This version allows special characters like "ñ" or "àèìòù" that in other answers doesn`t resolve it:

function palindromeUnicode(s)
{
     var sc = decodeURIComponent(escape(s));
     return sc === Array.from(sc).reverse().join('')
}
console.log(palindromeUnicode('áñitalavalatiñá')); //true

try this

Jobs

select s.name,l.name
 from  msdb..sysjobs s 
 left join master.sys.syslogins l on s.owner_sid = l.sid

Packages

select s.name,l.name 
from msdb..sysssispackages s 
 left join master.sys.syslogins l on s.ownersid = l.sid

I know this is an old question, but this will do the job.

SELECT colname, typename, length, scale, default, nulls
  FROM syscat.columns
 WHERE tabname = '<table name>'
   AND tabschema = '<schema name>'
 ORDER BY colno

As others have noted, in Notepad++ 6.0 and later, it is possible to use the "Replace" feature to delete all lines that begin with ";" or "#".

Tao provides a regular expression that serves as a starting point, but it does not account for white-space that may exist before the ";" or "#" character on a given line. For example, lines that begin with ";" or "#" but are "tabbed-in" will not be deleted when using Tao's regular expression, ^(#|;).*\r\n.

Tao's regular expression does not account for the caveat mentioned in BoltClock's answer, either: variances in newline characters across systems.

An improvement is to use ^(\s)*(#|;).*(\r\n|\r|\n)?, which accounts for leading white-space and the newline character variances. Also, the trailing ? handles cases in which the last line of the file begins with # or ;, but does not end with a newline.

For the curious, it is possible to discern which type of newline character is used in a given document (and more than one type may be used): View -> Show Symbol -> Show End of Line.

Handy one-liner

pkl() (
  python -c 'import pickle,sys;d=pickle.load(open(sys.argv[1],"rb"));print(d)' "$1"
)
pkl my.pkl

Will print __str__ for the pickled object.

The generic problem of visualizing an object is of course undefined, so if __str__ is not enough, you will need a custom script.

There's more to it than this, but you're probably looking for this list:

B   business day frequency
C   custom business day frequency (experimental)
D   calendar day frequency
W   weekly frequency
M   month end frequency
BM  business month end frequency
MS  month start frequency
BMS business month start frequency
Q   quarter end frequency
BQ  business quarter endfrequency
QS  quarter start frequency
BQS business quarter start frequency
A   year end frequency
BA  business year end frequency
AS  year start frequency
BAS business year start frequency
H   hourly frequency
T   minutely frequency
S   secondly frequency
L   milliseconds
U   microseconds

Source: http://pandas.pydata.org/pandas-docs/stable/timeseries.html#offset-aliases

Also worth noting window.scrollBy(dx,dy) (ref)

For Swift 4+ try the following code (tested on Swift 4.0, 4.1 - IOS 10, 11) :

override var prefersStatusBarHidden: Bool { return true }

override func viewDidAppear(_ animated: Bool) {
    super.viewDidAppear(animated)
    // call this func to force preferredStatusBarStyle to be read again.
    setNeedsStatusBarAppearanceUpdate()
}

Alternate approach : without installation of Redistributable package.

Check out in some github for the relevant dll, some people upload the reference dll for their application dependency.

you can download and use them in your project , I have used and run them successfully.

example : https://github.com/Emotiv/community-sdk/find/master

I know this question has been asked three years back.Now,String.trim() was added natively in JavaScript.For an instance, you can trim directly as following,

document.getElementById("id").value.trim();

This answer won't help you to change the logging level dynamically, you need to restart the service, if you are fine restarting the service, please use the below solution

I did this to Change log4j log level and it worked for me, I have n't referred any document. I used this system property value to set my logfile name. I used the same technique to set logging level as well, and it worked

passed this as JVM parameter (I use Java 1.7)

Sorry this won't dynamically change the logging level, it requires a restart of the service

java -Dlogging.level=DEBUG -cp xxxxxx.jar  xxxxx.java

in the log4j.properties file, I added this entry

log4j.rootLogger=${logging.level},file,stdout

I tried

 java -Dlogging.level=DEBUG -cp xxxxxx.jar  xxxxx.java
 java -Dlogging.level=INFO-cp xxxxxx.jar  xxxxx.java
 java -Dlogging.level=OFF -cp xxxxxx.jar  xxxxx.java

It all worked. hope this helps!

I have these following dependencies in my pom.xml

<dependency>
            <groupId>log4j</groupId>
            <artifactId>log4j</artifactId>
            <version>1.2.17</version>
</dependency>

<dependency>
    <groupId>log4j</groupId>
    <artifactId>apache-log4j-extras</artifactId>
    <version>1.2.17</version>
</dependency>

You are looking for the __getitem__ method. See http://docs.python.org/reference/datamodel.html, section 3.4.6

String labelText ="<html>Name :"+name+"<br>Surname :"+surname+"<br>Gender :"+gender+"</html>";
JLabel label=new JLabel(labelText);
label.setVisible(true);
label.setBounds(10, 10,300, 100);
dialog.add(label);

In HTML, SGML and XML, ⁽¹⁾ attributes cannot be repeated, and should only be defined in an element once.

So your example:

<span style="color:blue" style="font-style:italic">Test</span>

is non-conformant to the HTML standard, and will result in undefined behaviour, which explains why different browsers are rendering it differently.

Since there is no defined way to interpret this, browsers can interpret it however they want and merge them, or ignore them as they wish.

^{(1): Every article I can find states that attributes are "key/value" pairs or "attribute-value" pairs, heavily implying the keys must be unique. The best source I can find states:}

^{Attribute names (id and status in this example) are subject to the same restrictions as other names in XML; they need not be unique across the whole DTD, however, but only within the list of attributes for a given element. (Emphasis mine.)}

It wont break if you wrap each item in a div. Check out my fiddle with the link below. I made the width of the fieldset 125px and made each item 50px wide. You'll see the label and checkbox remain side by side on a new line and don't break.

<fieldset>
<div class="item">
    <input type="checkbox" id="a">
    <label for="a">a</label>
</div>
<div class="item">
   <input type="checkbox" id="b">
<!-- depending on width, a linebreak can occur here. -->
    <label for="b">bgf bh fhg fdg hg dg gfh dfgh</label>
</div>
<div class="item">
    <input type="checkbox" id="c">
    <label for="c">c</label>
</div>
</fieldset>

http://jsfiddle.net/t5dwp7pg/1/

For Select2 v4:

Use dropdownParent to attach the dropdown to the modal dialog, rather than the HTML body.

<!-- Modal -->
<div class="modal fade" id="myModal" tabindex="-1" role="dialog" aria-labelledby="myModalLabel">
  <div class="modal-dialog" role="document">
    <div class="modal-content">
      <div class="modal-header">
        <button type="button" class="close" data-dismiss="modal" aria-label="Close"><span aria-hidden="true">&times;</span></button>
        <h4 class="modal-title" id="myModalLabel">Modal title</h4>
      </div>
      <div class="modal-body">
        <select id="select2insidemodal" multiple="multiple">
          <option value="AL">Alabama</option>
            ...
          <option value="WY">Wyoming</option>
        </select>
      </div>
      <div class="modal-footer">
        <button type="button" class="btn btn-default" data-dismiss="modal">Close</button>
        <button type="button" class="btn btn-primary">Save changes</button>
      </div>
    </div>
  </div>
</div>


<script>

$(document).ready(function() {
  $("#select2insidemodal").select2({
    dropdownParent: $("#myModal")
  });
});

</script>

This will attach the Select2 dropdown so it falls within the DOM of the modal rather than to the HTML body (the default). See https://select2.org/dropdown#dropdown-placement

All you want is the below regex:

^\d+$

I changed windows password today then Tortoise declined to connect me to SVN server. I got around it by opening a Dos box and doing an "svn co ...". It prompted for the new credential then happily did its work. After that, Tortoise works also.

We recently encountered this error, root cause turned out to be an expired SSL cert on the IIS server. The Load Balancer (infront of our web tier) found the SSL expired, and instead of handling the HTTP traffic over to one of the IIS servers, started showing this error. So basically IIS unable to server requests, for a totally different reason :)

I have noticed that an emulator gets slow over a period of time. So, one can delete the emulator which gets very slow and create a new one with the help of the AVD manager. I have tried it a couple of times and it works well.

This is how it is done

select * from 
    (select top 100 percent pointx, pointy from point
     where pointtype = 1
     order by pointy) A
union all
select * from 
    (select top 100 percent pointx, pointy from point
     where pointtype = 2
     order by pointy desc) B

You can use this regex to get the yyyy-MM-dd format:

((?:19|20)\\d\\d)-(0?[1-9]|1[012])-([12][0-9]|3[01]|0?[1-9])

You can find example for date validation: How to validate date with regular expression.

The Easiest way to implement scrollbar using java swing is as below :

1. Navigate to Design view
2. right click on textArea
3. Select surround with JScrollPane

android:scaleType ="centerInside" --> this line use to center an image,, but you need to keep height and width of an image as wrap_context

 <ImageView
            android:id ="@+id/imageView6"
            android:layout_width ="wrap_content"
            android:layout_height ="wrap_content"
            android:scaleType ="centerInside"
            android:layout_marginTop ="20dp"
            app:srcCompat ="@drawable/myimage" />

I used System.Data.Linq.SqlClient.SqlMethods.Like(row.Name, "test") in my query.

This performs a case-insensitive comparison.

Martin Schillinger's version seems to be the strictly correct one.

Since I knew I only needed it to work correctly on business week days, I went with this simpler form, based on something I found online, don't remember where:

ISOWeekday = (0 == InputDate.getDay()) ? 7 : InputDate.getDay();
ISOCalendarWeek = Math.floor( ( ((InputDate.getTime() - (new Date(InputDate.getFullYear(),0,1)).getTime()) / 86400000) - ISOWeekday + 10) / 7 );

It fails in early January on days that belong to the previous year's last week (it produces CW = 0 in those cases) but is correct for everything else.

find:

^>([^\n\r]+)[\n\r]([A-Z\n\r]+)

\1 = some_varying_text

\2 = lines of all CAPS

Edit (proof that this works):

text = """> some_Varying_TEXT

DSJFKDAFJKDAFJDSAKFJADSFLKDLAFKDSAF
GATACAACATAGGATACA
GGGGGAAAAAAAATTTTTTTTT
CCCCAAAA

> some_Varying_TEXT2

DJASDFHKJFHKSDHF
HHASGDFTERYTERE
GAGAGAGAGAG
PPPPPAAAAAAAAAAAAAAAP
"""

import re

regex = re.compile(r'^>([^\n\r]+)[\n\r]([A-Z\n\r]+)', re.MULTILINE)
matches = [m.groups() for m in regex.finditer(text)]

for m in matches:
    print 'Name: %s\nSequence:%s' % (m[0], m[1])

Found that setting the secure property in Session_Start is sufficient, as recommended in MSDN blog "Securing Session ID: ASP/ASP.NET" with some augmentation.

    protected void Session_Start(Object sender, EventArgs e)
    {
        SessionStateSection sessionState = 
 (SessionStateSection)ConfigurationManager.GetSection("system.web/sessionState");
        string sidCookieName = sessionState.CookieName;

        if (Request.Cookies[sidCookieName] != null)
        {
            HttpCookie sidCookie = Response.Cookies[sidCookieName];
            sidCookie.Value = Session.SessionID;
            sidCookie.HttpOnly = true;
            sidCookie.Secure = true;
            sidCookie.Path = "/";
        }
    }

echo Yii::$app->request->url;

In your view, you have to cast it back to the original type. Without the cast, it's just an object.

<td>@((ViewBag.data as ICollection<Person>).First().FirstName)</td>

ViewBag is a C# 4 dynamic type. Entities returned from it are also dynamic unless cast. However, extension methods like .First() and all the other Linq ones do not work with dynamics.

Edit - to address the comment:

If you want to display the whole list, it's as simple as this:

<ul>
    @foreach (var person in ViewBag.data)
    {
        <li>@person.FirstName</li>
    }
</ul>

Extension methods like .First() won't work, but this will.

I ran to a similar error running Excel in VBA, what I've learned is that when I pull data from MSSQL, and then using get_range and .Value2 apply it's out of the range, any value that was of type uniqueidentifier (GUID) resulted in this error. Only when I cast the value to nvarcahr(max) it worked.

I think one error in the original code might have been that it had:

$message = echo getRequestURI();

instead of:

$message = getRequestURI();

(The code has since been edited though.)

There are some misconceptions here.

Frequencies above 500 can be represented in an FFT result of length 1000. Unfortunately these frequencies are all folded together and mixed into the first 500 FFT result bins. So normally you don't want to feed an FFT a signal containing any frequencies at or above half the sampling rate, as the FFT won't care and will just mix the high frequencies together with the low ones (aliasing) making the result pretty much useless. That's why data should be low-pass filtered before being sampled and fed to an FFT.

The FFT returns amplitudes without frequencies because the frequencies depend, not just on the length of the FFT, but also on the sample rate of the data, which isn't part of the FFT itself or it's input. You can feed the same length FFT data at any sample rate, as thus get any range of frequencies out of it.

The reason the result plots ends at 500 is that, for any real data input, the frequencies above half the length of the FFT are just mirrored repeats (complex conjugated) of the data in the first half. Since they are duplicates, most people just ignore them. Why plot duplicates? The FFT calculates the other half of the result for people who feed the FFT complex data (with both real and imaginary components), which does create two different halves.

For HTML Entities
◄ = ◄
► = ►
▼ = ▼
▲ = ▲

row vectors are (1,0) tensor, vectors are (0, 1) tensor. if using v = np.array([[1,2,3]]), v become (0,2) tensor. Sorry, i am confused.

You can use elevation property for Android if you don't mind the shadow.

{
  elevation:1
} 

You can also do

subset(df, aged <= laclen)

Try this:

<dependency>
    <groupId>com.fasterxml.jackson.core</groupId>
    <artifactId>jackson-databind</artifactId>
    <version>2.12.1</version>
</dependency>

If order is not important and you don't need to worry about duplicates then you can use set intersection:

>>> a = [1,2,3,4,5]
>>> b = [1,3,5,6]
>>> list(set(a) & set(b))
[1, 3, 5]

Buttons can be added to frozen rows as images. Assigning a function within the attached script to the button makes it possible to run the function. The comment which says you can not is of course a very old comment, possibly things have changed now.

In Eclipse -

1)Checkout master branch

Git Repositories ->Click on your repository -> click on Local ->double click master branch
->Click on yes for check out

2)Pull master branch

Right click on project ->click on Team -> Click on Pull

3)Checkout your feature branch(follow same steps mentioned in 1 point)

4)Merge master into feature

Git Repositories ->Click on your repository -> click on Local ->Right Click on your selected feature branch ->Click on merge ->Click on Local ->Click on Master ->Click on Merge.

5)Now you will get all changes of Master branch in feature branch. Remove conflict if any.

For conflict if any exists ,follow this -
Changes mentioned as Head(<<<<<< HEAD) is your change, Changes mentioned in branch(>>>>>>> branch) is other person change, you can update file accordingly.

Note - You need to do add to index for conflicts files

6)commit and push your changes in feature branch.

Right click on project ->click on Team -> Click on commit -> Commit and Push.

OR

Git Repositories ->Click on your repository -> click on Local ->Right Click on your selected feature branch ->Click on Push Branch ->Preview ->Push

Just in case if someone is wondering to save the CSV file to a specific path for email attachments. Then it can be done as follows

I know I have added a lot of comments just for newbies :)

I have added an example so that you can summarize well.

$activeUsers = /** Query to get the active users */

/** Following is the Variable to store the Users data as 
    CSV string with newline character delimiter, 

    its good idea of check the delimiter based on operating system */

$userCSVData = "Name,Email,CreatedAt\n";

/** Looping the users and appending to my earlier csv data variable */
foreach ( $activeUsers as $user ) {
    $userCSVData .= $user->name. "," . $user->email. "," . $user->created_at."\n";
}
/** Here you can use with H:i:s too. But I really dont care of my old file  */
$todayDate  = date('Y-m-d');
/** Create Filname and Path to Store */
$fileName   = 'Active Users '.$todayDate.'.csv';
$filePath   = public_path('uploads/'.$fileName); //I am using laravel helper, in case if your not using laravel then just add absolute or relative path as per your requirements and path to store the file

/** Just in case if I run the script multiple time 
    I want to remove the old file and add new file.

    And before deleting the file from the location I am making sure it exists */
if(file_exists($filePath)){
    unlink($filePath);
}
$fp = fopen($filePath, 'w+');
fwrite($fp, $userCSVData); /** Once the data is written it will be saved in the path given */
fclose($fp);

/** Now you can send email with attachments from the $filePath */

NOTE: The following is a very bad idea to increase the memory_limit and time limit, but I have only added to make sure if anyone faces the problem of connection time out or any other. Make sure to find out some alternative before sticking to it.

You have to add the following at the start of the above script.

ini_set("memory_limit", "10056M");
set_time_limit(0);
ini_set('mysql.connect_timeout', '0');
ini_set('max_execution_time', '0');

You are looking for CHAR_LENGTH() to get the number of characters in a string.

For multi-byte charsets LENGTH() will give you the number of bytes the string occupies, while CHAR_LENGTH() will return the number of characters.

another simple approach with modern built-in stuff like PercentRelativeLayout is now available for new users who hit this problem. thanks to android team for release this item.

<android.support.percent.PercentRelativeLayout xmlns:android="http://schemas.android.com/apk/res/android"
xmlns:app="http://schemas.android.com/apk/res-auto"
android:layout_width="match_parent"
android:layout_height="match_parent"
android:clickable="true"
app:layout_widthPercent="50%">

<FrameLayout xmlns:android="http://schemas.android.com/apk/res/android"
    android:layout_width="match_parent"
    android:layout_height="match_parent">

    <ImageView
        android:id="@+id/picture"
        android:layout_width="match_parent"
        android:layout_height="match_parent"
        android:scaleType="centerCrop" />

    <TextView
        android:id="@+id/text"
        android:layout_width="match_parent"
        android:layout_height="wrap_content"
        android:layout_gravity="bottom"
        android:background="#55000000"
        android:paddingBottom="15dp"
        android:paddingLeft="10dp"
        android:paddingRight="10dp"
        android:paddingTop="15dp"
        android:textColor="@android:color/white" />

</FrameLayout>

and for better performance you can use some stuff like picasso image loader which help you to fill whole width of every image parents. for example in your adapter you should use this:

int width= context.getResources().getDisplayMetrics().widthPixels;
    com.squareup.picasso.Picasso
            .with(context)
            .load("some url")
            .centerCrop().resize(width/2,width/2)
            .error(R.drawable.placeholder)
            .placeholder(R.drawable.placeholder)
            .into(item.drawableId);

now you dont need CustomImageView Class anymore.

P.S i recommend to use ImageView in place of Type Int in class Item.

hope this help..

json.loads() takes a JSON encoded string, not a filename. You want to use json.load() (no s) instead and pass in an open file object:

with open('/Users/JoshuaHawley/clean1.txt') as jsonfile:
    data = json.load(jsonfile)

The open() command produces a file object that json.load() can then read from, to produce the decoded Python object for you. The with statement ensures that the file is closed again when done.

The alternative is to read the data yourself and then pass it into json.loads().

For the record, the spring.jpa.hibernate.ddl-auto property is Spring Data JPA specific and is their way to specify a value that will eventually be passed to Hibernate under the property it knows, hibernate.hbm2ddl.auto.

The values create, create-drop, validate, and update basically influence how the schema tool management will manipulate the database schema at startup.

For example, the update operation will query the JDBC driver's API to get the database metadata and then Hibernate compares the object model it creates based on reading your annotated classes or HBM XML mappings and will attempt to adjust the schema on-the-fly.

The update operation for example will attempt to add new columns, constraints, etc but will never remove a column or constraint that may have existed previously but no longer does as part of the object model from a prior run.

Typically in test case scenarios, you'll likely use create-drop so that you create your schema, your test case adds some mock data, you run your tests, and then during the test case cleanup, the schema objects are dropped, leaving an empty database.

In development, it's often common to see developers use update to automatically modify the schema to add new additions upon restart. But again understand, this does not remove a column or constraint that may exist from previous executions that is no longer necessary.

In production, it's often highly recommended you use none or simply don't specify this property. That is because it's common practice for DBAs to review migration scripts for database changes, particularly if your database is shared across multiple services and applications.

sudo apt-get install build-essential is enough to get it working.

Several ways to check if an object property exists.

const dog = { name: "Spot" }

if (dog.name) console.log("Yay 1"); // Prints.
if (dog.sex) console.log("Yay 2"); // Doesn't print. 

if ("name" in dog) console.log("Yay 3"); // Prints.
if ("sex" in dog) console.log("Yay 4"); // Doesn't print.

if (dog.hasOwnProperty("name")) console.log("Yay 5"); // Prints.
if (dog.hasOwnProperty("sex")) console.log("Yay 6"); // Doesn't print, but prints undefined.

¦ What is an attribute?

– A variable that belongs to an object.Attributes is same term used alternatively for properties or fields or data members or class members

¦ How else can it be called?

– field or instance variable

¦ How do you create one? What is the syntax?

– You need to declare attributes at the beginning of the class definition, outside of any method. The syntax is the following: ;

It's called spread attributes and its aim is to make the passing of props easier.

Let us imagine that you have a component that accepts N number of properties. Passing these down can be tedious and unwieldy if the number grows.

<Component x={} y={} z={} />

Thus instead you do this, wrap them up in an object and use the spread notation

var props = { x: 1, y: 1, z:1 };
<Component {...props} />

which will unpack it into the props on your component, i.e., you "never" use {... props} inside your render() function, only when you pass the props down to another component. Use your unpacked props as normal this.props.x.

You are getting the warning because ArrayList is part of java generics. Essentially, it's a way to catch your type errors at compile time. For example, if you declare your array list with types Integer (ArrrayList<Integer>) and then try to add Strings to it, you'll get an error at compile time - avoiding nasty crashes at runtime.

The first syntax is there for backward compatibility and should be avoided whenever possible (note that generics were not there in older versions of java).

Second and third examples are pretty much equivalent. As you need to pass an object and not a primitive type to add method, your 3 is internally converted to Integer(3). By writing a string in double-quotes you effectively are creating a String object. When calling String("ss") you are creating a new String object with value being the same as the parameter ("ss").

Unless you really do need to store different types in your List, I would suggest actually using a proper type declaration, e.g. ArrayList<Integer> = new ArrayList<Integer>() - it'll save you a lot of headache in the long run.

If you do need multiple datatypes in the list, then the second example is better.

Disable horizontal scrollbar completely by adding this code.

body{
  overflow-x: hidden;
  overflow-y: scroll;
}

I need to select every production with a category that doesn't contain "Business"

Although I upvoted @Arran's answer as correct, I would also add this... Strictly interpreted, the OP's specification would be implemented as

//production[category[not(contains(., 'Business'))]]

rather than

//production[not(contains(category, 'Business'))]

The latter selects every production whose first category child doesn't contain "Business". The two XPath expressions will behave differently when a production has no category children, or more than one.

It doesn't make any difference in practice as long as every <production> has exactly one <category> child, as in your short example XML. Whether you can always count on that being true or not, depends on various factors, such as whether you have a schema that enforces that constraint. Personally, I would go for the more robust option, since it doesn't "cost" much... assuming your requirement as stated in the question is really correct (as opposed to e.g. 'select every production that doesn't have a category that contains "Business"').

I think some concepts from "Advanced Unix Programming" by Marc Rochkind were helpful in understanding the different roles of fork()/exec(), especially for someone used to the Windows CreateProcess() model:

A program is a collection of instructions and data that is kept in a regular file on disk. (from 1.1.2 Programs, Processes, and Threads)

.

In order to run a program, the kernel is first asked to create a new process, which is an environment in which a program executes. (also from 1.1.2 Programs, Processes, and Threads)

.

It’s impossible to understand the exec or fork system calls without fully understanding the distinction between a process and a program. If these terms are new to you, you may want to go back and review Section 1.1.2. If you’re ready to proceed now, we’ll summarize the distinction in one sentence: A process is an execution environment that consists of instruction, user-data, and system-data segments, as well as lots of other resources acquired at runtime, whereas a program is a file containing instructions and data that are used to initialize the instruction and user-data segments of a process. (from 5.3 exec System Calls)

Once you understand the distinction between a program and a process, the behavior of fork() and exec() function can be summarized as:

• fork() creates a duplicate of the current process
• exec() replaces the program in the current process with another program

(this is essentially a simplified 'for dummies' version of paxdiablo's much more detailed answer)

I use this code piece while working with indexes for radio group:

radioGroup.check(radioGroup.getChildAt(index).getId());

Wanted to add the UI portal Way to do as well. In case you want to create the folder structure, you would have to do it with the complete path for each file.

You need to Click on Upload Blob, Expand the Advanced and put it the path saying "Upload to Folder"

So Lets say you have a folder assets you want to upload and the content of the folder look like below

And if you have a folder under js folder with name main.js, you need to type in the path "assets/js" in upload to folder. Now This has to be done for each file. In case you have a lot of file, its recommended you do it programmatically.

For something simple that work for arrays , strings , and objects I builed this function:

function console_testing($var){

    $var = json_encode($var,JSON_UNESCAPED_UNICODE);

    $output = <<<EOT
    <script>
        console.log($var); 
    </script>
EOT;

    echo $output;

}

You need antMatcher for multiple HttpSecurity, see Spring Security Reference:

5.7 Multiple HttpSecurity

We can configure multiple HttpSecurity instances just as we can have multiple <http> blocks. The key is to extend the WebSecurityConfigurationAdapter multiple times. For example, the following is an example of having a different configuration for URL’s that start with /api/.

@EnableWebSecurity
public class MultiHttpSecurityConfig {
  @Autowired
  public void configureGlobal(AuthenticationManagerBuilder auth) { 1
      auth
          .inMemoryAuthentication()
              .withUser("user").password("password").roles("USER").and()
              .withUser("admin").password("password").roles("USER", "ADMIN");
  }

  @Configuration
  @Order(1)                                                        2
  public static class ApiWebSecurityConfigurationAdapter extends WebSecurityConfigurerAdapter {
      protected void configure(HttpSecurity http) throws Exception {
          http
              .antMatcher("/api/**")                               3
              .authorizeRequests()
                  .anyRequest().hasRole("ADMIN")
                  .and()
              .httpBasic();
      }
  }    

  @Configuration                                                   4
  public static class FormLoginWebSecurityConfigurerAdapter extends WebSecurityConfigurerAdapter {

      @Override
      protected void configure(HttpSecurity http) throws Exception {
          http
              .authorizeRequests()
                  .anyRequest().authenticated()
                  .and()
              .formLogin();
      }
  }
}

1 Configure Authentication as normal

2 Create an instance of WebSecurityConfigurerAdapter that contains @Order to specify which WebSecurityConfigurerAdapter should be considered first.

3 The http.antMatcher states that this HttpSecurity will only be applicable to URLs that start with /api/

4 Create another instance of WebSecurityConfigurerAdapter. If the URL does not start with /api/ this configuration will be used. This configuration is considered after ApiWebSecurityConfigurationAdapter since it has an @Order value after 1 (no @Order defaults to last).

In your case you need no antMatcher, because you have only one configuration. Your modified code:

http
    .authorizeRequests()
        .antMatchers("/high_level_url_A/sub_level_1").hasRole('USER')
        .antMatchers("/high_level_url_A/sub_level_2").hasRole('USER2')
        .somethingElse() // for /high_level_url_A/**
        .antMatchers("/high_level_url_A/**").authenticated()
        .antMatchers("/high_level_url_B/sub_level_1").permitAll()
        .antMatchers("/high_level_url_B/sub_level_2").hasRole('USER3')
        .somethingElse() // for /high_level_url_B/**
        .antMatchers("/high_level_url_B/**").authenticated()
        .anyRequest().permitAll()

The best way to accomplish this is by simply adding "href" to the link button like below.

<asp:LinkButton runat="server" id="SomeLinkButton" href="url" CssClass="btn btn-primary btn-sm">Button Text</asp:LinkButton>

Using javascript, or doing this programmatically in the page_load, will work as well but is not the best way to go about doing this.

You will get this result:

<a id="MainContent_ctl00_SomeLinkButton" class="btn btn-primary btn-sm" href="url" href="javascript:__doPostBack(&#39;ctl00$MainContent$ctl00$lSomeLinkButton&#39;,&#39;&#39;)">Button Text</a>

You can also get the same results by using using a regular <a href="" class=""></a>.

The most compact version:

<input type="submit" onclick="return confirm('Are you sure?')" />

The key thing to note is the return

-

Because there are many ways to skin a cat, here is another alternate method:

HTML:

<input type="submit" onclick="clicked(event)" />

Javascript:

<script>
function clicked(e)
{
    if(!confirm('Are you sure?')) {
        e.preventDefault();
    }
}
</script>

You can do this type of checking with Flash or Silverlight but not Javascript. The javascript sandbox does not allow access to the file system. The size check would need to be done server side after it has been uploaded.

If you want to go the Silverlight/Flash route, you could check that if they are not installed to default to a regular file upload handler that uses the normal controls. This way, if the do have Silverlight/Flash installed their experience will be a bit more rich.

I experienced this on a div that had a click event and after 20 some searches I found this snippet that saved my day.

-webkit-tap-highlight-color: rgba(0,0,0,0);

This disables the default button highlighting in webkit mobile browsers

If working on EJB client library:

You need to mention the argument for getting the initial context.

InitialContext ctx = new InitialContext();

If you do not, it will look in the project folder for properties file. Also you can include the properties credentials or values in your class file itself as follows:

Properties props = new Properties();
props.put(Context.INITIAL_CONTEXT_FACTORY, "org.jnp.interfaces.NamingContextFactory");
props.put(Context.URL_PKG_PREFIXES, "org.jboss.ejb.client.naming");
props.put(Context.PROVIDER_URL, "jnp://localhost:1099");

InitialContext ctx = new InitialContext(props);

URL_PKG_PREFIXES: Constant that holds the name of the environment property for specifying the list of package prefixes to use when loading in URL context factories.

The EJB client library is the primary library to invoke remote EJB components.
This library can be used through the InitialContext. To invoke EJB components the library creates an EJB client context via a URL context factory. The only necessary configuration is to parse the value org.jboss.ejb.client.naming for the java.naming.factory.url.pkgs property to instantiate an InitialContext.

You need to use:

await client.PostAsync(uri, content);

Something like that:

var comment = "hello world";
var questionId = 1;

var formContent = new FormUrlEncodedContent(new[]
{
    new KeyValuePair<string, string>("comment", comment), 
    new KeyValuePair<string, string>("questionId", questionId) 
});

var myHttpClient = new HttpClient();
var response = await myHttpClient.PostAsync(uri.ToString(), formContent);

And if you need to get the response after post, you should use:

var stringContent = await response.Content.ReadAsStringAsync();

Hope it helps ;)

In Java there is a difference between x++ and ++x

++x is a prefix form: It increments the variables expression then uses the new value in the expression.

For example if used in code:

int x = 3;

int y = ++x;
//Using ++x in the above is a two step operation.
//The first operation is to increment x, so x = 1 + 3 = 4
//The second operation is y = x so y = 4

System.out.println(y); //It will print out '4'
System.out.println(x); //It will print out '4'

x++ is a postfix form: The variables value is first used in the expression and then it is incremented after the operation.

For example if used in code:

int x = 3;

int y = x++;
//Using x++ in the above is a two step operation.
//The first operation is y = x so y = 3
//The second operation is to increment x, so x = 1 + 3 = 4

System.out.println(y); //It will print out '3'
System.out.println(x); //It will print out '4' 

Hope this is clear. Running and playing with the above code should help your understanding.

I've set up a JSFiddle to test several different solutions to this problem. Based on the [vague] criteria of

1) Maximum flexibility

2) No weird behavior

The accepted answer here of

img { display: block; }

which is recommended by a lot of people (such as in this excellent article), actually ranks fourth.

1st, 2nd, and 3rd place are all a toss-up between these three solutions:

1) The solution given by @Dave Kok and @Hasan Gursoy:

img { vertical-align: top; } /* or bottom */

pros:

• All display values work on both the parent and img.
• No very strange behavior; any siblings of the img fall where you'd expect them to.
• Very efficient.

cons:

• In the [perfectly valid] case of both the parent and img having `display: inline`, the value of this property can determine the position of the img's parent (a bit strange).

2) Setting font-size: 0; on the parent element:

.parent {
    font-size: 0;
    vertical-align: top;
}
.parent > * {
    font-size: 16px;
    vertical-align: top;
}

Since this one [kind of] requires vertical-align: top on the img, this is basically an extension of the 1st solution.

pros:

• All display values work on both the parent and img.
• No very strange behavior; any siblings of the img fall where you'd expect them to.
• Fixes the inline whitespace problem for any siblings of the img.
• Although this still moves the position of the parent in the case of the parent and img both having `display: inline`, at least you can't see the parent anymore.

cons:

• Less efficient code.
• This assumes "correct" markup; if the img has text node siblings, they won't show up.

3) Setting line-height: 0 on the parent element:

.parent {
    line-height: 0;
    vertical-align: top;
}
.parent > * {
    line-height: 1.15;
    vertical-align: top;
}

Similar to the 2nd solution in that, to make it fully flexible, it basically becomes an extension of the 1st.

pros:

• Behaves like the first two solutions on all display combinations except when the parent and img have `display: inline`.

cons:

• Less efficient code.
• In the case of both the parent and img having `display: inline`, we get all sorts of crazy. (Maybe playing with the `line-height` property isn't the best idea...)

So there you have it. I hope this helps some poor soul.

You can use ngStyle to set background for a div

<div [ngStyle]="{background-image: 'url(./images/' + trls.img + ')'}"></div>

or you can also use built in background style:

<div [style.background-image]="'url(/images/' + trls.img + ')'"></div>

Add try this code .. Its working grt.......

<body>_x000D_
<?php_x000D_
 if (isset($_POST['nav'])) {_x000D_
   header("Location: $_POST[nav]");_x000D_
 }_x000D_
?>_x000D_
<form id="page-changer" action="" method="post">_x000D_
    <select name="nav">_x000D_
        <option value="">Go to page...</option>_x000D_
        <option value="http://css-tricks.com/">CSS-Tricks</option>_x000D_
        <option value="http://digwp.com/">Digging Into WordPress</option>_x000D_
        <option value="http://quotesondesign.com/">Quotes on Design</option>_x000D_
    </select>_x000D_
    <input type="submit" value="Go" id="submit" />_x000D_
</form>_x000D_
</body>_x000D_
</html>

<html>_x000D_
<head>_x000D_
<script type="text/javascript" src="//ajax.googleapis.com/ajax/libs/jquery/2.0.0/jquery.min.js"></script>_x000D_
<script>_x000D_
$(function() {_x000D_
_x000D_
    $("#submit").hide();_x000D_
_x000D_
    $("#page-changer select").change(function() {_x000D_
        window.location = $("#page-changer select option:selected").val();_x000D_
    })_x000D_
_x000D_
});_x000D_
</script>_x000D_
</head>

Just set css property of container div 'pointer-events' as none i.e. 'pointer-events:none;'

You can use VLOOKUP.

Assuming those are in columns A and B in Sheet1 and Sheet2 each, 22350 is in cell A2 of Sheet1, you can use:

=VLOOKUP(A2, Sheet2!A:B, 2, 0)

This will return you #N/A if there are no matches. Drag/Fill/Copy&Paste the formula to the bottom of your table and that should do it.

Aside: attempt to amend Tomasz Nurkiewicz's answer was rejected:

This edit does not make the post even a little bit easier to read, easier to find, more accurate or more accessible. Changes are either completely superfluous or actively harm readability.

Correct and permanent link to the relevant section of documentation about integration testing.

To enable support for transactions, you must configure a PlatformTransactionManager bean in the ApplicationContext that is loaded via @ContextConfiguration semantics.

@Configuration
@PropertySource("application.properties")
public class Persistence {
    @Autowired
    Environment env;

    @Bean
    DataSource dataSource() {
        return new DriverManagerDataSource(
                env.getProperty("datasource.url"),
                env.getProperty("datasource.user"),
                env.getProperty("datasource.password")
        );
    }

    @Bean
    PlatformTransactionManager transactionManager() {
        return new DataSourceTransactionManager(dataSource());
    }
}

In addition, you must declare Spring’s @Transactional annotation either at the class or method level for your tests.

@RunWith(SpringJUnit4ClassRunner.class)
@ContextConfiguration(classes = {Persistence.class, SomeRepository.class})
@Transactional
public class SomeRepositoryTest { ... }

Annotating a test method with @Transactional causes the test to be run within a transaction that will, by default, be automatically rolled back after completion of the test. If a test class is annotated with @Transactional, each test method within that class hierarchy will be run within a transaction.

Here's another variation using list comprehension:

original_d = {'a': None, 'b': 'Some'}
d = dict((k,v) for k, v in original_d.iteritems() if v)
# result should be {'b': 'Some'}

The approach is based on an answer from this post: Efficient way to remove keys with empty strings from a dict

Another clean way to save the file is this:

import csv
import urllib

urllib.retrieve("your url goes here" , "output.csv")

simplest way i found is viewport-height in css..

div {height: 100vh;}

this takes the viewport-height of the browser-window and updates it during resizes.

see "can i use" for browser compatibility list

Rahul's answer is best fit for your question. Anyway, if you have a group of checkboxes to be checked and not all the checkbox in your form, you can go for it.

Put a classname for all the checkboxes you want to check, say for example, a classname test_check and now you can check if any of the checkbox is checked belonging to the group by:

$("#formID .test_check:checked").length > 0

If it returns true, assume that one or more checkboxes are checked having the classname test_check and none checked if returns false.

Hope it helps someone. Thanks :)-

You should definitely check out the MSDN on what Outlook will support in regards to css and html. The link is here: http://msdn.microsoft.com/en-us/library/aa338201(v=office.12).aspx. If you do not have at least office 2007 you really need to upgrade as there are major differences between 2007 and previous editions. Also try saving the resulting email to file and examine it with firefox you will see what is being changed by outlook and possibly have a more specific question to ask. You can use Word to view the email as a sort of preview as well (but you won't get info on what styles are/are not being applied.

It seems no one has mentioned a built-in factory method of producing ufunc in numpy package: np.frompyfunc which I have tested again np.vectorize and have outperformed it by about 20~30%. Of course it will perform well as prescribed C code or even numba(which I have not tested), but it can a better alternative than np.vectorize

f = lambda x, y: x * y
f_arr = np.frompyfunc(f, 2, 1)
vf = np.vectorize(f)
arr = np.linspace(0, 1, 10000)

%timeit f_arr(arr, arr) # 307ms
%timeit vf(arr, arr) # 450ms

I have also tested larger samples, and the improvement is proportional. See the documentation also here

In Rails 2, I would have written:

validates_uniqueness_of :zipcode, :scope => :recorded_at

In Rails 3:

validates :zipcode, :uniqueness => {:scope => :recorded_at}

For multiple attributes:

validates :zipcode, :uniqueness => {:scope => [:recorded_at, :something_else]}

If you don't have avahi installed then it's probably cups.

SQL injection can be a tricky problem but there are ways around it. Your risk is reduced your risk simply by using an ORM like Linq2Entities, Linq2SQL, NHibrenate. However you can have SQL injection problems even with them.

The main thing with SQL injection is user controlled input (as is with XSS). In the most simple example if you have a login form (I hope you never have one that just does this) that takes a username and password.

SELECT * FROM Users WHERE Username = '" + username + "' AND password = '" + password + "'"

If a user were to input the following for the username Admin' -- the SQL Statement would look like this when executing against the database.

SELECT * FROM Users WHERE Username = 'Admin' --' AND password = ''

In this simple case using a paramaterized query (which is what an ORM does) would remove your risk. You also have a the issue of a lesser known SQL injection attack vector and that's with stored procedures. In this case even if you use a paramaterized query or an ORM you would still have a SQL injection problem. Stored procedures can contain execute commands, and those commands themselves may be suceptable to SQL injection attacks.

CREATE PROCEDURE SP_GetLogin @username varchar(100), @password varchar(100) AS
DECLARE @sql nvarchar(4000)
SELECT @sql = ' SELECT * FROM users' +
              ' FROM Product Where username = ''' + @username + ''' AND password = '''+@password+''''

EXECUTE sp_executesql @sql

So this example would have the same SQL injection problem as the previous one even if you use paramaterized queries or an ORM. And although the example seems silly you'd be surprised as to how often something like this is written.

My recommendations would be to use an ORM to immediately reduce your chances of having a SQL injection problem, and then learn to spot code and stored procedures which can have the problem and work to fix them. I don't recommend using ADO.NET (SqlClient, SqlCommand etc...) directly unless you have to, not because it's somehow not safe to use it with parameters but because it's that much easier to get lazy and just start writing a SQL query using strings and just ignoring the parameters. ORMS do a great job of forcing you to use parameters because it's just what they do.

Next Visit the OWASP site on SQL injection https://www.owasp.org/index.php/SQL_Injection and use the SQL injection cheat sheet to make sure you can spot and take out any issues that will arise in your code. https://www.owasp.org/index.php/SQL_Injection_Prevention_Cheat_Sheet finally I would say put in place a good code review between you and other developers at your company where you can review each others code for things like SQL injection and XSS. A lot of times programmers miss this stuff because they're trying to rush out some feature and don't spend too much time on reviewing their code.

If you simply want to prevent interaction with the select altogether when my_condition is true, you could always just capture the mousedown event and do your event prevent there:

var my_condition = true;

$("#my_select").mousedown(function(e){
  if(my_condition)
  {
     e.preventDefault();
     alert("Because my_condition is true, you cannot make this change.");
  }
});

This will prevent any change event from ever occurring while my_condition is true.

labelName.Text = DateTime.Now.ToString("dddd , MMM dd yyyy,hh:mm:ss");

Output:

To add to Gavin's answer: prior to the merge, it is possible to get aggregate to use proper names when not using the formula interface:

aggregate(data[,"score", drop=F], list(group=data$group), mean) 

I had a similar problem, not exactly the same conditions and then i saw this post. Hope it helps someone. Apparently i was using one of my EF entity models a base class for a type that was not specified as a db set in my dbcontext. To fix this issue i had to create a base class that had all the properties common to the two types and inherit from the new base class among the two types.

Example:

//Bad Flow
    //class defined in dbcontext as a dbset
    public class Customer{ 
       public int Id {get; set;}
       public string Name {get; set;}
    }

    //class not defined in dbcontext as a dbset
    public class DuplicateCustomer:Customer{ 
       public object DuplicateId {get; set;}
    }


    //Good/Correct flow*
    //Common base class
    public class CustomerBase{ 
       public int Id {get; set;}
       public string Name {get; set;}
    }

    //entity model referenced in dbcontext as a dbset
    public class Customer: CustomerBase{

    }

    //entity model not referenced in dbcontext as a dbset
    public class DuplicateCustomer:CustomerBase{

       public object DuplicateId {get; set;}

    }

Get private variable's value using Reflection:

var _barVariable = typeof(Foo).GetField("_bar", BindingFlags.NonPublic | BindingFlags.Instance).GetValue(objectForFooClass);

Set value for private variable using Reflection:

typeof(Foo).GetField("_bar", BindingFlags.NonPublic | BindingFlags.Instance).SetValue(objectForFoocClass, "newValue");

Where objectForFooClass is a non null instance for the class type Foo.

And as suggested above by Siu Ching Pong -Asuka Kenji with the function which in my opinion makes more sense and leaves you with the convenience of the map type without the function wrapper around:

   // romanNumeralDict returns map[int]string dictionary, since the return
       // value is always the same it gives the pseudo-constant output, which
       // can be referred to in the same map-alike fashion.
       var romanNumeralDict = func() map[int]string { return map[int]string {
            1000: "M",
            900:  "CM",
            500:  "D",
            400:  "CD",
            100:  "C",
            90:   "XC",
            50:   "L",
            40:   "XL",
            10:   "X",
            9:    "IX",
            5:    "V",
            4:    "IV",
            1:    "I",
          }
        }

        func printRoman(key int) {
          fmt.Println(romanNumeralDict()[key])
        }

        func printKeyN(key, n int) {
          fmt.Println(strings.Repeat(romanNumeralDict()[key], n))
        }

        func main() {
          printRoman(1000)
          printRoman(50)
          printKeyN(10, 3)
        }

Try this at play.golang.org.

You could also use ContentResult as suggested here instead of subclassing JsonResult.

var serializer = new JavaScriptSerializer { MaxJsonLength = Int32.MaxValue, RecursionLimit = 100 };

return new ContentResult()
{
    Content = serializer.Serialize(data),
    ContentType = "application/json",
};

Pycharm 2017.1.1

1. Click on View->ToolBar & View->Tool Buttons
2. On the left pane Project would be visible, right click on it and press Autoscroll to source and then run your code.

This worked for me.

Just setting Skip Install to YES did not work for me. Hopefully this will help somebody.

I went to dependence of my project targets: Coreplot-CocoaTouch. Then went to Coreplot-CocoaTouch Targets. In its Targets opened Build Phases. Then opened Copy Headers. There I had some of headers in Public, some in Private and some in Project. Moved ALL of them to Project.

Of course, in Build Settings of Coreplot-CocoaTouch Targets checked that Skip Install was set to YES in Deployment options.

And this time Archive made an archive that could be signed and .ipa produced.

The V$ views are mainly dynamic views of system metrics. They are used for performance tuning, session monitoring, etc. So access is limited to DBA users by default, which is why you're getting ORA-00942.

The easiest way of finding the database name is:

select * from global_name;

This view is granted to PUBLIC, so anybody can query it.

I'm pretty mixed up on this. I am also running Excel 2010. I tried saving two sheets as a single PDF using:

    ThisWorkbook.Sheets(Array(1,2)).Select
    **Selection**.ExportAsFixedFormat xlTypePDF, FileName & ".pdf", , , False

but I got nothing but blank pages. It saved both sheets, but nothing on them. It wasn't until I used:

    ThisWorkbook.Sheets(Array(1,2)).Select
    **ActiveSheet**.ExportAsFixedFormat xlTypePDF, FileName & ".pdf", , , False

that I got a single PDF file with both sheets.

I tried manually saving these two pages using Selection in the Options dialog to save the two sheets I had selected, but got blank pages. When I tried the Active Sheet(s) option, I got what I wanted. When I recorded this as a macro, Excel used ActiveSheet when it successfully published the PDF. What gives?

The configuration seem alright, except that you should use excludeFilters instead of excludes:

@Configuration @EnableSpringConfigured
@ComponentScan(basePackages = {"com.example"}, excludeFilters={
  @ComponentScan.Filter(type=FilterType.ASSIGNABLE_TYPE, value=Foo.class)})
public class MySpringConfiguration {}

I think your solution would be to wrap your content container and your sidebar in a parent containing div. Float your sidebar to the left and give it the background image. Create a wide margin at least the width of your sidebar for your content container. Add clearing a float hack to make it all work.

Try with:

#! /bin/bash

i=0
while read line
do
    array[ $i ]="$line"        
    (( i++ ))
done < <(ls -ls)

echo ${array[1]}

In your version, the while runs in a subshell, the environment variables you modify in the loop are not visible outside it.

(Do keep in mind that parsing the output of ls is generally not a good idea at all.)

I wrote a shorthand for permission request in Android M. This code also handles backwards compatibility to older Android versions.

All the ugly code is extracted into a Fragment which attaches and detaches itself to the Activity requesting the permissions.You can use PermissionRequestManager as following:

new PermissionRequestManager()
        // We need a AppCompatActivity here, if you are not using support libraries you will have to slightly change 
        // the PermissionReuqestManager class
        .withActivity(this)

        // List all permissions you need
        .withPermissions(android.Manifest.permission.CALL_PHONE, android.Manifest.permission.READ_CALENDAR)

        // This Runnable is called whenever the request was successfull
        .withSuccessHandler(new Runnable() {
            @Override
            public void run() {
                // Do something with your permissions!
                // This is called after the user has granted all 
                // permissions, we are one a older platform where 
                // the user does not need to grant permissions 
                // manually, or all permissions are already granted

            }
        })

        // Optional, called when the user did not grant all permissions
        .withFailureHandler(new Runnable() {
            @Override
            public void run() {
                // This is called if the user has rejected one or all of the requested permissions
                L.e(this.getClass().getSimpleName(), "Unable to request permission");

            }
        })

        // After calling this, the user is prompted to grant the rights
        .request();

Take a look: https://gist.github.com/crysxd/385b57d74045a8bd67c4110c34ab74aa

There are a lot of jQuery plugins available for this

Thickbox

LightBox

FancyBox

FaceBox

NyroModal

PiroBox

Thickbox Examples

For a single image

1. Create a link element ()
2. Give the link a class attribute with a value of thickbox (class="thickbox")
3. Provide a path in the href attribute to an image file (.jpg .jpeg .png .gif .bmp)

In HTML5 you can use the navigator.onLine property. Look here:

http://www.w3.org/TR/offline-webapps/#related

Probably your current behavior is random as the javascript only ready the "browser" variable and then knows if you're offline and online, but it doesn't actually check the Network Connection.

Let us know if this is what you're looking for.

Kind Regards,

this is a bit late.. but i have seen this problem occurs when you want to insert or delete one line from/to DB but u put/pull more than one line or more than one value ,

E.g:

you want to delete one line from DB with a specific value such as id of an item but you've queried a list of ids then you will encounter the same exception message.

regards.

Do you need to rewind the buffer, perhaps?

Also, this might happen if the stride (in bytes) of the bitmap is greater than the row length in pixels * bytes/pixel. Make the length of bytes b.remaining() instead of size.

Just use look-arounds to solve this:

(?<=^|,)garp(?=$|,)

The difference with look-arounds and just regular groups are that with regular groups the comma would be part of the match, and with look-arounds it wouldn't. In this case it doesn't make a difference though.

Waterfall methodology is a sequential design process. This means that as each of the eight stages (conception, initiation, analysis, design, construction, testing, implementation, and maintenance) are completed, the developers move on to the next step.

As this process is sequential, once a step has been completed, developers can’t go back to a previous step – not without scratching the whole project and starting from the beginning. There’s no room for change or error, so a project outcome and an extensive plan must be set in the beginning and then followed careful

ACP Agile Certification came about as a “solution” to the disadvantages of the waterfall methodology. Instead of a sequential design process, the Agile methodology follows an incremental approach. Developers start off with a simplistic project design, and then begin to work on small modules. The work on these modules is done in weekly or monthly sprints, and at the end of each sprint, project priorities are evaluated and tests are run. These sprints allow for bugs to be discovered, and customer feedback to be incorporated into the design before the next sprint is run.

The process, with its lack of initial design and steps, is often criticized for its collaborative nature that focuses on principles rather than process.

In my case, I had checked out a different branch with a new library on it. I fixed my issue by only running npm install without doing anything else. I was confused why I was getting ELIFECYCLE error when the port was not being used, but it must have been because I did not have the library installed. So, you might not have to delete node_modules to fix the issue.

Very generally speaking:

An API key simply identifies you.

If there is a public/private distinction, then the public key is one that you can distribute to others, to allow them to get some subset of information about you from the api. The private key is for your use only, and provides access to all of your data.

Be aware that

(3 +2 + 1 - 5) + (4 % 2) - (1/4) + 6

even with the brackets results in 6.75 instead of 7 if calculated in Python 3.4.

And the '/' operator is not that easy to understand, too (python2.7): try...

- 1/4

1 - 1/4

This is a bit off-topic here, but should be considered when evaluating the above expression :)

You are not creating datetime index properly,

format = '%Y-%m-%d %H:%M:%S'
df['Datetime'] = pd.to_datetime(df['date'] + ' ' + df['time'], format=format)
df = df.set_index(pd.DatetimeIndex(df['Datetime']))

<div class="rmz-srchbg">
  <input type="text" id="globalsearchstr" name="search" value="" class="rmz-txtbox">
  <input type="submit" value="&nbsp;" id="srchbtn" class="rmz-srchico">
  <br style="clear:both;">
</div>

$(document).ready(function() {
  $('#globalsearchstr').bind('mouseenter', function() {
    $(this).parent().css("background", "black");
  });
});

Maybe slight overkill but created library ngx-if-empty-or-has-items it checks if an object, set, map or array is not empty. Maybe it will help somebody. It has the same functionality as ngIf (then, else and 'as' syntax is supported).

arrayOrObjWithData = ['1'] || {id: 1}

<h1 *ngxIfNotEmpty="arrayOrObjWithData">
  You will see it
</h1>

 or 
 // store the result of async pipe in variable
 <h1 *ngxIfNotEmpty="arrayOrObjWithData$ | async as obj">
  {{obj.id}}
</h1>

 or

noData = [] || {}
<h1 *ngxIfHasItems="noData">
   You will NOT see it
</h1>

• float stores floating-point values, that is, values that have potential decimal places
• int only stores integral values, that is, whole numbers

So while both are 32 bits wide, their use (and representation) is quite different. You cannot store 3.141 in an integer, but you can in a float.

Dissecting them both a little further:

In an integer, all bits are used to store the number value. This is (in Java and many computers too) done in the so-called two's complement. This basically means that you can represent the values of −2³¹ to 2³¹ − 1.

In a float, those 32 bits are divided between three distinct parts: The sign bit, the exponent and the mantissa. They are laid out as follows:

S EEEEEEEE MMMMMMMMMMMMMMMMMMMMMMM

There is a single bit that determines whether the number is negative or non-negative (zero is neither positive nor negative, but has the sign bit set to zero). Then there are eight bits of an exponent and 23 bits of mantissa. To get a useful number from that, (roughly) the following calculation is performed:

M × 2^E

(There is more to it, but this should suffice for the purpose of this discussion)

The mantissa is in essence not much more than a 24-bit integer number. This gets multiplied by 2 to the power of the exponent part, which, roughly, is a number between −128 and 127.

Therefore you can accurately represent all numbers that would fit in a 24-bit integer but the numeric range is also much greater as larger exponents allow for larger values. For example, the maximum value for a float is around 3.4 × 10³⁸ whereas int only allows values up to 2.1 × 10⁹.

But that also means, since 32 bits only have 4.2 × 10⁹ different states (which are all used to represent the values int can store), that at the larger end of float's numeric range the numbers are spaced wider apart (since there cannot be more unique float numbers than there are unique int numbers). You cannot represent some numbers exactly, then. For example, the number 2 × 10¹² has a representation in float of 1,999,999,991,808. That might be close to 2,000,000,000,000 but it's not exact. Likewise, adding 1 to that number does not change it because 1 is too small to make a difference in the larger scales float is using there.

Similarly, you can also represent very small numbers (between 0 and 1) in a float but regardless of whether the numbers are very large or very small, float only has a precision of around 6 or 7 decimal digits. If you have large numbers those digits are at the start of the number (e.g. 4.51534 × 10³⁵, which is nothing more than 451534 follows by 30 zeroes – and float cannot tell anything useful about whether those 30 digits are actually zeroes or something else), for very small numbers (e.g. 3.14159 × 10⁻²⁷) they are at the far end of the number, way beyond the starting digits of 0.0000...

You probably want os.makedirs as it will create intermediate directories as well, if needed.

import os

#dir is not keyword
def makemydir(whatever):
  try:
    os.makedirs(whatever)
  except OSError:
    pass
  # let exception propagate if we just can't
  # cd into the specified directory
  os.chdir(whatever)

Android Studio v1.2 installs the adb tool in this path:

~/Library/Android/sdk/platform-tools/adb

So it goes like this:

1. Run Terminal
2. run adb version and expect an error output
3. touch ~/.bash_profile
4. open ~/.bash_profile
5. add the above path before the 'closing' :$PATH
6. source ~/.bash_profile
7. run adb version and expect an output

Good luck!

Put file inside while True like so

while True:
     f = open('torecv.png','wb')
     c, addr = s.accept()     # Establish connection with client.
     print 'Got connection from', addr
     print "Receiving..."
     l = c.recv(1024)
     while (l):
         print "Receiving..."
         f.write(l)
         l = c.recv(1024)
     f.close()
     print "Done Receiving"
     c.send('Thank you for connecting')
     c.close()   

This also occurs when you don't set the form action.
For me, it was showing this error when the code was:

<form class="navbar-form form-inline my-2 my-lg-0" role="search" method="post">

When I corrected my code into this:

<form class="navbar-form form-inline my-2 my-lg-0" action="{% url 'someurl' %}" role="search" method="post">

my error disappeared.

You can use this

char name[20];
scanf("%20[^\n]", name);

Or this

void getText(char *message, char *variable, int size){
    printf("\n %s: ", message);
    fgets(variable, sizeof(char) * size, stdin);
    sscanf(variable, "%[^\n]", variable);
}

char name[20];
getText("Your name", name, 20);

DEMO

Here is simple example. A contact has one to many associated phone numbers. When a contact is deleted, I want all its associated phone numbers to also be deleted, so I use ON DELETE CASCADE. The one-to-many/many-to-one relationship is implemented with by the foreign key in the phone_numbers.

CREATE TABLE contacts
 (contact_id BIGINT AUTO_INCREMENT NOT NULL,
 name VARCHAR(75) NOT NULL,
 PRIMARY KEY(contact_id)) ENGINE = InnoDB;

CREATE TABLE phone_numbers
 (phone_id BIGINT AUTO_INCREMENT NOT NULL,
  phone_number CHAR(10) NOT NULL,
 contact_id BIGINT NOT NULL,
 PRIMARY KEY(phone_id),
 UNIQUE(phone_number)) ENGINE = InnoDB;

ALTER TABLE phone_numbers ADD FOREIGN KEY (contact_id) REFERENCES \
contacts(contact_id) ) ON DELETE CASCADE;

By adding "ON DELETE CASCADE" to the foreign key constraint, phone_numbers will automatically be deleted when their associated contact is deleted.

INSERT INTO table contacts(name) VALUES('Robert Smith');
INSERT INTO table phone_numbers(phone_number, contact_id) VALUES('8963333333', 1);
INSERT INTO table phone_numbers(phone_number, contact_id) VALUES('8964444444', 1);

Now when a row in the contacts table is deleted, all its associated phone_numbers rows will automatically be deleted.

DELETE TABLE contacts as c WHERE c.id=1; /* delete cascades to phone_numbers */

To achieve the same thing in Doctrine, to get the same DB-level "ON DELETE CASCADE" behavoir, you configure the @JoinColumn with the onDelete="CASCADE" option.

<?php
namespace Entities;

use Doctrine\Common\Collections\ArrayCollection;

/**
 * @Entity
 * @Table(name="contacts")
 */
class Contact 
{

    /**
     *  @Id
     *  @Column(type="integer", name="contact_id") 
     *  @GeneratedValue
     */
    protected $id;  

    /** 
     * @Column(type="string", length="75", unique="true") 
     */ 
    protected $name; 

    /** 
     * @OneToMany(targetEntity="Phonenumber", mappedBy="contact")
     */ 
    protected $phonenumbers; 

    public function __construct($name=null)
    {
        $this->phonenumbers = new ArrayCollection();

        if (!is_null($name)) {

            $this->name = $name;
        }
    }

    public function getId()
    {
        return $this->id;
    }

    public function setName($name)
    {
        $this->name = $name;
    }

    public function addPhonenumber(Phonenumber $p)
    {
        if (!$this->phonenumbers->contains($p)) {

            $this->phonenumbers[] = $p;
            $p->setContact($this);
        }
    }

    public function removePhonenumber(Phonenumber $p)
    {
        $this->phonenumbers->remove($p);
    }
}

<?php
namespace Entities;

/**
 * @Entity
 * @Table(name="phonenumbers")
 */
class Phonenumber 
{

    /**
    * @Id
    * @Column(type="integer", name="phone_id") 
    * @GeneratedValue
    */
    protected $id; 

    /**
     * @Column(type="string", length="10", unique="true") 
     */  
    protected $number;

    /** 
     * @ManyToOne(targetEntity="Contact", inversedBy="phonenumbers")
     * @JoinColumn(name="contact_id", referencedColumnName="contact_id", onDelete="CASCADE")
     */ 
    protected $contact; 

    public function __construct($number=null)
    {
        if (!is_null($number)) {

            $this->number = $number;
        }
    }

    public function setPhonenumber($number)
    {
        $this->number = $number;
    }

    public function setContact(Contact $c)
    {
        $this->contact = $c;
    }
} 
?>

<?php

$em = \Doctrine\ORM\EntityManager::create($connectionOptions, $config);

$contact = new Contact("John Doe"); 

$phone1 = new Phonenumber("8173333333");
$phone2 = new Phonenumber("8174444444");
$em->persist($phone1);
$em->persist($phone2);
$contact->addPhonenumber($phone1); 
$contact->addPhonenumber($phone2); 

$em->persist($contact);
try {

    $em->flush();
} catch(Exception $e) {

    $m = $e->getMessage();
    echo $m . "<br />\n";
}

If you now do

# doctrine orm:schema-tool:create --dump-sql

you will see that the same SQL will be generated as in the first, raw-SQL example

Trim just removes the trailing and leading whitespace. Use .replace(/ /g, "") if there are just spaces to be replaced.

this.maintabinfo = this.inner_view_data.replace(/ /g, "").toLowerCase();

jsonIssues = [...jsonIssues,{ID:'3',Name:'name 3',Notes:'NOTES 3'}]

Here is a way to do it using RxJava:

override fun onCreate(...) {
    backPresses.timeInterval(TimeUnit.MILLISECONDS, Schedulers.io())
            .skip(1) //Skip initial event; delay will be 0.
            .onMain()
            .subscribe {
                if (it.time() < 7000) super.onBackPressed() //7000 is the duration of a Toast with length LENGTH_LONG.
            }.addTo(compositeDisposable)

    backPresses.throttleFirst(7000, TimeUnit.MILLISECONDS, Schedulers.io())
            .subscribe { Toast.makeText(this, "Press back again to exit.", LENGTH_LONG).show() }
            .addTo(compositeDisposable)
}

override fun onBackPressed() = backPresses.onNext(Unit)

According to the docs, it means the total number throughout history:

Connections

The number of connection attempts (successful or not) to the MySQL server.

You can see the number of active connections either through the Threads_connected status variable:

Threads_connected

The number of currently open connections.

mysql> show status where `variable_name` = 'Threads_connected';
+-------------------+-------+
| Variable_name     | Value |
+-------------------+-------+
| Threads_connected | 4     |
+-------------------+-------+
1 row in set (0.00 sec)

... or through the show processlist command:

mysql> show processlist;
+----+------+-----------------+--------+---------+------+-------+------------------+
| Id | User | Host            | db     | Command | Time | State | Info             |
+----+------+-----------------+--------+---------+------+-------+------------------+
|  3 | root | localhost       | webapp | Query   |    0 | NULL  | show processlist | 
|  5 | root | localhost:61704 | webapp | Sleep   |  208 |       | NULL             | 
|  6 | root | localhost:61705 | webapp | Sleep   |  208 |       | NULL             | 
|  7 | root | localhost:61706 | webapp | Sleep   |  208 |       | NULL             | 
+----+------+-----------------+--------+---------+------+-------+------------------+
4 rows in set (0.00 sec)

Actually, I found a somewhat quirky way to do this. Add the protocol to your web.config, but inside a location element. Specify the webservice location as the path attribute, like so:

<location path="YourWebservice.asmx">
  <system.web>
    <webServices>
      <protocols>
        <add name="HttpGet"/>
        <add name="HttpPost"/>
      </protocols>
    </webServices>
  </system.web>
</location>

You can add element to arrayList using add() method in Kotlin. For example,

arrayList.add(10)

Above code will add element 10 to arrayList.

However, if you are using Array or List, then you can not add element. This is because Array and List are Immutable. If you want to add element, you will have to use MutableList.

Several workarounds:

1. Using System.arraycopy() method: You can achieve same target by creating new array and copying all the data from existing array into new one along with new values. This way you will have new array with all desired values(Existing and New values)
2. Using MutableList:: Convert array into mutableList using toMutableList() method. Then, add element into it.
3. Using Array.copyof(): Somewhat similar as System.arraycopy() method.

 h1 { font-size: 150%; }
 h2 { font-size: 120%; }

Tune as needed.

Solution:

public Response Get(string jsonData) {
    var json = JsonConvert.DeserializeObject<modelname>(jsonData);
    var data = StoredProcedure.procedureName(json.Parameter, json.Parameter, json.Parameter, json.Parameter);
    return data;
}

Model:

public class modelname {
    public long parameter{ get; set; }
    public int parameter{ get; set; }
    public int parameter{ get; set; }
    public string parameter{ get; set; }
}

There are several possible catches. I think that the most common error is in this part of the connection string:

res://xxx/yyy.csdl|res://xxx/yyy.ssdl|res://xxx/yyy.msl;

This is no magic. Once you understand what is stands for you'll get the connection string right.

First the xxx part. That's nothing else than an assembly name where you defined you EF context clas. Usually it would be something like MyProject.Data. Default value is * which stands for all loaded assemblies. It's always better to specify a particular assembly name.

Now the yyy part. That's a resource name in the xxx assembly. It will usually be something like a relative path to your .edmx file with dots instead of slashes. E.g. Models/Catalog - Models.Catalog The easiest way to get the correct string for your application is to build the xxx assembly. Then open the assembly dll file in a text editor (I prefer the Total Commander's default viewer) and search for ".csdl". Usually there won't be more than 1 occurence of that string.

Your final EF connection string may look like this:

res://MyProject.Data/Models.Catalog.DataContext.csdl|res://MyProject.Data/Models.Catalog.DataContext.ssdl|res://MyProject.Data/Models.Catalog.DataContext.msl;

In PHP, you can send POST data with cURL. Is there something comparable for .NET?

Yes, HttpWebRequest, see my post below.

//initializing few values
int[][] tab = new int[][]{
    {1,0,1,0,1,0,1,0},
    {0,1,0,1,0,1,0,1},
    {1,0,1,0,1,0,1,0},
    {0,1,0,1,0,1,0,1},
    {1,0,1,0,1,0,1,0},
    {0,1,0,1,0,1,0,1},
    {1,0,1,0,1,0,1,0},
    {0,1,0,1,0,1,0,1}
};

//tab.length in first loop
for (int row = 0; row < tab.length; row++)
{
    //tab[0].length in second loop
    for (int column = 0; column < tab[0].length; column++)
    {
        //printing one value from array with space
        System.out.print(tab[row][column]+ "   ");
    }
    System.out.println(); // new row = new enter
}

Report from the future: April 2018.

I wanted to normalize my local repos on my Mac and my Windows, which had ended up in different local folders.

The Windows 10 client made me go through the "Can't Find" > "Locate" routine, tedious but not terrible. Also need to update the local "Clone path" in Options for future use.

When I consolidated the mac folders, the Github client just found them again - I had to do nothing!

As per the official installation page of skimage (skimage Installation) : python-skimage package depends on matplotlib, scipy, pil, numpy and six.

So install them first using

sudo apt-get install python-matplotlib python-numpy python-pil python-scipy

Apparently skimage is a part of Cython which in turn is a superset of python and hence you need to install Cython to be able to use skimage.

sudo apt-get install build-essential cython

Now install skimage package using

sudo apt-get install python-skimage

This solved the Import error for me.

For fpdf to work properly, there cannot be any output at all beside what fpdf generates. For example, this will work:

<?php
$pdf = new FPDF();
$pdf->AddPage();
$pdf->SetFont('Arial','B',16);
$pdf->Cell(40,10,'Hello World!');
$pdf->Output();
?>

While this will not (note the leading space before the opening <? tag)

 <?php
$pdf = new FPDF();
$pdf->AddPage();
$pdf->SetFont('Arial','B',16);
$pdf->Cell(40,10,'Hello World!');
$pdf->Output();
?>

Also, this will not work either (the echo will break it):

<?php
echo "About to create pdf";
$pdf = new FPDF();
$pdf->AddPage();
$pdf->SetFont('Arial','B',16);
$pdf->Cell(40,10,'Hello World!');
$pdf->Output();
?>

I'm not sure about the drupal side of things, but I know that absolutely zero non-fpdf output is a requirement for fpdf to work.

add ob_start (); at the top and at the end add ob_end_flush();

<?php
    ob_start();
    require('fpdf.php');
    $pdf = new FPDF();
    $pdf->AddPage();
    $pdf->SetFont('Arial','B',16);
    $pdf->Cell(40,10,'Hello World!');
    $pdf->Output();
    ob_end_flush(); 
?>

give me an error as below:
FPDF error: Some data has already been output, can't send PDF

to over come this error: go to fpdf.php in that,goto line number 996

function Output($name='', $dest='')

after that make changes like this:

function Output($name='', $dest='') {   
    ob_clean();     //Output PDF to so

Hi do you have a session header on the top of your page. or any includes If you have then try to add this codes on top pf your page it should works fine.

<?

while (ob_get_level())
ob_end_clean();
header("Content-Encoding: None", true);

?>

cheers :-)

In my case i had set:

ini_set('display_errors', 'on');
error_reporting(E_ALL | E_STRICT);

When i made the request to generate the report, some warnings were displayed in the browser (like the usage of deprecated functions).
Turning off the display_errors option, the report was generated successfully.

public static int[] merge(int[] listA, int[] listB) {
        int[] mergedList = new int[ listA.length + listB.length];
        int i = 0; // Counter for listA
        int j = 0; // Counter for listB
        int k = 0; // Counter for mergedList
        while (true) {
            if (i >= listA.length && j >= listB.length) {
                break;
            }
            if (i < listA.length && j < listB.length) { // If both counters are valid.
                if (listA[i] <= listB[j]) {
                    mergedList[k] = listA[i];
                    k++;
                    i++;
                } else {
                    mergedList[k] = listB[j];
                    k++;
                    j++;
                }
            } else if (i < listA.length && j >= listB.length) { // If only A's counter is valid.
                mergedList[k] = listA[i];
                k++;
                i++;
            } else if (i <= listA.length && j < listB.length) { // If only B's counter is valid
                mergedList[k] = listB[j];
                k++;
                j++;
            }
        }
        return mergedList;
    }

The underlying data type of a datetime in Excel is a 64-bit floating point number where the length of a day equals 1 and 1st Jan 1900 00:00 equals 1. So 11th June 2009 17:30 is about 39975.72917.

If a cell contains a numeric value such as this, it can be converted to a datetime simply by applying a datetime format to the cell.

So, if you can convert your datetimes to numbers using the above formula, output them to the relevant cells and then set the cell formats to the appropriate datetime format, e.g. yyyy-mm-dd hh:mm:ss, then it should be possible to achieve what you want.

Also Stefan de Bruijn has pointed out that there is a bug in Excel in that it incorrectly assumes 1900 is a leap year so you need to take that into account when making your calculations (Wikipedia).

Some times decorating the json convert attribute will not work ,it will through exception saying that "2010-10-01" is valid date. To avoid this types i removed json convert attribute on the property and mentioned in the deserilizedObject method like below.

var addresss = JsonConvert.DeserializeObject<AddressHistory>(address, new IsoDateTimeConverter { DateTimeFormat = "yyyy-MM-dd" });

I am a VIMer. I can do some rare Hex edits with:

• :%!xxd to switch into hex mode

• :%!xxd -r to exit from hex mode

But I strongly recommend ht

apt-cache show ht

Package: ht
Version: 2.0.18-1
Installed-Size: 1780
Maintainer: Alexander Reichle-Schmehl <[email protected]>

Homepage: http://hte.sourceforge.net/

Note: The package is called ht, whereas the executable is named hte after the package was installed.

1. Supported file formats
   • common object file format (COFF/XCOFF32)
   • executable and linkable format (ELF)
   • linear executables (LE)
   • standard DO$ executables (MZ)
   • new executables (NE)
   • portable executables (PE32/PE64)
   • java class files (CLASS)
   • Mach exe/link format (MachO)
   • X-Box executable (XBE)
   • Flat (FLT)
   • PowerPC executable format (PEF)
2. Code & Data Analyser
   • finds branch sources and destinations recursively
   • finds procedure entries
   • creates labels based on this information
   • creates xref information
   • allows to interactively analyse unexplored code
   • allows to create/rename/delete labels
   • allows to create/edit comments
   • supports x86, ia64, alpha, ppc and java code
3. Target systems
   • DJGPP
   • GNU/Linux
   • FreeBSD
   • OpenBSD
   • Win32

To add to all the wonderful answers here

First of all float and double are both used for representation of numbers fractional numbers. So, the difference between the two stems from the fact with how much precision they can store the numbers.

For example: I have to store 123.456789 One may be able to store only 123.4567 while other may be able to store the exact 123.456789.

So, basically we want to know how much accurately can the number be stored and is what we call precision.

Quoting @Alessandro here

The precision indicates the number of decimal digits that are correct, i.e. without any kind of representation error or approximation. In other words, it indicates how many decimal digits one can safely use.

Float can accurately store about 7-8 digits in the fractional part while Double can accurately store about 15-16 digits in the fractional part

So, float can store double the amount of fractional part. That is why Double is called double the float

After installing conda in Linux if you are trying to create env just type bash and hit Enter later you can create env

Add this extension to convert your html code to a regular string:

    extension String {

        var html2AttributedString: NSAttributedString? {
            guard
                let data = dataUsingEncoding(NSUTF8StringEncoding)
            else { return nil }
            do {
                return try NSAttributedString(data: data, options: [NSDocumentTypeDocumentAttribute:NSHTMLTextDocumentType,NSCharacterEncodingDocumentAttribute:NSUTF8StringEncoding], documentAttributes: nil)
            } catch let error as NSError {
                print(error.localizedDescription)
                return  nil
            }
        }
        var html2String: String {
            return html2AttributedString?.string ?? ""
        }
}

And then you show your String inside an UITextView Or UILabel

textView.text = yourString.html2String or

label.text = yourString.html2String

$result = mysqli_query($con,"SELECT `note` FROM `glogin_users` WHERE email = '".$email."'");
while($row = mysqli_fetch_array($result))
echo $row['note'];

Here is how you would do it with Apache HttpClient (this solution is for those who don't mind using a 3rd party library):

    HttpEntity entity = MultipartEntityBuilder.create()
                       .addPart("file", new FileBody(file))
                       .build();

    HttpPost request = new HttpPost(url);
    request.setEntity(entity);

    HttpClient client = HttpClientBuilder.create().build();
    HttpResponse response = client.execute(request);

Trying to answer it from Linux Kernel's OS View

A program becomes a process when launched into memory. A process has its own address space meaning having various segments in memory such as .text segement for storing compiled code, .bss for storing uninitialized static or global variables, etc.
Each process would have its own program counter and user-space stack.

Inside kernel, each process would have its own kernel stack (which is separated from user space stack for security issues) and a structure named task_struct which is generally abstracted as the process control block, storing all the information regarding the process such as its priority, state,(and a whole lot of other chunk).
A process can have multiple threads of execution.

Coming to threads, they reside inside a process and share the address space of the parent process along with other resources which can be passed during thread creation such as filesystem resources, sharing pending signals, sharing data(variables and instructions) therefore making threads lightweight and hence allowing faster context switching.

Inside kernel, each thread has its own kernel stack along with the task_struct structure which defines the thread. Therefore kernel views threads of same process as different entities and are schedulable in themselves. Threads in same process share a common id called as thread group id(tgid), also they have a unique id called as the process id (pid).

I just use contentsMargin to fix the aspect ratio.

#pragma once

#include <QLabel>

class AspectRatioLabel : public QLabel
{
public:
    explicit AspectRatioLabel(QWidget* parent = nullptr, Qt::WindowFlags f = Qt::WindowFlags());
    ~AspectRatioLabel();

public slots:
    void setPixmap(const QPixmap& pm);

protected:
    void resizeEvent(QResizeEvent* event) override;

private:
    void updateMargins();

    int pixmapWidth = 0;
    int pixmapHeight = 0;
};

#include "AspectRatioLabel.h"

AspectRatioLabel::AspectRatioLabel(QWidget* parent, Qt::WindowFlags f) : QLabel(parent, f)
{
}

AspectRatioLabel::~AspectRatioLabel()
{
}

void AspectRatioLabel::setPixmap(const QPixmap& pm)
{
    pixmapWidth = pm.width();
    pixmapHeight = pm.height();

    updateMargins();
    QLabel::setPixmap(pm);
}

void AspectRatioLabel::resizeEvent(QResizeEvent* event)
{
    updateMargins();
    QLabel::resizeEvent(event);
}

void AspectRatioLabel::updateMargins()
{
    if (pixmapWidth <= 0 || pixmapHeight <= 0)
        return;

    int w = this->width();
    int h = this->height();

    if (w <= 0 || h <= 0)
        return;

    if (w * pixmapHeight > h * pixmapWidth)
    {
        int m = (w - (pixmapWidth * h / pixmapHeight)) / 2;
        setContentsMargins(m, 0, m, 0);
    }
    else
    {
        int m = (h - (pixmapHeight * w / pixmapWidth)) / 2;
        setContentsMargins(0, m, 0, m);
    }
}

Works perfectly for me so far. You're welcome.

--version is a valid option from JDK 9 and it is not a valid option until JDK 8 hence you get the below:

Unrecognized option: --version
Error: Could not create the Java Virtual Machine.
Error: A fatal exception has occurred. Program will exit.

You can try installing JDK 9 or any version later and check for java --version it will work.

Alternately, from the installed JDK 9 or later versions you can see from java -help the below two options will be available:

    -version      print product version to the error stream and exit
    --version     print product version to the output stream and exit

where as in JDK 8 you will only have below when you execute java -help

    -version      print product version and exit

I hope it answers your question.

Credits to Leonardo Savio Dabus:

I imagine most use cases is to get Proper Casing:

import Foundation

extension String {

    var toProper:String {
        var result = lowercaseString
        result.replaceRange(startIndex...startIndex, with: String(self[startIndex]).capitalizedString)
        return result
    }
}

You can use the drop_duplicates method to get the unique rows in a DataFrame:

In [29]: df = pd.DataFrame({'a':[1,2,1,2], 'b':[3,4,3,5]})

In [30]: df
Out[30]:
   a  b
0  1  3
1  2  4
2  1  3
3  2  5

In [32]: df.drop_duplicates()
Out[32]:
   a  b
0  1  3
1  2  4
3  2  5

You can also provide the subset keyword argument if you only want to use certain columns to determine uniqueness. See the docstring.

Remember to export your routes.js.

In routes.js, write your routes and all your code in this function module:

exports = function(app, passport) {

/* write here your code */ 

}

Go to mysql or phpmyadmin and select database then simply execute this query and it will work. Its working fine for me.

SET GLOBAL sql_mode=(SELECT REPLACE(@@sql_mode,'ONLY_FULL_GROUP_BY',''));

Another example of the same concept - but say - you have 2 different columns - and you want to apply different agg functions to each of them i.e

f.groupBy("col1").agg(sum("col2").alias("col2"), avg("col3").alias("col3"), ...)

Here is the way to achieve it - though I do not yet know how to add the alias in this case

See the example below - Using Maps

val Claim1 = StructType(Seq(StructField("pid", StringType, true),StructField("diag1", StringType, true),StructField("diag2", StringType, true), StructField("allowed", IntegerType, true), StructField("allowed1", IntegerType, true)))
val claimsData1 = Seq(("PID1", "diag1", "diag2", 100, 200), ("PID1", "diag2", "diag3", 300, 600), ("PID1", "diag1", "diag5", 340, 680), ("PID2", "diag3", "diag4", 245, 490), ("PID2", "diag2", "diag1", 124, 248))

val claimRDD1 = sc.parallelize(claimsData1)
val claimRDDRow1 = claimRDD1.map(p => Row(p._1, p._2, p._3, p._4, p._5))
val claimRDD2DF1 = sqlContext.createDataFrame(claimRDDRow1, Claim1)

val l = List("allowed", "allowed1")
val exprs = l.map((_ -> "sum")).toMap
claimRDD2DF1.groupBy("pid").agg(exprs) show false
val exprs = Map("allowed" -> "sum", "allowed1" -> "avg")

claimRDD2DF1.groupBy("pid").agg(exprs) show false

Also, RESTful lets you get data back from a POST request.

JS (put in static/hello.html to serve via Python):

<html><head><meta charset="utf-8"/></head><body>
Hello.

<script>

var xhr = new XMLHttpRequest();
xhr.open("POST", "/postman", true);
xhr.setRequestHeader('Content-Type', 'application/json');
xhr.send(JSON.stringify({
    value: 'value'
}));
xhr.onload = function() {
  console.log("HELLO")
  console.log(this.responseText);
  var data = JSON.parse(this.responseText);
  console.log(data);
}

</script></body></html>

Python server (for testing):

import time, threading, socket, SocketServer, BaseHTTPServer
import os, traceback, sys, json


log_lock           = threading.Lock()
log_next_thread_id = 0

# Local log functiondef


def Log(module, msg):
    with log_lock:
        thread = threading.current_thread().__name__
        msg    = "%s %s: %s" % (module, thread, msg)
        sys.stderr.write(msg + '\n')

def Log_Traceback():
    t   = traceback.format_exc().strip('\n').split('\n')
    if ', in ' in t[-3]:
        t[-3] = t[-3].replace(', in','\n***\n***  In') + '(...):'
        t[-2] += '\n***'
    err = '\n***  '.join(t[-3:]).replace('"','').replace(' File ', '')
    err = err.replace(', line',':')
    Log("Traceback", '\n'.join(t[:-3]) + '\n\n\n***\n*** ' + err + '\n***\n\n')

    os._exit(4)

def Set_Thread_Label(s):
    global log_next_thread_id
    with log_lock:
        threading.current_thread().__name__ = "%d%s" \
            % (log_next_thread_id, s)
        log_next_thread_id += 1


class Handler(BaseHTTPServer.BaseHTTPRequestHandler):

    def do_GET(self):
        Set_Thread_Label(self.path + "[get]")
        try:
            Log("HTTP", "PATH='%s'" % self.path)
            with open('static' + self.path) as f:
                data = f.read()
            Log("Static", "DATA='%s'" % data)
            self.send_response(200)
            self.send_header("Content-type", "text/html")
            self.end_headers()
            self.wfile.write(data)
        except:
            Log_Traceback()

    def do_POST(self):
        Set_Thread_Label(self.path + "[post]")
        try:
            length = int(self.headers.getheader('content-length'))
            req   = self.rfile.read(length)
            Log("HTTP", "PATH='%s'" % self.path)
            Log("URL", "request data = %s" % req)
            req = json.loads(req)
            response = {'req': req}
            response = json.dumps(response)
            Log("URL", "response data = %s" % response)
            self.send_response(200)
            self.send_header("Content-type", "application/json")
            self.send_header("content-length", str(len(response)))
            self.end_headers()
            self.wfile.write(response)
        except:
            Log_Traceback()


# Create ONE socket.
addr = ('', 8000)
sock = socket.socket (socket.AF_INET, socket.SOCK_STREAM)
sock.setsockopt(socket.SOL_SOCKET, socket.SO_REUSEADDR, 1)
sock.bind(addr)
sock.listen(5)

# Launch 100 listener threads.
class Thread(threading.Thread):
    def __init__(self, i):
        threading.Thread.__init__(self)
        self.i = i
        self.daemon = True
        self.start()
    def run(self):
        httpd = BaseHTTPServer.HTTPServer(addr, Handler, False)

        # Prevent the HTTP server from re-binding every handler.
        # https://stackoverflow.com/questions/46210672/
        httpd.socket = sock
        httpd.server_bind = self.server_close = lambda self: None

        httpd.serve_forever()
[Thread(i) for i in range(10)]
time.sleep(9e9)

Console log (chrome):

HELLO
hello.html:14 {"req": {"value": "value"}}
hello.html:16 
{req: {…}}
req
:
{value: "value"}
__proto__
:
Object

Console log (firefox):

GET 
http://XXXXX:8000/hello.html [HTTP/1.0 200 OK 0ms]
POST 
XHR 
http://XXXXX:8000/postman [HTTP/1.0 200 OK 0ms]
HELLO hello.html:13:3
{"req": {"value": "value"}} hello.html:14:3
Object { req: Object }

Console log (Edge):

HTML1300: Navigation occurred.
hello.html
HTML1527: DOCTYPE expected. Consider adding a valid HTML5 doctype: "<!DOCTYPE html>".
hello.html (1,1)
Current window: XXXXX/hello.html
HELLO
hello.html (13,3)
{"req": {"value": "value"}}
hello.html (14,3)
[object Object]
hello.html (16,3)
   {
      [functions]: ,
      __proto__: { },
      req: {
         [functions]: ,
         __proto__: { },
         value: "value"
      }
   }

Python log:

HTTP 8/postman[post]: PATH='/postman'
URL 8/postman[post]: request data = {"value":"value"}
URL 8/postman[post]: response data = {"req": {"value": "value"}}

Sometimes parse_str() alone is note accurate, it could display for example:

$url = "somepage?id=123&lang=gr&size=300";

parse_str() would return:

Array ( 
    [somepage?id] => 123 
    [lang] => gr 
    [size] => 300 
)

It would be better to combine parse_str() with parse_url() like so:

$url = "somepage?id=123&lang=gr&size=300";
parse_str( parse_url( $url, PHP_URL_QUERY), $array );
print_r( $array );

A little old but this works in L5:

<li class="{{ Request::is('mycategory/', '*') ? 'active' : ''}}">

This captures both /mycategory and /mycategory/slug

This works better when the id = container (which is the outer div) and id = contained (which is the inner div). The problem with the highly recommended solution is that it results in some cases into an horizontal scrolling bar when the browser is trying to cater for the left: -50% attribute. There is a good reference for this solution

        #container {
            text-align: center;
        }
        #contained {
            text-align: left;
            display: inline-block;
        }

package com.json;

import java.io.FileNotFoundException;
import java.io.FileReader;
import java.io.IOException;
import java.util.Iterator;

import org.json.simple.JSONArray;
import org.json.simple.JSONObject;
import org.json.simple.parser.JSONParser;
import org.json.simple.parser.ParseException;

public class ReadJSONFile {

    public static void main(String[] args) {

        JSONParser parser = new JSONParser();

        try {
            Object obj = parser.parse(new FileReader("C:/My Workspace/JSON Test/file.json"));

            JSONArray array = (JSONArray) obj;
            JSONObject jsonObject = (JSONObject) array.get(0);

            String name = (String) jsonObject.get("name");
            System.out.println(name);

            String city = (String) jsonObject.get("city");
            System.out.println(city);

            String job = (String) jsonObject.get("job");
            System.out.println(job);

            // loop array
            JSONArray cars = (JSONArray) jsonObject.get("cars");
            Iterator<String> iterator = cars.iterator();
            while (iterator.hasNext()) {
                System.out.println(iterator.next());
            }
        } catch (FileNotFoundException e) {
            e.printStackTrace();
        } catch (IOException e) {
            e.printStackTrace();
        } catch (ParseException e) {
            e.printStackTrace();
        }
    }

}

dG will delete from the current line to the end of file

dCtrl+End will delete from the cursor to the end of the file

But if this file is as large as you say, you may be better off reading the first few lines with head rather than editing and saving the file.

head hugefile > firstlines

(If you are on Windows you can use the Win32 port of head)

• suppose you have an array like

   const arr = [1, 2, 3, 4, 5, 6, 7, 8, 9]
    
    
    arr.map((myArr, index) => {
      console.log(`your index is -> ${index} AND value is ${myArr}`);
    })

> output will be
 index is -> 0 AND value is 1
 index is -> 1 AND value is 2
 index is -> 2 AND value is 3
 index is -> 3 AND value is 4
 index is -> 4 AND value is 5
 index is -> 5 AND value is 6
 index is -> 6 AND value is 7
 index is -> 7 AND value is 8
 index is -> 8 AND value is 9

One idea:

try {
    int i = Integer.parseInt(myString);
    if (i < 0) {
        // Error, negative input
    }
} catch (NumberFormatException e) {
    // Error, not a number.
}

There is also, in commons-lang library the CharUtils class that provides the methods isAsciiNumeric() to check that a character is a number, and isAsciiAlpha() to check that the character is a letter...

You just need this:

$(".hidden").attr("placeholder", "Type here to search");

classList is used for manipulating classes and not attributes.

Please, try this code:

import serial
ports = serial.tools.list_ports.comports(include_links=False)
for port in ports :
    print(port.device)

first of all, you need to import package for serial port communication, so:

import serial

then you create the list of all the serial ports currently available:

ports = serial.tools.list_ports.comports(include_links=False)

and then, walking along whole list, you can for example print port names:

for port in ports :
    print(port.device)

This is just an example how to get the list of ports and print their names, but there some other options you can do with this data. Just try print different variants after

port.

Simple fix to this was setting showAsAction to always in menu.xml in res/menu

<?xml version="1.0" encoding="utf-8"?>
<menu xmlns:android="http://schemas.android.com/apk/res/android"
    xmlns:app="http://schemas.android.com/apk/res-auto">

    <item
        android:id="@+id/add_alarm"
        android:icon="@drawable/ic_action_name"
        android:orderInCategory="100"
        android:title="Add"
        app:showAsAction="always"
        android:visible="true"/>

</menu>

Use sudo -i to switch to $root, then execute npm install -g xxxx

In my case ( Visual Studio 2012 / IIS Express / ASP.NET MVC 4 app / .Net Framework 4.5 ) what really worked after 30 minutes of trial and error was setting the maxQueryStringLength property in the <httpRuntime> tag:

<httpRuntime targetFramework="4.5" maxQueryStringLength="10240" enable="true" />

maxQueryStringLength defaults to 2048.

More about it here:

Expanding the Range of Allowable URLs

I tried setting it in <system.webServer> as @MattVarblow suggests, but it didn't work... and this is because I'm using IIS Express (based on IIS 8) on my dev machine with Windows 8.

When I deployed my app to the production environment (Windows Server 2008 R2 with IIS 7), IE 10 started returning 404 errors in AJAX requests with long query strings. Then I thought that the problem was related to the query string and tried @MattVarblow's answer. It just worked on IIS 7. :)

For Android API level 13 and you need to use this:

Display display = getWindowManager().getDefaultDisplay();
Point size = new Point();
display.getSize(size);
int maxX = size.x; 
int maxY = size.y;

Then (0,0) is top left corner and (maxX,maxY) is bottom right corner of the screen.

The 'getWidth()' for screen size is deprecated since API 13

Furthermore getwidth() and getHeight() are methods of android.view.View class in android.So when your java class extends View class there is no windowManager overheads.

          int maxX=getwidht();
          int maxY=getHeight();

as simple as that.

Convert file format to png

string newfilename , 
 string filename = "~/Photo/"  + lbl_ImgPath.Text.ToString();/*get filename from specific path where we store image*/
 string newfilename = Path.ChangeExtension(filename, ".png");/*Convert file format from jpg to png*/

foreach($shipmentarr as $index=>$val){    
    $additionalService = array();

    foreach($additionalService[$index] as $key => $value) {

        array_push($additionalService,$value);

    }
}

If that's literally all you want to do then just declaring the array as string fixes the selected item problem:

myViewData.PageOptionsDropDown = 
   new SelectList(new string[] {"10", "15", "25", "50", "100", "1000"}, "15");

With multiple return and multi parameter

string ConnectionString = CommonFunctions.GetConnectionString();
using (IDbConnection conn = new SqlConnection(ConnectionString))
{
    IEnumerable<dynamic> results = conn.Query(sql: "ProductSearch", 
        param: new { CategoryID = 1, SubCategoryID="", PageNumber=1 }, 
        commandType: CommandType.StoredProcedure);.  // single result

    var reader = conn.QueryMultiple("ProductSearch", 
        param: new { CategoryID = 1, SubCategoryID = "", PageNumber = 1 }, 
        commandType: CommandType.StoredProcedure); // multiple result

    var userdetails = reader.Read<dynamic>().ToList(); // instead of dynamic, you can use your objects
    var salarydetails = reader.Read<dynamic>().ToList();
}

public static string GetConnectionString()
{
    // Put the name the Sqlconnection from WebConfig..
    return ConfigurationManager.ConnectionStrings["DefaultConnection"].ConnectionString;
}

Lets say that you have a Text widget called my_text_widget.

To get input from the my_text_widget you can use the get function.

Let's assume that you have imported tkinter. Lets define my_text_widget first, lets make it just a simple text widget.

my_text_widget = Text(self)

To get input from a text widget you need to use the get function, both, text and entry widgets have this.

input = my_text_widget.get()

The reason we save it to a variable is to use it in the further process, for example, testing for what's the input.

YOU CAN ALSO DOWNLOAD THE CODE IN THE BELOW LINK AND SEE HOW IT WORKS

https://gallery.technet.microsoft.com/Extract-Database-dfa53d5a

THIS IS HOW YOU WILL SEE THE OUTPUT OF THIS QUERY

set nocount off

IF OBJECT_ID(N'tempdb..##temp1') IS NOT NULL
     DROP TABLE ##temp1

create table ##temp1(query varchar(1000))

insert into ##temp1 
select 'use '+db_name() +';'

insert into ##temp1 
select 'go'

/*creating database roles*/
insert into ##temp1
                    select 'if DATABASE_PRINCIPAL_ID('''+name+''')  is null 
                    exec sp_addrole '''+name+''''  from sysusers
where issqlrole = 1 and (sid is not null and sid <> 0x0)

/*creating application roles*/
insert into ##temp1
                    select 'if DATABASE_PRINCIPAL_ID('+char(39)+name+char(39)+')
                    is null CREATE APPLICATION ROLE ['+name+'] WITH DEFAULT_SCHEMA = ['+
                    default_schema_name+'], Password='+char(39)+'Pass$w0rd123'+char(39)+' ;'
 from sys.database_principals
where type_desc='APPLICATION_ROLE'

insert into ##temp1 
                     select  
                                case  
                                          when state_desc='GRANT_WITH_GRANT_OPTION' 
                                                       then
                                                                substring (state_desc,0,6)+' '+permission_name+' to '+'['+USER_NAME(grantee_principal_id)+']'+' WITH GRANT OPTION ;'

                                                         else 
                                                                  state_desc+' '+permission_name+' to '+'['+USER_NAME(grantee_principal_id)+']'+' ;'
                    END
from sys.database_permissions 
where class=0 and USER_NAME(grantee_principal_id) not in ('dbo','guest','sys','information_schema')

insert into ##temp1 
                    select 
                               case 
                                         when state_desc='GRANT_WITH_GRANT_OPTION' 
                                                   then
                                                             substring (state_desc,0,6)+' '+permission_name+' on '+OBJECT_SCHEMA_NAME(major_id)+'.['+OBJECT_NAME(major_id)
                                                             +'] to '+'['+USER_NAME(grantee_principal_id)+']'+' with grant option ;'
                                                     else 
                                                              state_desc+' '+permission_name+' on '+OBJECT_SCHEMA_NAME(major_id)+'.['+OBJECT_NAME(major_id)
                                                              +'] to '+'['+USER_NAME(grantee_principal_id)+']'+' ;'
                                  end
from sys.database_permissions where class=1 and USER_NAME(grantee_principal_id) not in ('public');


 insert into ##temp1 
                      select 
                                 case 
                                           when state_desc='GRANT_WITH_GRANT_OPTION' 
                                                     then
                                                              substring (state_desc,0,6)+' '+permission_name+' ON schema::['+sa.name+
                                                               '] to ['+user_name(dp.grantee_principal_id)+'] with grant option ;'
                                                       else
                                                               state_desc+' '+permission_name+' ON schema::['+sa.name+
                                                               '] to ['+user_name(dp.grantee_principal_id)+'] ;'
                                                       COLLATE LATIN1_General_CI_AS  
                                      end
from sys.database_permissions dp inner join sys.schemas sa on
 sa.schema_id = dp.major_id where dp.class=3

 insert into ##temp1 
                     select 
                                 case 
                                            when state_desc='GRANT_WITH_GRANT_OPTION'
                                             then
                                                    substring (state_desc,0,6)+' '+permission_name+' ON APPLICATION  ROLE::['+sa.name+
                                                     '] to ['+user_name(dp.grantee_principal_id)+'] with grant option ;'
                                             else
                                                      state_desc+' '+permission_name+' ON  APPLICATION ROLE::['+sa.name+
                                                      '] to ['+user_name(dp.grantee_principal_id)+'] ;'
                                                      COLLATE LATIN1_General_CI_AS  
                         end
from sys.database_permissions dp inner join sys.database_principals  sa on
 sa.principal_id = dp.major_id where dp.class=4 and sa.type='A'

 insert into ##temp1 
                      select 
                                 case 
                                          when state_desc='GRANT_WITH_GRANT_OPTION' 
                                           then
                                                  substring (state_desc,0,6)+' '+permission_name+' ON   ROLE::['+sa.name+
                                                  '] to ['+user_name(dp.grantee_principal_id)+'] with grant option ;'
                                           else
                                                   state_desc+' '+permission_name+' ON   ROLE::['+sa.name+
                                                    '] to ['+user_name(dp.grantee_principal_id)+'] ;'
                                                     COLLATE LATIN1_General_CI_AS  
                                           end
 from sys.database_permissions dp inner join
sys.database_principals  sa on sa.principal_id = dp.major_id 
 where dp.class=4 and sa.type='R'

 insert into ##temp1 
                      select 
                                  case 
                                           when state_desc='GRANT_WITH_GRANT_OPTION' 
                                                       then
                                                               substring (state_desc,0,6)+' '+permission_name+' ON ASSEMBLY::['+sa.name+
                                                                '] to ['+user_name(dp.grantee_principal_id)+'] with grant option ;'
                                                        else
                                                                state_desc+' '+permission_name+' ON ASSEMBLY::['+sa.name+
                                                                 '] to ['+user_name(dp.grantee_principal_id)+'] ;'
                                                                 COLLATE LATIN1_General_CI_AS  
                                       end
 from sys.database_permissions dp inner join sys.assemblies sa on
 sa.assembly_id = dp.major_id 
 where dp.class=5

 insert into ##temp1
                     select 
                                 case 
                                           when state_desc='GRANT_WITH_GRANT_OPTION' 
                                            then
                                                    substring (state_desc,0,6)+'  '+permission_name+' ON type::['
                                                    +SCHEMA_NAME(schema_id)+'].['+sa.name+
                                                    '] to ['+user_name(dp.grantee_principal_id)+'] with grant option ;'
                                            else
                                                    state_desc+' '+permission_name+' ON type::['
                                                    +SCHEMA_NAME(schema_id)+'].['+sa.name+
                                                     '] to ['+user_name(dp.grantee_principal_id)+'] ;'
                                                     COLLATE LATIN1_General_CI_AS  
                                              end
 from sys.database_permissions dp inner join sys.types sa on
 sa.user_type_id = dp.major_id 
 where dp.class=6


 insert into ##temp1
                      select 
                                 case 
                                          when state_desc='GRANT_WITH_GRANT_OPTION' 
                                           then
                                                     substring (state_desc,0,6)+'  '+permission_name+' ON  XML SCHEMA COLLECTION::['+
                                                     SCHEMA_NAME(SCHEMA_ID)+'].['+sa.name+'] to ['+user_name(dp.grantee_principal_id)+'] with grant option ;'
                                            else
                                                     state_desc+' '+permission_name+' ON  XML SCHEMA COLLECTION::['+
                                                     SCHEMA_NAME(SCHEMA_ID)+'].['+sa.name+'] to ['+user_name(dp.grantee_principal_id)+'];'
                                                     COLLATE LATIN1_General_CI_AS  
                                   end
 from sys.database_permissions dp inner join sys.xml_schema_collections sa on
 sa.xml_collection_id = dp.major_id 
 where dp.class=10



insert into ##temp1
                    select
                               case 
                                         when state_desc='GRANT_WITH_GRANT_OPTION' 
                                          then
                                                   substring (state_desc,0,6)+'  '+permission_name+' ON message type::['+sa.name+
                                                    '] to ['+user_name(dp.grantee_principal_id)+'] with grant option ;'
                                           else
                                                    state_desc+' '+permission_name+' ON message type::['+sa.name+
                                                    '] to ['+user_name(dp.grantee_principal_id)+'] ;'
                                                     COLLATE LATIN1_General_CI_AS  
                                             end
 from sys.database_permissions dp inner join sys.service_message_types sa on
 sa.message_type_id = dp.major_id 
 where dp.class=15


 insert into ##temp1
                      select 
                                  case 
                                            when state_desc='GRANT_WITH_GRANT_OPTION' 
                                              then
                                                       substring (state_desc,0,6)+'  '+permission_name+' ON contract::['+sa.name+
                                                        '] to ['+user_name(dp.grantee_principal_id)+'] with grant option ;'
                                                else
                                                         state_desc+' '+permission_name+' ON contract::['+sa.name+
                                                         '] to ['+user_name(dp.grantee_principal_id)+'] ;'
                                                         COLLATE LATIN1_General_CI_AS  
                                   end
 from sys.database_permissions dp inner join sys.service_contracts sa on
 sa.service_contract_id = dp.major_id 
 where dp.class=16



  insert into ##temp1
                      select 
                                 case 
                                           when state_desc='GRANT_WITH_GRANT_OPTION' 
                                            then
                                                      substring (state_desc,0,6)+'  '+permission_name+' ON SERVICE::['+sa.name+
                                                        '] to ['+user_name(dp.grantee_principal_id)+'] with grant option ;'
                                              else
                                                       state_desc+'  '+permission_name+' ON SERVICE::['+sa.name+
                                                        '] to ['+user_name(dp.grantee_principal_id)+'] ;'
                                                        COLLATE LATIN1_General_CI_AS  
                                    end
 from sys.database_permissions dp inner join sys.services sa on
 sa.service_id = dp.major_id 
 where dp.class=17


 insert into ##temp1 
                      select 
                                   case 
                                              when state_desc='GRANT_WITH_GRANT_OPTION'
                                               then
                                                          substring (state_desc,0,6)+'  '+permission_name+' ON REMOTE SERVICE BINDING::['+sa.name+
                                                          '] to ['+user_name(dp.grantee_principal_id)+'] with grant option ;'
                                                 else
                                                          state_desc+' '+permission_name+' ON REMOTE SERVICE BINDING::['+sa.name+
                                                           '] to ['+user_name(dp.grantee_principal_id)+'] ;'
                                                          COLLATE LATIN1_General_CI_AS  
                                      end
 from sys.database_permissions dp inner join sys.remote_service_bindings sa on
 sa.remote_service_binding_id = dp.major_id 
 where dp.class=18

 insert into ##temp1
                      select
                                  case 
                                            when state_desc='GRANT_WITH_GRANT_OPTION'
                                              then
                                                        substring (state_desc,0,6)+'  '+permission_name+' ON route::['+sa.name+
                                                        '] to ['+user_name(dp.grantee_principal_id)+'] with grant option ;'
                                                else
                                                          state_desc+' '+permission_name+' ON route::['+sa.name+
                                                          '] to ['+user_name(dp.grantee_principal_id)+'] ;'
                                                         COLLATE LATIN1_General_CI_AS  
                                      end
 from sys.database_permissions dp inner join sys.routes sa on
 sa.route_id = dp.major_id 
 where dp.class=19

 insert into ##temp1 
                      select 
                                 case 
                                           when state_desc='GRANT_WITH_GRANT_OPTION' 
                                            then
                                                     substring (state_desc,0,6)+'  '+permission_name+' ON FULLTEXT CATALOG::['+sa.name+
                                                      '] to ['+user_name(dp.grantee_principal_id)+'] with grant option ;'
                                             else
                                                       state_desc+' '+permission_name+' ON FULLTEXT CATALOG::['+sa.name+
                                                       '] to ['+user_name(dp.grantee_principal_id)+'] ;'
                                                        COLLATE LATIN1_General_CI_AS  
                                       end
 from sys.database_permissions dp inner join sys.fulltext_catalogs sa on
 sa.fulltext_catalog_id = dp.major_id 
 where dp.class=23

  insert into ##temp1 
                      select 
                                 case 
                                           when state_desc='GRANT_WITH_GRANT_OPTION'
                                            then
                                                        substring (state_desc,0,6)+'  '+permission_name+' ON SYMMETRIC KEY::['+sa.name+
                                                        '] to ['+user_name(dp.grantee_principal_id)+'] with grant option ;'
                                             else
                                                        state_desc+' '+permission_name+' ON SYMMETRIC KEY::['+sa.name+
                                                        '] to ['+user_name(dp.grantee_principal_id)+'] ;'
                                                        COLLATE LATIN1_General_CI_AS  
                                             end
 from sys.database_permissions dp inner join sys.symmetric_keys sa on
 sa.symmetric_key_id = dp.major_id 
 where dp.class=24

 insert into ##temp1 
                      select 
                                  case 
                                           when state_desc='GRANT_WITH_GRANT_OPTION' 
                                             then
                                                       substring (state_desc,0,6)+'  '+permission_name+' ON certificate::['+sa.name+
                                                        '] to ['+user_name(dp.grantee_principal_id)+'] with grant option ;'
                                               else
                                                          state_desc+' '+permission_name+' ON certificate::['+sa.name+
                                                          '] to ['+user_name(dp.grantee_principal_id)+'] ;'
                                                           COLLATE LATIN1_General_CI_AS  
                                   end
 from sys.database_permissions dp inner join sys.certificates sa on
 sa.certificate_id = dp.major_id 
 where dp.class=25


 insert into ##temp1 
                     select 
                                 case 
                                          when state_desc='GRANT_WITH_GRANT_OPTION' 
                                          then
                                                     substring (state_desc,0,6)+'  '+permission_name+' ON ASYMMETRIC KEY::['+sa.name+
                                                     '] to ['+user_name(dp.grantee_principal_id)+'] with grant option ;'
                                             else
                                                      state_desc+' '+permission_name+' ON ASYMMETRIC KEY::['+sa.name+
                                                       '] to ['+user_name(dp.grantee_principal_id)+'] ;'
                                                       COLLATE LATIN1_General_CI_AS  
                        end
 from sys.database_permissions dp inner join sys.asymmetric_keys sa on
 sa.asymmetric_key_id = dp.major_id 
 where dp.class=26

insert into ##temp1 
                     select  'exec sp_addrolemember ''' +p.NAME+''','+'['+m.NAME+']'+' ;'
FROM sys.database_role_members rm
JOIN sys.database_principals p
ON rm.role_principal_id = p.principal_id
JOIN sys.database_principals m
ON rm.member_principal_id = m.principal_id
where m.name not like 'dbo';






select *  from ##temp1  

Here is a batch script for converting symlinks in repository, for files only, based on Josh Lee's answer. Script with some additional check for administrator rights is at https://gist.github.com/Quazistax/8daf09080bf54b4c7641.

@echo off
pushd "%~dp0"
setlocal EnableDelayedExpansion

for /f "tokens=3,*" %%e in ('git ls-files -s ^| findstr /R /C:"^120000"') do (
     call :processFirstLine %%f
)
REM pause
goto :eof

:processFirstLine
@echo.
@echo FILE:    %1

dir "%~f1" | find "<SYMLINK>" >NUL && (
  @echo FILE already is a symlink
  goto :eof
)

for /f "usebackq tokens=*" %%l in ("%~f1") do (
  @echo LINK TO: %%l

  del "%~f1"
  if not !ERRORLEVEL! == 0 (
    @echo FAILED: del
    goto :eof
  )

  setlocal
  call :expandRelative linkto "%1" "%%l"
  mklink "%~f1" "!linkto!"
  endlocal
  if not !ERRORLEVEL! == 0 (
    @echo FAILED: mklink
    @echo reverting deletion...
    git checkout -- "%~f1"
    goto :eof
  )

  git update-index --assume-unchanged "%1"
  if not !ERRORLEVEL! == 0 (
    @echo FAILED: git update-index --assume-unchanged
    goto :eof
  )
  @echo SUCCESS
  goto :eof
)
goto :eof

:: param1 = result variable
:: param2 = reference path from which relative will be resolved
:: param3 = relative path
:expandRelative
  pushd .
  cd "%~dp2"
  set %1=%~f3
  popd
goto :eof

For me this code it work So put this code in XML file rounded_edit_text

<layer-list xmlns:android="http://schemas.android.com/apk/res/android" > <item> <shape android:shape="rectangle"> <stroke android:width="1dp" android:color="#3498db" /> <solid android:color="#00FFFFFF" /> <padding android:left="5dp" android:top="5dp" android:right="5dp" android:bottom="5dp" > </padding> </shape> </item> </layer-list>

I also got the similar error.

Problem :

Solution :

Main root cause for this issue ismultiDex is not enabled. So in the Project/android/app/build.gradle, enable the multiDex

For further information refer the documentation: https://developer.android.com/studio/build/multidex#mdex-gradle

In the Properties,

Go to Configuration Properties. In that go to C/C++ (or something like that). ,Then click General ,In that remove the check in the "Treat Warning As Errors" Check Box

UPDATE: This answer was originally written in 2008 when nth-of-type support was unreliable at best. Today I'd say you could safely use something like .bar:nth-of-type(2), unless you have to support IE8 and older.

Original answer from 2008 follows (Note that I would not recommend this anymore!):

If you can use Prototype JS you can use this code to set some style values, or add another classname:

// set style:
$$('div.theclassname')[1].setStyle({ backgroundColor: '#900', fontSize: '1.2em' });
// OR add class name:
$$('div.theclassname')[1].addClassName('secondclass'); // pun intentded...

(I didn't test this code, and it doesn't check if there actually is a second div present, but something like this should work.)

But if you're generating the html serverside you might just as well add an extra class on the second item...

Here's another option...

events = {}
for line in csv.reader(open(os.path.join(path, 'events.txt'), "rb")):
    if line[0][0] == "#":
        continue
    events[line[0]] = line[1] if len(line) == 2 else line[1:]

Taken from this page:

"NaN" stands for "not a number". "Nan" is produced if a floating point operation has some input parameters that cause the operation to produce some undefined result. For example, 0.0 divided by 0.0 is arithmetically undefined. Taking the square root of a negative number is also undefined.

I use

            chartRange = xlWorkSheet.Rows[1];
            chartRange.Font.Bold = true;

to turn the first-row-cells-font into bold. And it works, and I am using also Excel 2007.

You can call in VBA directly

            ActiveCell.Font.Bold = True

With this code I create a timestamp in the active cell, with bold font and yellow background

           Private Sub Worksheet_SelectionChange(ByVal Target As Range)
               ActiveCell.Value = Now()
               ActiveCell.Font.Bold = True
               ActiveCell.Interior.ColorIndex = 6
           End Sub

Here's a suggestion: use two indices into the string, say start and end. start points to the first character of the next string to extract, end points to the character after the last one belonging to the next string to extract. start starts at zero, end gets the position of the first char after start. Then you take the string between [start..end) and add that to your array. You keep going until you hit the end of the string.

The correct answer for Java is use a Set. If you already have a List<Customer> and want to de duplicate it

Set<Customer> s = new HashSet<Customer>(listCustomer);

Otherise just use a Set implemenation HashSet, TreeSet directly and skip the List construction phase.

You will need to override hashCode() and equals() on your domain classes that are put in the Set as well to make sure that the behavior you want actually what you get. equals() can be as simple as comparing unique ids of the objects to as complex as comparing every field. hashCode() can be as simple as returning the hashCode() of the unique id' String representation or the hashCode().

This also works like a charm

<form>_x000D_
    <label class="radio-inline">_x000D_
      <input type="radio" name="optradio" checked>Option 1_x000D_
    </label>_x000D_
    <label class="radio-inline">_x000D_
      <input type="radio" name="optradio">Option 2_x000D_
    </label>_x000D_
    <label class="radio-inline">_x000D_
      <input type="radio" name="optradio">Option 3_x000D_
    </label>_x000D_
  </form>

You can also use jQuery('.class-name').attr("href"), in my case it works better.

Here more information: "jQuery(...)" instead of "$(...)"

You can try it by adding  

Or... You can use Blob to achive this.

Like:

pdf.addHTML($('#content'), y, x, options, function () {
    var blob = pdf.output("blob");
    window.open(URL.createObjectURL(blob));
});

That code let you create a Blob object inside the browser and show it in the new tab.

The filter function wasn't working for me at all; maybe the more recent version of jquery doesn't perform as the version used in above code. Regardless; I used:

    var black = $('.black');
    var white = $('.white');

The selector will find every element classed under black or white. Button functions stay as stated above:

    $('#showBlackButton').click(function() {
           black.show();
           white.hide();
    });

    $('#showWhiteButton').click(function() {
           white.show();
           black.hide();
    });

char buffer [50];

unsigned long a = 5;

int n=sprintf (buffer, "%lu", a);

EF is looking for a table named dbo.BaseCs. Might be an entity name pluralizing issue. Check out this link.

EDIT: Updated link.

To expand on my comment.

You can validate on the command line using php -l [filename], which does a syntax check only (lint). This will depend on your php.ini error settings, so you can edit you php.ini or set the error_reporting in the script.

Here's an example of the output when run on a file containing:

<?php
echo no quotes or semicolon

Results in:

PHP Parse error:  syntax error, unexpected T_STRING, expecting ',' or ';' in badfile.php on line 2

Parse error: syntax error, unexpected T_STRING, expecting ',' or ';' in badfile.php on line 2

Errors parsing badfile.php

I suggested you build your own validator.

A simple page that allows you to upload a php file. It takes the uploaded file runs it through php -l and echos the output.

Note: this is not a security risk it does not execute the file, just checks for syntax errors.

Here's a really basic example of creating your own:

<?php
if (isset($_FILES['file'])) {
    echo '<pre>';
    passthru('php -l '.$_FILES['file']['tmp_name']);
    echo '</pre>';
}
?>
<form action="" method="post" enctype="multipart/form-data">
    <input type="file" name="file"/>
    <input type="submit"/>
</form>

Yes, there is a problem with pointers. Very likely you're using one that's not initialized properly, but it's also possible that you're messing up your memory management with double frees or some such.

To avoid uninitialized pointers as local variables, try declaring them as late as possible, preferably (and this isn't always possible) when they can be initialized with a meaningful value. Convince yourself that they will have a value before they're being used, by examining the code. If you have difficulty with that, initialize them to a null pointer constant (usually written as NULL or 0) and check them.

To avoid uninitialized pointers as member values, make sure they're initialized properly in the constructor, and handled properly in copy constructors and assignment operators. Don't rely on an init function for memory management, although you can for other initialization.

If your class doesn't need copy constructors or assignment operators, you can declare them as private member functions and never define them. That will cause a compiler error if they're explicitly or implicitly used.

Use smart pointers when applicable. The big advantage here is that, if you stick to them and use them consistently, you can completely avoid writing delete and nothing will be double-deleted.

Use C++ strings and container classes whenever possible, instead of C-style strings and arrays. Consider using .at(i) rather than [i], because that will force bounds checking. See if your compiler or library can be set to check bounds on [i], at least in debug mode. Segmentation faults can be caused by buffer overruns that write garbage over perfectly good pointers.

Doing those things will considerably reduce the likelihood of segmentation faults and other memory problems. They will doubtless fail to fix everything, and that's why you should use valgrind now and then when you don't have problems, and valgrind and gdb when you do.

Unlike the strong typed nature in Java. Python's duck typing behavior makes it so easy to pass objects around.

Java developers are focusing on the constructing the class strcuture and relation between objects, while keeping things flexible. IoC is extremely important for achieving this.

Python developers are focusing on getting the work done. They just wire up classes when they need it. They don't even have to worry about the type of the class. As long as it can quack, it's a duck! This nature leaves no room for IoC.

I created multiple threads in Python, I printed the thread objects, and I printed the id using the ident variable. I see all the ids are same:

<Thread(Thread-1, stopped 140500807628544)>
<Thread(Thread-2, started 140500807628544)>
<Thread(Thread-3, started 140500807628544)>

The move instruction copies a value from one register to another. The li instruction loads a specific numeric value into that register.

For the specific case of zero, you can use either the constant zero or the zero register to get that:

move $s0, $zero
li   $s0, 0

There's no register that generates a value other than zero, though, so you'd have to use li if you wanted some other number, like:

li $s0, 12345678

If all else fails, look for duplication. I was misdirected by the explicit initial reference to constructors and destructors until I read a reference in another post. It's any unresolved method. In my case, I thought I had replaced the declaration that used char *xml as the parameter with one using the unnecessarily troublesome const char *xml, but instead, I had created a new one and left the other one in place.

Alternatively, you can use the File.GetCreationTime Method if you need to delete files based on creation dates.

Building on @Waterscroll's response, if you want to use async and await in node 8+:

const fs = require('fs');
const util = require('util');
const readdir = util.promisify(fs.readdir);
const unlink = util.promisify(fs.unlink);
const directory = 'test';

async function toRun() {
  try {
    const files = await readdir(directory);
    const unlinkPromises = files.map(filename => unlink(`${directory}/${filename}`));
    return Promise.all(unlinkPromises);
  } catch(err) {
    console.log(err);
  }
}

toRun();

In Bash you can do it by enabling the extglob option, like this (replace ls with cp and add the target directory, of course)

~/foobar> shopt extglob
extglob        off
~/foobar> ls
abar  afoo  bbar  bfoo
~/foobar> ls !(b*)
-bash: !: event not found
~/foobar> shopt -s extglob  # Enables extglob
~/foobar> ls !(b*)
abar  afoo
~/foobar> ls !(a*)
bbar  bfoo
~/foobar> ls !(*foo)
abar  bbar

You can later disable extglob with

shopt -u extglob

You don't have to have a method for that. You could create a property like this instead:

class SalesPerson
{
    string firstName, lastName;
    public string FirstName { get { return firstName; } set { firstName = value; } }
    public string LastName { get { return lastName; } set { lastName = value; } }
    public string FullName { get { return this.FirstName + " " + this.LastName; } }
}

The class could even be shortened to:

class SalesPerson
{
    public string FirstName { get; set; }
    public string LastName { get; set; }
    public string FullName { 
       get { return this.FirstName + " " + this.LastName; } 
    }
}

The property could then be accessed like any other property:

class Program
{
    static void Main(string[] args)
    {
        SalesPerson x = new SalesPerson("John", "Doe");
        Console.WriteLine(x.FullName); // Will print John Doe
    }
}

This is a PowerShell solution for Python 3:

pip3 list --outdated --format=legacy | ForEach { pip3 install -U $_.split(" ")[0] }

And for Python 2:

pip2 list --outdated --format=legacy | ForEach { pip2 install -U $_.split(" ")[0] }

This upgrades the packages one by one. So a

pip3 check
pip2 check

afterwards should make sure no dependencies are broken.

There is no "previous" sibling selector unfortunately, but you can possibly still get the same effect by using positioning (e.g. float right). It depends on what you are trying to do.

In my case, I wanted a primarily CSS 5-star rating system. I would need to color (or swap the icon of) the previous stars. By floating each element right, I am essentially getting the same effect (the html for the stars thus must be written 'backwards').

I'm using FontAwesome in this example and swapping between the unicodes of fa-star-o and fa-star http://fortawesome.github.io/Font-Awesome/

CSS:

.fa {
    display: inline-block;
    font-family: FontAwesome;
    font-style: normal;
    font-weight: normal;
    line-height: 1;
    -webkit-font-smoothing: antialiased;
    -moz-osx-font-smoothing: grayscale;
}

/* set all stars to 'empty star' */
.stars-container {
    display: inline-block;      
}   

/* set all stars to 'empty star' */
.stars-container .star {
    float: right;
    display: inline-block;
    padding: 2px;
    color: orange;
    cursor: pointer;

}

.stars-container .star:before {
    content: "\f006"; /* fontAwesome empty star code */
}

/* set hovered star to 'filled star' */
.star:hover:before{
    content: "\f005"; /* fontAwesome filled star code */
}

/* set all stars after hovered to'filled star' 
** it will appear that it selects all after due to positioning */
.star:hover ~ .star:before {
    content: "\f005"; /* fontAwesome filled star code */
}

HTML: (40)

JSFiddle: http://jsfiddle.net/andrewleyva/88j0105g/

I have just published a Nuget package that allows setting up not only the first level Properties but also nested properties in the given object in any depth.

Here is the package

Sets the value of a property of an object by its path from the root.

The object can be a complex object and the property can be multi level deep nested property or it can be a property directly under the root. ObjectWriter will find the property using the property path parameter and update its value. Property path is the appended names of the properties visited from root to the end node property which we want to set, delimited by the delimiter string parameter.

Usage:

For setting up the properties directly under the object root:

Ie. LineItem class has an int property called ItemId

LineItem lineItem = new LineItem();

ObjectWriter.Set(lineItem, "ItemId", 13, delimiter: null);

For setting up nested property multiple levels below the object root:

Ie. Invite class has a property called State, which has a property called Invite (of Invite type), which has a property called Recipient, which has a property called Id.

To make things even more complex, the State property is not a reference type, it is a struct.

Here is how you can set the Id property (to string value of “outlook”) at the bottom of the object tree in a single line.

Invite invite = new Invite();

ObjectWriter.Set(invite, "State_Invite_Recipient_Id", "outlook", delimiter: "_");

location / { 
    if ($http_host !~ "^www.domain.com"){ 
        rewrite ^(.*)$ $scheme://www.domain.com/$1 redirect; 
    } 
}

The stopPropagation options are bad because they can interfere with other event handlers including other menus that might have attached close handlers to the HTML element.

Here is a simple solution based on user2989143's answer:

$('html').click(function(event) {
    if ($(event.target).closest('#menu-container, #menu-activator').length === 0) {
        $('#menu-container').hide();
    }
});

UserName with:

User.Identity.Name

But if you need to get just the ID, you can use:

using Microsoft.AspNet.Identity;

So, you can get directly the User ID:

User.Identity.GetUserId();