Some of it is native, the rest is available through libraries.
For example Datejs is a good international date library.
For the rest, it's just about language translation, and JavaScript is natively Unicode compatible (as well as all major browsers).
If you have control of a backend and are using django, a 4 line implementation of Dan's idea is:
def get_browser_lang(request):
if request.META.has_key('HTTP_ACCEPT_LANGUAGE'):
return JsonResponse({'response': request.META['HTTP_ACCEPT_LANGUAGE']})
else:
return JsonResponse({'response': settings.DEFAULT_LANG})
then in urls.py:
url(r'^browserlang/$', views.get_browser_lang, name='get_browser_lang'),
and on the front end:
$.get(lg('SERVER') + 'browserlang/', function(data){
var lang_code = data.response.split(',')[0].split(';')[0].split('-')[0];
});
(you have to set DEFAULT_LANG in settings.py of course)
For those who are looking for PHP ( >5.3.5 ) PDO statement, we can set charset as per below:
$dbh = new PDO('mysql:host=localhost;dbname=testdb;charset=utf8', 'username', 'password');
The decision to use 1st January 1753 (1753-01-01
) as the minimum date value for a datetime in SQL Server goes back to its Sybase origins.
The significance of the date itself though can be attributed to this man.
Philip Stanhope, 4th Earl of Chesterfield. Who steered the Calendar (New Style) Act 1750 through the British Parliament. This legislated for the adoption of the Gregorian calendar for Britain and its then colonies.
There were some missing days (internet archive link) in the British calendar in 1752 when the adjustment was finally made from the Julian calendar. September 3, 1752 to September 13, 1752 were lost.
Kalen Delaney explained the choice this way
So, with 12 days lost, how can you compute dates? For example, how can you compute the number of days between October 12, 1492, and July 4, 1776? Do you include those missing 12 days? To avoid having to solve this problem, the original Sybase SQL Server developers decided not to allow dates before 1753. You can store earlier dates by using character fields, but you can't use any datetime functions with the earlier dates that you store in character fields.
The choice of 1753 does seem somewhat anglocentric however as many catholic countries in Europe had been using the calendar for 170 years before the British implementation (originally delayed due to opposition by the church). Conversely many countries did not reform their calendars until much later, 1918 in Russia. Indeed the October Revolution of 1917 started on 7 November under the Gregorian calendar.
Both datetime
and the new datetime2
datatype mentioned in Joe's answer do not attempt to account for these local differences and simply use the Gregorian Calendar.
So with the greater range of datetime2
SELECT CONVERT(VARCHAR, DATEADD(DAY,-5,CAST('1752-09-13' AS DATETIME2)),100)
Returns
Sep 8 1752 12:00AM
One final point with the datetime2
data type is that it uses the proleptic Gregorian calendar projected backwards to well before it was actually invented so is of limited use in dealing with historic dates.
This contrasts with other Software implementations such as the Java Gregorian Calendar class which defaults to following the Julian Calendar for dates until October 4, 1582 then jumping to October 15, 1582 in the new Gregorian calendar. It correctly handles the Julian model of leap year before that date and the Gregorian model after that date. The cutover date may be changed by the caller by calling setGregorianChange()
.
A fairly entertaining article discussing some more peculiarities with the adoption of the calendar can be found here.
You can do something like this:
NSString *bundlePath = [[NSBundle mainBundle] pathForResource:@"Localizable" ofType:@"strings" inDirectory:nil forLocalization:@"es"];
NSBundle *spanishBundle = [[NSBundle alloc] initWithPath:[bundlePath stringByDeletingLastPathComponent]];
NSLocalizedStringFromTableInBundle(@"House", nil, spanishBundle, nil):
If you have intl extension installed, you can use Transliterator::transliterate function to create a slug easily.
<?php
$string = 'Namnet på bildtävlingen';
$slug = \Transliterator::createFromRules(
':: Any-Latin;'
. ':: NFD;'
. ':: [:Nonspacing Mark:] Remove;'
. ':: NFC;'
. ':: [:Punctuation:] Remove;'
. ':: Lower();'
. '[:Separator:] > \'-\''
)
->transliterate( $string );
echo $slug; // namnet-pa-bildtavlingen
?>
While accepted answer is pretty complete (I used myself in similar question that arised to me), I think it is worth to put the whole supported language codes and variations, as well as encodings, and point user to a file which is present in almost any linux distributions, in case he simply wants a quicker answer and no internet for example.
This is the file /usr/share/i18n/SUPPORTED
and its contents:
aa_DJ.UTF-8 UTF-8
aa_DJ ISO-8859-1
aa_ER UTF-8
aa_ER@saaho UTF-8
aa_ET UTF-8
af_ZA.UTF-8 UTF-8
af_ZA ISO-8859-1
am_ET UTF-8
an_ES.UTF-8 UTF-8
an_ES ISO-8859-15
ar_AE.UTF-8 UTF-8
ar_AE ISO-8859-6
ar_BH.UTF-8 UTF-8
ar_BH ISO-8859-6
ar_DZ.UTF-8 UTF-8
ar_DZ ISO-8859-6
ar_EG.UTF-8 UTF-8
ar_EG ISO-8859-6
ar_IN UTF-8
ar_IQ.UTF-8 UTF-8
ar_IQ ISO-8859-6
ar_JO.UTF-8 UTF-8
ar_JO ISO-8859-6
ar_KW.UTF-8 UTF-8
ar_KW ISO-8859-6
ar_LB.UTF-8 UTF-8
ar_LB ISO-8859-6
ar_LY.UTF-8 UTF-8
ar_LY ISO-8859-6
ar_MA.UTF-8 UTF-8
ar_MA ISO-8859-6
ar_OM.UTF-8 UTF-8
ar_OM ISO-8859-6
ar_QA.UTF-8 UTF-8
ar_QA ISO-8859-6
ar_SA.UTF-8 UTF-8
ar_SA ISO-8859-6
ar_SD.UTF-8 UTF-8
ar_SD ISO-8859-6
ar_SY.UTF-8 UTF-8
ar_SY ISO-8859-6
ar_TN.UTF-8 UTF-8
ar_TN ISO-8859-6
ar_YE.UTF-8 UTF-8
ar_YE ISO-8859-6
az_AZ UTF-8
as_IN UTF-8
ast_ES.UTF-8 UTF-8
ast_ES ISO-8859-15
be_BY.UTF-8 UTF-8
be_BY CP1251
be_BY@latin UTF-8
bem_ZM UTF-8
ber_DZ UTF-8
ber_MA UTF-8
bg_BG.UTF-8 UTF-8
bg_BG CP1251
bho_IN UTF-8
bn_BD UTF-8
bn_IN UTF-8
bo_CN UTF-8
bo_IN UTF-8
br_FR.UTF-8 UTF-8
br_FR ISO-8859-1
br_FR@euro ISO-8859-15
brx_IN UTF-8
bs_BA.UTF-8 UTF-8
bs_BA ISO-8859-2
byn_ER UTF-8
ca_AD.UTF-8 UTF-8
ca_AD ISO-8859-15
ca_ES.UTF-8 UTF-8
ca_ES ISO-8859-1
ca_ES@euro ISO-8859-15
ca_FR.UTF-8 UTF-8
ca_FR ISO-8859-15
ca_IT.UTF-8 UTF-8
ca_IT ISO-8859-15
crh_UA UTF-8
cs_CZ.UTF-8 UTF-8
cs_CZ ISO-8859-2
csb_PL UTF-8
cv_RU UTF-8
cy_GB.UTF-8 UTF-8
cy_GB ISO-8859-14
da_DK.UTF-8 UTF-8
da_DK ISO-8859-1
de_AT.UTF-8 UTF-8
de_AT ISO-8859-1
de_AT@euro ISO-8859-15
de_BE.UTF-8 UTF-8
de_BE ISO-8859-1
de_BE@euro ISO-8859-15
de_CH.UTF-8 UTF-8
de_CH ISO-8859-1
de_DE.UTF-8 UTF-8
de_DE ISO-8859-1
de_DE@euro ISO-8859-15
de_LU.UTF-8 UTF-8
de_LU ISO-8859-1
de_LU@euro ISO-8859-15
dv_MV UTF-8
dz_BT UTF-8
el_GR.UTF-8 UTF-8
el_GR ISO-8859-7
el_CY.UTF-8 UTF-8
el_CY ISO-8859-7
en_AG UTF-8
en_AU.UTF-8 UTF-8
en_AU ISO-8859-1
en_BW.UTF-8 UTF-8
en_BW ISO-8859-1
en_CA.UTF-8 UTF-8
en_CA ISO-8859-1
en_DK.UTF-8 UTF-8
en_DK ISO-8859-1
en_GB.UTF-8 UTF-8
en_GB ISO-8859-1
en_HK.UTF-8 UTF-8
en_HK ISO-8859-1
en_IE.UTF-8 UTF-8
en_IE ISO-8859-1
en_IE@euro ISO-8859-15
en_IN UTF-8
en_NG UTF-8
en_NZ.UTF-8 UTF-8
en_NZ ISO-8859-1
en_PH.UTF-8 UTF-8
en_PH ISO-8859-1
en_SG.UTF-8 UTF-8
en_SG ISO-8859-1
en_US.UTF-8 UTF-8
en_US ISO-8859-1
en_ZA.UTF-8 UTF-8
en_ZA ISO-8859-1
en_ZM UTF-8
en_ZW.UTF-8 UTF-8
en_ZW ISO-8859-1
es_AR.UTF-8 UTF-8
es_AR ISO-8859-1
es_BO.UTF-8 UTF-8
es_BO ISO-8859-1
es_CL.UTF-8 UTF-8
es_CL ISO-8859-1
es_CO.UTF-8 UTF-8
es_CO ISO-8859-1
es_CR.UTF-8 UTF-8
es_CR ISO-8859-1
es_CU UTF-8
es_DO.UTF-8 UTF-8
es_DO ISO-8859-1
es_EC.UTF-8 UTF-8
es_EC ISO-8859-1
es_ES.UTF-8 UTF-8
es_ES ISO-8859-1
es_ES@euro ISO-8859-15
es_GT.UTF-8 UTF-8
es_GT ISO-8859-1
es_HN.UTF-8 UTF-8
es_HN ISO-8859-1
es_MX.UTF-8 UTF-8
es_MX ISO-8859-1
es_NI.UTF-8 UTF-8
es_NI ISO-8859-1
es_PA.UTF-8 UTF-8
es_PA ISO-8859-1
es_PE.UTF-8 UTF-8
es_PE ISO-8859-1
es_PR.UTF-8 UTF-8
es_PR ISO-8859-1
es_PY.UTF-8 UTF-8
es_PY ISO-8859-1
es_SV.UTF-8 UTF-8
es_SV ISO-8859-1
es_US.UTF-8 UTF-8
es_US ISO-8859-1
es_UY.UTF-8 UTF-8
es_UY ISO-8859-1
es_VE.UTF-8 UTF-8
es_VE ISO-8859-1
et_EE.UTF-8 UTF-8
et_EE ISO-8859-1
et_EE.ISO-8859-15 ISO-8859-15
eu_ES.UTF-8 UTF-8
eu_ES ISO-8859-1
eu_ES@euro ISO-8859-15
fa_IR UTF-8
ff_SN UTF-8
fi_FI.UTF-8 UTF-8
fi_FI ISO-8859-1
fi_FI@euro ISO-8859-15
fil_PH UTF-8
fo_FO.UTF-8 UTF-8
fo_FO ISO-8859-1
fr_BE.UTF-8 UTF-8
fr_BE ISO-8859-1
fr_BE@euro ISO-8859-15
fr_CA.UTF-8 UTF-8
fr_CA ISO-8859-1
fr_CH.UTF-8 UTF-8
fr_CH ISO-8859-1
fr_FR.UTF-8 UTF-8
fr_FR ISO-8859-1
fr_FR@euro ISO-8859-15
fr_LU.UTF-8 UTF-8
fr_LU ISO-8859-1
fr_LU@euro ISO-8859-15
fur_IT UTF-8
fy_NL UTF-8
fy_DE UTF-8
ga_IE.UTF-8 UTF-8
ga_IE ISO-8859-1
ga_IE@euro ISO-8859-15
gd_GB.UTF-8 UTF-8
gd_GB ISO-8859-15
gez_ER UTF-8
gez_ER@abegede UTF-8
gez_ET UTF-8
gez_ET@abegede UTF-8
gl_ES.UTF-8 UTF-8
gl_ES ISO-8859-1
gl_ES@euro ISO-8859-15
gu_IN UTF-8
gv_GB.UTF-8 UTF-8
gv_GB ISO-8859-1
ha_NG UTF-8
he_IL.UTF-8 UTF-8
he_IL ISO-8859-8
hi_IN UTF-8
hne_IN UTF-8
hr_HR.UTF-8 UTF-8
hr_HR ISO-8859-2
hsb_DE ISO-8859-2
hsb_DE.UTF-8 UTF-8
ht_HT UTF-8
hu_HU.UTF-8 UTF-8
hu_HU ISO-8859-2
hy_AM UTF-8
hy_AM.ARMSCII-8 ARMSCII-8
id_ID.UTF-8 UTF-8
id_ID ISO-8859-1
ig_NG UTF-8
ik_CA UTF-8
is_IS.UTF-8 UTF-8
is_IS ISO-8859-1
it_CH.UTF-8 UTF-8
it_CH ISO-8859-1
it_IT.UTF-8 UTF-8
it_IT ISO-8859-1
it_IT@euro ISO-8859-15
iu_CA UTF-8
iw_IL.UTF-8 UTF-8
iw_IL ISO-8859-8
ja_JP.EUC-JP EUC-JP
ja_JP.UTF-8 UTF-8
ka_GE.UTF-8 UTF-8
ka_GE GEORGIAN-PS
kk_KZ.UTF-8 UTF-8
kk_KZ PT154
kl_GL.UTF-8 UTF-8
kl_GL ISO-8859-1
km_KH UTF-8
kn_IN UTF-8
ko_KR.EUC-KR EUC-KR
ko_KR.UTF-8 UTF-8
kok_IN UTF-8
ks_IN UTF-8
ks_IN@devanagari UTF-8
ku_TR.UTF-8 UTF-8
ku_TR ISO-8859-9
kw_GB.UTF-8 UTF-8
kw_GB ISO-8859-1
ky_KG UTF-8
lb_LU UTF-8
lg_UG.UTF-8 UTF-8
lg_UG ISO-8859-10
li_BE UTF-8
li_NL UTF-8
lij_IT UTF-8
lo_LA UTF-8
lt_LT.UTF-8 UTF-8
lt_LT ISO-8859-13
lv_LV.UTF-8 UTF-8
lv_LV ISO-8859-13
mag_IN UTF-8
mai_IN UTF-8
mg_MG.UTF-8 UTF-8
mg_MG ISO-8859-15
mhr_RU UTF-8
mi_NZ.UTF-8 UTF-8
mi_NZ ISO-8859-13
mk_MK.UTF-8 UTF-8
mk_MK ISO-8859-5
ml_IN UTF-8
mn_MN UTF-8
mr_IN UTF-8
ms_MY.UTF-8 UTF-8
ms_MY ISO-8859-1
mt_MT.UTF-8 UTF-8
mt_MT ISO-8859-3
my_MM UTF-8
nan_TW@latin UTF-8
nb_NO.UTF-8 UTF-8
nb_NO ISO-8859-1
nds_DE UTF-8
nds_NL UTF-8
ne_NP UTF-8
nl_AW UTF-8
nl_BE.UTF-8 UTF-8
nl_BE ISO-8859-1
nl_BE@euro ISO-8859-15
nl_NL.UTF-8 UTF-8
nl_NL ISO-8859-1
nl_NL@euro ISO-8859-15
nn_NO.UTF-8 UTF-8
nn_NO ISO-8859-1
nr_ZA UTF-8
nso_ZA UTF-8
oc_FR.UTF-8 UTF-8
oc_FR ISO-8859-1
om_ET UTF-8
om_KE.UTF-8 UTF-8
om_KE ISO-8859-1
or_IN UTF-8
os_RU UTF-8
pa_IN UTF-8
pa_PK UTF-8
pap_AN UTF-8
pl_PL.UTF-8 UTF-8
pl_PL ISO-8859-2
ps_AF UTF-8
pt_BR.UTF-8 UTF-8
pt_BR ISO-8859-1
pt_PT.UTF-8 UTF-8
pt_PT ISO-8859-1
pt_PT@euro ISO-8859-15
ro_RO.UTF-8 UTF-8
ro_RO ISO-8859-2
ru_RU.KOI8-R KOI8-R
ru_RU.UTF-8 UTF-8
ru_RU ISO-8859-5
ru_UA.UTF-8 UTF-8
ru_UA KOI8-U
rw_RW UTF-8
sa_IN UTF-8
sc_IT UTF-8
sd_IN UTF-8
sd_IN@devanagari UTF-8
se_NO UTF-8
shs_CA UTF-8
si_LK UTF-8
sid_ET UTF-8
sk_SK.UTF-8 UTF-8
sk_SK ISO-8859-2
sl_SI.UTF-8 UTF-8
sl_SI ISO-8859-2
so_DJ.UTF-8 UTF-8
so_DJ ISO-8859-1
so_ET UTF-8
so_KE.UTF-8 UTF-8
so_KE ISO-8859-1
so_SO.UTF-8 UTF-8
so_SO ISO-8859-1
sq_AL.UTF-8 UTF-8
sq_AL ISO-8859-1
sq_MK UTF-8
sr_ME UTF-8
sr_RS UTF-8
sr_RS@latin UTF-8
ss_ZA UTF-8
st_ZA.UTF-8 UTF-8
st_ZA ISO-8859-1
sv_FI.UTF-8 UTF-8
sv_FI ISO-8859-1
sv_FI@euro ISO-8859-15
sv_SE.UTF-8 UTF-8
sv_SE ISO-8859-1
sw_KE UTF-8
sw_TZ UTF-8
ta_IN UTF-8
ta_LK UTF-8
te_IN UTF-8
tg_TJ.UTF-8 UTF-8
tg_TJ KOI8-T
th_TH.UTF-8 UTF-8
th_TH TIS-620
ti_ER UTF-8
ti_ET UTF-8
tig_ER UTF-8
tk_TM UTF-8
tl_PH.UTF-8 UTF-8
tl_PH ISO-8859-1
tn_ZA UTF-8
tr_CY.UTF-8 UTF-8
tr_CY ISO-8859-9
tr_TR.UTF-8 UTF-8
tr_TR ISO-8859-9
ts_ZA UTF-8
tt_RU UTF-8
tt_RU@iqtelif UTF-8
ug_CN UTF-8
uk_UA.UTF-8 UTF-8
uk_UA KOI8-U
unm_US UTF-8
ur_IN UTF-8
ur_PK UTF-8
uz_UZ ISO-8859-1
uz_UZ@cyrillic UTF-8
ve_ZA UTF-8
vi_VN UTF-8
wa_BE ISO-8859-1
wa_BE@euro ISO-8859-15
wa_BE.UTF-8 UTF-8
wae_CH UTF-8
wal_ET UTF-8
wo_SN UTF-8
xh_ZA.UTF-8 UTF-8
xh_ZA ISO-8859-1
yi_US.UTF-8 UTF-8
yi_US CP1255
yo_NG UTF-8
yue_HK UTF-8
zh_CN.GB18030 GB18030
zh_CN.GBK GBK
zh_CN.UTF-8 UTF-8
zh_CN GB2312
zh_HK.UTF-8 UTF-8
zh_HK BIG5-HKSCS
zh_SG.UTF-8 UTF-8
zh_SG.GBK GBK
zh_SG GB2312
zh_TW.EUC-TW EUC-TW
zh_TW.UTF-8 UTF-8
zh_TW BIG5
zu_ZA.UTF-8 UTF-8
zu_ZA ISO-8859-1
It is not good practice to hard code strings into your layout files/ code. You should add them to a string resource file and then reference them from your layout.
strings.xml
file.supporting multiple languages
as a
separate strings.xml file
can be used for each supported language@string
system please read over the
localization documentation. It allows you to easily locate text in
your app and later have it translated.support multiple languages with a single application package file
(APK).Benefits
As a complement to other answers note that you can also put the lang
attribute on various HTML tags inside a page.
For example to give a hint to the spellchecker that the input text should be in english:
<input ... spellcheck="true" lang="en"> ...
See: https://developer.mozilla.org/en-US/docs/Web/HTML/Global_attributes/lang
You must extend the regional options like this (code split on multiple lines for readability):
var options = $.extend(
{}, // empty object
$.datepicker.regional["fr"], // fr regional
{ dateFormat: "d MM, y" /*, ... */ } // your custom options
);
$("#datepicker").datepicker(options);
The order of parameters is important because of the way jQuery.extend
works. Two incorrect examples:
/*
* This overwrites the global variable itself instead of creating a
* customized copy of french regional settings
*/
$.extend($.datepicker.regional["fr"], { dateFormat: "d MM, y"});
/*
* The desired dateFormat is overwritten by french regional
* settings' date format
*/
$.extend({ dateFormat: "d MM, y"}, $.datepicker.regional["fr"]);
PS: you also need to load the jQuery UI i18n files:
<script src="//ajax.googleapis.com/ajax/libs/jqueryui/1.11.1/i18n/jquery-ui-i18n.min.js">
</script>
I just use this solution in Kotlin:
var date : String = DateFormat.format("EEEE dd-MMM-yyyy HH:mm a" , Date()) as String
Create Language Table ‘languages’:
Fields:
language_id(primary and auto increamented)
language_name
created_at
created_by
updated_at
updated_by
Create a table in database ‘content’:
Fields:
content_id(primary and auto incremented)
main_content
header_content
footer_content
leftsidebar_content
rightsidebar_content
language_id(foreign key: referenced to languages table)
created_at
created_by
updated_at
updated_by
When user selects any language from dropdown or any area then save selected language id in session like,
$_SESSION['language']=1;
Now fetch data from database table ‘content’ based on language id stored in session.
Detail may found here http://skillrow.com/multilingual-website-in-php-2/
much easier use it
<input type="button" id="loadFileXml" value="Custom Button Name"onclick="document.getElementById('file').click();" />
<input type="file" style="display:none;" id="file" name="file"/>
We create a resources.utf8 file that contains the resources in UTF-8 and have a rule to run the following:
native2ascii -encoding utf8 resources.utf8 resources.properties
You have selected correct approach. You have to extend the class with TextWatcher and override afterTextChanged()
,beforeTextChanged()
, onTextChanged()
.
You have to write your desired logic in afterTextChanged()
method to achieve functionality needed by you.
&
is bitwise.
&&
is logical.
&
evaluates both sides of the operation.
&&
evaluates the left side of the operation, if it's true
, it continues and evaluates the right side.
using css we can adjust specific column width which i put in below code.
user.component.css
table{
width: 100%;
}
.mat-column-username {
word-wrap: break-word !important;
white-space: unset !important;
flex: 0 0 28% !important;
width: 28% !important;
overflow-wrap: break-word;
word-wrap: break-word;
word-break: break-word;
-ms-hyphens: auto;
-moz-hyphens: auto;
-webkit-hyphens: auto;
hyphens: auto;
}
.mat-column-emailid {
word-wrap: break-word !important;
white-space: unset !important;
flex: 0 0 25% !important;
width: 25% !important;
overflow-wrap: break-word;
word-wrap: break-word;
word-break: break-word;
-ms-hyphens: auto;
-moz-hyphens: auto;
-webkit-hyphens: auto;
hyphens: auto;
}
.mat-column-contactno {
word-wrap: break-word !important;
white-space: unset !important;
flex: 0 0 17% !important;
width: 17% !important;
overflow-wrap: break-word;
word-wrap: break-word;
word-break: break-word;
-ms-hyphens: auto;
-moz-hyphens: auto;
-webkit-hyphens: auto;
hyphens: auto;
}
.mat-column-userimage {
word-wrap: break-word !important;
white-space: unset !important;
flex: 0 0 8% !important;
width: 8% !important;
overflow-wrap: break-word;
word-wrap: break-word;
word-break: break-word;
-ms-hyphens: auto;
-moz-hyphens: auto;
-webkit-hyphens: auto;
hyphens: auto;
}
.mat-column-userActivity {
word-wrap: break-word !important;
white-space: unset !important;
flex: 0 0 10% !important;
width: 10% !important;
overflow-wrap: break-word;
word-wrap: break-word;
word-break: break-word;
-ms-hyphens: auto;
-moz-hyphens: auto;
-webkit-hyphens: auto;
hyphens: auto;
}
If you have control over the structure of the list, the most pythonic thing to do would probably be to change it from:
l=[1,2,3,4]
to:
l=[(1,2),(3,4)]
Then, your loop would be:
for i,j in l:
print i, j
Since JPA 2.0 a TypedQuery
can be used:
TypedQuery<SimpleEntity> q =
em.createQuery("select t from SimpleEntity t", SimpleEntity.class);
List<SimpleEntity> listOfSimpleEntities = q.getResultList();
for (SimpleEntity entity : listOfSimpleEntities) {
// do something useful with entity;
}
I made this into a bash shell script. Usage: keep NUM DIR
where NUM is the number of files to keep and DIR is the directory to scrub.
#!/bin/bash
# Keep last N files by date.
# Usage: keep NUMBER DIRECTORY
echo ""
if [ $# -lt 2 ]; then
echo "Usage: $0 NUMFILES DIR"
echo "Keep last N newest files."
exit 1
fi
if [ ! -e $2 ]; then
echo "ERROR: directory '$1' does not exist"
exit 1
fi
if [ ! -d $2 ]; then
echo "ERROR: '$1' is not a directory"
exit 1
fi
pushd $2 > /dev/null
ls -tp | grep -v '/' | tail -n +"$1" | xargs -I {} rm -- {}
popd > /dev/null
echo "Done. Kept $1 most recent files in $2."
ls $2|wc -l
Python 3.7.7
import typing
if isinstance([1, 2, 3, 4, 5] , typing.List):
print("It is a list")
The original variables you listed can be declared and assigned to the same value in a short line of code using destructuring assignment. The keywords let
, const
, and var
can all be used for this type of assignment.
let [moveUp, moveDown, moveLeft, moveRight, mouseDown, touchDown] = Array(6).fill(false);
As of now (Jan 2017 / Angular > 2.0) you can use the following:
changeBackground(): any {
return { 'background-color': this.color };
}
and
<div class="circle" [ngStyle]="changeBackground()">
<!-- <content></content> --> <!-- content is now deprecated -->
<ng-content><ng-content> <!-- Use ng-content instead -->
</div>
The shortest way is probably like this:
<div class="circle" [ngStyle]="{ 'background-color': color }">
<!-- <content></content> --> <!-- content is now deprecated -->
<ng-content><ng-content> <!-- Use ng-content instead -->
</div>
The top answers above did not work for me (restarting, updating to version 1.1.18 ... I was already updated, deleting the temp files, clearning NuGet cache etc).
What I discovered is that I had differing references to MSTest.TestAdapter and MSTest.Framework in different test projects (my solution has two). One was pointed to 1.1.18 like...
packages.config
<package id="MSTest.TestAdapter" version="1.1.18" targetFramework="net461" />
<package id="MSTest.TestFramework" version="1.1.18" targetFramework="net461" />
... but another has the references to 1.1.11. Some of the answers above lead to this discovery when two versions of the libraries showed up in my temp directory (%TEMP%\VisualStudioTestExplorerExtensions\) after restarting Visual Studio.
Simply updating my packages.config to the 1.1.18 version is what restored my unit tests functionality in VS. It appears that there are some bugs that do not allow side-by-side references of the MSTest libraries. Hope this helps you.
More info:
Use
$route.reload();
remember to inject $route
to your controller.
None of the answers are particularly satisfactory, so here's a small snippet to help.
class LineSeekableFile:
def __init__(self, seekable):
self.fin = seekable
self.line_map = list() # Map from line index -> file position.
self.line_map.append(0)
while seekable.readline():
self.line_map.append(seekable.tell())
def __getitem__(self, index):
# NOTE: This assumes that you're not reading the file sequentially.
# For that, just use 'for line in file'.
self.fin.seek(self.line_map[index])
return self.fin.readline()
Example usage:
In: !cat /tmp/test.txt
Out:
Line zero.
Line one!
Line three.
End of file, line four.
In:
with open("/tmp/test.txt", 'rt') as fin:
seeker = LineSeekableFile(fin)
print(seeker[1])
Out:
Line one!
This involves doing a lot of file seeks, but is useful for the cases where you can't fit the whole file in memory. It does one initial read to get the line locations (so it does read the whole file, but doesn't keep it all in memory), and then each access does a file seek after the fact.
I offer the snippet above under the MIT or Apache license at the discretion of the user.
I know this is an old thread, but I stumbled across it and thought I'd share my method which I have found to be a very fast way to use find
to find only non-binary files:
find . -type f -exec grep -Iq . {} \; -print
The -I
option to grep tells it to immediately ignore binary files and the .
option along with the -q
will make it immediately match text files so it goes very fast. You can change the -print
to a -print0
for piping into an xargs -0
or something if you are concerned about spaces (thanks for the tip, @lucas.werkmeister!)
Also the first dot is only necessary for certain BSD versions of find
such as on OS X, but it doesn't hurt anything just having it there all the time if you want to put this in an alias or something.
EDIT: As @ruslan correctly pointed out, the -and
can be omitted since it is implied.
You can use something like this
("{:0%db}"%length).format(num)
This is for the folks who use plain JavaScript instead of Type Script. In addition to referencing the forms script file on top of the page like below:
<script src="node_modules/@angular/forms/bundles/forms.umd.js"></script>
You should also tell the the module loader to load the ng.forms.FormsModule
. After making the changes my imports
property of NgModule
method looked like below:
imports: [ng.platformBrowser.BrowserModule, ng.forms.FormsModule],
They are both correct. Personally I prefer your approach better for its verbosity but it's really down to personal preference.
Off hand, running if($_POST) would not throw an error - the $_POST array exists regardless if the request was sent with POST headers. An empty array is cast to false in a boolean check.
You can find a convenient one here:
https://github.com/varra4u/utils4j/blob/master/src/main/java/com/varra/util/StopWatch.java
Usage:
final StopWatch timer = new StopWatch();
System.out.println("Timer: " + timer);
System.out.println("ElapsedTime: " + timer.getElapsedTime());
Return as a tuple, e.g.
def foo (a):
x=a
y=a*2
return (x,y)
In @dudusan's example, you could also reverse the order of I1, and then sort ascending:
> rum <- read.table(textConnection("P1 P2 P3 T1 T2 T3 I1 I2
+ 2 3 5 52 43 61 6 b
+ 6 4 3 72 NA 59 1 a
+ 1 5 6 55 48 60 6 f
+ 2 4 4 65 64 58 2 b
+ 1 5 6 55 48 60 6 c"), header = TRUE)
> f=factor(rum$I1)
> levels(f) <- sort(levels(f), decreasing = TRUE)
> rum[order(as.character(f), rum$I2), ]
P1 P2 P3 T1 T2 T3 I1 I2
1 2 3 5 52 43 61 6 b
5 1 5 6 55 48 60 6 c
3 1 5 6 55 48 60 6 f
4 2 4 4 65 64 58 2 b
2 6 4 3 72 NA 59 1 a
>
This seems a bit shorter, you don't reverse the order of I2 twice.
Shorter version of:
REGEXP_REPLACE( my_value, '[[:space:]]', '' )
Would be:
REGEXP_REPLACE( my_value, '\s')
Neither of the above statements will remove "null" characters.
To remove "nulls" encase the statement with a replace
Like so:
REPLACE(REGEXP_REPLACE( my_value, '\s'), CHR(0))
add “| pause” in command arguments box under debugging section at project properties.
import os, signal
def check_kill_process(pstring):
for line in os.popen("ps ax | grep " + pstring + " | grep -v grep"):
fields = line.split()
pid = fields[0]
os.kill(int(pid), signal.SIGKILL)
Here's the beginnings of a parser class to get you started. This ended up being my solution to a similar problem:
using System;
using System.Collections.Generic;
using System.Linq;
using System.Text;
using System.Threading.Tasks;
using System.Xml.Linq;
namespace XML
{
public class Parser
{
private string _FilePath = string.Empty;
private XDocument _XML_Doc = null;
public Parser(string filePath)
{
_FilePath = filePath;
_XML_Doc = XDocument.Load(_FilePath);
}
/// <summary>
/// Replaces values of all attributes of a given name (attributeName) with the specified new value (newValue) in all elements.
/// </summary>
/// <param name="attributeName"></param>
/// <param name="newValue"></param>
public void ReplaceAtrribute(string attributeName, string newValue)
{
ReplaceAtrribute(string.Empty, attributeName, new List<string> { }, newValue);
}
/// <summary>
/// Replaces values of all attributes of a given name (attributeName) with the specified new value (newValue) in elements with a given name (elementName).
/// </summary>
/// <param name="elementName"></param>
/// <param name="attributeName"></param>
/// <param name="newValue"></param>
public void ReplaceAtrribute(string elementName, string attributeName, string newValue)
{
ReplaceAtrribute(elementName, attributeName, new List<string> { }, newValue);
}
/// <summary>
/// Replaces values of all attributes of a given name (attributeName) and value (oldValue)
/// with the specified new value (newValue) in elements with a given name (elementName).
/// </summary>
/// <param name="elementName"></param>
/// <param name="attributeName"></param>
/// <param name="oldValue"></param>
/// <param name="newValue"></param>
public void ReplaceAtrribute(string elementName, string attributeName, string oldValue, string newValue)
{
ReplaceAtrribute(elementName, attributeName, new List<string> { oldValue }, newValue);
}
/// <summary>
/// Replaces values of all attributes of a given name (attributeName), which has one of a list of values (oldValues),
/// with the specified new value (newValue) in elements with a given name (elementName).
/// If oldValues is empty then oldValues will be ignored.
/// </summary>
/// <param name="elementName"></param>
/// <param name="attributeName"></param>
/// <param name="oldValues"></param>
/// <param name="newValue"></param>
public void ReplaceAtrribute(string elementName, string attributeName, List<string> oldValues, string newValue)
{
List<XElement> elements = _XML_Doc.Elements().Descendants().ToList();
foreach (XElement element in elements)
{
if (elementName == string.Empty | element.Name.LocalName.ToString() == elementName)
{
if (element.Attribute(attributeName) != null)
{
if (oldValues.Count == 0 || oldValues.Contains(element.Attribute(attributeName).Value))
{ element.Attribute(attributeName).Value = newValue; }
}
}
}
}
public void SaveChangesToFile()
{
_XML_Doc.Save(_FilePath);
}
}
}
"set -e
" is probably the easiest way to do this. Just put that before any commands in your program.
sp_configure 'show advanced options', 1;
GO
RECONFIGURE;
GO
sp_configure 'Ad Hoc Distributed Queries', 1;
GO
RECONFIGURE;
GO
This error started happening to me out of nowhere last week, affecting the existing web sites on my machine. I had no luck with it trying any of the suggestions here. Eventually I removed WebDAV from IIS completely (Windows Features -> Internet Information Services -> World Wide Web Services -> Common HTTP Features -> WebDAV Publishing). I did an IIS reset after this for good measure, and my error was finally resolved.
I can only guess that a Windows update started the issue, but I can't be sure.
<% @images.each_with_index do |page, index| %>
<% end %>
and also if you will try to create Navigation Bar
manually this code will help you
func setNavBarToTheView() {
let navBar: UINavigationBar = UINavigationBar(frame: CGRect(x: 0, y: 0, width: self.view.frame.size.width, height: 64.0))
self.view.addSubview(navBar);
let navItem = UINavigationItem(title: "Camera");
let doneItem = UIBarButtonItem(barButtonSystemItem: UIBarButtonSystemItem.cancel, target: self, action: #selector(CameraViewController.onClickBack));
navItem.leftBarButtonItem = doneItem;
navBar.setItems([navItem], animated: true);
}
I had this issue on one of my development machines (all run windows 7 x64) while all other machines' adb work normally. The reason I ran into this issue is I have an old version of adb.exe reside in %android-sdk%\tools while newer Android SDKs have adb.exe under %android-sdk%\platform-tools
remove the older adb.exe from %android-sdk%\tools and add %android-sdk%\platform-tools to %PATH% solves this issue
or more generally, hunt down any adb executable in your path that are out of date, just use the latest one provided with Android SDK
Maybe declaring a range might workout better for you.
// fill in the starting and ending range programmatically this is just an example.
string startRange = "A1";
string endRange = "A1";
Excel.Range currentRange = (Excel.Range)excelWorksheet.get_Range(startRange , endRange );
currentRange.Style.HorizontalAlignment = Microsoft.Office.Interop.Excel.XlHAlign.xlHAlignLeft;
This works for me:
$('#element').click(function (e) {
if (e.offsetX > e.target.offsetLeft) {
// click on element
}
else{
// click on ::before element
}
});
Using Visual Studio
This gives details about each assembly, app domain and has a few options to load symbols (i.e. pdb files that contain debug information).
Using Process Explorer
If you want an external tool you can use the Process Explorer (freeware, published by Microsoft)
Click on a process and it will show a list with all the assemblies used. The tool is pretty good as it shows other information such as file handles etc.
Programmatically
Check this SO question that explains how to do it.
Yes it's pretty work with jquery.serialize()
HTML
<form id="myform" class="myform" method="post" name="myform">
<textarea id="myField" type="text" name="myField"></textarea>
<input type="checkbox" name="myCheckboxes[]" id="myCheckboxes" value="someValue1" />
<input type="checkbox" name="myCheckboxes[]" id="myCheckboxes" value="someValue2" />
<input id="submit" type="submit" name="submit" value="Submit" onclick="return submitForm()" />
</form>
<div id="myResponse"></div>
JQuery
function submitForm() {
var form = document.myform;
var dataString = $(form).serialize();
$.ajax({
type:'POST',
url:'myurl.php',
data: dataString,
success: function(data){
$('#myResponse').html(data);
}
});
return false;
}
NOW THE PHP, i export the POST data
echo var_export($_POST);
You can see the all the checkbox value are sent.I hope it may help you
Very fast & clean Java-method that doesn't rely on external libraries:
(Simply replace MD5 with SHA-1, SHA-256, SHA-384 or SHA-512 if you want those)
public String calcMD5() throws Exception{
byte[] buffer = new byte[8192];
MessageDigest md = MessageDigest.getInstance("MD5");
DigestInputStream dis = new DigestInputStream(new FileInputStream(new File("Path to file")), md);
try {
while (dis.read(buffer) != -1);
}finally{
dis.close();
}
byte[] bytes = md.digest();
// bytesToHex-method
char[] hexChars = new char[bytes.length * 2];
for ( int j = 0; j < bytes.length; j++ ) {
int v = bytes[j] & 0xFF;
hexChars[j * 2] = hexArray[v >>> 4];
hexChars[j * 2 + 1] = hexArray[v & 0x0F];
}
return new String(hexChars);
}
In fact, your data is not well design. You'd better use something like :
$scope.steps = [
{stepName: "companyName", isComplete: true},
{stepName: "businessType", isComplete: true},
{stepName: "physicalAddress", isComplete: true}
];
Then it is easy to do what you want :
<div ng-repeat="step in steps">
Step {{step.stepName}} status : {{step.isComplet}}
</div>
Example: http://jsfiddle.net/rX7ba/
Actually, I found myself in a similar situation trying to take an array and parse it into XML. XML element names cannot begin with numbers -- and the code snippets I found did not correctly deal with arrays with numeric indexes.
Details on my particular situation are below
The answer provided above by @null ( http:// stackoverflow .com/a/173589/293332 ) was actually pretty darn close. I was dismayed that it got voted down tho: Those who do not understand regex lead very frustrating lives.
Anyway, based upon his answer, here is what I ended up with:
/**
* Checks if an array is associative by utilizing REGEX against the keys
* @param $arr <array> Reference to the array to be checked
* @return boolean
*/
private function isAssociativeArray( &$arr ) {
return (bool)( preg_match( '/\D/', implode( array_keys( $arr ) ) ) );
}
See the PCRE Escape Sequences and PCRE Syntax pages for further details.
Here is an example array that I am dealing with:
Case Areturn array(
"GetInventorySummary" => array(
"Filters" => array(
"Filter" => array(
array(
"FilterType" => "Shape",
"FilterValue" => "W",
),
array(
"FilterType" => "Dimensions",
"FilterValue" => "8 x 10",
),
array(
"FilterType" => "Grade",
"FilterValue" => "A992",
),
),
),
"SummaryField" => "Length",
),
);
The catch is that the filter
key is variable. For example:
return array(
"GetInventorySummary" => array(
"Filters" => array(
"Filter" => array(
"foo" => "bar",
"bar" => "foo",
),
),
"SummaryField" => "Length",
),
);
If the array I am transforming is like Case A, what I want returned is:
<?xml version="1.0" encoding="UTF-8" standalone="yes"?>
<GetInventorySummary>
<Filters>
<Filter>
<FilterType>Shape</FilterType>
<FilterValue>W</FilterValue>
</Filter>
<Filter>
<FilterType>Dimensions</FilterType>
<FilterValue>8 x 10</FilterValue>
</Filter>
<Filter>
<FilterType>Grade</FilterType>
<FilterValue>A992</FilterValue>
</Filter>
</Filters>
<SummaryField>Length</SummaryField>
</GetInventorySummary>
... However, if the array I am transforming is like Case B, what I want returned is:
<?xml version="1.0" encoding="UTF-8" standalone="yes"?>
<GetInventorySummary>
<Filters>
<Filter>
<foo>bar</foo>
<bar>foo</bar>
</Filter>
</Filters>
<SummaryField>Length</SummaryField>
</GetInventorySummary>
You can't use float
inside flex container and the reason is that float property does not apply to flex-level boxes as you can see here Fiddle
.
So if you want to position child
element to right of parent
element you can use margin-left: auto
but now child
element will also push other div
to the right as you can see here Fiddle
.
What you can do now is change order of elements and set order: 2
on child
element so it doesn't affect second div
.parent {_x000D_
display: flex;_x000D_
}_x000D_
.child {_x000D_
margin-left: auto;_x000D_
order: 2;_x000D_
}
_x000D_
<div class="parent">_x000D_
<div class="child">Ignore parent?</div>_x000D_
<div>another child</div>_x000D_
</div>
_x000D_
Since this seems to be a high-ranking result in Google, I want to add this:
iOS 8 and OS X 10.10 add the containsString:
method to NSString
. An updated version of Dave DeLong's example for those systems:
NSString *string = @"hello bla bla";
if ([string containsString:@"bla"]) {
NSLog(@"string contains bla!");
} else {
NSLog(@"string does not contain bla");
}
In your script you can add the following to the lines that you know are going to give an output:
some_code 2>>/dev/null
Or else you can also try
some_code >>/dev/null
I had a similar issue when I upgraded my Rails 3 app to Rails 4 recently. My fonts were not working properly as in the Rails 4+, we are only allowed to keep the fonts under app/assets/fonts
directory. But my Rails 3 app had a different font organization. So I had to configure the app so that it still works with Rails 4+ having my fonts in a different place other than app/assets/fonts
. I have tried several solutions but after I found non-stupid-digest-assets gem, it just made it so easy.
Add this gem by adding the following line to your Gemfile:
gem 'non-stupid-digest-assets'
Then run:
bundle install
And finally add the following line in your config/initializers/non_digest_assets.rb file:
NonStupidDigestAssets.whitelist = [ /\.(?:svg|eot|woff|ttf)$/ ]
That's it. This solved my problem nicely. Hope this helps someone who have encountered similar problem like me.
if your array looks like
array = [
{:name => "Hitesh" , :age => 27 , :place => "xyz"} ,
{:name => "John" , :age => 26 , :place => "xtz"} ,
{:name => "Anil" , :age => 26 , :place => "xsz"}
]
And you Want To know if some value is already present in your array. Use Find Method
array.find {|x| x[:name] == "Hitesh"}
This will return object if Hitesh is present in name otherwise return nil
You should simply return your object, and shouldn't be concerned about whether its XML or JSON. It is the client responsibility to request JSON or XML from the web api. For example, If you make a call using Internet explorer then the default format requested will be Json and the Web API will return Json. But if you make the request through google chrome, the default request format is XML and you will get XML back.
If you make a request using Fiddler then you can specify the Accept header to be either Json or XML.
Accept: application/xml
You may wanna see this article: Content Negotiation in ASP.NET MVC4 Web API Beta – Part 1
EDIT: based on your edited question with code:
Simple return list of string, instead of converting it to XML. try it using Fiddler.
public List<string> Get(int tenantID, string dataType, string ActionName)
{
List<string> SQLResult = MyWebSite_DataProvidor.DB.spReturnXMLData("SELECT * FROM vwContactListing FOR XML AUTO, ELEMENTS").ToList();
return SQLResult;
}
For example if your list is like:
List<string> list = new List<string>();
list.Add("Test1");
list.Add("Test2");
list.Add("Test3");
return list;
and you specify Accept: application/xml
the output will be:
<ArrayOfstring xmlns:i="http://www.w3.org/2001/XMLSchema-instance" xmlns="http://schemas.microsoft.com/2003/10/Serialization/Arrays">
<string>Test1</string>
<string>Test2</string>
<string>Test3</string>
</ArrayOfstring>
and if you specify 'Accept: application/json' in the request then the output will be:
[
"Test1",
"Test2",
"Test3"
]
So let the client request the content type, instead of you sending the customized xml.
Some of the answers here suggest using setTimeout
to delay the process of focusing on the target element. One of them mentions that the target is inside a modal dialog. I cannot comment further on the correctness of the setTimeout
solution without knowing the specific details of where it was used. However, I thought I should provide an answer here to help out people who run into this thread just as I did
The simple fact of the matter is that you cannot focus on an element which is not yet visible. If you run into this problem ensure that the target is actually visible when the attempt to focus it is made. In my own case I was doing something along these lines
$('#elementid').animate({left:0,duration:'slow'});
$('#elementid').focus();
This did not work. I only realized what was going on when I executed $('#elementid').focus()` from the console which did work. The difference - in my code above the target there is no certainty that the target will infact be visible since the animation may not be complete. And there lies the clue
$('#elementid').animate({left:0,duration:'slow',complete:focusFunction});
function focusFunction(){$('#elementid').focus();}
works just as expected. I too had initially put in a setTimeout
solution and it worked too. However, an arbitrarily chosen timeout is bound to break the solution sooner or later depending on how slowly the host device goes about the process of ensuring that the target element is visible.
In a VBA worksheet function UDF you use Application.Caller to get the range of cell(s) that contain the formula that called the UDF.
Update the master branch, which you need to do regardless.
Then, one of:
Rebase the old branch against the master branch. Solve the merge conflicts during rebase, and the result will be an up-to-date branch that merges cleanly against master.
Merge your branch into master, and resolve the merge conflicts.
Merge master into your branch, and resolve the merge conflicts. Then, merging from your branch into master should be clean.
None of these is better than the other, they just have different trade-off patterns.
I would use the rebase approach, which gives cleaner overall results to later readers, in my opinion, but that is nothing aside from personal taste.
To rebase and keep the branch you would:
git checkout <branch> && git rebase <target>
In your case, check out the old branch, then
git rebase master
to get it rebuilt against master.
Please also see this Microsoft Connect report on essentially, how blummin' difficult it is to use PowerShell to run shell commands (oh, the irony).
http://connect.microsoft.com/PowerShell/feedback/details/376207/
They suggest using --%
as a way to force PowerShell to stop trying to interpret the text to the right.
For example:
MSBuild /t:Publish --% /p:TargetDatabaseName="MyDatabase";TargetConnectionString="Data Source=.\;Integrated Security=True" /p:SqlPublishProfilePath="Deploy.publish.xml" Database.sqlproj
If you want to be sure that these files are properly refreshed by Chrome for all users, then you need to have must-revalidate
in the Cache-Control
header. This will make Chrome re-check files to see if they need to be re-fetched.
Recommend the following response header:
Cache-Control: must-validate
This tells Chrome to check with the server, and see if there is a newer file. If there is a newer file, it will receive it in the response. If not, it will receive a 304 response, and the assurance that the one in the cache is up to date.
If you do NOT set this header, then in the absence of any other setting that invalidates the file, Chrome will never check with the server to see if there is a newer version.
Here is a blog post that discusses the issue further.
In chrome to set the value you need to do YYYY-MM-DD
i guess because this worked : http://jsfiddle.net/HudMe/6/
So to make it work you need to set the date as 2012-10-01
Your code works for me. Here is my test case:
mysql> CREATE TABLE carmake (country ENUM('Canada', 'United States'));
Query OK, 0 rows affected (0.00 sec)
mysql> SHOW CREATE TABLE carmake;
+---------+-------------------------------------------------------------------------------------------------------------------------+
| Table | Create Table |
+---------+-------------------------------------------------------------------------------------------------------------------------+
| carmake | CREATE TABLE `carmake` (
`country` enum('Canada','United States') default NULL
) ENGINE=MyISAM DEFAULT CHARSET=latin1 |
+---------+-------------------------------------------------------------------------------------------------------------------------+
1 row in set (0.00 sec)
mysql> ALTER TABLE carmake CHANGE country country ENUM('Sweden','Malaysia');
Query OK, 0 rows affected (0.53 sec)
Records: 0 Duplicates: 0 Warnings: 0
mysql> SHOW CREATE TABLE carmake;
+---------+--------------------------------------------------------------------------------------------------------------------+
| Table | Create Table |
+---------+--------------------------------------------------------------------------------------------------------------------+
| carmake | CREATE TABLE `carmake` (
`country` enum('Sweden','Malaysia') default NULL
) ENGINE=MyISAM DEFAULT CHARSET=latin1 |
+---------+--------------------------------------------------------------------------------------------------------------------+
1 row in set (0.00 sec)
What error are you seeing?
FWIW this would also work:
ALTER TABLE carmake MODIFY COLUMN country ENUM('Sweden','Malaysia');
I would actually recommend a country table rather than enum column. You may have hundreds of countries which would make for a rather large and awkward enum.
EDIT: Now that I can see your error message:
ERROR 1265 (01000): Data truncated for column 'country' at row 1.
I suspect you have some values in your country column that do not appear in your ENUM
. What is the output of the following command?
SELECT DISTINCT country FROM carmake;
ANOTHER EDIT: What is the output of the following command?
SHOW VARIABLES LIKE 'sql_mode';
Is it STRICT_TRANS_TABLES
or STRICT_ALL_TABLES
? That could lead to an error, rather than the usual warning MySQL would give you in this situation.
YET ANOTHER EDIT: Ok, I now see that you definitely have values in the table that are not in the new ENUM
. The new ENUM
definition only allows 'Sweden'
and 'Malaysia'
. The table has 'USA'
, 'India'
and several others.
LAST EDIT (MAYBE): I think you're trying to do this:
ALTER TABLE carmake CHANGE country country ENUM('Italy', 'Germany', 'England', 'USA', 'France', 'South Korea', 'Australia', 'Spain', 'Czech Republic', 'Sweden', 'Malaysia') DEFAULT NULL;
Public strHostName As String
Public strIPAddress As String
strHostName = System.Net.Dns.GetHostName()
strIPAddress = System.Net.Dns.GetHostEntry(strHostName).AddressList(0).ToString()
MessageBox.Show("Host Name: " & strHostName & "; IP Address: " & strIPAddress)
Rather than trying to address the resource as a File just ask the ClassLoader to return an InputStream for the resource instead via getResourceAsStream:
InputStream in = getClass().getResourceAsStream("/file.txt");
BufferedReader reader = new BufferedReader(new InputStreamReader(in));
As long as the file.txt
resource is available on the classpath then this approach will work the same way regardless of whether the file.txt
resource is in a classes/
directory or inside a jar
.
The URI is not hierarchical
occurs because the URI for a resource within a jar file is going to look something like this: file:/example.jar!/file.txt
. You cannot read the entries within a jar
(a zip
file) like it was a plain old File.
This is explained well by the answers to:
With momentjs:
/* The difference, in years, between NOW and 2012-05-07 */
moment().diff(moment('20120507', 'YYYYMMDD'), 'years')
This work as a charm...
import csv
with open("data.csv", 'r') as f:
data = list(csv.reader(f, delimiter=";"))
import numpy as np
data = np.array(data, dtype=np.float)
You can try something like this
var access_token = driver.findElement(webdriver.By.name("AccToken"))
var access_token_getTextFunction = function() {
access_token.getText().then(function(value) {
console.log(value);
return value;
});
}
Than you can call this function where you want to get the value..
To get rid of the default dropdown arrow use:
-moz-appearance: window;
I have used jQuery AJAX to make AJAX requests.
Check the following code:
<html>
<head>
<script type="text/javascript" src="http://ajax.googleapis.com/ajax/libs/jquery/1.4/jquery.min.js"></script>
<script type="text/javascript">
$(document).ready(function() {
$('#call').click(function ()
{
$.ajax({
type: "post",
url: "testme", //this is my servlet
data: "input=" +$('#ip').val()+"&output="+$('#op').val(),
success: function(msg){
$('#output').append(msg);
}
});
});
});
</script>
<meta http-equiv="Content-Type" content="text/html; charset=UTF-8">
<title>JSP Page</title>
</head>
<body>
input:<input id="ip" type="text" name="" value="" /><br></br>
output:<input id="op" type="text" name="" value="" /><br></br>
<input type="button" value="Call Servlet" name="Call Servlet" id="call"/>
<div id="output"></div>
</body>
You can now use the Decodable protocol to Decode a .plist into a custom struct. I will go over a basic example, for more complicated .plist structures I recommend reading up on Decodable/Encodable (a good resource is here: https://benscheirman.com/2017/06/swift-json/).
First setup your struct into the format of your .plist file. For this example I will consider a .plist with a root level Dictionary and 3 entries: 1 String with key "name", 1 Int with key "age", and 1 Boolean with key "single". Here is the struct:
struct Config: Decodable {
private enum CodingKeys: String, CodingKey {
case name, age, single
}
let name: String
let age: Int
let single: Bool
}
Simple enough. Now the cool part. Using the PropertyListDecoder class we can easily parse the .plist file into an instantiation of this struct:
func parseConfig() -> Config {
let url = Bundle.main.url(forResource: "Config", withExtension: "plist")!
let data = try! Data(contentsOf: url)
let decoder = PropertyListDecoder()
return try! decoder.decode(Config.self, from: data)
}
Not much more code to worry about, and its all in Swift. Better yet we now have an instantiation of the Config struct that we can easily use:
let config = parseConfig()
print(config.name)
print(config.age)
print(config.single)
This Prints the value for the "name", "age", and "single" keys in the .plist.
Lexeme is basically the unit of a token and it is basically sequence of characters that matches the token and helps to break the source code into tokens.
For example: If the source is x=b
, then the lexemes would be x
, =
, b
and the tokens would be <id, 0>
, <=>
, <id, 1>
.
The problem is an issue of semantic meaning (as BoltClock mentions) and visual rendering.
Originally HTML used <b>
and <i>
for these purposes, entirely stylistic commands, laid down in the semantic environment of the document markup. CSS is an attempt to separate out as far as possible the stylistic elements of the medium. Thus style information such as bold and italics should go in CSS.
<strong>
and <em>
were introduced to fill the semantic need for text to be marked as more important or stressed. They have default stylistic interpretations akin to bold and italic, but they are not bound to that fate.
webapps
folderhttp://host:port/manager
. You will have to setup some users beforehand.webapps/webappname
Sometimes administrators configure tomcat so that war files are deployed outside the tomcat folder. Even in that case:
After you have it deployed (check the /logs
dir for any problems), it should be accessible via: http://host:port/yourwebappname/
. So in your case, one of those:
http://bilgin.ath.cx/TestWebApp/
http://bilgin.ath.cx:8080/TestWebApp/
If you don't manage by doing the above and googling - turn to your support. There might be an alternative port, or there might be something wrong with the application (and therefore in the logs)
http://blogs.mysql.com/peterg/2009/04/
In Mysql 6.1 you will be able to do FORMAT(X,D [,locale_name] )
As in
SELECT format(1234567,2,’de_DE’);
For now this ability does not exist, though you MAY be able to set your locale in your database my.ini check it out.
Do you need the object itself or do you just need to know if there is an object that satisfies. If the former then yes: use find:
found_object = my_array.find { |e| e.satisfies_condition? }
otherwise you can use any?
found_it = my_array.any? { |e| e.satisfies_condition? }
The latter will bail with "true" when it finds one that satisfies the condition. The former will do the same, but return the object.
As mentioned in comments, this is a scoping issue. Specifically, $con
is not in scope within your getPosts
function.
You should pass your connection object in as a dependency, eg
function getPosts(mysqli $con) {
// etc
I would also highly recommend halting execution if your connection fails or if errors occur. Something like this should suffice
mysqli_report(MYSQLI_REPORT_ERROR | MYSQLI_REPORT_STRICT); // throw exceptions
$con=mysqli_connect("localhost","xxxx","xxxx","xxxxx");
getPosts($con);
It seems it is impossible to do it without any external library.
An alternative way if you are using windows and don't want to open and close the shell everytime you want to clear it is by using windows command prompt.
Type python
and hit enter to turn windows command prompt to python idle (make sure python is installed).
Type quit()
and hit enter to turn it back to windows command prompt.
Type cls
and hit enter to clear the command prompt/ windows shell.
root/
assets/
lib/-------------------------libraries--------------------
bootstrap/--------------Libraries can have js/css/images------------
css/
js/
images/
jquery/
js/
font-awesome/
css/
images/
common/--------------------common section will have application level resources
css/
js/
img/
index.html
This is how I organized my application's static resources.
This is my PURE CSS solution :)
Add, scrolling yes to your iframe.
<iframe src="your iframe link" width="100%" scrolling="yes" frameborder="0"></iframe>
The trick :)
<style>
html, body, iframe { height: 100%; }
html { overflow: hidden; }
</style>
You don't need to worry about responsiveness :)
I think this would be a better way to do it in Swift:
func filterContentForSearchText(searchText:NSString, scope:NSString)
{
searchResults = recipes.filter { name.rangeOfString(searchText) != nil }
}
You can simply return
if you want to skip the current iteration.
Since you're in a function, if you return
before doing anything else, then you have effectively skipped execution of the code below the return
statement.
I have spent more time researching this topic that I'd like to admit. Luckily there are great open source solutions in the wild.
These are two great approaches, even if not well known enough (yet),
I think this issue will help you. Standard deviation
You are using the beta version of angular CLI you can do this way.
npm uninstall -g @angular/cli
npm uninstall -g angular/cli
Then type,
npm cache clean
Then go to the AppData folder which is hidden in your users and go to roaming folder which is inside AppData then go to npm folder and delete angular files in there and also go to npm-cache folder and delete angular components in there.After that restart your PC and type
npm install -g @angular/cli@latest
This worked for me ??
On Mac
If you are trying to clone the repo.... Then this problem is may occur because you don't have repo present in the github account present in Keychain Access. For resolution try to clone with the account name like
git clone https://[email protected]/org/repo.git
Replace
can use format attribute in HTML.
This seems to be implemented as standard in newer versions of angular.
The classes ng-untouched and ng-touched are set respectively before and after the user has had focus on an validated element.
CSS
input.ng-touched.ng-invalid {
border-color: red;
}
after few hours play with it and nearly become dull. miracle came to me, it work.
<pre>
var listname = [];
$.ajax({
url : wedding, // change to your local url, this not work with absolute url
success: function (data) {
callback(data);
}
});
function callback(data) {
$(data).find("a").attr("href", function (i, val) {
if( val.match(/\.(jpe?g|png|gif)$/) ) {
// $('#displayImage1').append( "<img src='" + wedding + val +"'>" );
listname.push(val);
}
});
}
function myfunction() {
alert (listname);
}
</pre>
Use this..
$("#myform input[type='radio']:checked").val();
This was happening for me in my Apache/2.4.18 (Ubuntu) setup. In my case, the error I was seeing was:
... AH01144: No protocol handler was valid for the URL /~socket.io/. If you are using a DSO version of mod_proxy, make sure the proxy submodules are included in the configuration using LoadModule.
The configuration related to this was:
ProxyPass /~socket.io/ ws://127.0.0.1:8090/~socket.io/
ProxyPassReverse /~socket.io/ ws://127.0.0.1:8090/~socket.io/
"No protocol handler was valid for the URL /~socket.io/
" meant that Apache could not handle the request being sent to "ws://127.0.0.1:8090/~socket.io/
"
I had proxy_http
loaded, but also needed proxy_wstunnel
. Once that was enabled all was good.
Even in base Python you can do the computation in generic form
result = sum(x**2 for x in some_vector) ** 0.5
x ** 2
is surely not an hack and the computation performed is the same (I checked with cpython source code). I actually find it more readable (and readability counts).
Using instead x ** 0.5
to take the square root doesn't do the exact same computations as math.sqrt
as the former (probably) is computed using logarithms and the latter (probably) using the specific numeric instruction of the math processor.
I often use x ** 0.5
simply because I don't want to add math
just for that. I'd expect however a specific instruction for the square root to work better (more accurately) than a multi-step operation with logarithms.
You can use javascript's indexOf function.
var str1 = "ABCDEFGHIJKLMNOP";
var str2 = "DEFG";
if(str1.indexOf(str2) != -1){
alert(str2 + " found");
}
You are trying to access the struct statically with a .
instead of ::
, nor are its members static
. Either instantiate ReducedForm
:
ReducedForm rf;
rf.iSimplifiedNumerator = 5;
or change the members to static
like this:
struct ReducedForm
{
static int iSimplifiedNumerator;
static int iSimplifiedDenominator;
};
In the latter case, you must access the members with ::
instead of .
I highly doubt however that the latter is what you are going for ;)
var response = taskwithresponse.Result;
var jsonString = response.ReadAsAsync<List<Job>>().Result;
i used replace feature in Notepad++ and replaced "
(without quotes) with "
and result was valid json
You could go a step further and break into the puppet code using a breakpoint.
http://logicminds.github.io/blog/2017/04/25/break-into-your-puppet-code/
This would only work with puppet apply or using a rspec test. Or you can manually type your code into the debugger console. Note: puppet still needs to know where your module code is at if you haven't set already.
gem install puppet puppet-debugger
puppet module install nwops/debug
cat > test.pp <<'EOF'
$var1 = 'test'
debug::break()
EOF
Should show something like.
puppet apply test.pp
From file: test.pp
1: $var1 = 'test'
2: # add 'debug::break()' where you want to stop in your code
=> 3: debug::break()
1:>> $var1
=> "test"
2:>>
Use the df command:
df -h
To avoid Special Characters in input type
public static InputFilter filter = new InputFilter() {
@Override
public CharSequence filter(CharSequence source, int start, int end, Spanned dest, int dstart, int dend) {
String blockCharacterSet = "~#^|$%*!@/()-'\":;,?{}=!$^';,?×÷<>{}€£¥?%~`¤??_|«»¡¿°•???¦???????????????:-);-):-D:-(:'(:O 1234567890";
if (source != null && blockCharacterSet.contains(("" + source))) {
return "";
}
return null;
}
};
You can set filter to your edit text like below
edtText.setFilters(new InputFilter[] { filter });
System.exit(ABORT); Quit's the process immediately.
First off, md5 and sha1 have been proven to be vulnerable to collision attacks and can be rainbow tabled easily (when they see if you hash is the same in their database of common passwords).
There are currently two things that are secure enough for passwords that you can use.
The first is sha512. sha512 is a sub-version of SHA2. SHA2 has not yet been proven to be vulnerable to collision attacks and sha512 will generate a 512-bit hash. Here is an example of how to use sha512:
<?php
hash('sha512',$password);
The other option is called bcrypt. bcrypt is famous for its secure hashes. It's probably the most secure one out there and most customizable one too.
Before you want to start using bcrypt you need to check if your sever has it enabled, Enter this code:
<?php
if (defined("CRYPT_BLOWFISH") && CRYPT_BLOWFISH) {
echo "CRYPT_BLOWFISH is enabled!";
}else {
echo "CRYPT_BLOWFISH is not available";
}
If it returns that it is enabled then the next step is easy, All you need to do to bcrypt a password is (note: for more customizability you need to see this How do you use bcrypt for hashing passwords in PHP?):
crypt($password, $salt);
A salt is usually a random string that you add at the end of all your passwords when you hash them. Using a salt means if someone gets your database, they can not check the hashes for common passwords. Checking the database is called using a rainbow table. You should always use a salt when hashing!
Here are my proofs for the SHA1 and MD5 collision attack vulnerabilities:
http://www.schneier.com/blog/archives/2012/10/when_will_we_se.html, http://eprint.iacr.org/2010/413.pdf,
http://people.csail.mit.edu/yiqun/SHA1AttackProceedingVersion.pdf,
http://conf.isi.qut.edu.au/auscert/proceedings/2006/gauravaram06collision.pdf and
Understanding sha-1 collision weakness
I was looking to make a checkbox that was just a little bit larger and looked at the source code for 37Signals Basecamp to find the following solution-
You can change the font size to make the checkbox slightly larger:
font-size: x-large;
Then, you can align the checkbox properly by doing:
vertical-align: top;
margin-top: 3px; /* change to center it */
I recommend PyInstaller, a simple python script can be converted to an exe with the following commands:
utils/Makespec.py [--onefile] oldlogs.py
which creates a yourprogram.spec file which is a configuration for building the final exe. Next command builds the exe from the configuration file:
utils/Build.py oldlogs.spec
More can be found here
I have created a javascript function that looks if he has enough space on the right side. If it has he will show it on the right side, else he will display it on the left side
Tested in:
Javascript:
$(document).ready(function(){
//little fix for the poisition.
var newPos = $(".fixed-menuprofile .dropdown-submenu").offset().left - $(this).width();
$(".fixed-menuprofile .dropdown-submenu").find('ul').offset({ "left": newPos });
$(".fixed-menu .dropdown-submenu").mouseover(function() {
var submenuPos = $(this).offset().left + 325;
var windowPos = $(window).width();
var oldPos = $(this).offset().left + $(this).width();
var newPos = $(this).offset().left - $(this).width();
if( submenuPos > windowPos ){
$(this).find('ul').offset({ "left": newPos });
} else {
$(this).find('ul').offset({ "left": oldPos });
}
});
});
because I don't want to add this fix on every menu items I created a new class on it. place the fixed-menu on the ul:
<ul class="dropdown-menu fixed-menu">
I hope this works out for you.
ps. little bug in safari and chrome, first hover will place it to mutch to the left will update this post if I fixed it.
<activity
android:name="MyBookActivity"
android:label="@string/app_name" >
<intent-filter>
<action android:name="android.intent.action.MAIN" />
<category android:name="android.intent.category.ALTERNATIVE" />
</intent-filter>
</activity>
where is your dot before MyBookActivity?
Just add the line below to the <TextInput>
secureTextEntry={true}
Use javascript
But it depends on what you are trying to do. If you just want to change the height and width, I suggest this:
{
document.getElementById('sample_id').style.height = '150px';
document.getElementById('sample_id').style.width = '150px';
}
TO totally remove it, remove the style, and then re-set the color:
getElementById('sample_id').removeAttribute("style");
document.getElementById('sample_id').style.color = 'red';
Of course, no the only question that remains is on which event you want this to happen.
If your are using Jakarta's http client library then you can do something like:
HttpClient client = new HttpClient();
client.getParams().setParameter(HttpClientParams.CONNECTION_MANAGER_TIMEOUT, new Long(5000));
client.getParams().setParameter(HttpClientParams.SO_TIMEOUT, new Integer(5000));
GetMethod method = new GetMethod("http://www.yoururl.com");
method.getParams().setParameter(HttpMethodParams.SO_TIMEOUT, new Integer(5000));
method.getParams().setParameter(HttpMethodParams.RETRY_HANDLER,
int statuscode = client.executeMethod(method);
(I can't comment yet, but wanted to share this):
Lyncee's code worked for me in desktop browser. However, on iPad (Chrome, iOS 9), it crashed the application. To fix it, I changed
document.documentElement.style.overflow = ...
to
document.body.style.overflow = ...
which solved my problem.
Mount a volume, copy the artifacts, adjust owner id and group id:
mkdir artifacts
docker run -i --rm -v ${PWD}/artifacts:/mnt/artifacts centos:6 /bin/bash << COMMANDS
ls -la > /mnt/artifacts/ls.txt
echo Changing owner from \$(id -u):\$(id -g) to $(id -u):$(id -g)
chown -R $(id -u):$(id -g) /mnt/artifacts
COMMANDS
EDIT: Note that some of the commands like $(id -u)
are backslashed and will therefore be processed within the container, while the ones that are not backslashed will be processed by the shell being run in the host machine BEFORE the commands are sent to the container.
You can use the server variables for this, for example $_SERVER['REQUEST_URI']
, or even better: $_SERVER['PHP_SELF']
.
depends on your DBMS (people don't seem to know what that is nowadays)
-- MYSql:
DELETE FROM table LIMIT 1;
-- Postgres:
DELETE FROM table LIMIT 1;
-- MSSql:
DELETE TOP(1) FROM table;
-- Oracle:
DELETE FROM table WHERE ROWNUM = 1;
I use to do this thing (Code Behind) ASP.NET using VB.NET:
1) Turn AutoPostBack = True in properties of said Textbox
2) Code for Textbox (Event : TextChanged) Me.TextBox1.Text = Me.TextBox1.Text.ToUpper
3) Observation After entering the string variables in TextBox1, when user leaves TextBox1, AutoPostBack fires the code when Text was changed during "TextChanged" event.
If you're doing some sort of math with the numbers you might also want to know the units. Given your input restrictions (that the input string contains unit and value only), this should correctly return both (you'll just need to figure out how to convert units into common units for your math).
def unit_value(str):
m = re.match(r'([^\d]*)(\d*\.?\d+)([^\d]*)', str)
if m:
g = m.groups()
return ' '.join((g[0], g[2])).strip(), float(g[1])
else:
return int(str)
From Documentation you can say that
View.GONE This view is invisible, and it doesn't take any space for layout purposes.
View.INVISIBLE This view is invisible, but it still takes up space for layout purposes.
Lets clear the idea with some pictures.
Assume that you have three buttons, like below
Now if you set visibility of Button Two as invisible (View.INVISIBLE
), then output will be
And when you set visibility of Button Two as gone (View.GONE
) then output will be
Hope this will clear your doubts.
Here is my almost similar case:
I have VC2010 working project under Win7 32bit. I make clean install of VC2013 under Win8.1 64bit
After successful converting of my project from VC2010 to VC2013, during 1st compilation the following error rise:
Finished generating code
LINK : fatal error LNK1158: cannot run 'rc.exe'
Solution 1:
Delete whole line “<ExecutablePath Condition=”...”>...</ExecutablePath>” in element “<PropertyGroup>” in NameOfYourSolution.vcxproj file in notepad before to run VC2013
Solution 2:
Copy only two files: rc.exe and rcdll.dll from “c:\Program Files (x86)\Windows Kits\8.1\bin\x86\” to “c:\Program Files (x86)\Microsoft Visual Studio 12.0\VC\bin\” and compilation will be successful!!
Note:
a)It is not need to touch any PATH or other Windows or VC environment variables.
b)“Platform Toolset” (Project Property Pages –> Configuration Properties –> General) will be automatic set to “Visual Studio 2013 (v120)” (not change it to “Visual Studio 2010” to be able to continue to develop your project under VC2013 concepts)
var myApp = angular.module('myApp',[]);
myApp .directive('myDirective', function ($timeout) {
return function (scope, element, attr) {
$timeout(function(){
element.val("value = "+attr.value);
});
}
});
function MyCtrl($scope) {
}
Use $timeout because directive call after dom load so your changes doesn`'t apply
That worked for me.
string address=senderAddress.Replace("'", "\\'");
Here it is in batch file form:
@echo off
set source=%1
set dest=%2
for %%f in (%source%\*) do if not exist "%dest%\%%~nxf" copy "%%f" "%dest%\%%~nxf"
One-line numpy solution for downsampling (by 2):
smaller_img = bigger_img[::2, ::2]
And upsampling (by 2):
bigger_img = smaller_img.repeat(2, axis=0).repeat(2, axis=1)
(this asssumes HxWxC shaped image. h/t to L. Kärkkäinen in the comments above. note this method only allows whole integer resizing (e.g., 2x but not 1.5x))
Add new SSH keys as described in this article on GitHub.
If Git still asks you for username & password, try changing https://github.com/
to [email protected]:
in remote URL:
$ git config remote.origin.url
https://github.com/dir/repo.git
$ git config remote.origin.url "[email protected]:dir/repo.git"
Before we write any code, let's discuss the difference between attributes and properties. Attributes are the settings you apply to elements in your HTML markup; the browser then parses the markup and creates DOM objects of various types that contain properties initialized with the values of the attributes. On DOM objects, such as a simple HTMLElement
, you almost always want to be working with its properties, not its attributes collection.
The current best practice is to avoid working with attributes unless they are custom or there is no equivalent property to supplement it. Since title
does indeed exist as a read/write property on many HTMLElement
s, we should take advantage of it.
You can read more about the difference between attributes and properties here or here.
With this in mind, let's manipulate that title
...
title
property without jQuerySince title
is a public property, you can set it on any DOM element that supports it with plain JavaScript:
document.getElementById('yourElementId').title = 'your new title';
Retrieval is almost identical; nothing special here:
var elementTitle = document.getElementById('yourElementId').title;
This will be the fastest way of changing the title if you're an optimization nut, but since you wanted jQuery involved:
title
property with jQuery (v1.6+)jQuery introduced a new method in v1.6 to get and set properties. To set the title
property on an element, use:
$('#yourElementId').prop('title', 'your new title');
If you'd like to retrieve the title, omit the second parameter and capture the return value:
var elementTitle = $('#yourElementId').prop('title');
Check out the prop()
API documentation for jQuery.
If you really don't want to use properties, or you're using a version of jQuery prior to v1.6, then you should read on:
title
attribute with jQuery (versions <1.6)You can change the title
attribute with the following code:
$('#yourElementId').attr('title', 'your new title');
Or retrieve it with:
var elementTitle = $('#yourElementId').attr('title');
Check out the attr()
API documentation for jQuery.
Reflection can take you from an object to a dictionary by iterating over the properties.
To go the other way, you'll have to use a dynamic ExpandoObject (which, in fact, already inherits from IDictionary, and so has done this for you) in C#, unless you can infer the type from the collection of entries in the dictionary somehow.
So, if you're in .NET 4.0 land, use an ExpandoObject, otherwise you've got a lot of work to do...
Use .ignore plugin: https://plugins.jetbrains.com/plugin/7495--ignore
It manages a lot of paths/patterns for you automatically and also has many useful extra features. It's compatible with:
I like this:
if (wlocation !== undefined)
But if you prefer the second way wouldn't be as you posted. It would be:
if (typeof wlocation !== "undefined")
String value = "{first_name = naresh,last_name = kumar,gender = male}"
Let's start
{
and }
from the String
>>first_name = naresh,last_name = kumar,gender = maleString
from ,
>> array of 3 elementarray
with 3
elementarray
and split each element by =
Map<String,String>
put each part separated by =
. first part as Key
and second part as Value
The accepted answer fires while scrolling through the messages, this avoids that.
You want a template like this.
<div #content>
<div #messages *ngFor="let message of messages">
{{message}}
</div>
</div>
Then you want to use a ViewChildren annotation to subscribe to new message elements being added to the page.
@ViewChildren('messages') messages: QueryList<any>;
@ViewChild('content') content: ElementRef;
ngAfterViewInit() {
this.scrollToBottom();
this.messages.changes.subscribe(this.scrollToBottom);
}
scrollToBottom = () => {
try {
this.content.nativeElement.scrollTop = this.content.nativeElement.scrollHeight;
} catch (err) {}
}
Im not a java developer but was using a java app to test a RESTful API. In order for me to fix the error I had to install the intermediate certificates in the webserver in order to make the error go away. I was using lighttpd, the original certificate was installed on an IIS server. Hope it helps. These were the certificates I had missing on the server.
Static variables in the context of a class are shared between all instances of a class.
In a function, it remains a persistent variable, so you could for instance count the number of times a function has been called.
When used outside of a function or class, it ensures the variable can only be used by code in that specific file, and nowhere else.
Constant variables however are prevented from changing. A common use of const and static together is within a class definition to provide some sort of constant.
class myClass {
public:
static const int TOTAL_NUMBER = 5;
// some public stuff
private:
// some stuff
};
This one liner will exit your Bash session after 10s
$ TMOUT=10 && echo "foo bar"
For XP, I used a (free/donateware) tool called "RAPIDEE" (Rapid Environment Editor), but SETX is definitely sufficient for Win 7 (I did not know about this before).
Right away, I can tell that at least the double quotes in the HTML tags are gonna be a problem. Those are probably all you'll need to escape for it to be valid JSON; just replace
"
with
\"
As for outputting user-input text, you do need to make sure you run it through HttpUtility.HtmlEncode() to avoid XSS attacks and to make sure that it doesn't screw up the formatting of your page.
One of the causes could be that you are not running the XAMPP Control Panel as an administrator.
The receiver must set port of receiver to match port set in sender DatagramPacket. For debugging try listening on port > 1024 (e.g. 8000 or 9000). Ports < 1024 are typically used by system services and need admin access to bind on such a port.
If the receiver sends packet to the hard-coded port it's listening to (e.g. port 57) and the sender is on the same machine then you would create a loopback to the receiver itself. Always use the port specified from the packet and in case of production software would need a check in any case to prevent such a case.
Another reason a packet won't get to destination is the wrong IP address specified in the sender. UDP unlike TCP will attempt to send out a packet even if the address is unreachable and the sender will not receive an error indication. You can check this by printing the address in the receiver as a precaution for debugging.
In the sender you set:
byte [] IP= { (byte)192, (byte)168, 1, 106 };
InetAddress address = InetAddress.getByAddress(IP);
but might be simpler to use the address in string form:
InetAddress address = InetAddress.getByName("192.168.1.106");
In other words, you set target as 192.168.1.106. If this is not the receiver then you won't get the packet.
Here's a simple UDP Receiver that works :
import java.io.IOException;
import java.net.*;
public class Receiver {
public static void main(String[] args) {
int port = args.length == 0 ? 57 : Integer.parseInt(args[0]);
new Receiver().run(port);
}
public void run(int port) {
try {
DatagramSocket serverSocket = new DatagramSocket(port);
byte[] receiveData = new byte[8];
String sendString = "polo";
byte[] sendData = sendString.getBytes("UTF-8");
System.out.printf("Listening on udp:%s:%d%n",
InetAddress.getLocalHost().getHostAddress(), port);
DatagramPacket receivePacket = new DatagramPacket(receiveData,
receiveData.length);
while(true)
{
serverSocket.receive(receivePacket);
String sentence = new String( receivePacket.getData(), 0,
receivePacket.getLength() );
System.out.println("RECEIVED: " + sentence);
// now send acknowledgement packet back to sender
DatagramPacket sendPacket = new DatagramPacket(sendData, sendData.length,
receivePacket.getAddress(), receivePacket.getPort());
serverSocket.send(sendPacket);
}
} catch (IOException e) {
System.out.println(e);
}
// should close serverSocket in finally block
}
}
Your query should work for synonyms as well as the tables. However, you seem to expect indexes on views where there are not. Maybe is it materialized views ?
If you go into the source code of an SVG file you can change the color fill by modifying the fill property.
<svg fill="#3F6078" height="24" viewBox="0 0 24 24" width="24" xmlns="http://www.w3.org/2000/svg" xmlns:xlink="http://www.w3.org/1999/xlink">
</svg>
Use your favorite text editor, open the SVG file and play around with it.
Try this code, include your object names & variable to work.
Set<String> windowids = driver.getWindowHandles();
Iterator<String> iter= windowids.iterator();
for (int i = 1; i < sh.getRows(); i++)
{
while(iter.hasNext())
{
System.out.println("Main Window ID :"+iter.next());
}
driver.findElement(By.id("lgnLogin_UserName")).clear();
driver.findElement(By.id("lgnLogin_UserName")).sendKeys(sh.getCell(0,
i).getContents());
driver.findElement(By.id("lgnLogin_Password")).clear();
driver.findElement(By.id("lgnLogin_Password")).sendKeys(sh.getCell(1,
i).getContents());
driver.findElement(By.id("lgnLogin_LoginButton")).click();
Thread.sleep(5000L);
windowids = driver.getWindowHandles();
iter= windowids.iterator();
String main_windowID=iter.next();
String tabbed_windowID=iter.next();
System.out.println("Main Window ID :"+main_windowID);
//switch over to pop-up window
Thread.sleep(1000);
driver.switchTo().window(tabbed_windowID);
System.out.println("Pop-up window Title : "+driver.getTitle());
If you prefer a graphical user interface, you can use pgAdmin III (Linux/Windows/OS X). Simply right click on the table of your choice, then "backup". It will create a pg_dump
command for you.
If you want to clean your database named "example_db":
1) Login to another db(for example 'postgres'):
psql postgres
2) Remove your database:
DROP DATABASE example_db;
3) Recreate your database:
CREATE DATABASE example_db;
find:
^>([^\n\r]+)[\n\r]([A-Z\n\r]+)
\1 = some_varying_text
\2 = lines of all CAPS
Edit (proof that this works):
text = """> some_Varying_TEXT
DSJFKDAFJKDAFJDSAKFJADSFLKDLAFKDSAF
GATACAACATAGGATACA
GGGGGAAAAAAAATTTTTTTTT
CCCCAAAA
> some_Varying_TEXT2
DJASDFHKJFHKSDHF
HHASGDFTERYTERE
GAGAGAGAGAG
PPPPPAAAAAAAAAAAAAAAP
"""
import re
regex = re.compile(r'^>([^\n\r]+)[\n\r]([A-Z\n\r]+)', re.MULTILINE)
matches = [m.groups() for m in regex.finditer(text)]
for m in matches:
print 'Name: %s\nSequence:%s' % (m[0], m[1])
preg_replace
offers one way:
$newText = preg_replace('/\bBy.*$/', '', $text);
Simple groovy way to check object type:
somObject in Date
Can be applied also to interfaces.
If only one checkbox should be checked in the same time use RadioButtonFor instead:
@Html.RadioButtonFor(model => model.Type,1, new { @checked = "checked" }) fultime
@Html.RadioButtonFor(model => model.Type,2) party
@Html.RadioButtonFor(model => model.Type,3) next option...
If one more one could be checked in the same time use excellent extension: CheckBoxListFor:
Hope,it will help
You can use this, it is pretty cool:
import dataconverters.commas as commas
filename = 'test.csv'
with open(filename) as f:
records, metadata = commas.parse(f)
for row in records:
print 'this is row in dictionary:'+rowenter code here
To append a new data element,just do this...
Document doc = docBuilder.parse(is);
Node root=doc.getFirstChild();
Element newserver=doc.createElement("new_server");
root.appendChild(newserver);
easy.... 'is' is an InputStream object. rest is similar to your code....tried it just now...
No there is no byte data type in C++. However you could always include the bitset header from the standard library and create a typedef for byte:
typedef bitset<8> BYTE;
NB: Given that WinDef.h defines BYTE for windows code, you may want to use something other than BYTE if your intending to target Windows.
Edit: In response to the suggestion that the answer is wrong. The answer is not wrong. The question was "Is there a 'byte' data type in C++?". The answer was and is: "No there is no byte data type in C++" as answered.
With regards to the suggested possible alternative for which it was asked why is the suggested alternative better?
According to my copy of the C++ standard, at the time:
"Objects declared as characters (char) shall be large enough to store any member of the implementations basic character set": 3.9.1.1
I read that to suggest that if a compiler implementation requires 16 bits to store a member of the basic character set then the size of a char would be 16 bits. That today's compilers tend to use 8 bits for a char is one thing, but as far as I can tell there is certainly no guarantee that it will be 8 bits.
On the other hand, "the class template bitset<N> describes an object that can store a sequence consisting of a fixed number of bits, N." : 20.5.1. In otherwords by specifying 8 as the template parameter I end up with an object that can store a sequence consisting of 8 bits.
Whether or not the alternative is better to char, in the context of the program being written, therefore depends, as far as I understand, although I may be wrong, upon your compiler and your requirements at the time. It was therefore upto the individual writing the code, as far as I'm concerned, to do determine whether the suggested alternative was appropriate for their requirements/wants/needs.
In my case I've used this:
var query = "select * from table where Id IN @Ids";
var result = conn.Query<MyEntity>(query, new { Ids = ids });
my variable "ids" in the second line is an IEnumerable of strings, also they can be integers I guess.
For Android 8.0, there is a new API to handle Hotspots. As far as I know, the old way using reflection doesn't work anymore. Please refer to:
void startLocalOnlyHotspot (WifiManager.LocalOnlyHotspotCallback callback,
Handler handler)
Request a local only hotspot that an application can use to communicate between co-located devices connected to the created WiFi hotspot. The network created by this method will not have Internet access.
Stack Overflow
How to turn on/off wifi hotspot programmatically in Android 8.0 (Oreo)
onStarted(WifiManager.LocalOnlyHotspotReservation reservation) method will be called if hotspot is turned on.. Using WifiManager.LocalOnlyHotspotReservation reference you call close() method to turn off hotspot.
Seems the most foolproof way to start with a UTC date is to create a new Date
object and use the setUTC…
methods to set it to the date/time you want.
Then the various toLocale…String
methods will provide localized output.
// This would come from the server._x000D_
// Also, this whole block could probably be made into an mktime function._x000D_
// All very bare here for quick grasping._x000D_
d = new Date();_x000D_
d.setUTCFullYear(2004);_x000D_
d.setUTCMonth(1);_x000D_
d.setUTCDate(29);_x000D_
d.setUTCHours(2);_x000D_
d.setUTCMinutes(45);_x000D_
d.setUTCSeconds(26);_x000D_
_x000D_
console.log(d); // -> Sat Feb 28 2004 23:45:26 GMT-0300 (BRT)_x000D_
console.log(d.toLocaleString()); // -> Sat Feb 28 23:45:26 2004_x000D_
console.log(d.toLocaleDateString()); // -> 02/28/2004_x000D_
console.log(d.toLocaleTimeString()); // -> 23:45:26
_x000D_
rdd = textFile('/data/{1.txt,2.txt}')
Since jQuery 1.6, attr()
will return the original value of an attribute (the one in the markup itself). You need to use prop() to get the current value:
var currentValue = $obj.prop("value");
However, using val() is not always the same. For instance, the value of <select>
elements is actually the value of their selected option. val()
takes that into account, but prop()
does not. For this reason, val()
is preferred.
The best solution I could find at present time to open a window maximized is (Internet Explorer 11, Chrome 49, Firefox 45):
var popup = window.open("your_url", "popup", "fullscreen");
if (popup.outerWidth < screen.availWidth || popup.outerHeight < screen.availHeight)
{
popup.moveTo(0,0);
popup.resizeTo(screen.availWidth, screen.availHeight);
}
see https://jsfiddle.net/8xwocrp6/7/
Note 1: It does not work on Edge (13.1058686). Not sure whether it's a bug or if it's as designed (I've filled a bug report, we'll see what they have to say about it). Here is a workaround:
if (navigator.userAgent.match(/Edge\/\d+/g))
{
return window.open("your_url", "popup", "width=" + screen.width + ",height=" + screen.height);
}
Note 2: moveTo
or resizeTo
will not work (Access denied) if the window you are opening is on another domain.
There were too many projects in my solution to go through and individually update so I fixed this by:
for k, m in self.materials.items():
example:
miles_dict = {'Monday':1, 'Tuesday':2.3, 'Wednesday':3.5, 'Thursday':0.9}
for k, v in miles_dict.items():
print("%s: %s" % (k, v))
In whatever (loosely-typed) language you can always cast a string to a number by adding a zero to it.
However, there is very little sense in this as PHP will do it automatically at the time of using this variable, and it will be cast to a string anyway at the time of output.
Note that you may wish to keep dotted numbers as strings, because after casting to float it may be changed unpredictably, due to float numbers' nature.
Use compareTo(BigDecimal.ZERO)
instead of equals()
:
if (price.compareTo(BigDecimal.ZERO) == 0) // see below
Comparing with the BigDecimal
constant BigDecimal.ZERO
avoids having to construct a new BigDecimal(0)
every execution.
FYI, BigDecimal
also has constants BigDecimal.ONE
and BigDecimal.TEN
for your convenience.
The reason you can't use BigDecimal#equals()
is that it takes scale into consideration:
new BigDecimal("0").equals(BigDecimal.ZERO) // true
new BigDecimal("0.00").equals(BigDecimal.ZERO) // false!
so it's unsuitable for a purely numeric comparison. However, BigDecimal.compareTo()
doesn't consider scale when comparing:
new BigDecimal("0").compareTo(BigDecimal.ZERO) == 0 // true
new BigDecimal("0.00").compareTo(BigDecimal.ZERO) == 0 // true
It was not clear to me in the question if ts.tax_status_code is a primary or alternate key or not. Same thing with recipient_code. This would be useful to know.
You can deal with the possibility of your bind variable being null using an OR as follows. You would bind the same thing to the first two bind variables.
If you are concerned about performance, you would be better to check if the values you intend to bind are null or not and then issue different SQL statement to avoid the OR.
insert into account_type_standard
(account_type_Standard_id, tax_status_id, recipient_id)
(
select
account_type_standard_seq.nextval,
ts.tax_status_id,
r.recipient_id
from tax_status ts, recipient r
where (ts.tax_status_code = ? OR (ts.tax_status_code IS NULL and ? IS NULL))
and (r.recipient_code = ? OR (r.recipient_code IS NULL and ? IS NULL))
This is just an add-on to the solution in case you want to compute not only unique values but other aggregate functions:
df.groupby(['group']).agg(['min','max','count','nunique'])
Hope you find it useful
The
res/values/colors.xml.
<color name="red">#ffff0000</color>
android:background="@color/red"
example didn't work for me, but the
android:background="#(hexidecimal here without these parenthesis)"
worked for me in the relative layout element as an attribute.
This answer is based on Array.forEach
, without any library, just native vanilla.
To basically call something()
3 times, use:
[1,2,3].forEach(function(i) {
something();
});
considering the following function:
function something(){ console.log('something') }
The outpout will be
something
something
something
To complete this questions, here's a way to do call something()
1, 2 and 3 times respectively:
[1,2,3].forEach(i => Array(i).fill(i).forEach(_ => {
something()
}))
[1,2,3].forEach(function(i) {
Array(i).fill(i).forEach(function() {
something()
})
}))
In both cases, the outpout will be
The outpout will be
something
something
something
something
something
something
(once, then twice, then 3 times)
The problem with the very idea is that the user has to have an email client, which is not the case if he rely on webmails, which is the case for many users. (at least there was no turn-around to redirect to this webmail when I investigated the issue a dozen years ago).
That's why the normal solution is to rely on php mail() for sending emails (server-side, then).
But if nowadays "email client" is always set, automatically, potentially to a webmail client, I'll be happy to know.
v is a query parameter, technically you need to consider cases ala: http://www.youtube.com/watch?p=DB852818BF378DAC&v=1q-k-uN73Gk
In .NET I would recommend to use System.Web.HttpUtility.ParseQueryString
HttpUtility.ParseQueryString(url)["v"];
And you don't even need to check the key, as it will return null if the key is not in the collection.
To connect remote machine through shell scripts , use below command:
sshpass -p PASSWORD ssh -o StrictHostKeyChecking=no USERNAME@IPADDRESS
where IPADDRESS
, USERNAME
and PASSWORD
are input values which need to provide in script, or if we want to provide in runtime use "read" command.
Another answer is:
Try checking the View dimensions at onWindowFocusChanged
.
A float gives you approx. 6-7 decimal digits precision while a double gives you approx. 15-16. Also the range of numbers is larger for double.
A double needs 8 bytes of storage space while a float needs just 4 bytes.
Why use any extension when you can do this without extension :)
Install specific version of node
sudo npm cache clean -f
sudo npm install -g n
sudo n stable
Specific version : sudo n 4.4.4
instead of sudo n stable
You want to restrict to input fields that are of type text so use the selector input[type=text]
rather than input
(which will apply to all input fields (e.g. those of type submit as well)).
Here is another solution, If you are using ES6 using spread operator:
var arr = [0, 21, 22, 7];
const indexOfMaxValue = arr.indexOf(Math.max(...arr));
You can use this query for checking database connection in laravel:
$pdo = DB::connection()->getPdo();
if($pdo)
{
echo "Connected successfully to database ".DB::connection()->getDatabaseName();
} else {
echo "You are not connected to database";
}
For more information you can checkout this page https://laravel.com/docs/5.0/database.
If initially typed the name of the database incorrectly. Then did a Php artisan migrate .You will then receive an error message .Later even if fixed the name of the databese you need to turn off the server and restart server
What you have is on the right track.
def dosomething( thelist ):
for element in thelist:
print element
dosomething( ['1','2','3'] )
alist = ['red','green','blue']
dosomething( alist )
Produces the output:
1
2
3
red
green
blue
A couple of things to note given your comment above: unlike in C-family languages, you often don't need to bother with tracking the index while iterating over a list, unless the index itself is important. If you really do need the index, though, you can use enumerate(list)
to get index,element
pairs, rather than doing the x in range(len(thelist))
dance.
Select the below code and drag that into in BOOKMARK BAR (if you don't see it, enable from Browser Settings), then EDIT that link :
javascript:var my_params = prompt("Enter your parameters", "var1=aaaa&var2=bbbbb"); var Target_LINK = prompt("Enter destination", location.href); function post(path, params) { var xForm = document.createElement("form"); xForm.setAttribute("method", "post"); xForm.setAttribute("action", path); for (var key in params) { if (params.hasOwnProperty(key)) { var hiddenField = document.createElement("input"); hiddenField.setAttribute("name", key); hiddenField.setAttribute("value", params[key]); xForm.appendChild(hiddenField); } } var xhr = new XMLHttpRequest(); xhr.onload = function () { alert(xhr.responseText); }; xhr.open(xForm.method, xForm.action, true); xhr.send(new FormData(xForm)); return false; } parsed_params = {}; my_params.split("&").forEach(function (item) { var s = item.split("="), k = s[0], v = s[1]; parsed_params[k] = v; }); post(Target_LINK, parsed_params); void(0);
That's all! Now you can visit any website, and click that button in BOOKMARK BAR!
The above method sends data using XMLHttpRequest
method, so, you have to be on the same domain while triggering the script. That's why I prefer sending data with a simulated FORM SUBMITTING, which can send the code to any domain - here is code for that:
javascript:var my_params=prompt("Enter your parameters","var1=aaaa&var2=bbbbb"); var Target_LINK=prompt("Enter destination", location.href); function post(path, params) { var xForm= document.createElement("form"); xForm.setAttribute("method", "post"); xForm.setAttribute("action", path); xForm.setAttribute("target", "_blank"); for(var key in params) { if(params.hasOwnProperty(key)) { var hiddenField = document.createElement("input"); hiddenField.setAttribute("name", key); hiddenField.setAttribute("value", params[key]); xForm.appendChild(hiddenField); } } document.body.appendChild(xForm); xForm.submit(); } parsed_params={}; my_params.split("&").forEach(function(item) {var s = item.split("="), k=s[0], v=s[1]; parsed_params[k] = v;}); post(Target_LINK, parsed_params); void(0);
The problem is due to SIGPIPE handling. You can solve this problem using the following code:
from signal import signal, SIGPIPE, SIG_DFL
signal(SIGPIPE,SIG_DFL)
See here for background on this solution. Better answer here.
From the builtin module this.py
(import this
):
s = "foobar"
d = {}
for c in (65, 97):
for i in range(26):
d[chr(i+c)] = chr((i+13) % 26 + c)
print("".join([d.get(c, c) for c in s])) # sbbone
Here's a variant of the solution from @JoshuaUlrich that uses the correct size instead of a hard-coded size:
fileName <- 'foo.txt'
readChar(fileName, file.info(fileName)$size)
Note that readChar allocates space for the number of bytes you specify, so readChar(fileName, .Machine$integer.max)
does not work well...
Try this:
if cookie and not cookie.isspace():
# the string is non-empty
else:
# the string is empty
The above takes in consideration the cases where the string is None
or a sequence of white spaces.
The accepted answer is correct but I will rewrite complete steps for java
.
I am currently using Swagger V2
with Spring Boot 2
and it's straightforward 3 step process.
Step 1: Add required dependencies in pom.xml
file. The second dependency is optional use it only if you need Swagger UI
.
<!-- https://mvnrepository.com/artifact/io.springfox/springfox-swagger2 -->
<dependency>
<groupId>io.springfox</groupId>
<artifactId>springfox-swagger2</artifactId>
<version>2.9.2</version>
</dependency>
<!-- https://mvnrepository.com/artifact/io.springfox/springfox-swagger-ui -->
<dependency>
<groupId>io.springfox</groupId>
<artifactId>springfox-swagger-ui</artifactId>
<version>2.9.2</version>
</dependency>
Step 2: Add configuration class
@Configuration
@EnableSwagger2
public class SwaggerConfig {
public static final Contact DEFAULT_CONTACT = new Contact("Usama Amjad", "https://stackoverflow.com/users/4704510/usamaamjad", "[email protected]");
public static final ApiInfo DEFAULT_API_INFO = new ApiInfo("Article API", "Article API documentation sample", "1.0", "urn:tos",
DEFAULT_CONTACT, "Apache 2.0", "http://www.apache.org/licenses/LICENSE-2.0", new ArrayList<VendorExtension>());
@Bean
public Docket api() {
Set<String> producesAndConsumes = new HashSet<>();
producesAndConsumes.add("application/json");
return new Docket(DocumentationType.SWAGGER_2)
.apiInfo(DEFAULT_API_INFO)
.produces(producesAndConsumes)
.consumes(producesAndConsumes);
}
}
Step 3: Setup complete and now you need to document APIs in controllers
@ApiOperation(value = "Returns a list Articles for a given Author", response = Article.class, responseContainer = "List")
@ApiResponses(value = { @ApiResponse(code = 200, message = "Success"),
@ApiResponse(code = 404, message = "The resource you were trying to reach is not found") })
@GetMapping(path = "/articles/users/{userId}")
public List<Article> getArticlesByUser() {
// Do your code
}
Usage:
You can access your Documentation from http://localhost:8080/v2/api-docs
just copy it and paste in Postman to import collection.
Optional Swagger UI: You can also use standalone UI without any other rest client via http://localhost:8080/swagger-ui.html
and it's pretty good, you can host your documentation without any hassle.
To add that using Jquery:
$('#commentForm').submit(function(){ //listen for submit event
$.each(params, function(i,param){
$('<input />').attr('type', 'hidden')
.attr('name', param.name)
.attr('value', param.value)
.appendTo('#commentForm');
});
return true;
});
I've a snippet that shows, how to get the spacings of elements with jQuery:
/* messing vertical spaces of block level elements with jQuery in pixels */
console.clear();
var jObj = $('selector');
for(var i = 0, l = jObj.length; i < l; i++) {
//jObj.eq(i).css('display', 'block');
console.log('jQuery object:', jObj.eq(i));
console.log('plain element:', jObj[i]);
console.log('without spacings - jObj.eq(i).height(): ', jObj.eq(i).height());
console.log('with padding - jObj[i].clientHeight: ', jObj[i].clientHeight);
console.log('with padding and border - jObj.eq(i).outerHeight(): ', jObj.eq(i).outerHeight());
console.log('with padding, border and margin - jObj.eq(i).outerHeight(true):', jObj.eq(i).outerHeight(true));
console.log('total vertical spacing: ', jObj.eq(i).outerHeight(true) - jObj.eq(i).height());
}
Reload the current document:
<script type="text/javascript">
function reloadPage()
{
window.location.reload()
}
</script>
Try this:
<marquee behavior="" Height="200px" direction="up" scroll onmouseover="this.setAttribute('scrollamount', 0, 0);this.stop();" onmouseout="this.setAttribute('scrollamount', 3, 0);this.start();" scrollamount="3" valign="center">
<img src="images/a.jpg">
<img src="images/a.jpg">
<img src="images/a.jpg">
<img src="images/a.jpg">
<img src="images/a.jpg">
<img src="images/a.jpg">
</marquee>
The one-liner that Andre Miller posted above works except for recent versions of sed when the input file ends with a blank line and no chars. On my Mac my CPU just spins.
Infinite loop if last line is blank and has no chars:
sed '$!N; /^\(.*\)\n\1$/!P; D'
Doesn't hang, but you lose the last line
sed '$d;N; /^\(.*\)\n\1$/!P; D'
The explanation is at the very end of the sed FAQ:
The GNU sed maintainer felt that despite the portability problems
this would cause, changing the N command to print (rather than
delete) the pattern space was more consistent with one's intuitions
about how a command to "append the Next line" ought to behave.
Another fact favoring the change was that "{N;command;}" will
delete the last line if the file has an odd number of lines, but
print the last line if the file has an even number of lines.To convert scripts which used the former behavior of N (deleting
the pattern space upon reaching the EOF) to scripts compatible with
all versions of sed, change a lone "N;" to "$d;N;".
Check out mtop.
To filter by multiple attributes use something like:
//for AND
$collection = Mage::getModel('sales/order')->getCollection()
->addAttributeToSelect('*')
->addFieldToFilter('my_field1', 'my_value1')
->addFieldToFilter('my_field2', 'my_value2');
echo $collection->getSelect()->__toString();
//for OR - please note 'attribute' is the key name and must remain the same, only replace //the value (my_field1, my_field2) with your attribute name
$collection = Mage::getModel('sales/order')->getCollection()
->addAttributeToSelect('*')
->addFieldToFilter(
array(
array('attribute'=>'my_field1','eq'=>'my_value1'),
array('attribute'=>'my_field2', 'eq'=>'my_value2')
)
);
For more information check: http://docs.magentocommerce.com/Varien/Varien_Data/Varien_Data_Collection_Db.html#_getConditionSql
Based on the answer of Arseniy-II: I had the Use-Case where the scrolling entity was not window itself but a inner Template (in this case a div). In this scenario we need to set an ID for the scrolling container and get it via getElementById
to use its scrolling function:
<div class="scroll-container" id="app-content">
...
</div>
const yOffsetForScroll = -100
const y = document.getElementById(this.idToScroll).getBoundingClientRect().top;
const main = document.getElementById('app-content');
main.scrollTo({
top: y + main.scrollTop + yOffsetForScroll,
behavior: 'smooth'
});
Leaving it here in case someone faces a similar situation!
Who knows if you still need it, but here is the solution.
Once you get to the --slurp
option, it's easy!
--slurp/-s:
Instead of running the filter for each JSON object in the input,
read the entire input stream into a large array and run the filter just once.
Then the +
operator will do what you want:
jq -s '.[0] + .[1]' config.json config-user.json
(Note: if you want to merge inner objects instead of just overwriting the left file ones with the right file ones, you will need to do it manually)
let restaurant = restaurants.find(element => element.restaurant.food == "chicken");
The find() method returns the value of the first element in the provided array that satisfies the provided testing function.
in: https://developer.mozilla.org/pt-PT/docs/Web/JavaScript/Reference/Global_Objects/Array/find
I was having this problem, when I was calling a soap method to obtain my data, and then return a json string, when I tried to do json_decode I just keep getting null.
Since I was using nusoap to do the soap call I tried to just return json string and now I could do a json_decode, since I really neaded to get my data with a SOAP call, what I did was add ob_start() before include nusoap, id did my call genereate json string, and then before returning my json string I did ob_end_clean(), and GOT MY PROBLEM FIXED :)
EXAMPLE
//HRT - SIGNED
//20130116
//verifica se um num assoc deco é valido
ob_start();
require('/nusoap.php');
$aResponse['SimpleIsMemberResult']['IsMember'] = FALSE;
if(!empty($iNumAssociadoTmp))
{
try
{
$client = new soapclientNusoap(PartnerService.svc?wsdl',
array(
// OPTS
'trace' => 0,
'exceptions' => false,
'cache_wsdl' => WSDL_CACHE_NONE
)
);
//MENSAGEM A ENVIAR
$sMensagem1 = '
<SimpleIsMember>
<request>
<CheckDigit>'.$iCheckDigitAssociado.'</CheckDigit>
<Country>Portugal</Country>
<MemberNumber">'.$iNumAssociadoDeco.'</MemberNumber>
</request>
</SimpleIsMember>';
$aResponse = $client->call('SimpleIsMember',$sMensagem1);
$aData = array('dados'=>$aResponse->xpto, 'success'=>$aResponse->example);
}
}
ob_end_clean();
return json_encode($aData);
The following example shows benchmarks for a few alternatives.
library(rbenchmark) # Note spelling: "rbenchmark", not "benchmark"
benchmark(seq(0,1e6,by=2),(0:5e5)*2,seq.int(0L,1e6L,by=2L))
## test replications elapsed relative user.self sys.self
## 2 (0:5e+05) * 2 100 0.587 3.536145 0.344 0.244
## 1 seq(0, 1e6, by = 2) 100 2.760 16.626506 1.832 0.900
## 3 seq.int(0, 1e6, by = 2) 100 0.166 1.000000 0.056 0.096
In this case, seq.int
is the fastest method and seq
the slowest. If performance of this step isn't that important (it still takes < 3 seconds to generate a sequence of 500,000 values), I might still use seq
as the most readable solution.
Drop the spaces around the =
sign:
#!/bin/bash
STR="Hello World"
echo $STR
EDIT: Yes, you can; but you have to cheat: The currently running class name is present on the call stack, and the traceback
module allows you to access the stack.
>>> import traceback
>>> def get_input(class_name):
... return class_name.encode('rot13')
...
>>> class foo(object):
... _name = traceback.extract_stack()[-1][2]
... input = get_input(_name)
...
>>>
>>> foo.input
'sbb'
However, I wouldn't do this; My original answer is still my own preference as a solution. Original answer:
probably the very simplest solution is to use a decorator, which is similar to Ned's answer involving metaclasses, but less powerful (decorators are capable of black magic, but metaclasses are capable of ancient, occult black magic)
>>> def get_input(class_name):
... return class_name.encode('rot13')
...
>>> def inputize(cls):
... cls.input = get_input(cls.__name__)
... return cls
...
>>> @inputize
... class foo(object):
... pass
...
>>> foo.input
'sbb'
>>>
The Use of Razor code @Html.Hidden or @Html.HiddenFor is similar to the following Html code
<input type="hidden"/>
And also refer the following link
Generate a random number (which is always between 0-1) and multiply by 1000000
Math.round(Math.random()*1000000);
One option is just to use the regex |
character to try to match each of the substrings in the words in your Series s
(still using str.contains
).
You can construct the regex by joining the words in searchfor
with |
:
>>> searchfor = ['og', 'at']
>>> s[s.str.contains('|'.join(searchfor))]
0 cat
1 hat
2 dog
3 fog
dtype: object
As @AndyHayden noted in the comments below, take care if your substrings have special characters such as $
and ^
which you want to match literally. These characters have specific meanings in the context of regular expressions and will affect the matching.
You can make your list of substrings safer by escaping non-alphanumeric characters with re.escape
:
>>> import re
>>> matches = ['$money', 'x^y']
>>> safe_matches = [re.escape(m) for m in matches]
>>> safe_matches
['\\$money', 'x\\^y']
The strings with in this new list will match each character literally when used with str.contains
.
# SOCKS5 proxy for HTTP/HTTPS
proxiesDict = {
'http' : "socks5://1.2.3.4:1080",
'https' : "socks5://1.2.3.4:1080"
}
# SOCKS4 proxy for HTTP/HTTPS
proxiesDict = {
'http' : "socks4://1.2.3.4:1080",
'https' : "socks4://1.2.3.4:1080"
}
# HTTP proxy for HTTP/HTTPS
proxiesDict = {
'http' : "1.2.3.4:1080",
'https' : "1.2.3.4:1080"
}
ES2020 Answer
With the Nullish Coalescing Operator, you can set a default value if value
is null or undefined.
const setVariable = localStorage.getItem('value') ?? 0;
However, you should be aware that the nullish coalescing operator does not return the default value for other types of falsy value such as 0
and ''
.
Do take note that browser support for the operator is limited. According to the data from caniuse, only 48.34% of browsers are supported (as of April 2020). Node.js support was added in version 14.
I was able to accomplish this in swift this way:
let navBarAppearance = UINavigationBar.appearance()
let colorImage = UIImage.imageFromColor(UIColor.morselPink(), frame: CGRectMake(0, 0, 340, 64))
navBarAppearance.setBackgroundImage(colorImage, forBarMetrics: .Default)
where i created the following utility method in a UIColor
category:
imageFromColor(color: UIColor, frame: CGRect) -> UIImage {
UIGraphicsBeginImageContextWithOptions(frame.size, false, 0)
color.setFill()
UIRectFill(frame)
let image = UIGraphicsGetImageFromCurrentImageContext()
UIGraphicsEndImageContext()
return image
}
I had the same program, I hope this could help.
I your using Windows 7, open Command Prompt-> run as Administrator. register your <...>.dll.
Why run as Administrator, you can register your <...>.dll using the run at the Windows Start, but still your dll only run as user even your account is administrator.
Now you can add your <...>.dll at the Project->Add Reference->Browse
Thanks
Simple ---
I have created a Sheet 2 with 4 cells and Sheet 1 with a single Cell with a Formula:
=SUM(Sheet2!B3:E3)
Note, trying as you stated, it does not make sense to assign a Single Cell a value from a range. Send it to a Formula that uses a range to do something with it.
The idiom (shared by quite a few other languages) for an unused variable is a single underscore _
. Code analysers typically won't complain about _
being unused, and programmers will instantly know it's a shortcut for i_dont_care_wtf_you_put_here
. There is no way to iterate without having an item variable - as the Zen of Python puts it, "special cases aren't special enough to break the rules".
You can bind the DropDownList in different ways by using List, Dictionary, Enum, DataSet DataTable
.
Main you have to consider three thing while binding the datasource of a dropdown.
you can use following code to bind a dropdownlist to a datasource as a datatable
:
SqlConnection con = new SqlConnection(ConfigurationManager.ConnectionStrings["ConnString"].ConnectionString);
SqlCommand cmd = new SqlCommand("Select * from tblQuiz", con);
SqlDataAdapter da = new SqlDataAdapter(cmd);
DataTable dt=new DataTable();
da.Fill(dt);
DropDownList1.DataTextField = "QUIZ_Name";
DropDownList1.DataValueField = "QUIZ_ID"
DropDownList1.DataSource = dt;
DropDownList1.DataBind();
if you want to process on selection of dropdownlist, then you have to change AutoPostBack="true"
you can use SelectedIndexChanged
event to write your code.
protected void DropDownList1_SelectedIndexChanged(object sender, EventArgs e)
{
string strQUIZ_ID=DropDownList1.SelectedValue;
string strQUIZ_Name=DropDownList1.SelectedItem.Text;
// Your code..............
}
This way can be helpful if you want to comment some Django Template format Code.
{#% include 'file.html' %#}
(Right Way)
Following code still executes if commented with HTML Comment.
<!-- {% include 'file.html' %} -->
(Wrong Way)
You probably didn't initialize the server or client is trying to connect to wrong ip/port.
Simple and easy to check or unchecked condition
<input type="checkbox" id="ev-click" name="" value="" >
<script>
$( "#ev-click" ).click(function() {
if(this.checked){
alert('checked');
}
if(!this.checked){
alert('Unchecked');
}
});
</script>
One you convert your image to gray-scale you cannot got back. You have gone from three channel to one, when you try to go back all three numbers will be the same. So the short answer is no you cannot go back. The reason your backtorgb function this throwing that error is because it needs to be in the format:
CvtColor(input, output, CV_GRAY2BGR)
OpenCV use BGR not RGB, so if you fix the ordering it should work, though your image will still be gray.
using(var client = new System.Net.WebClient()) {
client.UploadData(address,"PUT",data);
}
yum update
helped me out. After I had
wget: symbol lookup error: wget: undefined symbol: psl_latest
Be careful using the answer provide by @DevNG. Arrays.asList() returns internal implementation of ArrayList that doesn't implement some useful methods like add(), delete(), etc. If you call them an UnsupportedOperationException will be thrown. In order to get real ArrayList instance you need to write something like this:
List<Video> = new ArrayList<>(Arrays.asList(videoArray));
I think your choices are
entrySet()
and to find the keys which match the value. This is the slowest method, since it requires iterating through the entire collection, while the other two methods don't require that.The easiest way:
python 2
import urllib2, ssl
request = urllib2.Request('https://somedomain.co/')
response = urllib2.urlopen(request, context=ssl._create_unverified_context())
python 3
from urllib.request import urlopen
import ssl
response = urlopen('https://somedomain.co', context=ssl._create_unverified_context())
Think about somebody doing help(yourmodule)
at the interactive interpreter's prompt — what do they want to know? (Other methods of extracting and displaying the information are roughly equivalent to help
in terms of amount of information). So if you have in x.py
:
"""This module does blah blah."""
class Blah(object):
"""This class does blah blah."""
then:
>>> import x; help(x)
shows:
Help on module x:
NAME
x - This module does blah blah.
FILE
/tmp/x.py
CLASSES
__builtin__.object
Blah
class Blah(__builtin__.object)
| This class does blah blah.
|
| Data and other attributes defined here:
|
| __dict__ = <dictproxy object>
| dictionary for instance variables (if defined)
|
| __weakref__ = <attribute '__weakref__' of 'Blah' objects>
| list of weak references to the object (if defined)
As you see, the detailed information on the classes (and functions too, though I'm not showing one here) is already included from those components' docstrings; the module's own docstring should describe them very summarily (if at all) and rather concentrate on a concise summary of what the module as a whole can do for you, ideally with some doctested examples (just like functions and classes ideally should have doctested examples in their docstrings).
I don't see how metadata such as author name and copyright / license helps the module's user — it can rather go in comments, since it could help somebody considering whether or not to reuse or modify the module.