) graph over the complete plotting area and adding the legend to that. We can use the par(fig=...)
option. First we instruct R to create a new plot over the entire plotting device:
par(fig=c(0, 1, 0, 1), oma=c(0, 0, 0, 0), mar=c(0, 0, 0, 0), new=TRUE)
Setting oma
and mar
is needed since we want to have the interior of the plot cover the entire device. new=TRUE
is needed to prevent R from starting a new device. We can then add the empty plot:
plot(0, 0, type='n', bty='n', xaxt='n', yaxt='n')
And we are ready to add the legend:
legend("bottomright", ...)
will add a legend to the bottom right of the device. Likewise, we can add the legend to the top or right margin. The only thing we need to ensure is that the margin of the original plot is large enough to accomodate the legend.
Putting all this into a function;
add_legend <- function(...) {
opar <- par(fig=c(0, 1, 0, 1), oma=c(0, 0, 0, 0),
mar=c(0, 0, 0, 0), new=TRUE)
on.exit(par(opar))
plot(0, 0, type='n', bty='n', xaxt='n', yaxt='n')
legend(...)
}
And an example. First create the plot making sure we have enough space at the bottom to add the legend:
par(mar = c(5, 4, 1.4, 0.2))
plot(rnorm(50), rnorm(50), col=c("steelblue", "indianred"), pch=20)
Then add the legend
add_legend("topright", legend=c("Foo", "Bar"), pch=20,
col=c("steelblue", "indianred"),
horiz=TRUE, bty='n', cex=0.8)
Resulting in:
If you do not want to use numpy,
sorted(range(len(seq)), key=seq.__getitem__)
is fastest, as demonstrated here.
NewLine (\n) is 10 (0xA) and CarriageReturn (\r) is 13 (0xD).
Different operating systems picked different end of line representations for files. Windows uses CRLF (\r\n). Unix uses LF (\n). Older Mac OS versions use CR (\r), but OS X switched to the Unix character.
Here is a relatively useful FAQ.
There is a free tool from theRightAPI that lets you test any HTTP based API. It also lets you save and share your test scenarios.
I think the Wikipedia-article on Deprecation answers this one pretty well:
In the process of authoring computer software, its standards or documentation, deprecation is a status applied to software features to indicate that they should be avoided, typically because they have been superseded. Although deprecated features remain in the software, their use may raise warning messages recommending alternative practices, and deprecation may indicate that the feature will be removed in the future. Features are deprecated—rather than immediately removed—in order to provide backward compatibility, and give programmers who have used the feature time to bring their code into compliance with the new standard.
Collections.reverse()
can do that job for you if you put your numbers in a List
of Integers
.
List<Integer> list = Arrays.asList(1, 4, 9, 16, 9, 7, 4, 9, 11);
System.out.println(list);
Collections.reverse(list);
System.out.println(list);
Output:
[1, 4, 9, 16, 9, 7, 4, 9, 11]
[11, 9, 4, 7, 9, 16, 9, 4, 1]
No, there's no direct not operator. At least not the way you hope for.
You can use a zero-width negative lookahead, however:
\((?!2001)[0-9a-zA-z _\.\-:]*\)
The (?!...)
part means "only match if the text following (hence: lookahead) this doesn't (hence: negative) match this. But it doesn't actually consume the characters it matches (hence: zero-width).
There are actually 4 combinations of lookarounds with 2 axes:
On Windows CE derived platforms, there are no iostream
s by default. The way to go there is preferaby with the _itoa<>
family, usually _itow<>
(since most string stuff are Unicode there anyway).
As elements are yet ordered, you don't have to build a map, there's a fast solution :
var newarr = [arr[0]];
for (var i=1; i<arr.length; i++) {
if (arr[i]!=arr[i-1]) newarr.push(arr[i]);
}
If your array weren't sorted, you would use a map :
var newarr = (function(arr){
var m = {}, newarr = []
for (var i=0; i<arr.length; i++) {
var v = arr[i];
if (!m[v]) {
newarr.push(v);
m[v]=true;
}
}
return newarr;
})(arr);
Note that this is, by far, much faster than the accepted answer.
quirksmode has a good description of the 'text-overflow' property, but you may need to apply some additional properties like 'white-space: nowrap'
Whilst I'm not 100% how this will behave in a select object, it could be worth trying this first:
vim
also can convert files from UNIX to DOS format. For example:
vim hello.txt <<EOF
:set fileformat=dos
:wq
EOF
The error is:
Can not deserialize instance of java.lang.String out of START_ARRAY token at [Source: line: 1, column: 1095] (through reference chain: JsonGen["platforms"])
In JSON, platforms
look like this:
"platforms": [
{
"platform": "iphone"
},
{
"platform": "ipad"
},
{
"platform": "android_phone"
},
{
"platform": "android_tablet"
}
]
So try change your pojo to something like this:
private List platforms;
public List getPlatforms(){
return this.platforms;
}
public void setPlatforms(List platforms){
this.platforms = platforms;
}
EDIT: you will need change mobile_networks
too. Will look like this:
private List mobile_networks;
public List getMobile_networks() {
return mobile_networks;
}
public void setMobile_networks(List mobile_networks) {
this.mobile_networks = mobile_networks;
}
have you tried eager loading?
@attachments = Job.includes(:attachments).find(1).attachments
You have a date with a known timezone (Here Europe/Madrid
), and a target timezone (UTC
)
You just need two SimpleDateFormats:
long ts = System.currentTimeMillis(); Date localTime = new Date(ts); SimpleDateFormat sdfLocal = new SimpleDateFormat ("yyyy/MM/dd HH:mm:ss"); sdfLocal.setTimeZone(TimeZone.getTimeZone("Europe/Madrid")); SimpleDateFormat sdfUTC = new SimpleDateFormat ("yyyy/MM/dd HH:mm:ss"); sdfUTC.setTimeZone(TimeZone.getTimeZone("UTC")); // Convert Local Time to UTC Date utcTime = sdfLocal.parse(sdfUTC.format(localTime)); System.out.println("Local:" + localTime.toString() + "," + localTime.getTime() + " --> UTC time:" + utcTime.toString() + "-" + utcTime.getTime()); // Reverse Convert UTC Time to Locale time localTime = sdfUTC.parse(sdfLocal.format(utcTime)); System.out.println("UTC:" + utcTime.toString() + "," + utcTime.getTime() + " --> Local time:" + localTime.toString() + "-" + localTime.getTime());
So after see it working you can add this method to your utils:
public Date convertDate(Date dateFrom, String fromTimeZone, String toTimeZone) throws ParseException { String pattern = "yyyy/MM/dd HH:mm:ss"; SimpleDateFormat sdfFrom = new SimpleDateFormat (pattern); sdfFrom.setTimeZone(TimeZone.getTimeZone(fromTimeZone)); SimpleDateFormat sdfTo = new SimpleDateFormat (pattern); sdfTo.setTimeZone(TimeZone.getTimeZone(toTimeZone)); Date dateTo = sdfFrom.parse(sdfTo.format(dateFrom)); return dateTo; }
If you're going to access your local computer (or any computer) using UNC, you'll need to setup a share. If you haven't already setup a share, you could use the default administrative shares. Example:
\\localhost\c$\my_dir
... accesses a folder called "my_dir" via UNC on your C: drive. By default all the hard drives on your machine are shared with hidden shares like c$, d$, etc.
Today there is a simpler way to do that.
Just create the .env.local file in your root directory and set the variables there. In your case:
REACT_APP_API_KEY = 'my-secret-api-key'
Then you call it en your js file in that way:
process.env.REACT_APP_API_KEY
React supports environment variables since [email protected] .You don't need external package to do that.
*note: I propose .env.local instead of .env because create-react-app add this file to gitignore when create the project.
Files priority:
npm start: .env.development.local, .env.development, .env.local, .env
npm run build: .env.production.local, .env.production, .env.local, .env
npm test: .env.test.local, .env.test, .env (note .env.local is missing)
More info: https://facebook.github.io/create-react-app/docs/adding-custom-environment-variables
Even if you remove the shared folder via net use * /del
, on the server side there is still a connection up there.
In order to get around this problem which Microsoft created by design you should map the drive in a way to let windows think it's another share on another server. The simplest way to do that is to use DNS aliases or ip addresses.
In your case, if your first mapping uses the ip address like \\IP\Share
with your current credential, you should use something like \\ServerName\Share password /user:Domain\Username
this should create a new share with the new credentials.
Microsoft call this behavior by design .. i call it just stupid design.
You can Implement this also:- setPage(1, n); where, n = any number.
$products = Mage::getResourceModel('catalog/product_collection')
->addAttributeToSelect('*')
->addAttributeToSelect(array('name', 'price', 'small_image'))
->addFieldToFilter('visibility', Mage_Catalog_Model_Product_Visibility::VISIBILITY_BOTH) //visible only catalog & searchable product
->addAttributeToFilter('status', 1) // enabled
->setStoreId($storeId)
->setOrder('created_at', 'desc')
->setPage(1, 6);
<td style="white-space: nowrap">
The nowrap
attribute I believe is deprecated. The above is the preferred way.
You need to use a date formatting function for example to_char http://www.postgresql.org/docs/current/static/functions-formatting.html
This gem adds a Boolean class to Ruby with useful methods.
https://github.com/RISCfuture/boolean
Use:
require 'boolean'
Then your
true.is_a?(Boolean)
false.is_a?(Boolean)
will work exactly as you expect.
It is possible to play a local video file.
<input type="file" accept="video/*"/>
<video controls autoplay></video>
When a file is selected via the input
element:
input.files
FileListvideo.src
propertyLean back and watch :)
http://jsfiddle.net/dsbonev/cCCZ2/embedded/result,js,html,css/
(function localFileVideoPlayer() {_x000D_
'use strict'_x000D_
var URL = window.URL || window.webkitURL_x000D_
var displayMessage = function(message, isError) {_x000D_
var element = document.querySelector('#message')_x000D_
element.innerHTML = message_x000D_
element.className = isError ? 'error' : 'info'_x000D_
}_x000D_
var playSelectedFile = function(event) {_x000D_
var file = this.files[0]_x000D_
var type = file.type_x000D_
var videoNode = document.querySelector('video')_x000D_
var canPlay = videoNode.canPlayType(type)_x000D_
if (canPlay === '') canPlay = 'no'_x000D_
var message = 'Can play type "' + type + '": ' + canPlay_x000D_
var isError = canPlay === 'no'_x000D_
displayMessage(message, isError)_x000D_
_x000D_
if (isError) {_x000D_
return_x000D_
}_x000D_
_x000D_
var fileURL = URL.createObjectURL(file)_x000D_
videoNode.src = fileURL_x000D_
}_x000D_
var inputNode = document.querySelector('input')_x000D_
inputNode.addEventListener('change', playSelectedFile, false)_x000D_
})()
_x000D_
video,_x000D_
input {_x000D_
display: block;_x000D_
}_x000D_
_x000D_
input {_x000D_
width: 100%;_x000D_
}_x000D_
_x000D_
.info {_x000D_
background-color: aqua;_x000D_
}_x000D_
_x000D_
.error {_x000D_
background-color: red;_x000D_
color: white;_x000D_
}
_x000D_
<h1>HTML5 local video file player example</h1>_x000D_
<div id="message"></div>_x000D_
<input type="file" accept="video/*" />_x000D_
<video controls autoplay></video>
_x000D_